the peruvian el tor strains of vibrio cholerae o1 have a distinct ... · 1 the peruvian el tor...

1

The Peruvian El Tor strains of Vibrio cholerae O1 have a distinct region in the Vibrio

seventh pandemic island-II that differentiates them from the seventh pandemic strains

of other continents

Suraia Nusrin,1

Ana I. Gil, 2

* N. A. Bhuiyan, 1

Ashrafus Safa, 1

Masahiro Asakura, 3

C. F. Lanata,2 E.R. Hall,

4 H. Miranda,

5 B. Huapaya,

6 C. Vargas G,

7 M.A. Luna ,

8 D.A.

Sack, 1

Shinji Yamasaki3 and G. Balakrish Nair

1

1Enteric Microbiology Unit, Laboratory Sciences Division, ICDDR,B, Bangladesh;

2Instituto

de Investigación Nutricional, Lima, Peru; 3Graduate School of Life and Environmental

Sciences, Osaka Prefecture University, Sakai, Osaka , Japan; 4Naval Medical Research

Center Detachment, Lima, Peru; 5Instituto de Medicina Tropical e Infectologia, Facultad de

Medicina, Universidad Nacional de Trujillo, Trujillo, Peru; 6Instituto Nacional de Salud,

Lima Peru; 7CEPIS/SDE/OPS/OMS, Lima Peru;

8Oficina General de Epidemiología, Lima

Peru.

Word count:

Abstract: 253

Full Text without Abstract, References and Acknowledgement: 4277

*Correspondence to:

Ana I Gil, Investigadora Principal, Instituto de Investigacion Nutricional, Av. La Molina

1885, Lima 12, Peru, A.P. 18-0191, Lima – 18, Peru; Tel (+51-1) 349-6023; Fax (+51-1)

3496025; Email [email protected]

2

Abstract

A collection of environmental and clinical strains of Vibrio cholerae O1 isolated from

the beginning of the epidemic in 1991 to 2003 from multiple locations in Peru were examined

using a multi locus virulence gene profiling strategy. The overall results of this screening

indicated that the Peruvian strains were similar to the reference El Tor strain (N16961) of the

seventh pandemic with the only striking difference being the negative result by PCR for

VC0512 and VC0514 in the VSP-II gene cluster of all the Peruvian strains. This difference in

VSP-II was stably conserved in the Peruvian strains and this pattern was not observed in the

seventh pandemic El Tor V. cholerae O1 strains examined from Asia, Africa, Australia and

Europe. The comparison of the nucleotide sequences and other parameters of VSP-II and

flanking regions of one Peruvian strain (PERU-130) with that of VSP-II of N16961

confirmed the PCR results indicating that ORFs 20 to 24 of the Peruvian strain showed low

DNA homology (46.6%) to the corresponding region encompassing VC0511 to VC0515 of

NI6961. Based on the stable difference in VSP-II, we conclude that the Peruvian El Tor O1

strains are quite distinct from the seventh pandemic Eurasian and African strains, suggesting

that, although temporally associated with the seventh pandemic, it arose independently

probably from a nonhuman environmental source. The difference in the VSP-II lends a

distinctive stable molecular signature to the Peruvian strains that could form the basis of

tracking the origin of these strains and, therefore, of the Latin American pandemic.

3

Introduction

In 1991, after the absence of more than a century, Vibrio cholerae O1 biotype El Tor

entered into South America and caused explosive epidemics along the coast of Peru. Cholera

occurred simultaneously at different sites along the Peruvian coast, over a distance of more

than 1200 kms (32). By the end of 1992, 19 countries in Latin America had reported more

that 730,000 cholera cases and 6,300 deaths (15, 29). The epidemic, thereafter, spread to the

rest of south and Central America from Mexico to Argentina (34).

Since the entry of the El Tor biotype into Latin America, an intensive effort has been

made to understand the origin of these strains. Molecular typing methods indicate that

isolates from the 1991 Latin American epidemic are clonal and represent an extension of the

seventh pandemic strain of El Tor biotype in the Western hemisphere (36). More recent

studies have documented relatively high rate of genetic changes as shown by changing

serotypes, electrophoretic types (ET), ribotypes and PFGE types among the Latin American

strains (8, 29, 11). The current understanding is that there are a mélange of different

molecular types among the Latin American strains of V. cholerae O1 closely related to the

Asian and African seventh pandemic strains.

The past few years have witnessed many advances in our understanding of the

genome and genetics of V. cholerae. We now know that the cholera toxin (CT) genes are

encoded by a filamentous bacteriophage CTXΦ (37) and the toxin-coregulated pilus (TCP),

an important colonization factor, acts as the receptor for CTXΦ (18, 16). V. cholerae, like

other members of the genus Vibrio, has two circular chromosomes (35) and the whole

genome sequence of an El Tor V. cholerae O1 strain N16961 has shown them to be 2.96 Mb

and 1.07 Mb, respectively, in size (13). Comparative genomic analysis using a DNA

microarray showed differences in gene content between the sixth (classical biotype) and the

current seventh (El Tor biotype) pandemic strains of V. cholerae O1 and identified two

4

genomic regions designated as the Vibrio Seventh Pandemic island-I (VSP-I) and VSP-II that

are unique to seventh pandemic El Tor strains (10). VSP-I and VSP-II showed several

properties of pathogenicity islands, and are believed to be involved with the pandemic

propensity of the seventh pandemic El Tor strains. Although they share common lineage (27),

the classical strains that caused the first six pandemics are different from the El Tor strains

responsible for the on-going seventh pandemic, in that they lack the VSP-I and VSP-II (10).

In light of the new information on the molecular aspects of V. cholerae, we decided to

re-examine the strains of V. cholerae O1 isolated from the beginning of the Peruvian

epidemic in 1991 to 2003 from different locations in Peru using a PCR based multilocus

virulence gene profiling strategy. We report the identification of a distinctive stable

molecular signature in the Peruvian strains in the VSP-II not seen in other seventh pandemic

strains of V. cholerae O1 El Tor that could form the basis of tracking the origin of these

strains and, therefore, of the Latin American pandemic.

Materials and Methods

Bacterial strains.

Sixty strains of V. cholerae O1 (48 clinical and 12 environmental) isolated from Lima,

Trujillo, Lambayeque, Cajamarca, Arequipa, Ayacucho, Loreto and Ucayali in Peru from

1991 to 2003 were examined in this study. Twenty three V. cholerae O1 El Tor strains from

10 countries as shown in Table 1 were used in this study for comparison. The countries

included Australia, Bangladesh, India, Maldives, Malaysia, Myanmar, Mozambique, Macao,

Germany, and Zambia representing four continents (Asia, Africa, Australia and Europe).

V.cholerae O1 strain O395 of the classical biotype and the O1 El Tor strain N16961 were

used as standard reference strains representing each biotype. The 60 strains of V. cholerae O1

5

from Peru, the 23 strains from other countries and the two reference strains (Table 1) were

sub-cultured on gelatin agar plates, and stored at –80°C in Luria Bertini broth containing 25%

glycerol for further study.

Serotyping and Biotyping.

The serogroup of all the strains was reconfirmed by using polyvalent O1 and monoclonal

Inaba and Ogawa antisera prepared at ICDDR,B. Biotyping of the Peruvian strains was

performed using polymyxin B susceptibility (50 U), chicken cell (erythrocyte) agglutination

(CCA) and sensitivity to group IV classical and group 5 El Tor phages as described

previously (22).

Genomic DNA Isolation.

For extraction of genomic DNA, cells were harvested from 3 ml of overnight culture in LB

broth (Miller). The harvested cells were subjected to alkaline lysis by 10% SDS in the

presence of TE buffer (10mM Tris-HCl; 1mM EDTA, pH 8.0). The cells were then treated

with freshly prepared Proteinase K (final concentration 100 µg/ml in 0.5% SDS) incubated at

37°C for 1 h. After incubation, 1.0% CTAB/NaCl (Cetyl trimethyl ammonium bromide in

0.7M NaCl) was added followed by incubation for 10 min at 65°C. RNA was removed by

treating with RNase (final concentration 100µg/ml) at 37°C for 1h. This was followed by

phenol chloroform extraction and precipitation of the nucleic acid in the presence of

isopropanol (5). Excess salt was removed by 70% alcohol wash and the nucleic acid was air-

dried, resuspended in sterile TE buffer. The purity of the DNA was assayed using a

spectrophotometer (Gene Quant, England) that self calculates the ratio of optical densities at

260 and 280 nm and the DNA was stored at -20°C for subsequent PCR analysis.

PCR analysis.

6

Confirmation of strain identity: The identity of the strains examined in this study was

confirmed by the V. cholerae species-specific ompW PCR (25) and by a multiplex PCR used

to detect O-antigen biosynthesis genes (wbe or wbf) and for the cholera toxin gene ctxA (14).

The PCR reagents and kits were obtained from Invitrogen™. The biotype of all the strains

was further confirmed by genetic traits using PCR assays targeting the tcpA (classical or El

Tor variant) (17) and by the type of rstR gene that regulates the replication and integration of

the CTXΦ in the V. cholerae genome (9). These PCRs were performed using the primers and

procedures described previously (26).

Multilocus virulence gene profiling: We first used a multilocus virulence gene profiling that

scanned for 9 virulence associated genes and/or gene clusters and a house-keeping gene in the

genome of 20 representative Peruvian V. cholerae isolates and a reference strain each of the

classical (O395) and El Tor (N16961) using 31 sets of PCR primers and conditions described

previously (4, 27, 30, 24, 31). PCR was performed in 20 µl reaction mixture as follows: an

initial denaturation step at 96 °C for 1 min followed by 30 cycles of denaturation at 94°C for

30s, primer annealing at 45 to 58°C for 30s, 1 to 4 min of primer extension at 72°C and 7 min

of final extension at 72°C for one cycle. Amplicons were separated by agarose gel

electrophoresis (1%) in 0.5X Tris-Borate-EDTA buffers. The PCR products were analyzed

by electrophoresis in 1% agarose gels, stained with ethidium bromide, visualized under UV

light and recorded by a gel documentation system (Gel Doc™ 2000, BioRad). The PCR

products were sized with standard molecular weight markers and documented.

Analysis of VSP-II region. PCR was used to assay the VSP-II region in the genome of the

83 V. cholerae O1 isolates using previously designed 7 sets of PCR primers following

conditions described previously (27). Further, the GeneFisher software (available at

http://www.genefisher.de/) was utilized to design 5 sets of primers in this study (Table 2) to

amplify ORFs VC0511, VC0512, VC0513, VC0514 and VC0515. The primers of VC0511

7

and VC0512 were designed from the sequence that flanked the region of each of the ORFs.

The other 3 sets of primers for the ORFs VC0513, VC0514 and VC0515 were designed from

within each of the ORFs. PCR was performed in 20 µl reaction mixture as follows: an initial

denaturation step at 95°C for 3 min followed by 30 cycles of denaturation at 95°C for 1 min,

primer annealing at 50ºC to 54°C for 1 min and primer extension at 72°C for 1 min (Table 2).

Nucleotide sequence analysis of VSP-II region.

Several regions of the VSP-II region in PERU-130 strain were amplified by PCR using Ex

Taq (Takara Bio Inc. Shiga, Japan) and several primers newly designed in this study and

described previously (27) but with different combinations as shown in Table 2. PCR products

were purified by QIAquick PCR Purification Kit according to the manufacturer’s instruction

(QIAGEN GmbH, Hilden, Germany) and sequenced by using ABI Prism BigDye Terminator

Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster, CA, USA) and primers

designed on the basis of the sequence of the VSP-II region in V. cholerae O1 El Tor strain

N16961. The PCR product obtained by using LA-Taq (Takara Bio Inc. Shiga, Japan) and the

primer set VSPII LaU and VSPII LaR was digested by Sau3AI. The digests were ligated into

the BamHI site of pBluescript SKII (-) and the ligation mixture was transformed into E. coli

JM109. The recombinant E. coli strains were cultured in L-broth including ampicillin (100

µg/ml) and aliquot was boiled in TE buffer. The boiled template was amplified by M13

forward and reverse primers. The PCR products were purified by QIAquick PCR Purification

Kits (QIAGEN GmbH) and sequenced by using ABI Prism BigDye Terminator Cycle

Sequencing Ready Reaction Kit (Applied Biosystems, Foster, CA, USA) and M13 forward

and reverse primers or sequencing primer designed by the obtained sequence, if necessary.

The reactions were conducted in a GeneAmp 9700 thermal cycler in accordance with the

manufacturer’s instruction (Applied Biosystems). Nucleotide sequence was determined using

an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems, Forster City, CA, USA).

8

Sequence assembly and analysis.

The sequences obtained in this study were analyzed using DNA Lasergene software package

(DNASTAR Inc., Madison, WI, USA). Homology searches were performed using BLAST

program, made available by DNA Data Bank Japan (DDBJ). The sequence of VSP-II in

PERU-130 strain analyzed in this study has been registered in DDBJ (accession number

AB300724).

Nucleotide sequence of ctxB subunit.

To determine the nucleotide sequence of the ctxB subunit of CT, PCR amplification of ctxB

gene of 3 Peruvian strains of V. cholerae O1 El Tor (PERU-044, PERU-130 and PERU-296

isolated in 1995, 1991 and 2003, respectively) was performed in a 25µL reaction mixture in

an automated Peltier thermal cycler (PTC-200, M. J. Research). PCR primers and conditions

were as previously described (21). PCR products were purified with a Microcon centrifugal

filter device (Millipore Corporation, Bedford, Mass.) and sequenced using an ABI PRISM

BigDye Terminator Cycle Sequencing Reaction kit (Perkin-Elmer Applied Biosystems,

Foster City, CA, USA) on ABI PRISM 310 automated sequencer. The chromatogram

sequencing files were inspected using Chromas 2.23 (Technelysium, Queensland, Australia).

Nucleotide sequences of the reference strains were compared with the corresponding

sequences of the N16961 El Tor (GenBank Accession No. NC-002505) and 569B classical

(GenBank Accession No. U25679) strain retrieved from Genebank using Basic Local

Alignment Search Tool. Multiple sequence alignments were developed using CLUSTALX

1.81.13.

Pulsed Field Gel Electrophoresis.

Intact agarose-embedded chromosomal DNA from the isolates of V. cholerae was prepared

and PFGE was performed using a contour-clamped homogeneous electric field (CHEF-

9

Mapper) apparatus (Bio-Rad) following the standardized PulseNet Pulsed-Field Gel

Electrophoresis protocol recently developed for subtyping of V. cholerae (6). Genomic DNA

was digested with NotI enzyme (10 U/µl stock, Invitrogen). The restriction fragments were

separated in 1% SeaKam Gold agarose in 0.5X Tris-borate-EDTA buffer. V. cholerae O1 El

Tor biotype (N16961) and the strain 569B of the classical biotype were used as reference

strains. Salmonella enterica serotype Braenderup strain H9812 digested with 40 Units of

XbaI (Invitrogen) was used as the molecular size marker in lanes 1, 8 and 15. Following

electrophoresis, the gels were stained in ethidium bromide solution (50 µg/ml) for 20 to 30

minutes and destained with reagent grade water. Images were captured using a Gel Doc 2000

and Gel Doc XR systems (Bio-Rad).

Results

The 60 Peruvian and 23 strains from 10 other countries were reconfirmed to be V.

cholerae O1 by phenotypic traits and by serotyping. All the strains were positive for V.

cholerae species specific ompW and for the O1 wbe and belonged to the El Tor biotype (data

not shown). Among the 60 strains of V. cholerae O1 from Peru, two strains (PERU-067 and

PERU-189) were negative for tcpA of both the El Tor and classical type while others were

positive for tcpA of the El Tor type (Table 1). All Peruvian strains including the El Tor

reference strain N16961 were positive for rstR2 (repressor gene of the CTX prophage of the

El Tor biotype) whereas the classical reference strain O395 was positive for rstR1 (repressor

gene of the CTX prophage of the classical biotype). The serotype and genotype of the 60

Peruvian strains and the 23 strains of V. cholerae O1 from other countries are shown in Table

1. Four strains from other countries were negative for ctxA. The strains from Mozambique

were rstR1 positive as reported previously (1) and the strains GP7 from Myanmar and GP156

from Australia were positive for both rstR1 and rstR2. A recent study has shown that all the

10

El Tor strains of V. cholerae O1 isolated from 2001 in Bangladesh produce classical cholera

toxin (23). We therefore examined the nucleotide sequence of the ctxB gene of 3

representative Peruvian El Tor strains of V. cholerae O1 and found that the strains possess

DNA sequences identical to the El Tor type of ctxB which was identical to the ctxB sequence

of El Tor reference strain N16961 and differed from that of the classical reference strain

O395.

Of the 60 Peruvian strains, 20 (listed in Table 3) were selected representing different

year and location of isolation in Peru for the preliminary multilocus virulence gene profiling

that involved examining for 9 virulence associated genes and/or gene clusters and for a

house-keeping gene. For purposes of comparison, we also included a reference strain each of

the classical (O395) and El Tor (N16961) biotypes. The presence or absence of the various

genes was scored by PCR with specific primers using DNA extracted from cultured strains.

All 20 strains from Peru showed the presence of all genes comprising VSP-I, MSHA and

RTX gene clusters (Table 3). The four individual loci namely, hlyA, pilE, tlc and intl4 and the

rstC of RS1 were also present in all the Peruvian strains examined. Among the 9 ORFs of

VSP-II examined in the preliminary genetic screen, two ORFs namely VC0512 and VC0514

were consistently negative by PCR in all the 20 Peruvian strains tested, present in the El Tor

reference strain N16961 but absent in the classical reference strain O395 (classical biotype

strains lack the VSP-I and VSP-II). Apart from this, two Peruvian strains (PERU-067 and

PERU-189) lacked the genes of the VPI-I region examined and one strain PERU-097 was

negative for the ctxAB genes and concluded to be non toxigenic. The overall results of the

preliminary genetic screen indicated that all the Peruvian strains were similar to the reference

El Tor strain of the seventh pandemic with the only striking difference being the negative

result for VC0512 and VC0514 in the VSP-II gene cluster in all of the Peruvian strains.

11

Our next objective was to examine the negative PCR results for ORFs 512 and 514 in

VSP-II in further detail in the 60 Peruvian strains and in the 23 strains of V. cholerae O1

isolated from 10 different countries (Table 4). We examined all the 60 Peruvian strains for 12

ORFs of VSP-II and found that 51 out of the 60 Peruvian strains were negative for VC0511

and of these 20 were positive for VC0516 and 31 were negative for VC0516. The remaining

9 strains were positive for VC0511 but negative for VC0516. The other ORFs of VSP-II

region, that is, VC0490, VC0493, VC0498, VC0502, VC0504 and VC0517 were present in

all the Peruvian strains and only strains PERU-044 was negative for VC0490 and PERU-001

was negative for VC0493. VC0512, VC0513, VC0514 and VC0515 were negative by PCR in

all the 60 Peruvian strains but present in all other strains examined from different countries

except in three strains from Australia. The complete VSP-II region was absent in the

Australian strains, which was similar to the classical reference strain of V. cholerae (O395)

used in this study.

To understand the differences between the VSP-II of the Peruvian and the prototype

seventh pandemic V. cholerae O1 El Tor strain, PCR was performed to amplify the region

corresponding to the VSP-II of the Peruvian strain and to sequence. When primer sets, 498F

and 490R, 490F and 493R, 493F and 498R, 502F and 504R, 47U and 517R, were used,

expected sizes of the PCR products were obtained as shown in Fig. 1. When primer sets,

504F and 512R, 512F and 516R and 514F and 517R, were used, however, no amplicon were

obtained. Therefore, we newly designed PCR primer set, VSPII LaU and VSPII LaR on the

basis of the sequence obtained from PCR products amplified by 502F and 504R, and by 47U

and 517R, to amplify the regions where no amplification was observed by previously

reported PCR primer sets and we sequenced 31,299 bp comprising the entire VSP-II and

flanking regions of PERU-130 which was negative by PCR for VC0511 and for VC0513 to

VC0516. The comparison of the nucleotide sequences and other parameters of VSP-II and

12

flanking regions of PERU-130 with that of VSP-II of N16961 are shown in Figure 1 and

Table 5. The 26.5 kb (26,519 bp) VSP-II of PERU-130 contained 24 ORFs. The N16961 26.9

kb (26,866 bp) also contained 24 ORFs (28). In the VSP-II DNA shared between PERU-130

and N16961, four regions could be identified based on extent of similarity. These were ORFs

2 to 14 of PERU-130 (100% similarity), ORFs 15 to 19 (94.4% similarity), ORFs 20 to 24

(46.8% similarity) and ORF 25 (89% similarity) (Figure 1). The sequencing data confirmed

our PCR results indicating that ORFs 20 to 24 of the Peruvian strain were, indeed, different

from VC0511 to VC0515 of NI6961.

Each of the ORFs of PERU-130 was analyzed using the BLAST program (2). The

hypothetical proteins encoded by ORFs 20 and 21 showed 46.7% and 33.2% homology to

proteins of Azoarcus sp. BH72, a mutualistic N2-fixing endophyte of rice and other grasses

(19). ORF 22 representing another hypothetical protein that showed 46.7% homology to a

protein encoded by a gene designated as Mmcs_4842 of Mycobacterium sp. MCS (Table 5).

The transposase orfAB, subunit A represented by ORF 23 of PERU-130 showed 87.2%

homology to similar protein encoded by VCA0372 of NI6961 while transposase orfAB

subunit B representing ORF24 showed 83.6% and 86.1% homology to similar proteins of

Nitrococcus mobilis Nb-231 and VCA0371 of V. cholerae N16961, respectively (Table 5).

However, ORF23 and 24 DNA (1214 bp) have high homology to V. cholerae serogroup

O103 insertion sequences ISalg (DNA identity = 98.8%) reported earlier (33). ORF25 of

PERU-130 shared close homology to the phage integrase of V. vulnificus YJ016 (98.5%) and

V. cholerae (93.7%) strain N16961. The 5’ flanking region (ORF1) and the 3’ flanking region

(ORF26) of PERU-130 were identical to VC0489 and VC0517 of strain N16961.

PFGE analysis of 10 representative Peruvian strains isolated between 1991 and 1996

showed that the strains were not clonal and there were 8 different PFGE profiles (Figure 2)

indicating the genetic diversity among these strains.

13

Discussion

The VSP-I and VSP-II are unique to the seventh pandemic El Tor biotype strains of V.

cholerae O1 and absent in strains of the classical biotype. The role of VSP-I and VSP-II in

the El Tor biotype is not known (27) but their exclusive presence among the El Tor strains is

responsible for some of the distinctive properties of this biotype (10) and may contribute in

some way to its fitness and survival (27). The VSP-II is a 29.6 kb genomic island

encompassing 24 predicted ORFs (VC0490 to VC0516) whose functions include DNA repair

and methyl-accepting chemotaxis proteins, a group of hypothetical proteins and a

bacteriophage-like integrase adjacent to a tRNA gene (28). By utilizing a multilocus

virulence gene profiling approach, we discovered that the Peruvian El Tor strains of V.

cholerae O1 have an intact VSP-I but by PCR all strains were consistently negative for

adjacent ORFs of the VSP-II namely VC0512 (methyl-accepting chemotaxis protein),

VC0513 (transcriptional regulator), VC0514 (methyl-accepting chemotaxis protein) and

VC0515 (hypothetical protein). At the time of its discovery, the VSP-II was described as a

7.5 kb region encompassing 8 ORFs (VCO490 to VCO497). Later, O’Shea et. al. (28)

demonstrated that the 7.5 kb VSP-II region is part of a 29.6 kb island that encompasses ORFs

VC0490-VC0516. In the initial study of Dizejman et al. (10), a Peruvian strain C6709 was

included but the absence of ORFs although identified went unnoticed since at that time these

ORFs were not included as a part of the VSP-II region.

The Latin American isolates, at the time of its introduction, were clonal and were

described as ET4 by multi locus enzyme electrophoresis (MEE); the seventh pandemic strains

in Asia and Africa belonged to ET3 (36). Later studies showed at least two distinct clones

easily distinguishable by multilocus enzyme electrophoresis (MEE), ribotype, PFGE pattern

and antimicrobial resistance pattern (11). By ribotyping, the Latin American epidemic was

caused by strains of ribotype 5, which were isolated from several other geographical locations

14

but could be differentiated from the Latin American strains by other molecular typing

techniques (29). The evolution of V. cholerae O1 biotype El Tor strains isolated in Lima,

Peru from 1991 to 1995 showed the continuous, and more frequent occurrence than

previously, of genetic changes in the Latin American cholera epidemic strains (8). The

Peruvian strains that we examined in this study were isolated from the beginning of the

epidemic in 1991 through 2003. The PFGE analysis of the Peruvian strains from 1991 to

1996 in this study showed a variety of PFGE profiles indicating genetic diversity among

these strains. Despite the genetic diversity, changing serotypes and different years and

locations of isolation, the VSP-II region of the Peruvian strains isolated for more than a

decade was stably conserved and different from the seventh pandemic strains isolated in other

continents.

The complete nucleotide sequence analysis of VSP-II showed little difference in the

overall size of the VSP-II of PERU-130 and NI6961 and the flanking regions were

conserved. Of the 25 ORFs in the VSP-II of PERU-130, 20 showed extensive homology with

the corresponding ORFs of N16961. Only one region comprising ORFs 20 to 24 of PERU-

130 was different from the corresponding VSP-II region constituting VC0511 to VC0515 of

the prototype El Tor strain N16961. The presence of hypothetical proteins homologous to

those present in the nitrogen-fixing endophyte symbiotic Azoarcus sp. in the VSP-II region

(ORF 20 and 21) indicates that the progenitor of the Peruvian V. cholerae strains may have

acquired these genes from microorganisms in the environment. The extensive DNA

homology of ORFs 23 and 24 of the VSP-II of PERU-130 to V. cholerae serogroup O103

insertion sequence ISalg is interesting since ISalg is distributed in 69% of the V. cholerae

non-O1 non-O139 strains and has extensive homology to the IS element of Vibrio

alginolyticus and IS911 of Shigella dysenteriae (12, 33). We are not sure if these five

15

divergent ORFs of PERU-130 assembled together or were independent acquisitions but the

presence of ISalg suggests genetic rearrangements or horizontal transfer.

The origin and the source of the Latin American strains of V. cholerae O1 in Peru

remains a mystery. The ‘single introduction hypothesis’ states that the Latin American strains

may have originated as a result of emptying of contaminated bilge waters of ships arriving

from cholera endemic areas of Asia or Africa (20). The difference in the VSP-II between the

Peruvian strains and those from Asia and Africa does not support this hypothesis. Another,

less accepted hypothesis, consistent with simultaneous appearance of the disease in a number

of coastal Peruvian cites within a few days, relates to the sudden and massive expansion of a

preexisting small population of pathogenic cholera vibrios on zoo- or phytoplankton in

Peruvian coastal waters (7). Once introduced into the coastal communities in concentrations

large enough for human infection to occur, cholera spread by the well-known means of

contaminated water and food (32). Our studies indicate that the Peruvian strains may be

genetic derivatives of V. cholerae O1 from the coastal environs of Peru because the VSP-II of

1991 environmental Peruvian strains examined in this study were similar to all the clinical

Peruvian strains and different from strains isolated from other countries and continents. Seas

et. al. (32) also postulate that cholera vibrios, autochthonous to the aquatic environment, were

present in multiple coastal locations, and resulted from environmental conditions that existed

during an El Niño phenomenon.

From a functional viewpoint, we do not know the significance of the difference

between VSP-II of the Peruvian strains and those isolated from other continents. However,

from an identity point of view, this difference in the VSP-II lends a unique molecular

signature to the Peruvian strains that could form the basis of tracking the origin of the

Peruvian strains and therefore the Latin American pandemic. Based on the stable difference

in VSP-II, we conclude that the Peruvian El Tor O1 strains are quite distinct from the seventh

16

pandemic Eurasian and African strains, suggesting that, although temporally associated with

the seventh pandemic, it arose independently probably from a nonhuman environmental

source. Optimally, we should have examined strains from other Latin American countries but

did not do so since we had none in our collection. Further studies are required to understand

what the difference means functionally.

17

Acknowledgements

This study was supported by grants provided to AG (IIN, Lima, Peru) and GBN

(ICDDR,B, Dhaka, Bangladesh) from The Academy of Sciences for the Developing World

(formerly the Third World Academy of Sciences) and by International Cooperation Research

Grant to SY (OPU, Osaka, Japan) and GBN (ICDDR,B, Dhaka, Bangladesh) from the

Ministry of Health, Labor, and Welfare, Japan. We also wish to thank Dr. Cesar Munayco

and Biol. Tania H Alarcon for graciously providing the environmental strains of V. cholerae

from Peru

18

References

1. Ansaruzzaman, M., N.A. Bhuiyan, G.B. Nair, D.A. Sack, M. Lucas, J.L. Deen, J.

Ampuero, C.L.Chaignat, and Mozambique Cholera Vaccine Demonstration

Project Coordination Group. 2004. Cholera in Mozambique, variant of Vibrio

cholerae. Emerg. Infect. Dis. 10:2057-2059.

2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and

D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein

database search programs. Nucleic Acids Res. 25: 3389–3402.

3. Chen, C.Y., K.M. Wu, Y.C. Chang, C.H. Chang, H.C. Tsai, T.L. Liao, Y.M. Liu,

H.J. Chen, A.B. Shen, J.C. Li, T.L. Su, C.P. Shao, C.T. Lee, L.I. Hor, and S.F.

Tsai. 2003. Comparative genome analysis of Vibrio vulnificus, a marine pathogen.

Genome Res. 13:2577-87.

4. Chow, K. H., T. K. Ng, K. Y. Yuen, and W. C. Yam. 2001. Detection of RTX toxin

gene in Vibrio cholerae by PCR. J. Clin. Microbiol. 39: 2594–2597.

5. Chowdhury, N. R., S. Chakraborty, T. Ramamurthy, M. Nishibuchi, S.

Yamasaki, Y. Takeda, and G. B. Nair. 2000. Molecular evidence of clonal Vibrio

parahaemolyticus pandemic strains. Emerg. Infect. Dis. 6: 631-636.

6. Cooper, K.L., C.K. Luey, M. Bird, J. Terajima, G.B. Nair, K.M. Kam, E.

Arakawa, A. Safa, D.T. Cheung, C.P. Law, H. Watanabe, K. Kubota, B.

Swaminathan, and E.M. Ribot. 2006. Development and validation of a PulseNet

standardized pulsed-field gel electrophoresis protocol for subtyping of Vibrio

cholerae. Foodborne Pathog. Dis.3: 51-58

7. Craig, J. P. 1996. Cholera: outlook for the twenty-first century. Caduceus. 12: 25-42.

19

8. Dalsgaard, A., M.N. Skov, O. Serichantalergs, P. Echeverria, R. Meza, D.N.

Taylor. 1997. Molecular evolution of Vibrio cholerae O1 strains isolated in Lima,

Peru, from 1991 to 1995. J. Clin. Microbiol. 35:1151– 1156.

9. Davis, B. M., H. H. Kimsey, W. Chang, and M. K. Waldor.1999. The Vibrio

cholerae O139 Calcutta bacteriophage CTXφ is infectious and encodes a novel

repressor. J. Bacteriol. 181: 6779–6787.

10. Dziejman, M., E. Balon, D. Boyd, C. M. Fraser, J. F. Heidelberg, and J. J.

Mekalanos. 2002. Comparative genomic analysis of Vibrio cholerae: genes that

correlate with cholera endemic and pandemic disease. Proc. Natl. Acad. Sci. U S A.

99: 1556–1561.

11. Evins, G.M., D.N. Cameron, J.G. Wells, K.D. Greene, T. Popovic, S. Giono-

Cerezo, I.K. Wachsmuth, and R.V. Tauxe. 1995. The emerging diversity of the

electrophoretic types of Vibrio cholerae in the Western hemisphere. J. Infect. Dis.

172:173-179.

12. Hayashi, M., J. Fujii, and T. Unemoto. 1997. Genetic defect of the sodium pump-

defective mutant nap-1 from the marine Vibrio alginolyticus. Biochem. Mol. Biol.

Intl. 41:41-47.

13. Heidelberg J. F., J. A. Eisen, W. C. Nelson, and 23 other authors. 2000. DNA

sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:

477–483.

14. Hoshino, K., S. Yamasaki, A. K. Mukhopadhyay, S. Chakraborty, A. Basu, S. K.

Bhattacharya, G. B. Nair, T. Shimada, and Y. Takeda. 1998. Development and

evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae

O1 and O139. FEMS Immunol. Med. Microbiol .20: 201–207.

20

15. Kaper, J. B., J. G. Morris, M. M. Jr, and Levine. 1995. Cholera. Clin. Microbiol.

Rev. 8: 48–86.

16. Karaolis, D.K., J.A. Johnson, C.C. Bailey, E.C. Boedeker, J.B. Kaper, and

P.R.Reeves. 1998. A Vibrio cholerae pathogenicity island associated with epidemic

and pandemic strains. Proc. Natl. Acad. Sci. U S A. 95:3134-3139.

17. Keasler, S. P., and R. H. Hall. 1993. Detecting and biotyping V. cholerae O1 with

multiplex polymerase chain reaction. Lancet. 341: 1661.

18. Kovach, M.E., M.D. Shaffer, and K.M. Peterson. 1996. A putative integrase gene

defines the distal end of a large cluster of ToxR-regulated colonization genes in

Vibrio cholerae. Microbiology. 142:2165-2174.

19. Krause, A., A. Ramakumar, D. Bartels, and 19 other authors. 2006. Complete

genome of the mutualistic, N2-fixing grass endophyte Azoarcus sp. Strains BH72.

Nature Biotech. 24:1385-1391.

20. McCarthy, S. A., and F. M. Khambaty. 1994. International dissemination of

epidemic Vibrio cholerae by cargo ship ballast and other nonpotable waters. Appl.

Env. Microbiol. 60: 2597-2601.

21. Mitra, R. K., R. K. Nandy, T. Ramamurthy, S. K. Bhattacharya, S. Yamasaki,T.

Shimada, S. Toshio, Y. Takeda, and G. B. Nair. 2001. Molecular characterization

of rough variants of Vibrio cholerae isolated from hospitalised patients with

diarrhoea. J. Med. Microbiol. 50:268–276.

22. Nair, G. B., S. M. Faruque, N. A. Bhuiyan, M. Kamruzzaman, A. K. Siddique,

and D. A. Sack. 2002. New variants of Vibrio cholerae O1 biotype El Tor with

attributes of the classical biotype from hospitalized patients with acute diarrhea in

Bangladesh. J. Clin. Microbiol. 40:3296–3299.

21

23. Nair, G.B., F. Qadri, J. Holmgren, A.-M. Svennerholm, A. Safa, N.A. Bhuiyan,

Q.Shafi Ahmed, S.M. Faruque, Y. Takeda and D.A. Sack. 2006. Cholera due to

altered El Tor strains of Vibrio cholerae O1 in Bangladesh. J. Clin. Microbiol.

44:4211-4213.

24. Nair, G.B., A. Safa, N.A. Bhuiyan, S. Nusrin, D. Murphy, C. Nicol, M. Valcanis,

S. Iddings, I. Kubuabola, and H. Vally. 2006. Isolation of Vibrio cholerae O1

strains similar to pre-seventh pandemic El Tor strains during an outbreak of

gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55:1559-1562.

25. Nandi, S., D. Maiti, A. Shaha, and R. K. Bhadra. 2003. Genesis of variants of V.

cholerae O1 biotype El Tor: role of the CTXϕ array and its position in the genome.

Microbiology. 149: 89–97.

26. Nusrin, S., G. Y. Khan, N. A. Bhuiyan, and 9 other authors. 2004. Diverse ctx

phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994

and 2002 in an area where cholera is endemic in Bangladesh. J. Clin. Microbiol. 42:

5854–5856.

27. O’Shea, Y. A., F. J. Reen, A. M. Quirke, and E. F. Boyd. 2004a. Evolutionary

genetic analysis of the emergence of epidemic Vibrio cholerae isolates based on

comparative nucleotide sequence analysis and multilocus virulence gene profiles. J.

Clin. Microbiol. 42:4657–4671.

28. O’Shea, Y.A., S. Finnan, F. J. Reen, J. P. Morrissey, F. O’Gara, and E.F. Boyd.

2004b. The Vibrio seventh pandemic island-II is a 26.9 kb genomic island present in

Vibrio cholerae El Tor and O139 serogroup isolates that shows homology to a 43.4 kb

genomic island in V. vulnificus. Microbiology. 150: 4053–4063.

22

29. Popovic, T., C. Bopp, O. Olsvik, and I.K. Wachsmuth. 1993. Epidemiologic

application of a standardized ribotype scheme for Vibrio cholerae O1. J. Clin.

Microbiol. 31:2474-2482.

30. Rivera, I. N., J. Chun, A. Huq, R. B. Sack, and R. R. Colwell. 2001. Genotypes

associated with virulence in environmental isolates of Vibrio cholerae. Appl. Env.

Microbiol. 67: 2421–2429.

31. Safa, A., N.A. Bhuiyan, S. Nusrin, M. Ansaruzzaman, M. Alam, T. Hamabata, Y.

Takeda, D.A. Sack, and G.B. Nair. 2006. Genetic characteristics of Matlab variants

of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med.

Microbiol. 55:1563-1569.

32. Seas, C., J. Miranda, A.I. Gil, R. Leon-Barua, J. Patz, A. Huq, R.R. Colwell, and

R.B. Sack. 2000. New insights on the emergence of cholera in Latin America during

1991: The Peruvian experience. Am. J. Trop. Med. Hyg. 62:513-517.

33. Sozhamannan, S., Y.K. Deng, M. Li, A. Sulakvedidze, J.B. Kaper, J. A. Johnson,

G.B. Nair, and J.G. Morris, Jr. 1999. Cloning and sequencing of the genes

downstream of the wbf gene cluster of Vibrio cholerae serogroup O139 and analysis

of the junction genes in other serogroups. Infect. Immun. 67:5033-5040.

34. Tauxe R., E. Mintz, and R. Quick. 1995. Epidemic cholera in the New World:

translating field epidemiology into new prevention strategies. Emerg. Infect. Dis. 1:

141-146.

35. Trucksis, M., J. Michalski, Y. K. Deng, and J. B. Kaper. 1998. The Vibrio

cholerae genome contains two unique circular chromosomes. Proc. Natl. Acad. Sci. U

S A. 95: 14464–14469.

23

36. Wachsmuth, I.K., G.M. Evins, P.I. Fields, Ǿ. Olsvik, T. Popovic, C.A. Bopp, J.G.

Wells, C. Carrillo, and P.A. Blake .1993. The molecular epidemiology of cholera in

Latin America. J. Infect. Dis. 167:621– 626.

37. Waldor, M.K. and J.J. Mekalanos. 1996. Lysogenic conversion by a filamentous

phage encoding cholera toxin. Science. 272: 1910-1914.

24

Legend to Figures

Figure 1. Schematic representation of the organization of VSP-II from V. cholerae strains

N16961 (a) and PERU-130 (b). The position and direction of transcription of the ORFs are

indicated by the direction of the arrows. Homology between N16961 and PERU-130 at the

DNA level is described as percentage and is shown between the ‘a’ and ‘b’ panels. The

numbers refer to the genetic organization of the genes. The regions amplified by PCR using

each primer set, described in Table 2, are depicted (c). The solid bar indicates the region

amplified, however, dashed bar indicates the region fail to be amplified. The number below

the arrow indicates the name of the PCR primer used.

Figure 2. NotI-restricted patterns of chromosomal DNA of Peruvian V. cholerae O1 El Tor

strains isolated between 1991 and 1996. Lanes: 1, 8, and 15 Salmonella braenderup strain

H9812 as molecular mass marker; lanes 2, 3,and 5 represent pulsotype A1, PERU-180

(1991), PERU-139 (1992) and PERU-067 (1993) respectively; lane 4 pulsotype B1, PERU-

011 (1993); lane 6 pulsotype B2, PERU-086 (1994); lane 7 pulsotype A2, PERU-115 (1994);

lane 9 pulsotype C, PERU-097 (1995); lane 10 pulsotype D, PERU-132 (1995); lane 11

pulsotype A3, PERU-120 (1996); lane 12 pulsotype A4, PERU-137 (1996); and lanes 13, 14

represent 569B classical and N16961 El Tor strains respectively.

Table 1. Serotype and genotype of the V. cholerae O1 El Tor biotype strains and

the two reference strains examined in this study

Genotype Country

(number of strains)

Year of

Isolation

Serotype

ctxA tcpA rstRa

Peru (47) 1991-1999, 2003 Ogawa + + 2

Peru (10) 1991-1994 Inaba + + 2

Peru (1) 1991 Inaba + - 2

Peru (1) 1995 Ogawa - + 2

Peru (1) 1993 Ogawa + - 2

Australia (1) 1986 Inaba + + 1

Australia (1) 1965 Inaba - - -

Australia (1) 1979 Inaba + + 1,2

Bangladesh (4) 2004 Ogawa + + 2

India (2) 1975, 1982 Ogawa + + 2

India (1) 1981 Ogawa - + 2

Maldives (1) 1978 Ogawa + + 2

Maldives (1) 1978 Ogawa - + 2

Malaysia (1) 1978 Inaba + + 2

Malaysia (1) 1978 Ogawa + + 2

Myanmar (1) 1970 Ogawa + + 1,2

Macao, China (1) 1970 Inaba - + 2

Germany (1) 1975 Inaba + + 2

Germany (1) 1975 Ogawa + + 2

Zambia (2) 1996, 2003 Ogawa + + 2

Mozambique (3) 2004 Ogawa + + 1

O395 (classical) 1965 Ogawa + + 1

N16961 (El Tor) 1971 Inaba + + 2

a 1, classical biotype rstR; 2 El Tor biotype rstR

Table 2. PCR primer sequences and conditions for analyzing the VSP-II region of V. cholerae O1 El Tor strains isolated in Peru and various other

countries

Primer Sequences (5'-3') PCR condition No. of Product size Reference

designation Denaturation Annealing Extention cycle (bp)

VC0511F1 CTTGCTGCGTACTTAGCA 95ºC, 1 min 54ºC, 1 min 72ºC, 1 min 30 385 This study

VC0511R1 AGTAGCATCGCTCTCGTA

VC0512F1 TCCTGATTGGGAGCGAA 95ºC, 1 min 54ºC, 1 min 72ºC, 1 min 30 1.704 This study

VC0512R1 TCACGCGGGTTATTCCA

VC0513F1 CTGAGGTGTTATATGTTTCG 95ºC, 1 min 54ºC, 1 min 72ºC, 1 min 30 781 This study

VC0513R1 TCAAATTTCCTGACAGTTCC

VC0514F1 GTTTGGGAAGGGTACACA 95ºC, 1 min 52ºC, 1 min 72ºC, 1 min 30 1.651 This study

VC0514R1 GCTCTTCAGCCGCTGA

VC0515F1 GGTGGTGCTGCATGGA 95ºC, 1 min 50ºC, 1 min 72ºC, 1 min 30 1.135 This study

VC0515R1 TCTAAAGCCTCACACCA

VC0489F AGATCAACTACGATCAAGCC 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 5.202 27

VC0490R TGCAGTTGTTGAATGGAC

VC0490F CGTGAAGGGATATAGGAG 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 6.718 27

VC0493R CGCTCTTCTTTCCACGCTTCA

VC0493F AATGCTTCTCAGGGGGGTCTT 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 7.439 27

VC0498R TGCGGCTCCAATGGAGTCTG

VC0502F TCATCAGTTAGCACACGAAC 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 5.808 27

VC0504R AGCCCGAAATGAATCCCAAAA

VC0504F CAGCAAAGGCGGAAGAGGTAG 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 7.616 27

VC0512R CCCTCCACTGCTATTCCG

VC0512F CAGTGGCTTCGCAGAGGA 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 8.384 27

VC0516R TCCTGATGTCTCTCTTGCCG

VC0514F TTATGATCCAAGGAGTAGGG 94ºC, 30 sec 52ºC, 30 sec 72ºC, 4 min 30 6.736 27

Table 3. Results of the genetic screen used for identifying 11 virulence regions and 1 house-keeping gene of Vibrio cholerae O1 strains isolated in Peru between 1991 and 2003

Ho

use

kee

pin

g

gen

e

VSP-I MSHA hlyA VSP-II VPI-I pilE RTX RS1 CTX

Strain

Bio

typ

e

md

h

175

178

180

183

185

398

400

403

406

489

490

493

498

502

504

512

514

516

517

tcp

A

tox

T

acf

B

pil

E

rtxA

rtxC

rstC

rstA

orf

U

zot

ctx

AB

tlc

intl

4

PERU-130 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-139 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-067 El Tor + + + + + + + + + + + + + + + + - - + + - - - + + + + + + + + + +

PERU-115 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-044 El Tor + + + + + + + + + + + - + + + + - - + + E + + + + + + + + + + + +

PERU-097 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + - + +

PERU-120 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-169 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-037 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-299 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-189 El Tor + + + + + + + + + + + + + + + + - - + + - - - + + + + + + + + + +

PERU-200 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-205 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-219 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-306 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-324 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-327 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-328 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-329 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

PERU-330 El Tor + + + + + + + + + + + + + + + + - - + + E + + + + + + + + + + + +

N16961 El Tor + + + + + + + + + + + + + + + + + + + + E + + + + + + + + + + + +

O395 Classical + - - - - - + + + + + - - - - - - - - - C + + + + - - + + + + + +

E for El tor tcpA and C for classical tcpA

TABLE 4. Comparison of VSP-II region of the Peruvian V. cholerae O1 El Tor isolates with

the isolates from different countries possessing different ORFs of VSP-II region

VSP-II

Pla

ce o

f

isola

tion

No. of

str

ain

s

VC

O4

90

VC

O4

93

VC

O4

98

VC

O5

02

VC

O5

04

VC

O5

11

VC

O5

12

VC

O5

13

VC

O5

14

VC

O5

15

VC

O5

16

VC

O5

17

Peru 30 + + + + + - - - - - - +

Peru 19 + + + + + - - - - - + +

Peru 9 + + + + + + - - - - - +

Peru 1 - + + + + - - - - - + +

Peru 1 + - + + + - - - - - - +

Australia 3 - - - - - - - - - - - +

Bangladesh 4 + - - + + + + + + + + +

Myanmar 1 + + + + + + + + + + + +

India 3 + + + + + + + + + + + +

Maldives 2 + + + + + + + + + + + +

Malaysia 2 + + + + + + + + + + + +

Mozambique 3 + + + + + + + + + + + +

Macao, China 1 + + + + + + + + + + + +

Germany 2 + + + + + + + + + + + +

Zambia 1 + + + + + + + + + + + +

Zambia 1 + - - + + + + + + + + +

Classical (O395) 1 - - - - - - - - - - - +

El Tor (N16961) 1 + + + + + + + + + + + +

Table 5. The 24 ORFs encompassing the 26.5 kb VSP-II island in Vibrio cholerae O1 El Tor Peru-130 strain

ORF Length Homologue Length (aa) Amino acid DNA Gene Strain Accession

(aa) identity (%) identity (%) designation number

1 1302 (433) Heamolysin 1761 (586) 432/433 (99.8) 1301/1302 (99.9) VC0489 V. cholerae N16961 NP 230143

2 1962 (653) Hypothetical protein 1962 (653) 653/653 (100) 1962/1962 (100) VC0490 V. cholerae N16961 NP 230144

3 537 (178) Hypothetical protein 537 (178) 177/178 (99.4) 537/537 (100) VC0491 V. cholerae N16961 NP 230145






9 201 (66) Transcriptional regulator 201 (66) 66/66 (100) 201/201 (100) VC0497 V. cholerae N16961 NP 230151

10 441 (146) Ribonuclease H 441 (146) 146/146 (100) 441/441 (100) VC0498 V. cholerae N16961 NP 230152

11 525 (174) Type IV pilin 525 (174) 174/174 (100) 525/525 (100) VC0502 V. cholerae N16961 NP 230153




15 735 (244) Hypothetical protein 735 (244) 236/244 (96.7) 708/735 (96.3) VC0506 V. cholerae N16961 NP 230157

16 177 (58) Hypothetical protein 177 (58) 53/58 (91.4) 165/177 (93.2) VC0507 V. cholerae N16961 NP 230158

17 444 (147) Hypothetical protein 444 (147) 143/147 (97.3) 424/444 (95.5) VchoR_02001367 V. cholerae RC385 ZP 01482712

137/147 (93.2) 410/444 (92.3) VV0523 V. vulnificus YJ016 NP 933316

137/147 (93.2) 419/444 (94.4) VC0508 V. cholerae N16961 NP 230159

18 444 (147) Hypothetical protein 444 (147) 140/144 (97.2) 397/427 (93.0) VV0524 V. vulnificus YJ016 ZP 01482712

133/144 (92.4) 398/434 (91.7) VC0509 V. cholerae N16961 NP 230160

19 474 (157) DNA repair protein RadC family protein 474 (157) 154/157 (98.1) 443/474 (93.5) VV0525 V. vulnificus YJ016 NP 933318

151/157 (96) 440/474 (92.8) VC0510 V. cholerae N16961 NP 230161

20 1812 (603) Hypothetical protein 1776 (591) 278/595 (46.7) 982/1836 (53.5) azo2045 Azoarcus sp. BH72 YP 933549

21 2466 (821) Hypothetical protein 2187 (728) 246/741 (33.2) 432/914 (47.3) azo2046 Azoarcus sp. BH72 YP 933550

22 2043 (673) Hypothetical protein 2043 (680) 319/683 (46.7) 1072/2054 (52.2) Mmcs_4842 Mycobacterium sp. MCS YP 642002

23 345 (114) Transposase OrfAB, subunit A 345 (114) 107/114 (93.9) 300/345 (87.2) VCA0372 V. cholerae N16961 NP 232767

24 870 (289) Transposase OrfAB, subunit B 921 (306) 265/289 (91.7) 727/870 (83.6) NB231_17565 Nitrococcus mobilis Nb-231 ZP 01128962

873 (290) 264/289 (91.3) 749/870 (86.1) VCA0371 V. cholerae N16961 NP 232766

23+24# 1214 Isalg ( IS element found in V. 1258 - 1200/1214 (98.8) Isalg V. cholerae O103 AF 133213

25 1242 (413) Phage integrase 1230 (409) 402/408 (98.5) 1193/1224 (97.5) VV0560 V. vulnificus YJ016 NP 933353

1242 (413) 387/413 (93.7) 1110/1242 (89.4) VC0516 V. cholerae N16961 NP 230167

26 1878 (625) RNA polymerase sigma factor (RpoD) 1878 (625) 625/625 (100) 1878/1878 (100) VC0517 V. cholerae N16961 NP 230168

# DNA sequence of ORF23 and 24 has high homology to V. cholerae serogroup O103 insertion sequence Isalg.

the peruvian el tor strains of vibrio cholerae o1 have a distinct ... · 1 the peruvian el tor...

Documents