typing of clostridium perfringens from necrotic enteritis ...· typing of clostridium perfringens

Download Typing of Clostridium Perfringens from necrotic enteritis ...· Typing of Clostridium Perfringens

Post on 08-Sep-2018

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    MS thesis submitted by

    Amany El-Sayed

    Under the supervision of

    Prof. Dr. Heidy Shawky Prof. Dr. Mohamed Refai

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

  • Introduction Material and Methods Results Conclusion and Recommendation

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

  • Introduction

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

  • Introduction

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Avian necrotic enteritis (NE) was first described in 1961 since then it has been reported to occur in almost all poultry-producing countries

    Studies showed that the subclinical form of (NE) is a worldwide problem with an average of 80% of the flocks having had Clostridium diagnosed especially in broiler and turkey flocks

    A follow-up study in 2005 indicated an increased incidence of Clostridial enteritis in all regions of the world.

    Recent European surveys confirmed the severity and the widespread of the problem

    (NE) is caused by toxins produced by Clostridium perfringens.

  • Introduction

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Isolation of C. perfringens and/or detection of its alpha toxin are of little value to confirm the disease because both are often found in the intestine of healthy birds

    Clostridium perfringens is a Gram-positive, spore forming and anaerobic bacterium responsible for a wide range of diseases in humans and animals

    Clostridium perfringens is commonly classified to Toxigenotypes: Type A, B, C, D and E. based on the types of toxins they produce. The main toxins produced by strains of Clostridium perfringens are , , and

  • Introduction

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    The conventional method of Clostridium perfringens typing is based on the detection and typing of the toxins with toxin neutralization test in mice. This procedure consumes a lot of antisera and experimental animals. Moreover, it is time consuming. In recent years, molecular techniques such as polymerase chain reaction (PCR) are increasingly used to type Clostridium perfringens

    Toxin genotyping of Clostridium perfringens isolates utilizing PCR has usually required multiple reactions per isolate as the organism produces many different important toxins.

    The large number of oligonucleotide primers needed to detect these genes in a single multiplex reaction.

  • Introduction

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    The aim of this research was to determine the prevalence of (NE) in turkeys and

    identify the different types of Clostridium perfringens isolated from living and

    slaughtered turkeys by Multiplex PCR molecular method.

  • Material and methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    A total number of 122 samples (39 intestinal samples and 83 fecal swabs

    samples) was collected from apparently healthy and diseased turkey poults.

    butchers' shops in Giza (27) and from Kafr Ghataty farm (95) The age of the turkey poults varied from 2 to 5 months. Media used for isolation and identification of C. perfringens:

    1. Liquid media: Cooked meat medium enrichment. 1. Solid media: Neomycin sulphate sheep blood agar medium: isolation, purification observation of colonial morphology haemolytic activity of C. perfringens.

    Materials

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Media used for preservation of C. perfringens:

    Sheep blood agar for one week only.

    Cooked meat medium for repeated subcultures.

    Brain heart infusion with 16% glycerol for cryopreservation of C. perfringens

    isolates till further use.

    Stain: Gram's stain for microscopically identification.

    Material used for DNA extraction, PCR, and agarose gel electrophoresis: Tris Edita buffer (TE). PCR master mix. Oligonucleotide primers.

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Primers of C. perfringens alpha toxin gene

    Beta toxin gene

    Epsilon toxin gene

    iota toxin gene enterotoxin

    (van Asten et al., 2009)

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Primer name and direction Nucleotide sequence ( 5 `to 3 `) Amplicon (bp)

    cpa:

    324 Forward GCTAATGTTACTGCCGTTGA

    Reverse CCTCTGATACATCGTGTAAG`

    cpb:

    196 Forward GCGAATATGCTGAATCATCTA

    Reverse GCAGGAACATTAGTATATCTTC`

    etx:

    655

    Forward GCGGTGATATCCATCTATTC

    Reverse CCACTTACTTGTCCTACTAAC

    iA:

    446 Forward ACTACTCTCAGACAAGACAG

    Reverse CTTTCCTTCTATTACTATACG`

    cpe:

    233 Forward GGAGATGGTTGGATATTAGG

    Reverse GGACCAGCAGTTGTAGATA

    Table (2): Primers for the five toxins genes of C. perfringens used in multiplex PCR.

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Nuclease- free water.

    Reagents used for agarose gel electrophoresis: Agarose gel (1.5%) Electrophoresis buffer Ethidium bromide solution

    DNA loading dye.

    DNA size markers: Gene ruler TM 100 bp DNA ladder. Gene ruler TM 50 bp DNA ladder.

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Isolation of C. perfringens: Inoculation of freshly prepared cooked meat medium Incubation anaerobically at 37C for 24-48 hours. Subculture onto 10% sheep blood agar with neomycin sulphate (150-200 g

    /ml). The plate was incubated anaerobically at 37C for 24-48 hours. Examination of suspected colonies for : morphological and cultural characters Gram stained films

    Methods

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    Colonial appearance Flat rounded with double zone of haemolysis Microscopically appearance: Gram positive bacilli with rounded ends rarely had central or oval non bulging endospores.

    Methods

  • Materials and Methods

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    3. Identification of the isolates: Biochemical tests PCR for genotyping of C. perfringens: A total of 56 C. perfringens isolates subjected to genotyping by multiplex PCR.

    1. Extraction of C. perfringens DNA 2. PCR amplification and cycling protocol 3. Visualization of PCR products

    Methods

  • Results

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

  • Results

    Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Cairo University

    Faculty of Veterinary Medicine

    Microbiology Department

    1. Symptoms observed on the examined diseased turkey poults.

    2. P.M. lesions.

    3. Classification of the collected samples:

    I. Classification of the collected samples according to location

    II. Classification of the collected samples according to sex

  • Typing of Clostridium Perfringens from necrotic enteritis in turkeys by multiplex PCR

    Results Classification of the collected samples according to location

    Kafr Ghatati's Farm

    slaughter house and butchers shops

    0

    10

    20

    30

    40

    50

    60

    70

    80

    Apparently heathy birds

Recommended

View more >