Mia

Wa

b

N

a

ARRAA

KEPHSV

1

tvtatormgi2iDwse

0h

Microbiological Research 169 (2014) 476–482

Contents lists available at ScienceDirect

Microbiological Research

j ourna l h omepa ge: www.elsev ier .com/ locate /micres

utational analysis of the Verticillium dahliae protein elicitor PevD1dentifies distinctive regions responsible for hypersensitive responsend systemic acquired resistance in tobacco

enxian Liua,b, Hongmei Zengb,∗, Zhipeng Liua, Xiufen Yangb, Lihua Guob, Dewen Qiub,∗

State Key Laboratory of Grassland Agro-Ecosystems, School of Pastoral Agriculture Science and Technology, Lanzhou University, Lanzhou 730020, PR ChinaKey Laboratory of Integrated Pest Management in Crops, Ministry of Agriculture, Institute of Plant Protection, Chinese Academy of Agricultural Sciences,o. 12, Zhongguancun South Street, Beijing 100081, PR China

r t i c l e i n f o

rticle history:eceived 19 April 2013eceived in revised form 23 July 2013ccepted 3 August 2013vailable online 27 September 2013

eywords:

a b s t r a c t

In our previous study, PevD1 was characterized as a novel protein elicitor produced by Verticillium dahliaeinducing hypersensitive response (HR) and systemic acquired resistance (SAR) in tobacco plants; how-ever, the detailed mechanisms of PevD1’s elicitor activity remain unclear. In this study, five mutantfragments of PevD1 were generated by polymerase chain reaction-based mutagenesis and the truncatedproteins expressed in Escherichia coli were used to test their elicitor activities. Biological activity analysisshowed that the N-terminal and C-terminal of PevD1 had distinct influence on HR and SAR elicitation.

licitorevD1ypersensitive responseystemic acquired resistanceerticillium dahliae

Fragment PevD1�N98, which spans the C-terminal 57 amino acids of PevD1, was critical for the induc-tion of HR in tobacco plants. In contrast, fragment PevD1�C57, the N-terminal of 98 amino acids ofPevD1, retained the ability to induce SAR against tobacco mosaic virus (TMV) but not induction of HR,suggesting that the induction of HR is not essential for SAR mediated by PevD1. Our results indicatedthat fragment PevD1�C57 could be a candidate peptide for plant protection against pathogens withoutcausing negative effects.

© 2013 Elsevier GmbH. All rights reserved.

. Introduction

In nature, plants undergo continuous exposure to various poten-ial stresses caused by pathogens. To survive under such conditions,arious mechanisms have evolved in plants to defend againsthe incursion of pathogens. These include constitutive chemicalnd mechanical barriers as well as with inducible defense sys-ems (Bruce and Pickett, 2007). Recognition of the pathogen orther foreign material is central for plants to initiate defenseesponses to reduce damage. During plant-microbe interactions,any molecules produced and released by pathogenic microor-

anisms, so called elicitors, are thought to have significant rolesn signal exchange between plants and pathogens (Mishra et al.,012). Elicitors belong to a diverse range of molecular types, includ-

ng proteins, peptides, glycoproteins, lipids, and oligosaccharides.iverse plant defense responses induced by elicitors include cell

all strengthening, production of phytoalexin, reactive oxygen

pecies (ROS), extracellular alkalinization, ethylene biosynthesis,xpression of pathogenesis-related (PR) proteins, and induction of

∗ Corresponding author. Tel.: +86 10 82105929.E-mail addresses: zenghongmei@caas.cn (H. Zeng), qiudewen@caas.cn (D. Qiu).

944-5013/$ – see front matter © 2013 Elsevier GmbH. All rights reserved.ttp://dx.doi.org/10.1016/j.micres.2013.08.001

cell death (hypersensitive response, HR) (Wang et al., 2004; Miyataet al., 2006; Wang et al., 2012). These defense responses are firstexpressed in the cells located at the site of infection and thenextended to non-infected cells, leading to whole plant immunity,called systemic acquired resistance (SAR) that is effective against abroad-spectrum of pathogens (Durrant and Dong, 2004).

Many elicitors have been isolated and have shown variouseffects on plant’s resistance to pathogens and development. Forexample, Harpin proteins are multifunctional protein elicitors pro-duced by Gram-negative plant pathogenic bacteria (Wei et al.,1992; Zhang et al., 2011a). Exogenous application or transformationof Harpin-encoding genes could induce SAR and enhance toleranceto a range of stress in plants (Oh and Beer, 2007; Ren et al., 2008;Shao et al., 2008; Zhang et al., 2011b). Over expression of a flag-ellin gene in rice triggers immune responses and confers improvedresistance to blast in transgenic rice (Takakura et al., 2008). Whenan elicitor-encoding gene PemG1 from Magnaporthe grisea wasintroduced into rice, the expression of defense-related genes forphenylalanine ammonia-lyase and praline content was triggered

and the plants showed enhanced resistance against M. grisea (Qiuet al., 2009).

Previous studies have demonstrated that individual portions ofsome elicitors are responsible for several phenotypes elicited by

al Research 169 (2014) 476–482 477

tttpntcpe2bstoetaiSwfeaPHTtmtod

aema2sg(dnwsI

Table 1Polymerase chain reaction primers used to produce PevD1 and its deletionfragments.

Primer name Sequence

PevD1F 5′- CATGCCATGGGCATGCAGTTCACCCTCGCCG -3′

Upstream primer used to construct PevD1PevD1R 5′- CCGGAATTCCGGTTAAGCCTCGGCGGGAGC -3′

Downstream primer used to construct PevD1PevD1�C23R 5′- CCGGAATTCCGGTTAGTCACCAAGGCCGCCAGCA -3′

Downstream primer used with PevD1F to construct PevD1�C23PevD1�C47R 5′- CCGGAATTCCGGTTACTCGTGGTACAGGC -3′

Downstream primer used with PevD1F to construct PevD1�C47PevD1�C57R 5′- CCGGAATTCCGGTTACTGCTTACCAGAGGACAG -3′

Downstream primer used with PevD1F to construct PevD1�C57PevD1�C88R 5′- CCGGAATTCCGGTTAGCCGTCGGCGTCGTCGC -3′

Downstream primer used with PevD1F to construct PevD1�C88PevD1�N98F 5′- CATGCCATGGGCTATGAGTTCGCTCTGAGCCTG -3′

Upstream primer used with PevD1R to construct PevD1�N98

Note: Restriction sites were incorporated into primers (underlined) for cloning pur-

Fur

W. Liu et al. / Microbiologic

heir full-length proteins. NPP1 is an elicitor purified from Phytoph-hora parastitica. Structure-activity relationship studies revealedhat two cysteine residues were critical for its ability to triggerhytoalexin production and cell death in parsley protoplasts andecrotic lesion formation in tobacco leaves (Fellbrich et al., 2002). Inhe interaction of cultured parsley cells with a 42 kDa cell wall gly-oprotein elicitor from the soybean pathogen Phytophthora sojae, aeptide of 13 amino acids (Pep-13) was necessary and sufficient tolicit the biosynthesis of ethylene and phytoalexins (Halim et al.,004). The elicitor activity of flg22 would be completely abolishedy removal of the Leu residue present at position 12 of flg 15, ortrongly decreased with replacements of the two Asp residues orhe Gly residue in the center of flg 15, indicating the critical rolesf these residues involved in the elicitor activity of flg 22 (Felixt al., 1999; Asai et al., 2002). Deletion analyses of Hpa1Xoo of Xan-homonas oryzae pv. oryzae indicated that the 12 highly hydrophilicmino acids that partially overlap the N-terminal ˛-helix were crit-cal for the elicitation of HR activity in tobacco (Felix et al., 1999).imilarly, the fragment responsible for HR induction on tobaccoas also resided in the N-terminal ˛-helix motif of the HpaG harpin,

rom Xanthomonas axonopodis pv. glycines (Kim et al., 2004). How-ver, Alfano et al. (1996) found that both the N-terminal 109 aminocids and the C-terminal 216 amino acids of the HrpZ harpin, fromseudomonas syringae pv. syringae, possess the ability to induceR, implying that multiple functional domains existed in HarpZ.he fragment HpaG62–137, which spans amino acids 62 to 137 ofhe HpaG harpin, from Xanthomonas oryzae pv. oryzicola, induced

ore intense HR than that of its parent protein HpaGXooc; in con-rast, the fragment of HpaG10–42, consisting of amino acids 10 to 42f the HpaG harpin, is most active in promoting plant growth andefense both in nursery and field conditions (Chen et al., 2008a,b).

Verticillium dahliae Kleb. is a phytopathogenic fungus that causes serious wilt disease in a wide range of crops, including manyconomically important ones (Fradin and Thomma, 2006). Manyolecules purified from V. dahliae culture fluids have behaved both

s defense elicitors and (or) pathogenicity factors (Wang et al.,004; Yao et al., 2011). Previously, we reported the isolation of aecreted protein elicitor PevD1 from V. dahliae, which could trig-er HR and induce SAR to tobacco mosaic virus (TMV) in tobaccoWang et al., 2012). By homology search against protein sequenceatabases, the amino acid sequence of PevD1 does not share sig-

ificant homology with other known proteins, and it is unclearhether there are functional regions that reside in PevD1 respon-

ible for eliciting different plant phenotypes, such as HR and SAR.n this study, five mutant fragments of PevD1 were generated

ig. 1. Macro-hypersensitive response (HR) elicitor activity of PevD1 and truncated PevDsed to test the elicitor activity of different regions of the protein. Bold bars indicate the

esponse (HR). Tobacco leaves were infiltrated with cell-free preparations of the indicate

poses. Bases underlined are NcoI (CCATGG) and EcoRI (GAATCC) in the upstream anddownstream primers, respectively.

by polymerase chain reaction-based mutagenesis and their elic-itor activities were tested and compared. We demonstrate thatC-terminal and N-terminal of PevD1 were responsible for inducingHR and eliciting SAR for resistance to TMV in tobacco, respectively.Their characteristics, activities and future applications were alsodiscussed.

2. Materials and methods

2.1. Nucleic acid manipulations and plasmid construction

Standard methods were used for DNA cloning, restriction map-ping, and gel electrophoresis (Sambrook and Russell, 2001). Forthe expression of wild-type and truncated forms of PevD1, DNAsencoding the fragments shown in Fig. 1 were amplified by PCRfrom plasmid pMD18-T-PevD1 (Wang et al., 2012). Primers usedin the vector construction are listed in Table 1. The PCR productswere cloned into pMD 18-T simple vector (TaKaRa BiotechnologyCo., Ltd., Dalian, China) for sequencing analysis. Subsequently, themutated target DNA fragments were excised from pMD 18-T simplevectors by Nco I-EcoR I digestion and cloned into the corresponding

sites of pET30a(+) vector (Novagen) to reserve the upstream histi-dine tag (His-tag) close to T7 promoter; the downstream His-tagwas excluded by adding proper stop codons in the primers.

1 proteins in tobacco leaves. (A) Diagram of PevD1 and truncated PevD1 proteinsspans of amino acids included. (B) Macroscopic views of the macro-hypersensitived proteins. Photos were taken at 24 h post treatment.

4 al Res

2f

iteaLdpp(hrppW

2

catw(wow(va(

2

lto(

Fpt

78 W. Liu et al. / Microbiologic

.2. Expression and purification of PevD1 and its deletionragments

All the engineered vectors constructed above were transformednto E. coli BL21 (DE3; Novagen) to produce protein preparations,ermed cell-free preparations. Strains harboring wild-type andach mutant clone were grown in Luria broth (LB) with kanamycint 50 �g/ml, and the overnight cultures were diluted 100-fold inB induced for 3 h by the addition of 0.5 mM IPTG (isopropyl �--thiogalactopyranoside). BL21 cells containing only the emptyET30a(+) vector were grown similarly to produce an inactiverotein preparation, termed cell-free empty vector preparationCEVP), which was used as the control. Cell-free preparations werearvested by centrifugation and disrupted with an ultrasonic dis-uptor. Concentrations of the proteins were estimated as describedreviously (Liu et al., 2006). The purification and detection of theroteins were conducted according to the method described byang et al. (2012).

.3. Hypersensitive response (HR) assays

Seedlings (7–8 weeks old) of tobacco plants (Nicotiana tabacumv. Samsun NN) were used for the hypersensitive response (HR)ssay. For macro-HR induction, wild-type and mutant PevD1 pro-eins were infiltrated into tobacco leaves at 1 �M with a syringeithout a needle. Visible HR was observed 24 h post treatment

hpt). For micro-HR observation, in situ evaluation of cell deathas performed using vital dye trypan blue as described previ-

usly (Peng et al., 2004). Hydrogen peroxide (H2O2) accumulationas detected by in situ staining with 3,3-diaminobenzidine (DAB)

Sigma-Aldrich, St. Louis) according to the method described pre-iously (Chen et al., 2012). Cleared leaves for cell death and H2O2ccumulation were observed under an Olympus Stereoscope SZX-9Olympus America Inc., Melville, NY, USA).

.4. Tobacco TMV resistance assays

Infection of tobacco plants by TMV was investigated by estab-

ished methods (Wang et al., 2012). The fourth and fifth leaves ofobacco were infiltrated with protein solutions at the concentrationf 1 �M. TMV inoculation was performed 3 days post treatmentdpt) by gently rubbing the sixth leaves of tobacco plants with

ig. 2. Effects of purified PevD1, PevD1�C57 and PevD1�N98 on induction of macrolyacrylamide gel electrophoresis comparison of purified proteins. (B) Macroscopic vhe concentration of 1 �M. Photos were taken at 24 h post treatment.

earch 169 (2014) 476–482

200 �l of the viral suspension (12 �g/ml) containing Carborundum.The number and size of necrotic lesions induced by TMV infectionwere recorded 3 days after inoculations as described previously(Wang et al., 2012). The percentage inhibition of lesion forma-tion was calculated using the equation: Inhibition (%) = [1−(number(size) of lesions on treatment leaf/(number (size) of lesions on con-trol leaf)] × 100%. All experiments were repeated three times with10 plants per replicate.

2.5. RNA extraction and RT-PCR analyses

Total RNA was extracted from 250-mg tobacco leaves using theTRIzol reagent (Invitrogen, USA). Prior to cDNA synthesis, RNA wastreated with DNase (TaKaRa Biotechnology Co., Ltd., Dalian, China)to remove possible DNA contamination. Reverse transcription wasperformed in 20 �l reactions containing 1 �g total RNA accordingto the manufacturer’s instructions (RT-PCR kit, Promega, Madison,WI, USA). After 10-fold dilution, 1 �l of the RT products was used asa template in PCR amplification. To quantify the expression level oftarget genes, the tobacco Actin gene was selected as an endogenouscontrol in the RT-PCR assays.

For amplification of tobacco genes by RT-PCR,the following primers were used: HSR203 (for-ward, 5′-TGTACTACACTGTCTACACGC-3′; reverse,5′-GATAAAAGCTATGTCCCACTCC-3′. GenBank accession No.:AF212184); HIN1 (forward, 5′-CTTCACCCTTCACCCTTCT-3′;reverse, 5′-GGCATCTGGTTTCCTCAA-3′. GenBank accessionNo.: Y07563.1); PR1a (forward, 5′- GCAGATTGTAACCTCGTA-3′; reverse, 5′-CAATTAGTA TGGACTTTCG-3′. GenBank accessionNo.: D90196); NPR1 (forward, 5′-ATCGCCAAGAGGCTCACTA-3′;reverse, 5′-CAGACAAGTCATCAGCATCC-3′. GenBank accession No.:AF480488); and Actin (forward, 5′-CGGAATCCAC GAGACTACATAC-3′; reverse, 5′-GGGAAGCCAAGATAGAGC-3′. GenBank accessionNo.: X69885).

3. Results

3.1. Mapping of PevD1 regions required for HR induction in

tobacco plants

To determine whether there are regions in PevD1 criticalfor the induction of HR in nonhost plants, we constructed five

o-hypersensitive response (HR) in tobacco leaves. (A) Sodium dodecyl sulfate-iews of macro-hypersensitive response (HR) induced by the purified proteins at

al Research 169 (2014) 476–482 479

tiPwtimIvP

3i

eaivtvftaweCP

oPwRoamtsHoe

saPbPcP

rmliosHP

et(rtca

Fig. 3. Microscopic views of micro-HR in tobacco leaves. Treated leaves harvested24 h post-treatment with purified PevD1, PevD1�C57 or PevD1�N98 proteinswere stained by trypan blue for 8 h and observed under a microscope. Micro-hypersensitive responses are shown as areas stained in blue. Tobacco plants treatedwith CEVP as control. Scale bar = 0.1 mm.

Fig. 4. Microscopic views of H2O2 accumulation in tobacco leaves. Treated leavesharvested 24 h post-treatment with purified PevD1, PevD1�C57 or PevD1�N98

W. Liu et al. / Microbiologic

runcated PevD1 deletion fragments and their abilities to induce HRn tobacco plants were tested and compared with that of wild-typeevD1. Both full-length and series deleted mutant PevD1 fragmentsere generated using conventional PCR protocols with PevD1 as the

emplate. The primers used in the vector construction are listedn Table 1. After confirmed by DNA sequencing, all the gene frag-

ents were excised from pMD 18-T simple vectors by Nco I-EcoR digestion and cloned into the corresponding sites of pET30a(+)ector to generate PevD1, PevD1�C23, PevD1�C47, PevD1�C57,evD1�C88 and PevD1�N98, respectively (Fig. 1A).

.2. All the resulting plasmids mentioned above were transformednto E. coli BL21 (DE3) and induced for protein expression

After analyzed by sodium dodecyl sulfate-polyacrylamide gellectrophoresis (SDS-PAGE), cell-free preparations of wild-typend mutant PevD1 fragments were first tested for their ability tonduce HR in tobacco leaves. As a negative control, cell-free emptyector preparation (CEVP) was similarly prepared from E. coil cellshat only contained the pET30a (+) vector. To consider individualariation between different plants and leaves, the infiltration siteor each sample was taken from the adjacent intercostals areas ofhe same source leaf. As shown in Fig. 1B, PevD1�C23, PevD1�C45nd PevD1�N98 had elicitor activity equivalent to that of theild-type PevD1, however, no HR traces were observed in the pan-

ls infiltrated with PevD1�C57, PevD1�C88 and negative controlEVP. These results indicated that the C-terminal 57 amino acids ofevD1 might critical for the induction of HR in tobacco.

To further confirm the ability of N- and C-terminal fragmentsf PevD1 in induction of HR, His-tagged PevD1, PevD1�C57 andevD1�N98 were expressed in E. coli and the recombinant proteinsere then sequentially purified over a HisTrap HP affinity column, aesource Q column and a Superdex-200 column. High purificationf wild-type, N-terminal 98 amino acid and C-terminal 57 aminocid of PevD1 fragments were harvested and differed sharply inolecular mass on SDS-PAGE (Fig. 2A). HR was tested by infil-

rating leaf intercellular spaces of tobacco plants separately witholutions of these proteins. Both PevD1 and PevD1�N98 elicitedR in tobacco leaves when infiltrated into leaves at a concentrationf 1 �M. However, similar to CEVP, PevD1�C57 failed to induce HR,ven at a concentration of 10 �M (Fig. 2B).

In a parallel experiment, the micro-HR in tobacco leaves corre-ponding to macro-HR was further visualized with Trypan blue,

dye that specifically stains dead cells. As shown in Fig. 3, theevD1�N98 protein induced cell death similar to that inducedy the wild-type PevD1 protein. In contrast, the CEVP control andevD1�C57 resulted in no obvious cell death. These results furtheronfirmed our hypothesis that the C-terminal 57 amino acids ofevD1was responsible for the induction of HR in tobacco.

As reactive oxygen species (ROS) are important components inegulating cell death in the HR with accumulation of H2O2 (Wohlge-uth et al., 2002), the H2O2 production was also monitored in

eaves by staining with 3′3-diaminobenzidine (DAB), a histochem-cal reagent that polymerizes and turns brown in the presencef H2O2. At 8 h post treatment, the effects of infiltration of eacholution protein were evaluated. As shown in Fig. 4, substantial2O2 accumulated in leaf cells following the treatment of PevD1 orevD1�N98 compared with that of PevD1�C57 or CEVP.

The HSR203 and HIN1genes are molecular markers of HR (Liut al., 2006). RT-PCR was conducted to study whether the HR induc-ion was coincident with the gene expression in the treated leavesFig. 6A). With the tobacco Actin gene as a control, the RT-PCR

esults showed that infiltration of PevD1 or PevD1�N98 into theobacco leaves induced accumulation of HSR203 and HIN1 trans-ripts, while leaves treated with CEVP or PevD1�C57 showed noccumulation of these mRNAs.

proteins were infiltrated with a solution of 3,3- diaminobenzidine (DAB) for 8 h andobserved under a microscope. Tissues with H2O2 accumulation are stained in orange.Tobacco plants treated with CEVP as control. Scale bar = 0.1 mm.

3.3. Mapping of PevD1 regions required to induce SAR in tobaccoplants challenged with TMV

Considering fragments PevD1�C57 and PevD1�N98 differedsignificantly in their inductive effects on HR in tobacco, we nexttested the two mutant fragments and wild-type PevD1 for theirfunctions in induction of SAR to TMV in tobacco. On tobacco leaves,numbers and sizes of lesions caused by TMV greatly varied withdifferent treatments, as observed at 3 days after treatment (Fig. 5).There was a clearly enhanced resistance against TMV infectionobserved in the nontreated upper leaves after the lower leavesinjected with PevD1 or PevD1�C57. Relative to the CEVP control,the lesion number and size of leaves treated by PevD1 decreasedby 49.17% and 25.18%, while PevD1�C57 by 42.50% and 21.58%.There was no significant difference in TMV lesion number and sizebetween CEVP- and PevD1�N98-treated plants (Table 2).

Expressions of the tobacco SAR pathway genes NPR1 and PR1a

were also tested in response to treatment with different proteins.RT-PCR analyses, conducted using Actin as a standard, indicatedthat expressions of NPR1 and PR1a in untreated tobacco leaves weremarkedly induced when lower leaves were treated with PevD1 or

480 W. Liu et al. / Microbiological Research 169 (2014) 476–482

Fig. 5. Systemic acquired resistance to TMV infection in PevD1, PevD1�C57 or PevD1�N98 proteins treated tobacco plants. Two primary leaves per plant were infiltratedwith different proteins and systemic leaves were inoculated with TMV 3 d later. SAR leaves were photographed 3 d after inoculation of TMV. Tobacco plants treated withCEVP as control.

F tion po a stan( on of

Pa

4

aa2

TEi

Dms

ig. 6. Expression of HR and SAR marker genes in tobacco leaves. Reverse transcripr for 3 days post treatment from untreated leaves of treated plants, using Actin asA) Expression of HR marker genes HIN1 and HSR203 in tobacco leaves. (B) Expressi

evD1�C57. In contrast, NPR1 and PR1a genes were not detectedfter treatment with CEFV or PevD1�N98 (Fig. 6B).

. Discussion

As an alternative, nonconventional and ecologically friendlypproach for plant protection, elicitors have attracted consider-ble attention and research effort in recent years (Mishra et al.,012). Many beneficial effects, such as resistance to pathogens

able 2ffects of PevD1, PevD1�C57 and PevD1�N98 proteins on number and size of lesionn tobacco leaves inoculated with TMV.

Number of lesions Diameter of lesions (mm) Inhibition (%)

Number ± SE Diameter ± SE (Number/diameter)

CEVP 120 ± 2A 2.78 ± 0.18a 0/0PevD1 61 ± 4B 2.08 ± 0.06b 49.17/25.18PevD1�C57 69 ± 7B 2.18 ± 0.10b 42.50/21.58PevD1�N98 112 ± 7A 2.71 ± 0.20a 6.67/2.52

ata are representative of three replicates and ten plants per replicate. Values areeans ± standard errors. Values with the same letter in the same column are not

tatistically different at 5% significance level.

olymerase chain reaction was done with RNA isolated for 24 h from treated leavesdard control. Experiments were repeated three times and showed similar results.

SAR marker genes NPR1 and PR1a in tobacco leaves.

and pests, stimulation of plant growth and drought tolerance, andimprovement of grain yield could be induced by the application ofelicitors to plants (Chen et al., 2008a; Wang et al., 2012). Mean-while, localized hypersensitive cell death (HCD) that accompaniesthe hypersensitive response (HR) in plants, which increases photo-synthesis and respiration without contributing to plant growth andproductivity, also occurred in response to elicitor treatment (Kimet al., 2004). Studies on structure-function relationships of elicitorsindicated that special regions of elicitor proteins are responsible fordifferent phenotypes elicited by full-length proteins (Wang et al.,2008; Engelhardt et al., 2009). Thus, characterization and under-standing the association between elicitor fragments function andplant response will help to design novel elicitors and facilitate theirbeneficial use in crop protection (Chen et al., 2008b; Che et al.,2011).

We previously reported the isolation of a novel protein elici-tor PevD1 from Verticillium dahliae. Recombinant PevD1 has theability to induce HR and SAR to TMV in tobacco plants (Wanget al., 2012). Analysis of the deduced amino acid sequence sug-

gested that PevD1 does not share significant homology with otherknown proteins, and the detailed mechanisms of HR and SAR induc-tion by PevD1 in tobacco are still unclear. In this study, the abilityof the wild-type and five mutated PveD1 proteins to induce HR

al Res

astp5oHlRFmrFraHeasttsbaoetPe

wawdttFaawttfsa2sHpi

piNiCtiuatstg2a

W. Liu et al. / Microbiologic

nd associated defense responses were investigated. The resultshowed that the N-terminal and C-terminal of PevD1 have dis-inct influence on elicitor activity. Both the partially purified proteinreparation and purified protein test showed that the C-terminal7 amino acids of PevD1 (PevD1�N98) are critical for the inductionf HR in tobacco. Similar to PevD1, both macro-HR and micro-R could be observed after PevD1�N98 infiltrated into tobacco

eaves (Fig. 1B and Fig. 2B). This cell death was accompanied byOS and enhanced expression of HIN1 and HSR203 genes (Fig. 4 andig. 6A). In contrast, the further C-terminal deletion of this frag-ent (PevD1�C57) resulted in the complete loss of the related

esponse in tobacco leaves as that of PevD1�N98 (Fig. 1B andig. 2B). Previous researches indicated that HR induction activityesided in different regions of the elicitors. The 109 N-terminalmino acid residues and 216 C-terminal amino acid residues ofrpZ from Pseudomonas syringae pv. syringae were sufficient tolicit an HR response in tobacco (Alfano et al., 1996). While thective domains for HR elicitation in harpinPsph from Pseudomonasyringae pv. phaseolicola (Lee et al., 2001) and HpaG from Xan-homonas axonopodis pv. glycines (Kim et al., 2004) only reside inhe C-terminal and N-terminal, respectively. Based on the resultshowed in this study, the HR induction activity of PevD1 likely toe resided in the C-terminal 57 amino acids. Furthermore, thereppears to be a positive correlation between the ˛-helical featuref active domains and their HR elicitor activity (Kim et al., 2004; Oht al., 2007; Wang et al., 2008). There is a putative ˛-helical struc-ure of 9 amino acids (H2N 99-YEFALSLYH-107 COOH) involved inevD1�N98, and whether this ˛-helical region is important in HRlicitation still needs to be confirmed.

Although the N-terminal 98 amino acids of PevD1 (PevD1�C57)ere devoid of the HR-inducing activity, this mutation was invari-

bly in induction of SAR to TMV infection in tobacco leaves asild-type PevD1. As shown in Fig. 5 and Table 2, the number andiameter of TMV lesions in SAR leaves of PevD1- and PevD1�C57-reated plants were lower than that of CEVP and PevD1�N98, andhere was no significant difference between CEVP and PevD1�N98.urthermore, the expression of tobacco SAR pathway genes NPR1nd PR1a could be induced strongly in the upper untreated leavesfter treatment with PevD1 and PevD1�C57, while no expressionas observed in the tobacco leaves regardless of whether it was

reated with CEVP or PevD1�N98 (Fig. 6B). These results showedhat the N-terminal of 98 amino acids of PevD1 was responsibleor the induction of SAR against TMV in tobacco plants. Previoustudies showed that the performance of HR and SAR occurred sep-rately and induced by different domains of elicitors (Chen et al.,008a; Wang et al., 2008). The data presented in this study are con-istent with early findings which indicated that the phenotypes ofR and SAR were only induced by the C-terminal or N-terminalortion of PevD1 separately, and the HR (or SAR) induced by PevD1

s not accompanied by the development of SAR (or HR).In summary, the peptide PevD1�N98 from the C-terminal

ortion of PevD1 is an independent functional element for HRnducing in tobacco leaves, while the peptide PevD1�C57 from the-terminal portion retained the ability to induce disease resistance

n tobacco without injuring plants through the development of HR.onsidering the putative deleterious effects of HR on plant growth,he peptide PevD1�C57 might be a better choice than PevD1 forts future practical application. These results further enhance thenderstanding of the structure-function relationships of PevD1nd also provide new possibility of its application in plant pro-ection against infection by pathogens. Besides, previous researchhowed that novel molecules could be generated by combining

he amino acid sequences of two peptides to show the syner-ism of both peptides and be used in plant protection (Che et al.,011). We assumed a chimeric protein consisting of PevD1�C57nd HpaG10–42, which consisting of amino acids 10 to 42 of the

earch 169 (2014) 476–482 481

HpaGXooc from Xanthomonas oryzae pv. oryzicola and has the mostactivity in promoting plant growth and defense (Chen et al., 2008a),might show more defense ability in vitro and in transgenic plants.Such studies are underway in our laboratory.

Acknowledgements

This work was supported by National Hi-Tech Research andDevelopment Program of China (863 Project, 2011AA10A201 and2012AA101504), the Fundamental Research Funds for the CentralUniversities (lzujbky-2013-82) and the National Natural ScienceFoundation of China (31272086). We are grateful to Dr. Zulfi Jahufer(AgResearch Grasslands Research Center, New Zealand) for criticalreview of the manuscript.

References

Alfano JR, Bauer DW, Milos TM, Collmer A. Analysis of the role of the Pseudomonassyringae pv. syringae HrpZ harpin in elicitation of the hypersensitive response intobacco using functionally non-polar hrpZ deletion mutations, truncated HrpZfragments, and hrmA mutations. Molecular Microbiol 1996;19(4):715–28.

Asai T, Tena G, Plotnikova J, Willmann MR, Chiu W, Gomez-Gomez L, et al.MAP kinase signalling cascade in Arabidopsis innate immunity. Nature2002;415(6875):977–83.

Bruce TJ, Pickett JA. Plant defence signalling induced by biotic attacks. Curr OpinPlant Biol 2007;10(4):387–92.

Che YZ, Li YR, Zou HS, Zou LF, Zhang B, Chen GY. A novel antimicrobial protein forplant protection consisting of a Xanthomonas oryzae harpin and active domainsof cecropin A and melittin. Microb Biotechnol 2011;4(6):777–93.

Chen L, Qian J, Qu S, Long J, Yin Q, Zhang C, et al. Identification of specific fragmentsof HpaGXooc, a harpin from Xanthomonas oryzae pv. oryzicola, that induce diseaseresistance and enhance growth in plants. Phytopathology 2008a;98(7):781–91.

Chen L, Zhang S, Zhang S, Qu S, Ren X, Long J, et al. A fragment of the Xanthomonasoryzae pv. oryzicola harpin HpaGXooc reduces disease and increases yield of ricein extensive grower plantings. Phytopathology 2008b;98(7):792–802.

Chen M, Zeng H, Qiu D, Guo L, Yang X, Shi H, et al. Purification and characterizationof a novel hypersensitive response-inducing elicitor from Magnaporthe oryzaethat triggers defense response in rice. PloS ONE 2012;7(5):e37654.

Durrant W, Dong X. Systemic acquired resistance. Annu Rev Phytopathol2004;42:185–209.

Engelhardt S, Lee J, Gäbler Y, Kemmerling B, Haapalainen ML, Li CM, et al. Separa-ble roles of the Pseudomonas syringae pv. phaseolicola accessory protein HrpZ1in ion-conducting pore formation and activation of plant immunity. Plant J2009;57(4):706–17.

Felix G, Duran JD, Volko S, Boller T. Plants have a sensitive perception system for themost conserved domain of bacterial flagellin. Plant J 1999;18(3):265–76.

Fellbrich G, Romanski A, Varet A, Blume B, Brunner F, Engelhardt S, et al. NPP1,a Phytophthora-associated trigger of plant defense in parsley and Arabidopsis.Plant J 2002;32(3):375–90.

Fradin EF, Thomma BP. Physiology and molecular aspects of Verticillium wilt diseasescaused by V. dahliae and V. albo-atrum. Mol Plant Pathol 2006;7(2):71–86.

Halim VA, Hunger A, Macioszek V, Landgraf P, Nürnberger T, Scheel D, et al. Theoligopeptide elicitor Pep-13 induces salicylic acid-dependent and-independentdefense reactions in potato. Physiol Mol Plant P 2004;64(6):311–8.

Kim J, Jeon E, Oh J, Moon JS, Hwang I. Mutational analysis of Xanthomonas harpinHpaG identifies a key functional region that elicits the hypersensitive responsein nonhost plants. J Bacteriol 2004;186(18):6239–47.

Lee J, Klessig DF, Nürnberger T. A harpin binding site in tobacco plasma mem-branes mediates activation of the pathogenesis-related gene HIN1 independentof extracellular calcium but dependent on mitogen-activated protein kinaseactivity. Plant Cell 2001;13(5):1079–93.

Liu F, Liu H, Jia Q, Wu X, Guo X, Zhang S, et al. The internal glycine-rich motif and cys-teine suppress several effects of the HpaGXooc protein in plants. Phytopathology2006;96(10):1052–9.

Mishra AK, Sharma K, Misra RS. Elicitor recognition, signal transduction and inducedresistance in plants. J Plant Interact 2012;7(2):95–120.

Miyata K, Miyashita M, Nose R, Otake Y, Miyagawa H. Development of a colorimetricassay for determining the amount of H2O2 generated in tobacco cells in responseto elicitors and its application to study of the structure-activity relationship offlagellin-derived peptides. Biosci Biotechnol Biochem 2006;70(9):2138–44.

Oh C, Beer SV. AtHIPM, an ortholog of the apple HrpN-interacting protein, is a neg-ative regulator of plant growth and mediates the growth-enhancing effect ofHrpN in Arabidopsis. Plant Physiol 2007;145(2):426–36.

Oh J, Kim J, Jeon E, Yoo C, Moon JS, Rhee S, et al. Amyloidogenesis of

type III-dependent harpins from plant pathogenic bacteria. J Biol Chem2007;282(18):13601–9.

Peng J, Bao Z, Ren H, Wang J, Dong H. Expression of harpinXoo in transgenic tobaccoinduces pathogen defense in the absence of hypersensitive cell death. Phy-topathology 2004;94(10):1048–55.

4 al Res

Q

R

S

S

T

W

82 W. Liu et al. / Microbiologic

iu D, Mao J, Yang X, Zeng H. Expression of an elicitor-encoding gene from Magna-porthe grisea enhances resistance against blast disease in transgenic rice. PlantCell Rep 2009;28(6):925–33.

en X, Liu F, Bao Z, Zhang C, Wu X, Chen L, et al. Root growth of Arabidop-sis thaliana is regulated by ethylene and abscisic acid signaling interaction inresponse to HrpNEa, a bacterial protein of harpin group. Plant Mol Biol Rep2008;26(3):225–40.

ambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd edn NewYork, USA: Cold Spring Harbor Laboratory Press; 2001.

hao M, Wang J, Dean RA, Lin Y, Gao X, Hu S. Expression of a harpin-encodinggene in rice confers durable nonspecific resistance to Magnaporthe grisea. PlantBiotechnol J 2008;6(1):73–81.

akakura Y, CHE FS, Ishida Y, Tsutsumi F, KUROTANI KI, Usami S, et al. Expres-sion of a bacterial flagellin gene triggers plant immune responses and confersdisease resistance in transgenic rice plants. Mol Plant Pathol 2008;9(4):

525–9.

ang B, Yang X, Zeng H, Liu H, Zhou T, Tan B, et al. The purification and characteriza-tion of a novel hypersensitive-like response-inducing elicitor from Verticilliumdahliae that induces resistance responses in tobacco. Appl Environ Microbiol2012;93(1):191–201.

earch 169 (2014) 476–482

Wang J, Cai Y, Gou J, Mao Y, Xu Y, Jiang W, et al. VdNEP, an elicitor fromVerticillium dahliae, induces cotton plant wilting. Appl Environ Microbiol2004;70(8):4989–95.

Wang X, Song C, Miao W, Ji Z, Wang X, Zhang Y, et al. Mutations in the N-terminalcoding region of the harpin protein Hpa1 from Xanthomonas oryzae causeloss of hypersensitive reaction induction in tobacco. Appl Microbiol Biotechnol2008;81(2):359–69.

Wei Z, Laby RJ, Zumoff CH, Bauer DW, He SY, Collmer A, et al. Harpin, elicitor of thehypersensitive response produced by the plant pathogen Erwinia amylovora.Science 1992;257(5066):85.

Yao Z, Rashid KY, Adam LR, Daayf F. Verticillium dahliae’s VdNEP acts both as a plantdefence elicitor and a pathogenicity factor in the interaction with Helianthusannuus. Can J Plant Pathol 2011;33(3):375–88.

Zhang C, Shi H, Chen L, Wang X, Lü B, Zhang S, et al. Harpin-induced expression andtransgenic overexpression of the phloem protein gene AtPP2-A1 in Arabidopsis

repress phloem feeding of the green peach aphid Myzus persicae. BMC Plant Biol2011a;11(1):11.

Zhang L, Xiao S, Li W, Feng W, Li J, Wu Z, et al. Overexpression of a Harpin-encoding gene hrf1 in rice enhances drought tolerance. J Exp Bot 2011b;62(12):4229–38.