Fetal gene therapy of �-thalassemia in a mouse modelXiao-Dong Han*†, Chin Lin*, Judy Chang*, Michel Sadelain‡, and Y. W. Kan*§

*Cardiovascular Research Institute, Institute of Human Genetics and Department of Medicine, University of California, San Francisco, CA 94143;and ‡Memorial Sloan–Kettering Cancer Center, New York, NY 10021

Contributed by Y. W. Kan, April 9, 2007 (sent for review February 15, 2007)

Fetuses with homozygous �-thalassemia usually die at the thirdtrimester of pregnancy or soon after birth. Hence, the disease couldpotentially be a target for fetal gene therapy. We have previouslyestablished a mouse model of �-thalassemia. These mice mimic thehuman �-thalassemic conditions and can be used as preclinicalmodels for fetal gene therapy. We tested a lentiviral vectorcontaining the HS 2, 3, and 4 of the �-LCR, a central polypurine tractelement, and the �-globin gene promoter directing either the EGFPor the human �-globin gene. We showed that the GFP expressionwas erythroid-specific and detected in BFU-E colonies and theerythroid progenies of CFU-GEMM. For in utero gene delivery, wedid yolk sac vessel injection at midgestation of mouse embryos.The recipient mice were analyzed after birth for human �-globingene expression. In the newborn, human �-globin gene expressionwas detected in the liver, spleen, and peripheral blood. The human�-globin gene expression was at the peak at 3–4 months, when itreached 20% in some recipients. However, the expression declinedat 7 months. Colony-forming assays in these mice showed lowabundance of the transduced human �-globin gene in their BFU-Eand CFU-GEMM and the lack of its transcript. Thus, lentiviralvectors can be an effective vehicle for delivering the human�-globin gene into erythroid cells in utero, but, in the mousemodel, delivery at late midgestation could not transduce hemato-poietic stem cells adequately to sustain gene expression.

in utero gene transfer � lentiviral vector � yolk sac vessel injection

The human �-globin genes are duplicated, and four copiesof �-globin genes are present in the diploid genome.

�-Thalassemia is a hereditary disorder caused by deficient orabsent production of �-globin. �-Globin gene mutation fre-quency is high among many populations, and the severe form hasthe highest prevalence in Southeast Asia. Hydrops fetalis asso-ciated with hemoglobin Bart syndrome is caused by completeabsence of �-globin and is usually not compatible with postnatallife. Hemoglobin H disease, caused by a deletion and/or muta-tion affecting three of the �-globin genes, results in hemolyticanemia of variable severity. The prenatal genetic diagnosis for�-thalassemia has been clinically available for many years (1). Afew patients with homozygous �-thalassemia have survived byearly and regular blood transfusions (2–6), and hemoglobin Hdisease is usually treated symptomatically.

Recombinant lentiviral vectors have been shown to be effec-tive in transducing nondividing hematopoietic stem cells (7–10).By using lentiviral vectors carrying the �-globin transcriptionunits and ex vivo transduction, therapeutic �-hemoglobin syn-thesis has been demonstrated in �-thalassemic mice (11)) as wellas the antisickling capability of the �-globin variant in a trans-genic mouse model of sickle cell disease (12).

Direct in vivo delivery of the therapeutic viral vector has beenshown in animal models to be an effective alternative to the ex vivoapproach (13, 14). Particularly, direct in utero viral vector transferhas been demonstrated to result in widespread transduction andlong-term correction of transduced genes in animal models ofhuman genetic diseases such as lysosomal storage disease, Crigler–Najjar disease, and Duchenne muscular dystrophy (15–17).

In this study, we investigated the efficacy of direct in uterodelivery of a lentiviral-based human a-globin gene to a mousemodel of �-thalassemia. We demonstrated erythroid specific

expression of the transduced human �-globin gene and relativelyhigh levels of expression of the human �-globin gene in micereceiving the lentiviral vector by yolk sac vessel injection atmidgestation. However, the expression decreased to low levelson long-term follow up.

ResultsLentiviral Vector Construction. The lentiviral vector used in thisstudy was derived from a TNS9 vector (11), which contains anextended �-promoter, �-proximal enhancers, and genomic frag-ments of the human �-globin control region, HS2, HS3, and HS4.This vector has been shown in ex vivo transduction experimentsto be effective in transferring the therapeutic human �-globingene into murine hematopoietic stem cells (11, 18–20). Allelements in the original vector remained except for the replace-ment of the �-globin gene with either the human �-globin geneor the cDNA-encoding GFP (Fig. 1A). Southern blot analysis ofgenomic DNA from infected mouse erythroleukemia (MEL)cells showed a single band corresponding to the intact proviralvector (Fig. 1B).

Erythroid-Specific Expression of GFP. To evaluate whether geneexpression from these lentiviral vectors are erythroid-specific, K562and MEL cells were infected with the viral supernatant of dANS9-cppt-egfp. GFP expression was detected when these cells wereinduced toward erythroid differentiation (Fig. 2A), whereas noexpression was detected in infected 293 cells (data not shown).When this vector was used to infect primary murine bone marrowcells, GFP expression was detected in BFU-E colonies or erythroidlineage of CFU-GEMM colonies, but not in cells of other lineagesderived from the same progenitors (Fig. 2B).

Direct Delivery of the Lentiviral Vectors into Fetuses by Yolk SacVessel Injection. Direct administration of the therapeutic viralvectors into the fetus can eliminate multiple manipulating stepsassociated with ex vivo gene transfer. Therefore, a modified yolksac vessel injection protocol was used in this study to deliver theviral vector systematically into the fetuses (21, 22). By injectingTrypan blue dye as tracer, we could see blue color appearingwithin seconds in the fetal circulation. Fig. 3 shows the site ofinjection (Left), followed immediately by the appearance of thedye in the yolk sac vessels (Center). They can be distinguishedfrom the uterine wall vessels, which were not stained blue. Inaddition, the dye was concentrated in the liver as shown by thehigh dye intensity in its location (Right). This is important fortargeting hematopoietic progenitors because the fetal liver is amajor site for hematopoietic stem cell homing and development.

Author contributions: X.-D.H. and Y.W.K. designed research; X.-D.H. and C.L. performedresearch; J.C. and M.S. contributed new reagents/analytic tools; X.-D.H., M.S., and Y.W.K.analyzed data; and X.-D.H. and Y.W.K. wrote the paper.

The authors declare no conflict of interest.

Abbreviations: cppt, central polypurine tract; MEL, mouse erythroleukemia.

†Present address: ViroMed Laboratories, 6101 Blue Circle Drive, Minnetonka, MN 55343.

§To whom correspondence should be addressed at: Institute of Human Genetics, 513Parnassus Avenue, HSW 901B, University of California, San Francisco, CA 94143-0793.E-mail: yw.kan@ucsf.edu.

© 2007 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0702457104 PNAS � May 22, 2007 � vol. 104 � no. 21 � 9007–9011

MED

ICA

LSC

IEN

CES

Dow

nloa

ded

by g

uest

on

June

13,

202

0

In the mouse, fetal liver erythropoiesis starts from day 11,progressing to around day 14, when the erythroblastic islands areestablished (23). Although it would be preferable to target thefetal liver during the early part of this period when it is relativelyricher in hematopoietic stem cells (24), we injected on day 14.5because of technical difficulties and the high mortality associatedwith earlier injections.

Efficacy of Gene Transfer. To investigate the effectiveness of genetransfer of the dANS9-cppt-egfp and dANS9-cppt-ha vectors viayolk sac vessel injection, we analyzed the transgene expression innewborn recipient mice. GFP expression was detected in spleenfor dANS9-cppt-egfp (Fig. 4A) and human a-globin specifictranscripts in liver for dANS9-cppt-h� (Fig. 4B).

Long-Term Expression of Erythroid-Specific Lentiviral Vectors. Primerextension analysis was performed to measure the transgeneexpression relative to the endogenous mouse �-globin geneexpression in peripheral blood at different time points after birth(Fig. 5A). Expression of the transduced human �-globin genewas detectable at �70 days and reached peak levels at 130 daysafter birth, indicating the expansion of the targeted erythroidprogenitors. The human �-globin transcript was expressed at alevel equal to 20% of the mouse �-globin transcript in onemouse. However, in all of the mice, expression declined to thelow level of 5% or less in recipient’s peripheral blood 7 monthsafter birth (Fig. 5B).

Possible Reason for the Decline in Transgene Expression. We har-vested bone marrows from two of the mice that had shown adecline in �-globin gene expression and cultured BFU-E andCFU-Emix from them. Fifty-five individual colonies were ana-lyzed for the human �-globin DNA by PCR and for the presenceof human and mouse �-globin mRNA by RT-PCR. Twenty-fourof these colonies were also cultured in the presence of5-azacytidine (Table 1). Human �-globin DNA was found in only6 of these 55 colonies, and �-globin transcripts were found innone, with or without 5-azacytidine. In contrast, mouse �-globinmRNA was detected in 49 of these colonies, showing that theRNA prepared from them were of good quality. Hence, thedecline in gene expression could be due to the loss of cells thatcontained the human �-globin transgene and to the silencing orlevel too low to be detected in the few that retained thetransgene.

DiscussionIn this study, we investigated the approach of intrauterinetherapy for �-thalassemia in an �-globin gene knockout mousemodel that we have constructed (25). Homozygous �-thalasse-mia appears to be a good candidate for intrauterine gene therapybecause prenatal diagnosis can be made by DNA analysis earlyin pregnancy, and the homozygously affected fetuses oftensurvive up to the third trimester of pregnancy or to birth.Although several newborns with this disease survived when they

Fig. 1. Structures and integration of the lentiviral vectors. (A) Exons and introns of the human �-globin gene are represented by filled and open boxesrespectively and GFP coding region by the hatched box. The splice donor (SD) and acceptor (SA), the packaging sequence (�), and rev-response element (RRE),DNase hypersensitive sites (HS), human �-globin promoter (P), and 3� �-globin enhancer (E) are derived from the lentiviral vector, TNS9 [11]. The inverted triangleindicates the 3� LTR deletion and cppt central polypurine tract. (B) Southern blot analysis of transduced MEL cells. Genomic DNA of MEL cells infected withdANS9-cppt-h� vector was digested with restriction enzyme SacI and hybridized with the human �-globin probe. The upper band represents the expected sizefor the proviral vector, and the lower band was due to cross hybridization with the endogenous mouse �-globin gene. The �/HindIII DNA molecular markers areindicated in kilobases.

Fig. 2. Expression of GFP in vitro transduction studies. (A) Erythroid cell linesK562 and MEL were infected with the lentiviral vector dANS9-cppt-egfpfollowed by induction for 5 days with HMBA for MEL cells and Hemin for K562cells. (B) Mouse bone marrow cells were infected with the lentiviral vectordANS9-cppt-egfp and cultured in complete methylcellulose medium supple-mented with IL-3, IL-6, SCF, and erythropoietin for 10 days. Green fluorescencewas detected under fluorescent microscope. GFP-positive cells were observedin CFU-Emix (Left) and BFU-E (Right). Images with UV light (Upper) and visibleand UV light (Lower) are shown. The arrows indicate the nonerythroid colonythat was negative for GFP.

9008 � www.pnas.org�cgi�doi�10.1073�pnas.0702457104 Han et al.

Dow

nloa

ded

by g

uest

on

June

13,

202

0

received transfusion prenatally or immediately after birth, theanemia is invariably severe, and they invariable require regulartransfusion beginning from birth. Thus, the disease is moresevere than �-thalassemia, where the clinical manifestation ismuch more variable, with some patients having the less severeintermediate form. Even those who require transfusion may notneed it until a few months or a few years of age. Successfulintrauterine gene therapy in �-thalassemia would thereforeobviate subsequent transfusion.

Using a dye as a marker, we showed that injection into the yolksac vein resulted in concentration of the dye in the liver. Van derWegen et al. (26) reported the successful treatment of UDP-glucuronosyltransferase deficiency in a rat model of Crigler–Najjar disease by using a liver-specific lentiviral vector. Targetingthe liver is a distinct advantage for treating globin disordersbecause the fetal liver is a hematopoietic organ. However, somevectors will also be expected to reach the systemic circulation.

Hence, the use of erythroid-specific promoters and enhancers isdesirable. Lentiviral vectors were chosen to deliver the GFP andthe �-globin genes because they could transduce hematopoieticcells efficiently and were successful in treating mouse models of�-thalassemia and sickle cell anemia by ex vivo transduction ofhematopoietic cells. Indeed, we also found that our vectorspecifically expressed GFP in erythroid cell lines and in ery-throid colonies cultured from mouse bone marrow cells.

The �-globin gene we used was controlled by the �-LCRbecause such a construct has been shown to express the �-globinefficiently in transgenic mice (27). Control by the �-globinelements would also be expected to maintain gene expressioninto postnatal life. Intrauterine injection resulted in expressionof the �-globin gene at birth and reached a peak of up to 20%

Fig. 3. In utero delivery of lentiviral vector by yolk vessel injection. (Left) Needle insertion site. (Center) Dye in yolk sac vessel after injection. ysv, yolk sac vessel;uwv, uterine wall vessel. (Right) Concentration of the dye in fetal liver after injection.

Fig. 4. Gene expression in the newborn mice after in utero lentiviralinjection. (A) GFP expression in frozen section of the spleen after injection ofdANS9-cppt-egfp. (B) Human �-globin RNA detection in the liver. Digestion ofthe 350-bp human �-globin RT-PCR product with Pml 1 yields 180- and 170-bpbands and with HindIII 230/120-bp bands. The left side shows injected new-born mouse liver, and the right side shows human fetal liver control. U,undigested; H, HindIII; P, Pml I.

Fig. 5. Primer extension analysis of human �-globin gene expression in threerecipient mice. Total RNA was prepared from peripheral blood at 70 days (lanea), 90 days (lane b), 130 days (lane c), and 210 days (lane d) after birth. c1 andc2 are positive (human fetal liver) and negative (uninjected mouse) controlsrespectively. (A) Autoradiography. (B) Human � globin mRNA relative to totalhuman and mouse �-globin mRNA determined by PhosphorImager.

Han et al. PNAS � May 22, 2007 � vol. 104 � no. 21 � 9009

MED

ICA

LSC

IEN

CES

Dow

nloa

ded

by g

uest

on

June

13,

202

0

in some mice at �3–4 months. However, the level of expressiondeclined to �5% at approximately the seventh month. Thedecline could be due to several factors. Very few erythroidcolonies cultured from the bone marrow of the mice after their�-globin expression has declined contained the �-globin trans-gene. This suggests that the decline may be due to the loss of thetransgene as a result of the inadequate transduction of hema-topoietic stem cells, and most of the transduced cells were laterprogenitors. Because of technical difficulty and the high mor-tality rate, delivery of the lentiviral vectors close to day 14.5 ofgestation and not to day 11 may account for the transduction ofthe later progenitor cells. Unlike effective fetal treatment ofmetabolic diseases, where the liver cell could be targeted duringmost of the duration of pregnancy, treatment of hematopoieticdisorders may have a much narrower window for effectivehematopoietic stem cell targeting. Our inability to detect human�-globin mRNA in the few human �-globin gene-containingcolonies may be due to the low level of the transcripts or to genesilencing that cannot be reactivated by demethylating agents.

In summary, we demonstrated the erythroid-specific expres-sion of the human �-globin gene after the lentiviral-based vectordelivery at midgestation by yolk sac vessel injection. However,the expression declined at 7 months. The decline may be due tothe inability to transduce early hematopoietic stem cells bydelivery at 14.5 days of gestation or to gene silencing. Larger-animal models in which the fetal circulation can be accessedearlier may well be used to test the efficacy of in vivo lentiviraltransduction of hematopoietic stem cells.

Materials and MethodsConstruction of the Lentiviral Vectors. The human �-globin genefragment spanning NcoI and PstI sites was used to replace the�-globin gene in the lentiviral vector TNS9 (11). The centralpolypurine tract (cppt) fragment was amplified from the pol regionof the packaging vector pCMV-�8.9 (14) and inserted into ClaI andHapI sites downstream of the 3� �-enhancer. The primers used forthe cppt fragment amplification were as follow: cppt-5-HpaI,TCGCGTTAACTTTTAAAAGAAAAGGGGGG and cppt-3-ClaI, AAGCTTATCGATAAAATTTTGAATTTTTGTAA-TTTG. The orientation of cppt was checked by sequencing. Sub-sequently, the human �-globin gene in the resulting vectors,dANS9-cppt-h�, was replaced with the EGFP gene fragment frompIRES-EGFP (Clontech, Mountain View, CA) to make the controlvector dANS9-cppt-egfp.

Production and Purification of Lentiviral Vector. The vector, dANS9-cppt-h� or dANS9-cppt-egfp, was cotransfected with pCMV�R8.9 (14) and pMD.G (28) into human embryonic kidney cells293FT as described (8). Briefly, 6 � 108 of 293FT cells in 750 mlof DMEM containing 10% FBS (D10F) were plated into apolylysine-precoated cell factory unit (Nalge Nunc Interna-tional, Rochester, NY) and transfected the next day with 580 �gof dANS9-cppt-h� or dANS9-cppt-egfp, 430 �g of pCMV�R8.9,and 145 �g of pMD.G in a 5% CO2 incubator at 37°C for 24 h.After the transfection medium was removed, the cells werewashed once with DMEM, and the transfected cells wereincubated for another 24 h in fresh D10F supplemented with 10mM sodium butyrate (Sigma, St. Louis, MO) and 20 mM Hepes.

The cells were washed twice with DMEM and incubated with 450ml of DMEM containing 5% FBS and 20 mM Hepes for virusproduction. The viral supernatants were collected on threeconsecutive days, spun at 3,500 rpm [RC-3B; Sorvall (Newtown,CT) at 4°C for 10 min and filtered through a 0.45-�m low-protein-binding filter (Millipore, Bedford, MA)]. The viral su-pernatant was concentrated by two rounds of ultracentrifugationat 25,000 rpm, 15°C for 100 min in a SW32Ti rotor in OptimaL-90K Ultracentrifuge (Beckman, Fullerton, CA). The final viralpellet was resuspended in 1 ml of saline containing 4 �g/mlPolybrene and stored at �80°C until use.

Virus titer was determined by a p24 antigen ELISA, followingthe manufacturer’s instructions (ZeptoMetrix, Buffalo, NY).The number of erythroid-specific infectious viral particles wasdetermined by infecting MEL cells with dANS9-cppt-egfp len-tiviral vector, followed by induction for 4–5 days with 5 mMN,N�-hexamethylene bisacetamid (HMBA; Sigma).

Cell Lines and CFU Assay. MEL and K562 cells were carried inRPMI medium 1640 containing 10% of FCS. For infection, cellswere incubated with the viral solution containing 10 �g/ml ofPolybrene for 4–6 h, followed by induction for 5 days withHMBA for MEL cells and hemin for K562 cells, respectively.Bone marrow cells were prepared from the �-globin geneknockout mice and infected overnight with the viral solution inthe presence of 10 �g/ml Polybrene and plated into completemethylcellulose medium containing IL-3, IL-6, SCF, and eryth-ropoietin (M3434; StemCell Technologies, Vancouver, BC, Can-ada). The colonies were scored after 10 days of incubation.

CFUs were similarly prepared from the bone marrow of twoof the injected mice that had a decline of �-globin expressionafter 7 months. Half of the cultures was incubated in the presenceof 5 �M 5-azacytidine (Sigma). After 12 days, cells from anindividual BFU-E or CFU-Emix colony were transferred to a2-ml tube containing ULTRASPEC RNA solution, and totalRNA and DNA were isolated according to the manufacturer’sinstruction and DNA and RNA determined as described.

Southern Blot Analysis. Genomic DNA was isolated from infectedMEL cells by proteinase K digestion and sodium chloride precip-itation. Ten micrograms of DNA were digested with ScaI, electro-phoresed on a 1% agarose gel, transferred to a Hybond-n �membrane (Amersham Biosciences, Piscataway, NJ), and hybrid-ized to a digoxigenin-labeled human �-globin probe at 65°C in 0.5Msodium phosphate buffer and 6% SDS. After washing at 65°C, thehybridized products were detected by chemiluminescence by usingan antidigoxigenin alkaline phosphatase conjugate and the CSPDsubstrate (Roche, Indianapolis, IN).

Animal Model and Yolk Sac Vessel Injection. The �-globin knockoutmice were produced as described (25). The heterozygous (��/��) females were bred with the homozygous (��/��) males.Pregnant mice at day 14.5 of gestation were anesthetized by i.p.injection of 0.1 ml of 2.4% tribromoethanol (Sigma–Aldrich) per10 g of body weight. A midline laparotomy (1–1.5 cm) wasperformed to expose horns of the gravid uteri. The yolk sacvessels of individual embryos were visualized under a dissectingmicroscope. The injection was done by inserting a glass needle(70–80 �m) attaching to a Hamilton microliter syringe. Injectionvolume was controlled through a PB600–1 repeating dispenser(Hamilton, Reno, NV). Ten to 15 �l of lentiviral vector equiv-alent to 5 � 105 to 1 � 106 infectious viral particles was injectedinto each embryo. After injection, the uteri were returned to theabdominal cavity and the abdomen was closed with 4–0 silksuture. The mice were allowed to recover in a warm cage. Allanimal experiments were carried out according to the institu-tional guidelines for animal use.

Table 1. Number of CFUs assayed for human �-globin transgeneand mRNA and mouse mRNA

5-aza n h DNA h RNA m RNA

� 24 2 0 22� 31 4 0 27Total 55 6 0 49

9010 � www.pnas.org�cgi�doi�10.1073�pnas.0702457104 Han et al.

Dow

nloa

ded

by g

uest

on

June

13,

202

0

RT-PCR Analysis. Peripheral blood samples or tissues were lysed inULTRASPEC RNA solution (Bioteck Laboratories, Houston,TX), and total RNA was isolated, following the manufacturer’sinstructions. For RT-PCR, cDNA was synthesized from 1 �g oftotal RNA in 10 �l of RT buffer containing 5 mM dNTP, 10 �Moligo d(T), 10 units of RNase inhibitor, and 2 units of M-MLVreverse transcriptase at 37°C for 50 min, followed by 70°C for 15min. PCR was carried out by using the following primers:H�660�: 5�-TAAGGTCGGCGCGCACGCTGGC andH�1266-: AAGCCAGGAACTTGTCCAGG. The reactionswere first denatured at 94°C for 5 min, followed by 40 cycles of94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30seconds. The final extension was carried out at 72°C for 5 min.The PCR products were digested with restriction enzyme Pml Ior HindIII and analyzed by electrophoresis on 2% agarose gel.

Primer Extension Analysis. A primer extension assay was done byusing the AMV Reverse Transcription Primer Extension Sys-tem (Promega, Madison, WI) with �-[32P]ATP-labeled prim-ers as the following: m�-98 5�-AGCAGCCTTCTCAGCAT-CAG, resulting in a 98-nt band for mouse �-globin; m�-535�-TGATGTCTGTTTCTGGGGTTGTG; h�-82 5�-CGTTG-GTCTTGTCGGCAGGAAAC. The labeled primers were an-nealed to 1 �g of total RNA, and the reaction was carriedour according the manufacturer’s instruction. The intensity ofradioactive bands was determined with PhosphorImageranalysis.

We thank Hao He (Memorial Sloan–Kettering Cancer Center) for theTNS9 human �-globin vector. This work was partially supported byNational Institutes of Health Grants DK016666 and HL053762.

1. Kan YW, Golbus MS, Dozy AM (1976) N Engl J Med 295:1165–1167.2. Thornley I, Lehmann L, Ferguson WS, Davis I, Forman EN, Guinan EC (2003)

Bone Marrow Transplant 32:341–342.3. Zhou X, Ha SY, Chan GC, Luk CW, Chan V, Hawkins B, Lam YH, Liang RH,

Lau YL (2001) Bone Marrow Transplant 28:105–107.4. Beaudry MA, Ferguson DJ, Pearse K, Yanofsky RA, Rubin EM, Kan YW

(1986) J Pediatr 108:713–716.5. Bianchi DW, Beyer EC, Stark AR, Saffan D, Sachs BP, Wolfe L (1986) J Pediatr

108:716–718.6. Chik KW, Shing MM, Li CK, Leung TF, Tsang KS, Yuen HL, Cheng SB, Yuen

PM (1998) J Pediatr 132:1039–1042.7. Uchida N, Sutton RE, Friera AM, He D, Reitsma MJ, Chang WC, Veres G,

Scollay R, Weissman IL (1998) Proc Natl Acad Sci USA 95:11939–11944.8. Miyoshi H, Smith KA, Mosier DE, Verma IM, Torbett BE (1999) Science

283:682–686.9. Case SS, Price MA, Jordan CT, Yu XJ, Wang L, Bauer G, Haas DL, Xu D,

Stripecke R, Naldini L, et al. (1999) Proc Natl Acad Sci USA 96:2988–2993.10. Evans JT, Kelly PF, O’Neill E, Garcia JV (1999) Hum Gene Ther 10:1479–1489.11. May C, Rivella S, Callegari J, Heller G, Gaensler KM, Luzzatto L, Sadelain M

(2000) Nature 406:82–86.12. Pawliuk R, Westerman KA, Fabry ME, Payen E, Tighe R, Bouhassira EE,

Acharya SA, Ellis J, London IM, Eaves CJ, et al. (2001) Science 294:2368–2371.13. Naldini L, Blomer U, Gage FH, Trono D, Verma IM (1996) Proc Natl Acad

Sci USA 93:11382–11388.14. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D (1997) Nat Biotechnol

15:871–875.

15. Shen JS, Meng XL, Maeda H, Ohashi T, Eto Y (2004) J Gene Med 6:1206–1215.16. Seppen J, van der Rijt R, Looije N, van Til NP, Lamers WH, Oude Elferink

RP (2003) Mol Ther 8:593–599.17. Gregory LG, Waddington SN, Holder MV, Mitrophanous KA, Buckley SM,

Mosley KL, Bigger BW, Ellard FM, Walmsley LE, Lawrence L, et al. (2004)Gene Ther 11:1117–1125.

18. May C, Rivella S, Chadburn A, Sadelain M (2002) Blood 99:1902–1908.19. Rivella S, May C, Chadburn A, Riviere I, Sadelain M (2003) Blood 101:2932–

2939.20. Samakoglu S, Lisowski L, Budak-Alpdogan T, Usachenko Y, Acuto S, Di

Marzo R, Maggio A, Zhu P, Tisdale JF, Riviere I, Sadelain M (2006) NatBiotechnol 24:89–94.

21. Waddington SN, Mitrophanous KA, Ellard FM, Buckley SM, Nivsarkar M,Lawrence L, Cook HT, Al-Allaf F, Bigger B, Kingsman SM, et al. (2003) GeneTher 10:1234–1240.

22. Schachtner S, Buck C, Bergelson J, Baldwin H (1999) Gene Ther 6:1249–1257.23. Sasaki K, Iwatsuki H (1997) Microsc Res Tech 39:398–405.24. Moore MA, Metcalf D (1970) Br J Haematol 18:279–296.25. Chang J, Lu RH, Xu SM, Meneses J, Chan K, Pedersen R, Kan YW (1996)

Blood 88:1846–1851.26. van der Wegen P, Louwen R, Imam AM, Buijs-Offerman RM, Sinaasappel M,

Grosveld F, Scholte BJ (2006) Mol Ther 13:374–381.27. Albitar M, Katsumata M, Liebhaber SA (1991) Mol Cell Biol 11:3786–3794.28. Ory DS, Neugeboren BA, Mulligan RC (1996) Proc Natl Acad Sci USA

93:11400–11406.

Han et al. PNAS � May 22, 2007 � vol. 104 � no. 21 � 9011

MED

ICA

LSC

IEN

CES

Dow

nloa

ded

by g

uest

on

June

13,

202

0