eastern shore real estate guide

16
MARYLAND’S EASTERN SHORE Featuring: Kent, Queen Anne’s, Talbot, Caroline, Dorchester, Wicomico & Somerset Counties DETAILS ON THIS PROPERTY Sharon Real Estate 410/228-2525 Sharon Spedden Johnston Located on Page 3 FOR ADVERTISING INFORMATION Call: 410/213-9200 Toll Free 877/213-9220 [email protected] Vol. 01 : No. 06 YOUR RESOURCE FOR BUYING AND SELLING ON THE SHORE REALESTATE guide eastern shore’s

Upload: lynch-printing-llc

Post on 10-Mar-2016

221 views

Category:

Documents


4 download

DESCRIPTION

Vol. 1 Issue 6

TRANSCRIPT

Page 1: Eastern Shore Real Estate Guide

MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,

Talbot, Caroline, Dorchester, Wicomico & Somerset Counties

DETAILS ON THIS PROPERTY Sharon Real Estate 410/228-2525Sharon Spedden JohnstonLocated on Page 3

FOR ADVERTISING INFORMATIONCall: 410/213-9200Toll Free 877/[email protected]

Vol. 01 : No. 06

YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g

uid

e

eastern shore’s

ESREG.01.06.indd 1 5/10/11 10:56:34 AM

Page 2: Eastern Shore Real Estate Guide

Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 06

www.sharonre.com [email protected]

Penny M. WindsorRhonda Richardson Carol L. Wolf

THE BEST FOR THE $$$ - This solid built 3 bedroom, 2 bath home offers full basement, attic, living room, dining room, breakfast area and enclosed porch. Charming floor plan. New super efficient heating system. Located on double lot with off-street parking and garage. $119,000.00 DO7556713

SACRIFICING - This 5 bedroom Victorian due to the economy. Painstakingly restored, this beautiful home offers all new kitchen, baths, butlers pantry, wrap around porch, plumbing, electrical, landscaping and more. $458,000.00 DO7547400

OWNER FINANCING AVAILABLE - Private beach overlooking the Choptank River. Cape Cod features 3 bedrooms, 2 baths and large deck off back of house with gorgeous waterviews. $530,000.00 DO7547927

1ST FLOOR WATERVIEW CONDO – Located in Cambridge’s Historic District near Yacht Club and Long Wharf. Affordable boat dockage across the street from this 2 bedroom unit. Walking distance to downtown. $78,500.00 DO7568374

BUILD YOUR DREAM HOME – Enjoy country living at it’s best. Fishing, crabbing and boating. Beautiful sunsets overlooking Barren Island. Priced to sell at $36,000.00 DO7543249

BEST WATERFRONT VIEWS – Watch the boat races and fireworks from your front yard or front screened porch. Hardwood floors throughout this 3 bedroom house with fireplace. Cement drive and detached garage. $549,900.00 DO7462999 MAkE OFFER

REDUCED

REDUCED

REDUCED

REDUCED

REDUCED

REDUCED

ESREG.01.06.indd 2 5/10/11 10:57:00 AM

Page 3: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 3

WATERFRONT FARMETTE – 20+ acres with over 1200 ft. of shoreline and lovely 3 bedroom, 1-1/2 bath home with stocked fresh water pond and 2 car detached garage. Excellent hunting, boating and wildlife. $595,000.00 iNcludEs AddiTiONAl hOMEsiTE dO7587144

BEAuTiFul cusTOM BuilT hOME – Country location with 2.59 acres of privacy. Spacious 4 bedroom home with solid brick foundation, wrap around porch, rear deck, 2 car attached plus 2 car detached garage. Quality throughout. $319,900.00

TAKE A lOOK – Completely remodeled inside and out, this 3 bedroom, 2 bath home is practically brand new. New windows, siding, roof, kitchen, baths, HVAC and more. Great location, big yard and near YMCA. $139,000.00

MOVE-iN REAdY – Fully applianced kitchen and laundry room, 3 bedrooms and 2 baths. Spacious living room with wood burning fireplace, new roof, shutters and hot water heater. Paved driveway, shed and landscaped for privacy overlooking farm fields. Conveniently located for work commute to Easton, Federalsburg, Seaford, Cambridge or Salisbury. $99,000.00 dO7580783

OVERlOOKEd – This terrific 3 bedroom, 2 bath home has been overlooked by the market. Gorgeous floor plan with 1st floor bedroom and bath. New windows, remodeled kitchen, off-street parking, garage and more. $199,999.00 dO7537228

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 06 - Page 3

[email protected]

Penny M. WindsorRhonda Richardson Carol L. Wolf

NEW LISTING

ESREG.01.06.indd 3 5/10/11 10:57:21 AM

Page 4: Eastern Shore Real Estate Guide

Page 4 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06

ON THE COVER

For additional information on thislisting, from this realtor see page 3 or contact:

BEAUTIFUL CUSTOM BUILT HOME –

Country location with 2.59 acres of privacy. Spacious 4 bedroom home with solid brick foundation, wrap around porch, rear deck, 2 car attached plus 2 car detached garage. Quality throughout. $319,900.00

1 Vol. 1 Issue No. 1 - Please saw you saw us in the Eastern Shore Home Improvement Guide

Who Should I Ask For: Specialty:

What Licenses Do You Have:

Service Area: When Were You Established:

What Are Your Hours:

email: web:

Vol. 1 Issue 1

Improving & EnhancingYour Home on the Shore

Hardscapes Perfection443.443.4444 | Page 15

www.ShoreHomeGuide.com

2. Here is Where

7. Business Categories

12. Featured in Each Issue

16. Would be Listed

MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,

Talbot, Caroline, Dorchester, Wicomico & Somerset Counties

DETAILS ON THIS PROPERTY Sharon Real Estate 443/553-4984Sharon Spedden JohnstonLocated on Page 3

FOR ADVERTISING INFORMATIONCall: 410/213-9200Toll Free 877/[email protected]

Vol. 01 : No. 06

YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g

uid

e

eastern shore’s Be sure to pick up BOTH publications!

Eastern Shore’s Real Estate Guide

to help you fi nd a REALTOR® or a home, and Eastern Shore’s Home Improvement Guide

to help you fi nd local business to improve your new home, or boost your

exisiting home’s value!

With over 25,000 publications distributed over the entire Eastern Shore, whether you are a home owner looking to buy or sell, a REALTOR® looking to gain exposure, or a home improvement business looking to

target clients, both of these publications are here for you!

For advertising information in Eastern Shore Resort Real Estate Guide

contact:

Katie DavisToll Free: 1-877-213-9220

Offi ce: 410-213-9200Fax: 410-213-9240

Email: [email protected]

Next Ad Submission DeadlineMay 27th, 2011

Next Book DistributedJune 16th, 2011

Want to see your home advertised in this magazine? Contact any of the real estate

professionals in this magazine.

“All real estate advertised herein is subject to the Federal Fair Housing Act which makes it illegal to advertise any preference, limitations, or discrimination based on race, color, religion, sex,

handicap, familial status, or national origin, or intention to make any such preferences, limitation, or discrimination. We will not knowingly accept any advertising for real estate which is in violation of the law. All persons are hereby informed that all dwellings advertised are available on an equalopportunity basis.”

gui

deREALESTATE

eastern shore resort

Sharon Real EstateSharon Spedden JohnstonOffi ce: [email protected]

ESREG.01.06.indd 4 5/10/11 10:57:46 AM

Page 5: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 - Page 5

Kelly MacomberCell: 443-553-4984

Offi ce: 410-641-8550www.sunshinepropinc.com

Sunshine Properties, Inc.61 Quarter Staff Place • Berlin, MD 21811

AN ENTERTAINER’S DELIGHT! Welcome to this magnifi cent waterfront estate property of over fi ve acres. The home and grounds area true respite. Highlights are many both inside and out. The home features a brick and stone front with dramatic roof lines, a well thought-out interior, and gorgeous rooms throughout. The main level is spacious and includes formal living and dining rooms, large open kitchen with table area, family room, game (or lounge) room, and a master suite. The upper level has four bedrooms and over three full baths with a spectacular theatre/media room. The exterior has it all! Private resort

setting, yard, patio, pier to dock, large pool, hot tub, deck, porches, and more!

Priced to sell at $1,499,000! Call Kelly Macomber today for your appointment to see this stunning home!

Visit this home online at www.MR4.View24Hours.com

Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 - Page 5

ESREG.01.06.indd 5 5/10/11 10:58:52 AM

Page 6: Eastern Shore Real Estate Guide

Page 6 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 Page 6 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06

$15,000 GRANT FOR BUYER * Available through SNHS* $95,000 (www.LNF.com\470074)* 4BR/2BA classic; 1954 Sq. Ft.* Move in ready - nicely updated* 9’ Ceilings; W-U Attic; Bsmt* C. Air; DOUBLE LOT

Looking for a cute & cozy 2 BR gem w/ C. Air that could easily become a 3BR sparkler? Its 1400 sq. ft. make each of the rooms look and feel LARGE. The over-sized garage interior is fi nished. Nice corner lot. Move in ready! $120,000 (472139) Call Nancy Althaus 410-726-6080

280’ ON WICOMICO RIVERThis is a once in a lifetime op-portunity to own WATERFRONT! The vintage 2 BR/2BA cottage w/ C. Air has all rooms facing the water! Awesome FLA Room; aweome location; awesome price: $195,000 (471979) Call Nancy Althaus 410-726-6080

$15,000 GRANT FOR BUYER * Available through SNHS* NOW $70,950 * (www.LNF.com\465412)* 4BR/1.5BA cutie; 1848 Sq. Ft.* New Roof & Zone Central Air* Walk-up Attic; Basement* Fenced Yd w/Koi Pond

$15,000 GRANT FOR BUYER * Available through SNHS* $162,000 (www.LNF.com\470558)* 4BR/2BA gem; 1952 Sq. Ft.* Fireplace; beautiful HW fl oors* 3 Season Porch; brick Patio* Fenced DOUBLE LOT; 2 C. garage

QUALIFIES for RURAL HOUSING! * Covered Bridge location provides special fi nancing!* $280,000 (www.LNF.com\470772)* 3BR/2.5BA jewel; 2800 Sq. Ft.* 2 Bonus Rms: now used as “Man Cave” & Offi ce with private entry* Exceptional use of Oak Wood throughout* Porch, Pool & Garages for 3 cars

RUARK’S MODEL HOME* Talk about bells and whistles!!!* 4BR/3BA w/ First Floor B&B* A WOW Master Bathroom * Potential 5th BR* Garage on own HVAC system* $325,000 * (www.LNF.com\471393)

COUNTY TAXES W/ CITY SERVICES * $174,900 (www.LNF.com\469586)* 4BRs/1 full, 2 half Baths, on .4 A * 2 Bonus Rms; 2617 Sq. Ft.* 3 Zone HVAC; Basement* AWESOME Kitchen & FR Addition* 3 Season Porch; Deck w/ Awning* Outstanding location near S.U. & PRMC

LOTS of LOTS! City: $19,900 (463053) or County: .4A for $29,900 (463041) CALL NANCY ALTHAUS 410-726-6080

GOLDEN OPPORTUNITY * To own in FOXCHASE!* $300,000 (www.LNF.com\458215)* 4BR/3BA Original Modle Home* First fl oor Offi ce* 2 Bonus Rooms* Expanded FR w/brick FP* 3 Zone HVAC; 3400 Sq. Ft* .8 Acres w/I-G Irrigation

FIRST FLOOR MASTER * NOW $255,000 * (www.LNF.com\470073)* 4BR/3BA w/ 1st & 2nd fl r MBRS* Like to entertain? Awesome FR & Deck* 2436 Sq. Ft. of perfection! * 1.74 A. park-like setting on Cul-de-Sac* Great Eastside location

LIVE FREE & EASY ON 1 LEVEL * No better time than the present!* Resize & relax @ Mallard Landing* NOW $113,900* 1BR/1.5 BA * (www.lnf.com\470127)* Bonus Rm; 1187 Sq. Ft)* “Oxford” modle w/upgrades* One of the few to have a Fireplace

THINK ABOUT ITWhether you rent or own, YOU pay for the house you live in. So, why pay the Landlord? THERE ARE SOME INCREDIBLE BUYS OUT THERE! Doesn’t it make sense to invest in

yourself? Call Nancy Althaus 410-726-6080 for FREE Buyer counseling.

THERE ARE SOME INCREDIBLE BUYS OUT THERE! Doesn’t it make sense to invest in

FIRST FLOOR MASTER * $170,000* (www.LNF.com\465146)* 3BR/2.5BA Townhouse; 1916 Sq. Ft.* 2 Bonus Rooms = 4th BR & a Craft Rm. or Offi ce* FR w/FP; E-I Kitchen * Formal LR & DR* California-style fi nished Garage

ESREG.01.06.indd 6 5/10/11 11:00:49 AM

Page 7: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 7

8407 Fishing island rd., westover - Comfortable and spacious home on 1.07 acre

lot close to the bay. 3 BR and 2BA plus large kitchen and LR. Fenced yard and

storage shed. $145,000 MLS# 464263

8605 Middlesex dr., delMar 4 bedsrooms 2 baths on .95 acres in Essex Ridge. Open floorplan with first floor bed

and bath $199,000 MLS# 471481

426 Priscilla st., salisbury REMODELED! This beautiful

home boasts 3BR and 2.5 BA including a 1st floor master, hardwood and tile flooring. Screened porch and rear

deck plus garage and shed. $129,900 MLS# 467906

29833 deer harbour dr., salisbury - 5 bedrooms, 3.5 baths with first floor master in Deer Harbour. $278,000 MLS# 471778

911 vaden ave., salisbury Great Investment! Triple

lot on corner. 3 bedrooms and 2 full bathrooms with separate apartment and

partial basement. $99,900 MLS# 471943

9331 croPPers island rd., newark custom built 4 bedrm 2.5 bath home on 1.5 acres in Newark. attention to detail throughout,

gourmet kitchen and delux master suite with private porch.

$369,800 MLS# 466803

lots

Sally Todd Stout 410.726.3506

[email protected]

2618 N. Salisbury Blvd. Suite 120, Salisbury, MD 21801 • 410-912-4700An Independently owned and operated member of the Prudential Real Estate Affiliates

Skip Lyons 443.235.0200

[email protected]

134 nina ln., Fruitland .41 acres $69,900 nanticoke rd., nanticoke 4.06 acres $69,900 9076 bistate blvd, delMar .34 acres $4,900

cove st., crisField .20 acres $13,900 cove st., crisField .17 acres $11,900

20214 nanticoke rd.700 feet of private beach on Nanticoke River on this 13 acre parcel with 4 bedroom

1600 square foot home. $578,853 MLS# 463711

7 139th st., ocean cityLooking for a great invest-

ment? This first floor 2 bed 2 bath unit is only 1/2 block from the beach with great rental potential! $239,900

MLS# 468214

reduced

new listing

161 nina ln, FruitlandBeautiful 5 BR home in East Field subdivision. 1st floor BR & BA along with large

LR, formal DR, FP, and back deck.

$269,900 MLS# 469550

600 edgewater dr., salisbury Recently updated 2 bed-

room, 2 bathroom home in immaculate condition; On a corner lot in Spring Chase.

$174,900 MLS# 472323

reduced

reduced

reduced reduced

See more of these listings at

www.youtube.com-enter property

address.

20 sandyhook rd.,ocean Pines - An Ocean

Pines best buy! Remodeled with all new appliances. 3 bed 2 bath home with large

fenced rear yard conve-nientlly located inside the

North Gate of Ocean Pines $176,853 MLS# 465630

reduced

1204 orchard cr., salisbury Close to the Universtiy- city

services and no city taxes. 3 bedroom 2 bath rancher with sunroom, living room, family room with fireplace, and din-

ing room. $205,000 MLS# 448793

28305 nanticoke rd., salisbury - Spacious

2100 square foot home on 1.62 acres with fenced yard, outbuilding and two

master suites, a great value! $199,900 MLS# 457283

231 canal Park dr - salisbury2 bedroom 2 bath condo in Canal Woods- enjoy maintenance free living! Freshly painted and great

views of the pond in this first floor unit. $93,900 MLS# 465784

1201 taney ave., salisbury Close to University, city services

and no city tax. This 1766 sq foot 3 bedroom 2 bath home

with basement on a lg corner lot is a must see.

$169,900 MLS# 470064

new listing

ESREG.01.06.indd 7 5/10/11 11:01:54 AM

Page 8: Eastern Shore Real Estate Guide

Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06

“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801

410.912.4700 800.241.9590

Prudential Carruthers SalisburyPrudentialCarruthers.com

“Model Home”Captain’s Cove, VA757.854.0548

Captain’s Galley Condo, Crisfield410.968.9686

Visit us Online Search the Entire MLS

www.prudentialcarruthers.com

Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06

An independently owned and operated member of the Prudential Real Estate Affiliates.

3 Bedrooms, 2.5 Baths$119,000(472195)

2 Bedrooms, 1 Bath$117,900(471773)

3 Bedrooms, 1.5 Baths$114,900(467744)

3 Bedrooms, 2 Baths$132,495(470115)

2 Bedrooms, 1 Bath$89,900(469294)

3 Bedrooms, 2 Baths $117,600(468611)

3 Bedrooms, 1 Bath$69,900(467666)

2 Bedrooms, 1 Bath$86,900(470320)

3 Bedrooms, 2.5 Baths$164,900(471192)

3 Bedrooms, 2 Baths$159,900(468314)

4 Bedrooms, 2 Baths$149,900(470366)

3 Bedrooms, 2 Baths$164,900(470763)

Smart Phone?Here’s the QR Code

for SALISBURY Prudential CarruthersREALTORS Website

www.facebook.com/SalisburyHomes

1.2 ACRES

3 Bedrooms, 2 Baths$168,900(472082)

4 Bedrooms, 1 Bath$139,900(471958)

Waterfront Lot$110,000(472439)

ESREG.01.06.indd 8 5/10/11 11:02:22 AM

Page 9: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 9

Kevin White

MAnAGeR

“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801

410.912.4700 800.241.9590

Prudential Carruthers SalisburyPrudentialCarruthers.com

“Model Home”Captain’s Cove, VA757.854.0548

Captain’s Galley Condo, Crisfield410.968.9686

Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE- Vol. 01, no. 06 - Page 9

4 Bedrooms, 3.5 Baths32.5 Acres $1,800,000

(469465)

3 Bedrooms, 2.5 Baths$1,495,000(460879)

3 Bedrooms, 2 Baths$396,318(472011)

3 Bedrooms, 2 Baths$249,000(467835)

4 Bedrooms, 2 Baths$315,000(467876)

5 Bedrooms, 3 Baths$269,900(469550)

4 Bedrooms, 2.5 Baths$275,000(464516)

3 Bedrooms, 2.5 Baths$282,000(471639)

3 Bedrooms, 2.5 Baths$199,000(470767)

4 Bedrooms, 2.5 Baths$369,800(466803)

WATERFRONT21+ ACRES

4 Bedrooms, 1.5 Baths $289,900(468221)

15 ACRES

Visit us Online Search the Entire MLS

www.prudentialcarruthers.comAn independently owned and operated member of the Prudential Real Estate Affiliates.

4 Bedrooms, 2.5 Baths$329,000(471224)

4 Bedrooms, 2.5 Baths$279,900(466099)

3 Bedrooms, 2 Baths$177,900(469555)

3 Bedrooms, 2 Baths$164,986(468882)

ESREG.01.06.indd 9 5/10/11 11:02:55 AM

Page 10: Eastern Shore Real Estate Guide

www.captainscoveproperties.com2618 N. Salisbury Blvd. Suite 120

Salisbury, MD 21801

CINDY WELSH302-381-6910 Cell

410-912-4700 [email protected]

Your Captains Cove Connection

Chincoteague Bay Views 70’ BoardwalkCanal Front, Owner Financing

MLS# 463872

NEW LISTING 943 Sailors Ct. Canal Front

$110,000 MLS# 472393

Interior Lots$9,900 4/1948 Wooded (465820)$9,900 7/227 Wooded (465783)$9,900 10/8 Cleared, cul-de-sac (465781)$10,000 9/112 Wooded, (466845)$10,000 1/816 Wooded, (469904)$11,900 5/2442 Wooded, Approved for septic (471387)$11,900 4/1993 Wooded, Approved for septic (472282)$12,000 6/85 Wooded, Approved for septic (466989)$12,895 8/24 mostly cleared, Approved for septic (470484)$13,000 11/91 Wooded, Approved for septic (468131)$13,495 5/2376 Wooded, Approved for septic (471602)$14,000 5/41 Wooded, Approved for septic (470205)$25,000 8/8 Wooded, Approved for septic (464430)$39,900 1/856 Wooded, corner lot Water & Sewer (464019)$59,900 1/1238 Cleared, Bay view, Water & Sewer (464021)

Golf Course Lots:$26,900 Mostly Cleared w/s Availability (472279)$27,000 2/136 Wooded, Views of 8th green & fairway (468729)$27,500 Cleared, Views of 9th Hole & Pond (471489)$29,500 2/313 Cleared, Views of 6th fairway (470230)$55,000 2/150 Wooded, Approved for septic, Views of 9th fairway & pond (463847)$55,000 2/125 Wooded, Approved for septic, Views of 8th fairway (463848)

Future Development/Investment Lots: Lots currently in undeveloped areas$3,900 17/81 (465778) $4,000 13/298 (467036) $9,900 13/97 (465835)$3,900 18/109 (465841) $4,000 13/357 (467038)$4,000 13/325 (467041) $4,000 10/49 (471390)

7 LOT PACKAGE:$9,900 For ALL 7 LOTS!! (1 buildable/6 future buildable) Great opportunity for a group of golfers/swimmers, ect. to own property in Captains Cove and enjoy all the amenities (469636)

Page 10 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06

An independently owned and operated member of the Prudential Real Estate Affiliates.

ESREG.01.06.indd 10 5/10/11 11:03:36 AM

Page 11: Eastern Shore Real Estate Guide

Page 11 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 MHBRMHBR MHBR MHBR H # 457# 4545# 45775700

Actual view from residence

Have it all at The Gateway Grand, Ocean City’s premier oceanfront property. Ocean and bay views. Private terraces and shared lounges. Indoor and outdoor pools. The Vista residences off er beach lovers twice the luxury all year long.

Schedule your tour of the new Vista models today. Sales offi ce open daily from 10 a.m. to 5 p.m.

GrandValueOC.com866-531-5942 Two 48th Street, Ocean City, MD 21842

TTHHHHEEE GGGGGGGAAAAAAAATTTTTTEEEEEEEWWWWWAAAAYYYY GGGGGRRRRAAANDD IINNNTTTRRROOODDDDUUUCCEEEESSS......

LuLuLuLuxuxuxuxuryryryry TTTThrhrhreeeeeee- anana dd FoFoururu -BB- eddede rooommom RResese iddididennenencececec sss wiwithth BBototthhhh OcOceaeannnn anand d BaBaBay yy ViViViV ewewwss StStara tingg at $6$69999,9,90000..

TCC_GG_SpringAd_RealEstate_42806b.indd 1 4/19/11 4:21 PMESREG.01.06.indd 11 5/10/11 11:03:58 AM

Page 12: Eastern Shore Real Estate Guide

Page 12 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06

VERY NICE 3 BR rancher within short distance of Schumaker Park pavil-ion & playground. Family rm has FP w/gas insert, sunroom, wood & tile floors, granite countertops & central air, 2-car detached garage w/shop area & woodstove, 10x21 shed & paved drive. $199,900. (468513)

SPACIOUS COLONIAL Northwest spa-cious colonial has 3Br, 2.5 bath with great room, DR, beautiful kitchen, screened porch, large MBR w/ walk-in closet and bath. 2 car attached garage and fenced patio. $249,900. Call Jill Yost 443-523-1365. (471089)

23 TIDEWATER SEAFORD, DEGlamorous contemporary 4BR, 4 bath Seaford home in Holly Shores has full finished basement, FP in Fam Rm, beau-tiful cathedral ceilings & state of the art kitchen, 3 car garage, walk up attic, spe-cial financing available. $599,900. Call Jill Yost (578562)

CHARMING rancher in a private setting. 3 bedrooms, 2 baths, fireplace in living room. Outside includes a deck, patio & a attached garage. $174,900. Call Jill Yost 443-523-1365. (470187)

SCOTLAND PARkWAY 3rd floor game room 580 sq ft; fireplace in family room; large rooms; formal living room & din-ing room; eat-in kitchen; 2 car garage. $324,900. Call Jill Yost 443-523-1365. (471825)

GREAT RANCHER Just around the corner from marina, over 4.5 acres sur-rounded by County Park. 3 bedroom rancher with central air, family room, and several outbuildings. $155,000. Call Jill Yost 443-523-1365. (468341)

CUSTOM bUILT 5bR, 3.5 bath Contem-porary with beautiful fireplace, cathedral ceiling Great Room, hardwood & tile floors, loft overlooking Great Room, of-fice, 2 master bedrooms, deck & 3 car garage on cul-de-sac just 13 miles East of Salisbury. $424,900 Call Jill Yost @ 443.523.1365 (453550)

CHARMING HOME In established neighborhood. Nice kitchen with tile floor, center island, recessed lighting, 2-car detached garage and large deck. $229,900. Call Jill Yost 443-523-1365.

AUGUSTA CIRCLE Contemporary 4 BR, 2.5 bath home with main floor MBR, of-fice, formal LR & DR, family room w/FP, kitchen w/central island, deck, inground pool, 2-car attached garage. $279,900 Call Jill Yost 443.523.1365 (472079)

Jill Yost REALTOR® / AGENT

cell 443.523.1365 office 1.800.842.5704

[email protected]

Long & Foster® Real Estate, Inc.

Salisbury, Md

Page 12 - Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06

ESREG.01.06.indd 12 5/10/11 11:27:19 AM

Page 13: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 13

107 S. Commerce StreetCentreville, MD 21617

www.AshleyPremier.com

410.758.3000 410.763.7000

123 N. Washington StreetEaston, MD 21601

Rockcliff DRiveEaston - 2731 SF heated living space and a 480 SF Garage. Wonderful wrap around porches. Open kitchen, dining - family area. Sports a very large dining room, den and lots of bedroom space. $439,000 Joyce Wallace 410-829-5031

MaRshall DRiveBrand new Colonial to be placed on a premium 1.19 acre lot in Bridgetown Estates. 4 BR, 2.5 Ba. Great location. $340,000 (QA7548490) Jack Ashley 410-310-0800

Wye Mills 2+ unrestricted acres in picturesque Wye Mills and approx. 5 miles from the public boat ramp. First floor master, living areas upstairs and down, inground pool, and more! $450,000 Cynthia DeGuzman 410-725-6977

conquest DRiveHave it all - water views, gourmet kitchen, 1st floor master, luxurious pool area, separate driveway to huge outbuilding. $585,000 Kelli Miles 410-490-9107

centRevilleGreat kitchen w/breakfast area. Gas fire place, bright and airy foyer and open dining. Large master suite. $424,900 Norma Coursey 410-490-1307

haRMony RoaDNice Farmette that has been redone. New roof, siding, replacement windows add to the value. There is a stream and small pond. Mostly cleared; bring the horses and other pets. $298,000 Shirley Joyce 410-310-8635

colony ciRcle Stunning and private in affordable, sought after Easton community. Wood floors, built-ins, generous kitchen and more; Only $279,000 Cynthia DeGuzman 410-725-6977

Belle aiRe PlaceGood size rancher in nice community located on a quiet cul-de-sac backs to woods. (TA7582926) $133,400 Shirley Joyce 410-310-8635

henDeRson4+ acre wooded lot. Built with lots of special touches - rounded corners, arches, tile and wood flooring. $199,000 Shirley Joyce 410-310-8635

79+ Wooded Acres in Queen Anne Co. $475,000

ESREG.01.06.indd 13 5/10/11 11:04:40 AM

Page 14: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 14

Staples & Associates Insurance offers peace of mind through quality insurance products and a caring staff of professionals that is always ready to serve. As a full service Insurance Agency providing Auto, Home, Life, Business, and Farm insurance solutions, Staples & Associates Insurance can help you control uncontrolable cirumstances.

Securities offered through Billy Staples as a Registered Representative of Nationwide Securities, LLC P.O. Box 183137, Columbus, OH 43218, 888-753-7364. Member FINRA, SIPC. DBA Nationwide Advisory Services, INc. in AR, FL, IL, WV. DBA NAtionwide Advisory Services in MA, NY, OK. Representative of Nationwide Life Insurance Copman af liated companies and other companies.

Billy Staples, MBA

Staples & Associates Insurance

1410 S. Salisbury Blvd.Salisbury, MD 21801

[email protected]: 410.546.3999 | Fax: 410.546.6165

On Your Side Certified Agent

Nationwide Financial Network®

37101.22.13.indd 6 4/12/11 3:21:59 PMESREG.01.06.indd 14 5/10/11 11:04:53 AM

Page 15: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 15 Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 15

7802 Coastal HighwayOcean City, Maryland 21842

MELISSA BEROTTIREALTOR®, Licensed in MD

Cell: 443-497-1888Office: 410-723-0988Email: [email protected]

Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 - Page 15

Austin Circle- Fabulous 4 bedroom home located just minutes from downtown Berlin. Great kitchen, gas fi replace, 3 full baths, open living area, fi rst fl oor master suite w/whirlpool tub, and a bonus room with a full bath as well. Great backyard with a rear screened deck for you to BBQ. This Contemporary home also features an oversized attached garage w/plenty of storage, ceiling fans in every room, and a vinyl fenced in rear yard...Priced to sell at $284,500!! Call Melissa Berotti

for your appointment to see Austin Circle today at 443-497-1888

ESREG.01.06.indd 15 5/10/11 11:05:50 AM

Page 16: Eastern Shore Real Estate Guide

Page 16 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06

ALL BRICK BEAUTY Offering a complete re do inside! Beautifully refinished hard-wood floors, all new kitchen with upgraded appliances, new tile floors, new high end cabinets, faucet, sink. A complete package! Custom painted through out. lovely crown molding. All new bathrooms. Two masonry fireplaces. Partial basement. Full walk up attic. This is a showplace!New high efficiency oil furnace installed 2007. $169,900 (471190)

2.26 ACRES Great potential for an in home business, in law quarters or just a lot of home for the money! Huge Deck w/screened room, lg open floor plan, skylights on the 2nd flr, Loads of possi-bilites w/adddition side, ramp already in place! Highly motivated seller that is easy to work with. Bring all offers for this coun-try living yet walk to Wor Wic convenient location!. $195,000 (467871)

SOLD!

GORGEOUS! 9 foot ceilings! Hardwood floors! Granite countertops! Lots of windows! 3 car garage! This 4 bedroom home has it all. Delmar school district. $275,000 Call Elaine Gordy 410-726-9001 (467424)

BEAUTIfUL LOCATIOn across from Tony Tank Lake. Gorgeous home with hard-wood floors, brand new gourmet kitchen, screened porch, fenced yard, 2 car garage, 2 fireplaces, 4 bedrooms, 2.5 baths & hardwood floors!! BEST Of BOTH WORLDS: COUnTY TAxES & CITY SERvICES... CALL ELAInE GORDY 410.726.9001 $324,900 (468678)

BEAUTIfUL TOWnHOME - Very well cared for one owner home in the new-est section of Stone Gate. Privacy in the back yard, attached storage shed. Huge living area flows into a large kitchen and dining area perfect for entertaining. Upstairs the master bed-room affords privacy and a larger than life walk in closet. This floorplan offers the most living space for the dollar in a Salisbury townhome. $139,900 (470250)

GREAT RAnCHER! - Beautiful little one owner home. Hardwood floors, oil furnace replaced 8 years ago, roof is 12 years old. Solid, well built and well cared for home. $69,900 (470283)

BEAUTIfUL double wide home with ca-thedral ceilings, 3 bedrooms, 2 baths, fireplace, deluxe master bathroom, almost 1800 square feet. Only 6 years old this home has been gently lived in, very clean and well cared for. New shed. Nicely landscaped.$59,900 (469554)

DELIGHTfULLY DECORATED Easy liv-ing home with a delightful screened porch, rear deck, full walk up attic, lovely upgraded kitchen with pantry, 2 lazy susans, appliance garage. HOA maintains the yard, sprinklers, shrub-bery, mulch. Lock it up and go lifestyle in a very comfortable setting. Located near the historic Teackle Mansion. $174,000 (471165)

CLOSE TO BEACH! - 3 Bedrooms, 2 baths, great floorplan, home features a sun-room overlooking a large back yard, an oversized 2 car detached garage, paved driveway, rear deck. Very com-fortable, convenient and economical. 15 minute drive to the beach. Call Elaine Gordy 410.726.9001 $164,900 (462211)

SPRInG CHASE BEAUTY located on a beau-tiful lot overlooking a serene and private wooded area. Comfortably updated and ready to move into this custom decorat-ed home is warm and perfect for anyone looking for a low maintenance home in a convenient location. $173,250 (462362)

GREAT LOCATIOn Close to Salisbury Uni-versity. Nice waterfront end unit with great views and extra windows. Water-front balcony. Updated bathrooms. Very nice, convenient carefree living. Condo fee includes water, sewer, and trash fee. No maintenance, no worries. $109,900 (466282)

LOvELY REMODELED and updated home on a very quiet dead end street. New carpeting, new vinyl, replacement windows, new exterior doors, brand new bathroom with tile wall and floors, freshly painted. Great back yard with a deck overlooking a wooded back drop. Attached garage. Well maintained and gently lived in, this home is in move in condition. .$159,900 (466607)

EASY LIvInG LIfESTYLE! Custom built, gently lived in one owner home in a convenient, well manicured com-munity. Lg open one floor living w/9 ft ceils, designer kitchen, FR w/FP, screened porch overlooking a peaceful, tranquil setting. Attached 2 car garage. $239,900 (454671)

PREPARE fOR nO MAInTEnAnCE! Prepare for low heating & cooling costs! Lock it up and go on vacation! - No worries! This lovely, all brick, Village in the Park home provides you peace of mind, se-curity & elegance! Move in tomorrow! Very private setting this 3 bedroom, 2 bath home with 2 car garage is a carefree home in a convenient location. $274,900 (457227)

Elaine Gordy410-726-9001

1-800-842-5704 [email protected]

LonG & FostEr rEaL EstatE , Inc.

LOTS...LOTS...LOTS 2.3 acres south of Salisbury. Country living! Cleared, perced, ready to go! fruitland School District. $69,900

Beautiful wooded private 1.5 acre lot in established neighborhood. Approved & ready to build on! $69,900

REDUCED

REDUCED

REDUCED

REDUCED

ESREG.01.06.indd 16 5/10/11 11:06:47 AM