dichotomy of ca2+ signals triggered by different phospholipid

Dichotomy of Ca2+ signals triggered by different phospholipid pathways in antigen stimulation

of human mast cells.

Alirio J. Melendez and Aik Kia Khaw

Department of Physiology, Faculty of Medicine, National University of Singapore, Singapore

117597.

Corresponding author:

Alirio J. Melendez

Telephone: (+65) 874 1697

Fax: (+65) 778 8161

E-mail: [email protected]

Running title: Calcium signaling by SPHK1 and PLCγ1

1

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on February 20, 2002 as Manuscript M110944200 by guest on A

pril 8, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Summary

Mast cell activation triggers Ca2+ signals and the release of enzyme containing granules, events

that play a major role in allergic/hypersensitivity reactions. However, the precise molecular

mechanisms that regulate antigen triggered degranulation and Ca2+ fluxes, in human mast cells,

are still poorly understood. Here we show, for the first time, that a receptor can trigger Ca2+ via

two separate molecular mechanisms. Using an antisense approach, we show that IgE-antigen

stimulation, of human bone marrow-derived mast cells, triggers a sphingosine kinase 1

(SPHK1)-mediated fast and transient Ca2+ release from intracellular stores. However, PLCγ1

triggers a second (slower) wave of calcium release from intracellular stores, and it this PLCγ1

generated signal that is responsible for Ca2+ entry. Surprisingly, FcεRI triggered mast cell

degranulation depends on the first, sphingosine kinase-mediated, Ca2+ signal. These two

pathways act independently, since antisense knock down of either enzyme does not interfere with

the activity of the other. Of interest, similarly to PLCγ1, SPHK1 rapidly translocates to the

membrane, after FcεRI crosslinking. Here we also show that SPHK1 activity depends on

phospholipase D1 (PLD1), and that, FcεRI-triggered mast cells degranulation depends primarily

on the activation of both PLD1 and SPHK1.

Abbreviations used in this paper: IgE, immunoglobulin E; FcεRI, high affinity receptor for IgE;

hBMMC, human bone marrow-derived mast cells; SPHK1, sphingosine kinase 1; SPP,

sphingosine-1-phosphate; PLD1, phospholipase D1; PtdCho, phosphatidylcholine; PA,

phosphatidic acid; PLCγ1, phospholipase C-gamma 1; DAG, diacylglycerol; IP3, inositol-

1,4,5-trisphosphate.

2

by guest on April 8, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Introduction

Aggregation of the high affinity receptor for IgE (FcεRI) on Mast cells triggers the Ca2+

dependent release and production of a wide range of mediators responsible for the major

symptoms of immediate hypersensitivity reactions (1, 2, 3). Although some of the signaling

cascades triggered by FcεRI have been characterized, the regulatory mechanisms governing mast

cell degranulation and calcium release from internal stores are only partially understood. FcεRI

is a heterotrimeric receptor complex (αβγ2) that contains immunoreceptor tyrosine-based

activation motifs (ITAMs) in both the β and the γ subunit cytoplasmic domains (4). The

protein-tyrosine kinase Lyn is associated with the β subunit in resting cells (5), and its activation

is promoted by FcεRI cross-linking (6). Activated Lyn phosphorylates ITAMs of the β and γ

subunits, resulting in the recruitment of other Src-like as well as Syk protein tyrosine kinases

(PTK), through Src homology-2 (SH2) domain-mediated interactions with phosphotyrosine

residues (7, 8). Activation of these newly recruited PTKs, in turn, facilitates the translocation

and phosphorylation of multiple signaling molecules, including phospholipase Cγ (PLCγ)

isoforms and phosphoinositide 3-kinases (PI3K) (9). Activated PLCγ hydrolyses

phosphatidylinositol 4,5-bisphosphate (PI-4,5-P2) to D-myo-inositol 1,4,5-trisphosphate (Ins-

1,4,5-P3) and diacylglycerol (DAG), which induce the release of Ca2+ from intracellular stores

and the activation of protein kinase C isoforms (PKCs), respectively. The amplitude and

duration of the Ca2+ response potentially modulates the activation of different transcription

factors (10), regulating different gene expression. Ca2+ signals are also indispensable for the

release of histamine containing granules (1), the synthesis of arachidonic acid-derived mediators

and the release and generation of various cytokines (2), which together are responsible for the

major symptoms of immediate hypersensitivity reactions. Thus, an understanding of mast cell

activation, and Ca2+ signaling, therefore, has obvious therapeutic implications. It has previously

been shown that FcεRI, on the rat mast cell line RBL-2H, triggers Ca2+ signals via a novel

pathway potentially involving sphingosine kinase activity (11) and not phospholipase Cγ, even

though IP3 production was observed (11). We have recently shown that a similar receptor, FcγRI

in monocytes, triggers intracellular Ca2+ via the sequential activation of phospholipase D and

3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

sphingosine kinase (12); however, no IP3 generation was observed in this case (12).

Phospholipase D hydrolysis phosphatidylcholine (PtdCho) to yield phosphatidic acid (PA) and

choline (13), PA has been shown to play many intracellular signaling functions (13, 14),

including the activation of sphingosine kinase (SPHK) (14-16). SPHK phosphorylates

sphingosine to generate sphingosine-1-phosphate (SPP) (15, 16, 17). SPP has been

demonstrated to act as an alternative second messenger to Inositol-1,4,5-trisphosphate in the

release of Ca2+ from intracellular stores (11, 12). In this study we show, for the first time, a dual

molecular mechanism responsible for triggering different calcium signals. Firstly, a rapid rise in

internal calcium, triggered by the sequential activation of phospholipase D1 (PLD1) and

sphingosine kinase 1 (SPHK1). Secondly a prolong calcium response is triggered by

phospholipase Cγ1. Furthermore, mast cell degranulation is triggered by the combined action of

PLD1 and SPHK1. However, the PLCγ1 activation is necessary to trigger calcium entry into the

cells.

Understanding the intracellular signaling pathways coupling FcεRI activation, by IgE-antigen, to

physiological responses triggered by mast cell activation has profound therapeutic implications

for allergic/inflammatory diseases.

4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Materials and MethodsUnless stated differently all chemicals and reagents were obtained from Sigma.

BMMC Generation, and cell culture

Bone marrow was collected from human donors following the protocol approved by the FDA

Committee for Research Involving Human Subjects. Normal donor eligibility criteria include

healthy males and non-pregnant females between the ages of 18 and 45 years old. The donors

must have a negative medical history for all major diseases. Bone marrow was withdrawn by

board-certified physicians from two separate sites of the posterior pelvic bone into syringes

containing preservative-free heparin sodium injection (20-50 units heparin per ml bone

marrow). BMMCs were generated using the, previously described 18, following protocol: fresh

human bone marrow cells were cultured in complete RPMI 1640 supplemented with 10ng/ml

IL-3 (Calbiochem) and 100ng/ml Stem Cell Factor (Calbiochem) for two weeks. Cells were

characterized as BMMCs by flow cytometry as CD45+, CD117+, CD9+, positive with FITC-

labeled human IgE, CD4-, CD8-, CD45-, CD11b-, CD11c-, and MHC class II-. Purity was

estimated at >95%. All antibodies were FITC or biotin labeled (Serotec).

Antisense oligonucleotides were purchased from Oswell DNA Services; 20-mers were

synthesised, capped at either end by the phosphorothiorate linkages (first two and last two

linkages), and corresponded to the reverse complement of the first 20 coding nucleotides for

PLD1, SPHK1, PLCγ1, and a scrambled oligo for control. The sequences of the oligonucleotides

were:

5‘CCGTGGCTCGTTTTTCAGTG 3‘ for PLD1,

5‘CCCGCAGGATCCATAACCTC 3‘ for SPHK1.

5‘GGGGACGCGGCGCCCGCCAT 3‘ for PLCγ1.

5‘CTGGTGGAAGAAGAGGACGT 3‘ scrambled for control

Cells were incubated/transfected with 1µM oligonucleotides mixed with transfection reagent

(FuGene, Roche) for a total of 48 hrs (36 hrs prior to, and then for the duration of sensitisation).

Reverse Transcription PCR

mRNA from BMMC was isolated using the Quiagen midi kit for mRNA extraction. Specific

5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

forward (TGAACCCGCGCGGCAAGGGC) and reverse (GGTCAGCCGGCGCCATCCACG)

primers were designed for the human SPHK1 to yield a 570 bp fragment.

Peptide-derived polyclonal antibody specific for the human SPHK1

A peptide sequence, specific for the human SPHK1, was selected for its apparent hydrophobisity

properties, and synthesised.

Peptide: FIADVDLESEKYRRLGEMRFTLGT. Two rabbits were immunised giving rise to

two peptide-derived antisera. The polyclonal antibodies were purified using protein-A agarose

affinity columns. The polyclonal antibodies only recognised one band, in western blots, for the

correct molecular weight of endogenous, or recombinant human SPHK1. The antibody was also

successfully used, as primary antibody, for immune-staining for confocal microscopy analysis.

FcεRI aggregation

BMMC cells were sensitized with 1µg/ml human DNP-specific IgE overnight. Then cells were

collected, washed, resuspended in RPMI-1% FBS, activated by the antigen DNP-BSA

(1µg/ml), and activation stopped at the times indicated in the figures.

Cell lyses and subcellular fractionation

For translocation experiments, cell lyses and subcellular fractions were prepared following the

method previously described (19). Briefly, cells were harvested and resuspended in cold nuclear

preparation lyses buffer (10 mM Tris-HCL, pH 7.4, 2 mM magnesium chloride, 140 mM

sodium chloride, 1% Triton X100, 0.25% sodium deoxycholate, 1 mM EGTA, 1 mM PMSF, 10

mM sodium orthovanadate, 10 µg/ml chymostatin, 10 µg/ml leupeptin, 10 µg/ml antipain and 10

µg/ml pepstatin). After lyses by freeze thaw (x 3 in liquid nitrogen), from the total cell lysates,

the nuclei and cell debris (containing the cytoskeleton) were removed by centrifugation at 15,000

g for 5 min. The supernatant was centrifuged at 100,000 g and 4°C for 60 min. The pellet

containing the nuclear-free membrane fraction was resuspended in 200 µl of nuclear preparation

buffer (without detergents) and stored at -20 °C. The amount of protein recovered in each

fraction was quantified using the Bradford reagent system (Bio-Rad, UK).

6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Gel Electrophoresis and Western Blots

Unless stated otherways, 40 µg of lysate for each sample was resolved on 10% polyacrylamide

gels (SDS-PAGE) under denaturing conditions and then transferred to 0.45µm nitrocellulose

membranes. For translocation experiments, 40 µg of lysate for each sample was fractionated as

mentioned above, the supernatant and the membrane fractions for each sample were separately

resolved on 10% polyacrylamide gels (SDS-PAGE) under denaturing conditions and then

transferred to 0.45µm nitrocellulose membranes. After blocking overnight at 4°C with 5% non-

fat milk in TBS, 0.1% Tween 20 and washing, the membranes were incubated with the relevant

antibodies for 4 hr at room temperature. The membranes were washed extensively in TBS/0.1%

Tween 20 (washing buffer). The blots were probed using specific, monoclonal (anti-PLCγ1,

Santa Cruz) ; polyclonal (anti-PLD1, QCB) ; (anti-SPHK1 made in house as described) ;

primary antibodies. Blots were stripped and reprobed with policlonal antibodies: an anti-

PDGFRα antibody (against the alpha subunit of the PDGF receptor, Santa Cruz), for membrane loading

control; or with an anti-HSP 90 (H-114, against the heat shock protein 90, Santa Cruz) for

cytosol loading control. The anti-PDGFα antibody was also used as a loading control for blots

containing whole cell lysates. Bands were visualised using the appropriate HRP-conjugated

secondary antibody, and the ECL Western Blotting Detection System (Amersham, UK).

Phospholipase D (PC-PLD) activity

PLD activity was measured as previously described (12) using the transphosphatidylation assay.

Briefly, BMMC cells were labeled (106 cells/ml) with [3H] palmitic acid (5 µCi/ml, Amersham,

UK) in the cell culture medium for 16 hr. Following washing, the cells were incubated at 37°C

for 15 min in RHB medium, containing butan-1-ol (0.3% final). Following FcεRI aggregation,

cells were incubated for a further 30 min and then extracted by Bligh-Dyer phase separation.

The accumulated phosphatidyl butanol was assayed as described previously (12).

Inositol-1,4,5-trisphosphate

Inositol-1,4,5-trisphosphate (IP3) was measured as previously described (20), using the

BIOTRAK TRK 1000 kit (Amersham-Pharmacia). Briefly, this is a competition binding assay

7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

in which cellular generated (unlabelled) IP3 competes with a fixed, known amount of [3H]IP3

for binding to the IP3 receptor present in homogenates from bovine adrenal glands, which has a

high affinity and specificity for IP3. FcεRI aggregation was carried out described above, and

activation stopped at the times indicated in the figures.

Sphingosine kinase activity

Activation of sphingosine kinase was measured as described previously (12, 21). Briefly, cells

were resuspended in ice-cold 0.1 M phosphate buffer (pH 7.4) containing 20% glycerol, 1 mM

mercaptoethanol, 1 mM EDTA, phosphatase inhibitors (20 mM ZnCL2, 1 mM sodium

orthovanadate, and 15 mM sodium fluoride), protease inhibitors (10 µg/ml leupeptin, 10 µg/ml

aprotinin, and 1 mM PMSF), and 0.5 mM 4-deoxypyridoxine, disrupted by freeze thawing and

centrifuged at 105,000 g for 90 min at 4ºC. Supernatants (cytosolic) and particulate (membrane)

fractions were assayed for sphingosine kinase activity by incubating with sphingosine (Sigma)

and [γ32P]ATP (2 µCi, 5 mM) for 30 min at 37ºC and products were separated by TLC on silica

gel G60 (Whatman, U.K.) using chloroform/methanol/acetic acid/water (90:90:15:6) and

visualized by autoradiography. The radioactive spots corresponding to sphingosine phosphate

were scraped and counted in a scintillation counter.

Cytosolic Ca2+

Cytosolic calcium was measured as described previously (12, 21), except that for some

experiments the buffer was Ca2+ supplemented (final concentration 1.5 mM Ca2+). Briefly,

sensitized cells were loaded with 1 µg/ml Fura2-AM (Molecular Probes, Leiden, The

Netherlands) in PBS, 1.5 mM Ca2+ and 1 % BSA. After removal of excess reagents by dilution

and centrifugation, the cells were resuspended in 1.5 mM Ca2+ supplemented PBS and warmed

to 37°C in the cuvette. FcεRI was aggregated as described above. Fluorescence was measured

at 340 and 380 nm and the background-corrected 340:380 ratio was calibrated as previously

described (12).

8


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Confocal microscopy

After receptor aggregation, suspended cells were fixed in 4% paraformaldehyde and deposited on

microscope slides in a cytospin centrifuge, then permeabilised for 5 min in 0.1% Triton X100 in

PBS. Fluorescent labeling was performed as previously described (22), using anti-PLCγ1

monoclonal antibody (Santa Cruz), or anti-SPHK1 polyclonal (made in house as described), as

primary antibodies. Stainings were analyzed in horizontal confocal microscopy sections (50-100

sections of 0.2 µm), recorded by a Leica TCS NT, and images deconvoluted. Signals were

projected into one image as an extended focus view.

β-Hexosaminidase release

Degranulation was measured using a previously described (23) colorimetric assay to assess the

release of β-hexosaminidase. Briefly, 50µl of the sample supernatant was incubated with 200µl

of 1mM p-nitrophenyl N-acetyl-β-D-glucosiaminide for 1hr at 37°C. The total β-

hexosaminidase concentration was determined by a 1:1 extraction of the remaining buffer and

cells with 1% Triton X-100; a 50µl aliquot was removed and analyzed as described. Reactions

were quenched by addition of 500µl of 0.1M sodium carbonate buffer. The enzyme

concentration was determined by measuring the OD at 400nm. β-hexosaminidase release was

represented as a percent of total enzyme.

9


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Results

In this study we explored the molecular mechanisms regulating receptor coupling to various lipid

modifying-enzymes and relate these to the triggering of Ca2+ signals, and degranulation.

Since SPHK had been shown to play a potential role in triggering Ca2+ release from intracellular

stores, we decided to investigate whether SPHK is indeed involved in the FcεRI triggering of

Ca2+ signals in the human mast cells. Two human sphingosine kinases have recently been cloned

and characterized, namely sphingosine kinase 1 (SPHK1) (15), and sphingosine kinase 2

(SPHK2) (17). First, the presence of specific SPHK isozymes present in the cells was examined.

In bone marrow-derived mast cells only SPHK1 was found by RTPCR (Figure 1A), and by

western blot (Figure 1B). Western blot analysis showed that SPHK1, in resting cells, is found

primarily in the cytosolic fraction of the cells (Figure 1B upper). However, aggregation of FcεRI

resulted in the rapid translocation of SPHK1, from the cytosol to the nuclear-free membrane

fraction (Figure 1B lower). In agreement with this, confocal microscopy also shows that in

resting cells SPHK1 is primarily cytosolic, but after receptor engagement it rapidly translocates

to the cell periphery (Figure 1C).

Sphingosine kinase activity, and its product sphingosine-1-phosphate (SPP), has been shown to

be involved in many cellular processes, including Ca2+ signals (11, 12), suppression of

ceramide-mediated apoptosis (24), and cell survival and proliferation (24). However, the

regulation of SPHK activity is still poorly understood. We have previously shown that a similar

receptor, FcγRI in monocytic cells, triggers sphingosine kinase activity dependent on

phospholipase D (PLD) activation (11, 21). There is also in-vitro evidence for the regulation of

SPHK activity by acidic phospholipids (such as phosphatidic acid, the direct product of PLD

activity) (16). Here we show that in the human bone marrow-derived mast cells FcεRI couples

to PLD1 to activate SPHK1. Antisense to PLD1 blocks FcεRI triggered PLD activity (Figure 2A

upper), and considerably reduced endogenous PLD1 expression levels to only 18% + 5% of the

PLD1 expressed in the control cells taken as 100% (Figure 2A lower). In resting cells, very little

SPHK activity is observed, however, following FcεRI crosslinking SPHK activity very rapidly

increases (Figure 2B). In agreement with the translocation experiments (Figures 1A and 1C),

very little SPHK activity is observed in the membrane fraction of resting cells, however,

10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

following FcεRI crosslinking, SPHK activity very rapidly increases in the membrane fraction to

higher levels than that observed in the cytosolic fraction (Figure 2B, right and left, respectively).

Moreover, antisense to PLD1 blocked the FcεRI triggered SPHK1 activity (Figure 2B upper), but

had no effect on SPHK1 expression (Figure 2B lower). Furthermore, an antisense to SPHK1

blocked FcεRI triggered sphingosine kinase activity (Figure 2B upper), and had no effect on

PLD activity (figure 2A upper), or on PLD1 expression levels (Figure 2A lower), but

considerably reduced endogenous SPHK1 expression levels to only 15% + 5% of the SPHK1

expressed in the control cells taken as 100% (Figure 2B lower). The scrambled oligo used as

control had no effect on the level of expression of either protein. These data suggest that SPHK1

is downstream of PLD1 activity in the FcεRI triggered signal transduction pathways.

In the rat mast cell line RBL-2H, Choi and co-workers (11) showed that FεRI triggered Ca2+

release from intracellular stores was dependent on sphingosine kinase activity, by addition of the

non-selective sphingosine kinase inhibitor dihydrosphingosine (DHS); which reduced the

increase in Ca2+ in response to antigen, while the antigen induced production of IP3 was

unimpaired. However, IP3 is widely known to trigger the release of Ca2+ from intracellular

stores by activating specific receptors on the membranes of these stores (25, 26), and PLCγ has

been shown to be phosphorylated, and to translocate following FcεRI triggering in rat mast cells

(27, 28). To determine whether in the human mast cells, FcεRI triggers IP3-generation and IP3-

mediated Ca2+ release, IP3 generation was monitored over time. We found that, in the human

mast cells, PLC is activated by FcεRI, as shown by the generation of IP3 (Figure 3A).

Moreover, PLCγ1 is the PLC isoform that translocates to the membrane, following FcεRI

engagement (Figure 3B upper). Furthermore, antisense to PLCγ1 inhibited IP3 generation

triggered by FcεRI (Figure 3A), and dowregulated the endogenous PLCγ1 expression levels

(Figure 3B lower). Antisense to SPHK1 had no effect on IP3 production (Figure 3A), or on

PLCγ1 expression levels (Figure 3B lower).

For all experiments the antisense transfection efficiency was very even, an average 85% of the

cells treated with any of the antisense used showed complete downregulation in the expression

11


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

levels of the targeted protein (FACS analysis, data not shown).

In order to clarify the roles of SPHK1 and/or PLCγ1 in the Ca2+ signals generated following

FcεRI engagement, we next used the antisense oligonucleotides against the human SPHK1 and

PLCγ1, to demonstrate which pathway was responsible for Ca2+ triggering in the human mast cells.

It was found that antisense downregulation of SPHK1 substantially inhibited the initial rise in

Ca2+ release from intracellular stores (Figure 4A); however, Ca2+ entry was unaffected (Figure

4A). In cells pretreated with antisense to PLCγ1 the first peak in Ca2+ was unaffected (Figure

4B), however, calcium entry was reduced (Figure 4B). Experiments without extracellular Ca2+

showed that the first, initial, rise in intracellular Ca2+ is due to SPHK1 (Figure 4C), whereas, a

second (smaller) increase in Ca2+ release from internal stores was dues to PLCγ1 (Figure 4C). A

combination of both, antisense to SPHK1 and PLCγ1, completely blocked the calcium response

triggered by FcεRI (Figure 4D). The use of specific inhibitors for SPHK, N,N-dimethyl-

sphingosine (DMS); or for PLC, ET-18-OCH3, generated similar results as those observed with

the antisense oligonucleotides (data not shown).

These results show that FcεRI triggers Ca2+ signals by two different pathways. Firstly, a novel

pathway that uses SPHK1, and is responsible for the initial strong Ca2+ released from internal

stores. Secondly, a more classical pathway that triggers IP3 generation via PLCγ, which triggers

a second although smaller peak in Ca2+ release from intracellular stores, but which is

responsible for triggering Ca2+ entry.

In contrast to previous studies in rat mast cells (11), the non-selective tyrosine kinase inhibitor,

genistein, completely blocked SPHK activity and IP3 generation (Figures 5A and 5B), as well as

FcεRI induced PLD activity, but had no effect on PMA induced PLD activity, suggesting that the

tyrosine kinase inhibitor does not directly inhibits PLD activity (Figure 5C). The FcεRI

triggered membrane translocation of SPHK1 and PLCγ1 was also inhibited by the tyrosine

kinase inhibitor (Figures 5D and 5E, respectively). Moreover, the Ca2+ signals triggered by

12


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

FcεRI, were also completely blocked in cells pretreated with genistein (Figure 5D). These data show

that SPHK1 and PLCγ1 activities, as well as all the Ca2+ signals triggered by FcεRI, are

completely tyrosine kinase dependent.

Mast cells degranulation has been shown to be Ca2+ dependent (2, 3), and linked to

Phospholipase D activity (23, 29, 30). Antisense downregulation of different PLD isoforms is

proving a very useful tool in dissecting the functions of each particular isoenzyme (31).

Antisense downregulation of PLD1 substantially inhibits FcεRI triggered mast cell degranulation

(Figure 6A), but has no effect on IP3 generation (Figure 6B). Similarly, antisense to SPHK1 also

inhibited enzyme release (Figure 6A), and a combination of antisense to PLD1 and SPHK1

almost completely inhibited FcεRI triggered degranulation (Figure 6A), but had no effect on IP3

production. Antisense to PLCγ1 had no effect on enzyme release (Figure 6A), but significantly

reduced IP3 generation (Figure 6B).

These results show that both PLD1 and SPHK1 are necessary for FcεRI to trigger mast

cell degranulation.

13


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Discussion

Taken together, the data presented here demonstrates that the activation of FcεRI by surface

IgE-antigen complexes, on human bone marrow-derived mast cells, stimulates two different

pathways to trigger Ca2+ release from internal stores. A novel pathway, that couples

phospholipase D1 (PLD1) to sphingosine kinase1 activation (SPHK1), is responsible for the

initial peak in the FcεRI generated Ca2+ signals as well as the mast cell degranulation; and a

more classical pathway which triggers PLCγ1 activity and IP3 dependent second wave of Ca2+

release from internal stores, as well as Ca2+ entry into the cells.

The activation of sphingosine kinase and the generation of sphingosine-1-phosphate have been

previously proposed to play a role in mobilizing calcium from intracellular stores (11, 12, 32-

34). However, this proposal has proven highly controversial due to the presence of extracellular

G protein-coupled receptors for sphingosine-1-phosphate (35, 36), which are able to mobilize

calcium through conventional IP3 receptor-dependent pathways. However, the resent cloning of

the SCaMPER receptor (37) provides additional evidence that sphingoid derivatives are able to

engage intracellular receptors and effect calcium release from intracellular stores independently

of IP3 generation. The data presented here provide evidence for specific immune receptor

triggering of this pathway in mast cells. Thus, aggregation of FcεRI resulted in the rapid

membrane translocation and activation of SPHK1. The results presented in this report

demonstrate that the initial peak in Ca2+ release from intracellular stores, triggered by FcεRI, is

dependent on sphingosine kinase activity. In this respect, FcεRI aggregation in human mast cells

is behaving like in the rat mast cell line RBL-2H (11), and like the high affinity IgG receptor,

FcγRI, in human myeloid cells (12). Of interests, both these receptors use the same signal-

transducing molecule (γ-chain) to recruit soluble tyrosine kinases (38, 39). However, unlike the

study in the RBL-2H cells (11), and that of FcγRI in human myeloid cells (12), a second peak in

Ca2+ release from internal stores, as well as Ca2+ influx to the cells, triggered by FcεRI in mast

cells, was dependent on PLCγ1 activation. The mechanism of coupling of tyrosine kinases to

sphingosine kinase activation following FcεRI aggregation in the RBL-2H cells was unclear

(11). Here, we demonstrate that PLD1 is activated following FcεRI aggregation in human mast

cells and that SPHK1 activation is dependent on PLD1 activation. The immediate product of

14


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

PtdCho-PLD is phosphatidic acid, and this is subsequently converted to DAG through the action

of phosphatidic acid phosphohydrolases (14). Previous studies have shown that sphingosine

kinase is activated by phosphatidic acid (16, 40) and not by DAG (16, 40), a product of both

phospholipase D and phospholipase C. Our finding that sphingosine kinase is downstream of

PLD is, therefore, consistent with this in vitro work. Moreover, both components of this novel

FcεRI-coupled intracellular signaling pathway involving the sequential activation of PLD and

sphingosine kinase depend on tyrosine kinase. This finding is consistent with previous in vitro

studies demonstrating that v-Src can activate PLD (41).

Aggregation of FcεRI in mast cells triggers a number of effector functions. The novel

intracellular signaling pathway demonstrated here appears to be functionally associated with

these. Thus, previous studies have implicated phospholipase D in modulating neutrophil,

monocyte and macrophage function, in particular by influencing the respiratory burst/NADPH

oxidase cascade (42), vesicular trafficking (6), and phagocytosis (43). In the study reported here,

inhibiting this pathway at either PLD1 or SPHK1 level reduced the ability of this receptor to

mobilize Ca2+ from intracellular stores. In addition, the inhibition of PLD and/or sphingosine

kinase significantly reduced enzyme release/degranulation. Of interest, ADP-ribosylation factor

(ARF) plays a major role in regulating vesicular trafficking (44-46), and this small weight G

protein has also been demonstrated to regulate phospholipase D activity (31, 45-47).

This potential diversity of phospholipid signaling pathways offers the opportunity within the cell

to very tightly regulate different physiological events of the cell effector mechanisms. The

finding that FcεRI is coupled to the release of calcium from intracellular stores and enzyme

release/degranulation via a novel pathway has profound implication for the development of

strategies for therapeutic intervention against different allergic and inflammatory responses.

Acknowledgements

We thank Dr. Laszlo Takacs for helpful comments during the preparation of the manuscript. A

start-up grant form the National Medical Research Counsel of Singapore supported this work.

15


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

References

1. Beaven, M.A., and Metzger, H. (1993) Immunol. Today 14, 222-226

2. Barnes, P.J., Chung, K.F., and Page, C.P. (1998) Pharmacol. Rev. 50, 515-596

3. Kinet, J.P. (1999) Ann. Rev. Immunol. 17, 931-972

4. Metzger, H. (1992) Immunol. Rev. 125, 37-48

5. Vonakis, B.M., Chen, H., Haleen-Smith, H., and Metzger, H. (1997) J. Biol. Chem. 272,

24072-24080

6. Pribluda, V.S., Pribluda, C., and Metzger, H. (1994) Proc. Natl. Acad. Sci. U.S.A. 91,

11246-11250

7. Jouvin, M.H., Adamczewski, M., Numerof, R., Letourneur, O., Valle, A., and Kinet, J. P.

(1994) J. Biol. Chem. 269, 5918-5925

8. Kihara, H., and Siraganian, R.P. (1994) J. Biol. Chem. 269, 22427-22432

9. Metcalfe, D.D., Baram, D., and Mekori, Y.A. (1997) Physiol. Rev. 77, 1033-1079

10. Dolmetsch, R.E., Lewis, R.S., Goodnow, C.C., and Healy, J.I. (1997) Nature 386, 855-

857

11. Choi, O.H., Kim, J-H., and Kinet, J-P. (1996) Nature 380, 634-636

12. Melendez, A., Floto, R.A., Gillooly, D.J., Harnett, M.M., and Allen, J.M. (1998) J. Biol.

Chem. 273, 9393-9402

13. Exton, J.H. (1997) Physiol. Rev. 77, 303-320

14. English, D., Cui, Y., and Sidiqui, R.A. (1996) Chem. Phys. Lips. 80, 117-132

15. Melendez, A.J., Carlos-Dias, E., Gosink, M., Allen, J.M., and Takacs, L. (2000) Gene

251, 19-26

16. Olivera, A., Kohama, T., Tu, Z., Milstein, S., and Spiegel, S. (1998) J. Biol. Chem. 273,

12576-12583

17. Liu, H., Sugiura, M., Nava, V.E., Edsall, L.C., Kono, K., Poulton, S., Milstien, S.,

Kohama, T., and Spiegel, S. (2000) J. Biol. Chem. 275, 19513-19520

18. Rottem, M., Hul,l G., and Metcalfe, D.D. (1994) Exp. Hematol. 22, 1147-1155

19. Melendez, A.J., Harnett, M.M., and Allen, J.M. (1999) Immunol. 96, 457-464

20. Melendez, A.J., Harnett, M.M., and Allen, J.M. (1999) Immunol. 98, 1-8

21. Melendez, A.J., Bruetschy, L., Floto, R.A., Harnett, M.M., and Allen, J.M. (2001) Blood

16


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

98, 3421-3428

22. Vietor, I., Bader, T., Paiha, K, and Huber, L.A. (2001) EMBO 4:306-312

23. Cohen, J.S., and Brown, A. (2001) Biochemistry 40, 6589-6597

24. Cuvillier, O., Pirianov, G., Kleuser, B., Vanek, P.G., Coso, O.A., Gutkind, J.S., and

Spiegel, S. (1996) Nature 381, 800-803

25. Berridge, M.J. (1993) Nature 261, 315-325

26. Finch, E.A., and Augustine, G.J. (1998) Nature 396, 24-31

27. Park, D.J., Min, H.K., and Rhee, S.G. (1991) J. Biol. Chem. 266, 24237-24240

28. Atkinson, T.P., Kaliner, M.A., and Hohman, R.J. (1992) J. Immunol. 148, 2194-2200

29. Way, G., O’Luanaigh, and Cockroft, S. (2000) Biochem. J. 346, 63-70

30. Brown, F.D., Thompson, N., Saqib, K.M., Clark, J.M., Powner, D., Thompson, N.T.,

Solari, R., and Wakelam, M.J. (1998) Curr. Biol. 8, 835-838

31. Melendez, A.J., Harnett, M.M., and Allen, J.M. (2001) Curr. Biol. 11, 869-874

32. Ghosh, T.K., Bian, J., and Gill, D.L. (1990) Science 248, 1653-1656

33. Mattie, M., Brooker, G., and Spiegel, S. (1994) J. Biol. Chem. 269, 3181-3188

34. Olivera, A., Zhang, H., Carlsson, R.O., Mattie, M.E., Schmidt, R.R., and Spiegel, S.

(1994) J. Biol. Chem. 269, 17924-17930

35. Wu, J., Spiegel, S., and Sturgill, T.W. (1995) J. Biol. Chem. 270, 11484-11488

36. Postma, F.R., Jalink, K., Hengeveld, T., and Moolenaar, W.H., (1996) EMBO J. 15,

2388-2395

37. Mao, C., Kim, S.H., Almenoff, J.H., Rudner, X.L., Kearney, D.M., and Kidman, L.A.

(1996) Proc. Natl. Acad. Sci. U.S.A. 93, 1993-1996

38. Ra, C., Jouvin, M-H., Blank, J., and Kinet, J-P. (1989) Nature 341, 752-754

39. Cambier, J.C. (1995) J. Immunol. 155, 3281-3285

40. Olivera, A., Rosenthal, J., and Spiegel, S. (1996) J. Cell. Biochem. 60, 529-537

41. Jlang, H., Luo, J.Q., Urano, T., Frankel, P., Foster, D.A., and Feig, L.A. (1995) Nature

378, 409-412

42. Qualliotine-Mann, D., Agwu, D.E., Ellenburg, M.D., McCall, C.E., and McPhail, L.C.

(1993) J. Biol. Chem. 268, 23843-23849

43. Kusner, D.J., Hall, C.F., Jackson, S. (1999) J. Immunol. 162, 2266-2274

17


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

44. Ktistakis, N.T., Brown, H.A., Waters, M.G., Sternweis, P.C., and Roth, M.G. (1996) J.

Cell. Biol. 134, 295-306

45. Morgan, C.P., Sengelov, H., Whatmore, J., Borregaard, N., and Cockcroft S. (1997)

Biochem. J. 325, 581-585

46. Caumont, A-S., Galas, M-C., Vitale, N., Aunis, D., and Bader, M-F. (1998) J. Biol.

Chem. 273, 1373-1379.

47. Le Stunff, H., Dokhac, L., Bourgoin, S., Bader, M.F., and Harbon, S. (2000) Biochem. J.

352, 491-499

18


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure legends:

Figure 1. SPHK1 expression and subcellular localization in human BMMC.A. RTPCR analysis of mRNA expression levels before sensitization (1); and after

sensitization (2); line 3 is without primers.B. Western blot analysis of SPHK1 subcellular localization before and after FcεRI

crosslinking. Upper panel, time course for FcεRI crosslinking probing for SPHK1 in the cytosolic fraction: resting cells (1); 30 sec after FcεRI crosslinking (2); 1 min after FcεRI crosslinking (3). Blots were stripped and reprobed HSP 90 for cC. ytosol loading control; Lower panel, time course for FcεRI crosslinking probing for SPHK1 in the nuclear-free membrane fraction: resting cells (1); 30 sec after FcεRI crosslinking (2); 1 min after FcεRI crosslinking (3). Blots were stripped and reprobed for PDGFRα, for membrane loading control.

D. Confocal microscopy of cells immuno-stained for SPHK1. Cells before FcεRI aggregation (Resting cells); cells after crosslinking FcεRI for 1 min (XL FcεRI).Results shown are representative of three separate experiments.

Figure2. FcεRI triggers PLD1 activity upstream of SPHK1.A. Upper panel: PLD basal activity (1); PLD activity after FcεRI crosslinking in control

cells (2); PLD activity after crosslinking FcεRI in cells pretreated with an antisense to PLD1 (3); PLD activity in cell pretreated with an antisense to SPHK1 (4). Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.

A. Lower panel: PLD1 expression is downregulated by the antisense against PLD1. Western blot probed with anti PLD1 antibody, extracts from control cells (control); cells pretreated with an scrambled oligo (Scrambled a.s.); cells pretreated with the antisense to PLD1 (a.s.PLD1); cells pretreated with the antisense to SPHK1 (a.s.SPHK1). For loading control, blots were stripped and reprobed with an anti-PDGFRα antibody (edited band).Results shown are representative of three separate experiments.

B. Upper panel left = cytosol; right = membrane: FcεRI triggers SPHK1 activity downstream of PLD1. Basal SPHK activity control (Basal); SPHK activity after FcεRI crosslinking control (XL FcεRI); SPHK activity after FcεRI crosslinking in cells pretreated with the antisense to SPHK1 (XL FcεRI a.s.SPHK1); SPHK activity after FcεRI crosslinking in cells pretreated with the antisense to PLD1 (XL FcεRI a.s.PLD1). Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.Lower panel: SPHK1 expression is downregulated by the antisense against SPHK1, but not by the PLD1 antisense. Western blot probed with anti SPHK1 antibody, cell extracts from control cells (Control); cells pretreated with an scramble oligo (Scrambled a.s.); cells pretreated with the antisense to SPHK1 (a.s.SPHK1); cells pretreated with the antisense to PLD1 (a.s.PLD1); and 0.5ng of purified recombinant SPHK1 (rSPHK1). For loading control, blots were stripped and reprobed with an anti-PDGFRα antibody (edited band). Results are representative of three separate experiments.

19


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 3. FcεRI triggers PLCγ1 activity and translocation.A. IP3 generation basal control (Basal); IP3 generation after FcεRI crosslinking, control

time course (XL FcεRI); IP3 generation after FcεRI crosslinking, time course, in cells

pretreated with an antisense to PLCγ1 (XL FcεRI a.s.PLCγ1); IP3 generation after FcεRI

crosslinking, time course, in cells pretreated with an antisense to SPHK1 (XL FcεRI a.s.SPHK1). Results sB. hown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.

C. Western blots showing PLCγ1 translocation and downregulation by antisense to PLCγ1. Upper panel: a time course of FcεRI crosslinking, cytosolic fraction probed with an anti- PLCγ1 antibody (upper band), loading control using an anti-HSP 90 antibody (lower band). Middle panel: a time course of FcεRI crosslinking, nuclear-free membrane fraction probed with an anti- PLCγ1 antibody (upper band), loading control using an anti-PDGFRα antibody (lower band). Lower panel: antisense downregulation of PLCγ1. Western blot probed with an anti-PLCγ1 antibody, cell extracts from: control cells (Control); cells pretreated with an Scrambled oligo (Scrambled a.s.); cells pretreated with the antisense to PLCγ1 (a.s.PLCγ1); cells pretreated with the antisense to SPHK1 (a.s.SPHK1). For loading control, blots were stripped and reprobed with an anti- PDGFRα antibody. Results shown are representative of three separate experiments.

Figure 4. FcεRI triggers different cytosolic Ca2+ signals from SPHK1 and PLCγ1.

A. Cytosolic Ca2+ triggered by FcεRI aggregation, cells in 1.5M extracellular Ca2+, time

course control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with the antisense to SPHK1 (XL a.s.SPHK1), cells in 1.5M

extracellular Ca2+.

B. Cytosolic Ca2+ triggered by FcεRI aggregation, cells in 1.5M extracellular Ca2+, time

course control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with the antisense to PLCγ1 (XL a.s.PLCγ1), cells in 1.5M

extracellular Ca2+.

C. Cytosolic Ca2+ triggered by FcεRI aggregation, no extracellular Ca2+, time course

control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in

cells pretreated with the antisense to PLCγ1 (XL a.s.PLCγ1), no extracellular Ca2+;

cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with the

antisense to SPHK1 (XL a.s.SPD. HK1), no extracellular Ca2+.

E. Cytosolic Ca2+ triggered by FcεRI aggregation, cells in 1.5M extracellular Ca2+, time

course control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with both, antisense to SPHK1 and antisense to PLCγ1 (XL a.s.SPHK1

+ a.s.PLCγ1), cells in 1.5M extracellular Ca2+.Results shown are representative of three separate experiments.

Figure 5. FcεRI triggered SPHK activity, PLC activity, PLD activity, Ca2+ signals, as well as

20


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

the translocation of SPHK1 and PLCγ1, are completely blocked by the tyrosine kinase inhibitor genistein.

A. SPHK activity left = cytosol; right = membrane: Basal SPHK activity in control cells (Basal); SPHK activity triggered by FcεRI in control cells (XL FcεRI Control); basal SPHK activity in cells pretreated with 0.35M genistein (Basal + Gen); SPHK activity triggered by FcεRI in cells pretreated with 0.35M genistein (XL FcεRI + Gen). Results shown are the mean + the standard deviation of triplicate measurements and are B. representative of three separate experiments.

C. IP3 generation: Basal IP3 generation in control cells (Basal control); basal IP3

generation in cells pretreated with 0.35M genistein (Basal + Gen); IP3 generation

triggered by FcεRI in control cells (XL control); IP3 generation triggered by FcεRI in

cells pretreated with 0.35M genistein (XL + Gen). Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.

D. PLD activity: Basal PLD activity in control cells (1); PLD activity triggered by FcεRI in control cells (2); basal PLD activity in cells pretreated with 0.35M genistein (3); PLD activity triggered by FcεRI in cells pretreated with 0.35M genistein (4); PLD activity triggered by 10µM PMA iE. n control cells (5); PLD activity triggered by 10µM PMA in cells pretreated with 0.35M genistein (6).

F. Confocal microscopy of cells immunostained for SPHK1. Control cells (Resting cells); control cells 1 min after FcεRI crosslinking (XL Control); cells pretreated with 0.35M genistein 1 min after FcεRI crosslinking (XL + Gen). Results shown are representative of three separate experiments.

G. Confocal microscopy of cells immunostained for PLCγ1. Control cells (Resting cells); control cells 1 min after FcεRI crosslinking (XL Control); cells pretreated with 0.35M genistein 1 min after FcεRI crosslinking (XL + Gen). Results shown are representative of three separate experiments.

H. Cytosolic Ca2+ signals triggered by FcεRI aggregation in control cells (XL Control); or in cells pretreated with 0.35M genistein (XL + Gen). Results shown are representative of three separate experiments.

Figure 6. Mast cell degranulation triggered by FcεRI is dependent on PLD1 and SPHK1, but not on PLCγ1.

Α. β-Hexosaminidase release. Basal (1); β-hexosaminidase release after FcεRI crosslinking control (2); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the antisense to PLCγ1 (3); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the antB. isense to SPHK1 (4); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the antisense to PLD1 (5); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the combined antisense oligos to SPHK1 and to PLD1 (6).

C. IP3 generation is not inhibited by the combined antisense oligos to SPHK1 and to PLD1.

Basal IP3 generation (Basal); IP3 generation after FcεRI crosslinking control (XL

FcεRI); IP3 generation after FcεRI crosslinking in cells pretreated with the combined aD. ntise

nse oligos to SPHK1 and to PLD1 (XL FcεRI a.s.SPHK1 + a.s.PLD1); IP3 generation

21


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

after FcεRI crosslinking in cells pretreated with the antisense to PLCγ1 (XL FcεRI a.s.PLCγ1).Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.

22


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Alirio J. Melendez and Aik K. Khawstimulation of human mast cells

Dichotomy of Ca2+ signals triggered by different phospholipid pathways in antigen

published online February 20, 2002J. Biol. Chem.

10.1074/jbc.M110944200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M110944200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M110944200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2002/02/20/jbc.M110944200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2002/02/20/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2002/02/20/jbc.M110944200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

dichotomy of ca2+ signals triggered by different phospholipid

Documents