KISS1 receptor is preferentially expressed in clinicallynon-functioning pituitary tumors

Marianna Yaron • Ulrich Renner • Suzan Gilad •

Gunter K. Stalla • Naftali Stern • Yona Greenman

� Springer Science+Business Media New York 2014

Abstract

Objective KISS1 is a metastasis suppressor gene involved

in cancer biology. Given the high expression levels of KISS1

and KISS1R in the hypothalamus and the pituitary respec-

tively, we hypothesized that this system could possibly affect

tumor invasiveness and clinical behavior of pituitary tumors.

Methods Expression levels of KISS1 and KISS1R mRNA

were evaluated by RT-PCR. Clinical information pertaining

tumor characteristics was extracted from patients’ charts.

Results Tumors from 39 patients (21 females, mean age

47.5 years) were examined. KISS1R was expressed in 26

(67 %) of samples (94 % of NFPA, 42 % of GH-, 67 % of

ACTH-, and 25 % of PRL-secreting adenomas) and was

found more often in female patients (81 vs. 50 % males,

p \ 0.05); and in NFPA (94 vs. 45.5 % in secreting

tumors; p = 0.003). Patients expressing KISS1R were

older at presentation (50.5 ± 1.4 vs. 38.1 ± 1.3 years;

p = 0.008). In the multivariate analysis, factors signifi-

cantly associated with KISS1R expression included female

gender (OR 13.8, 95 % CI 1.22–155.9; p = 0.03) and

having a NFPA (OR 24.7, 95 % CI 1.50–406.4; p = 0.02).

Tumor size, invasiveness and age at presentation were not

independently associated with KISS1R expression.

Pituitary tumors and normal pituitary were negative for

KISS1 mRNA expression.

Conclusions The majority of human NFPA expressed

KISS1R with lower rates of expression in other types of

pituitary tumors. KISS1R expression did not impart a

clinical beneficial tumor phenotype, as it was not associ-

ated with tumor size or invasiveness. Additional studies are

required to elucidate the role of KISS1 receptor in pituitary

gland physiology and pathology.

Keywords KISS1 � GPR54 � KISS1R � Pituitary adenoma

Abbreviations

NFPA Non functional pituitary adenoma

KISS1R KISS1 receptor

GH Growth hormone

ACTH Adrenocorticotropic hormone

PRL Prolactin

Introduction

The KISS1 gene, localized to chromosome 1, was originally

isolated more than a decade ago from melanoma and breast

carcinoma cells that have lost their ability to metastasize

[1, 2]. Later, a family of peptides encoded by the KISS1 gene

and named kisspeptins were isolated from human placenta

and found to be the endogenous ligands for the than orphan G

protein-coupled receptor GPR54 [3–5], now named KISS1

receptor (KISS1R). KISS1R is highly expressed in placenta,

pituitary and in the brain, mostly within forebrain nuclei,

whereas KISS1 is predominantly expressed in the placenta,

hypothalamus and striatum with lower levels of expression

in testis, pancreas and liver [3–6].

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11102-014-0572-y) contains supplementarymaterial, which is available to authorized users.

M. Yaron � S. Gilad � N. Stern � Y. Greenman (&)

Institute of Endocrinology, Metabolism and Hypertension, Tel

Aviv-Sourasky Medical Center and Sackler Faculty of Medicine,

Tel Aviv University, 6 Weizmann Street, 64239 Tel Aviv, Israel

e-mail: yonagr@tlvmc.gov.il

U. Renner � G. K. Stalla

Neuroendocrinology Group, Max-Plank-Institute of Psychiatry,

Munich, Germany

123

Pituitary

DOI 10.1007/s11102-014-0572-y

There are strong data indicating that KISS1 is a metas-

tasis suppressor gene in melanoma [7], gastric [8], esoph-

ageal [9], bladder [10], papillary thyroid [11], and other

cancers [12–15], in that loss of KISS1 mRNA expression

was correlated with tumor progression, presence of

metastasis and a poor outcome. Nevertheless, these find-

ings are not universal as high KISS1 expression in hepa-

tocellular carcinoma is associated with a worse prognosis,

and the correlation of KISS1 expression with breast cancer

progression remains controversial [16].

In addition to its involvement in cancer biology, the

KISS1/KISS1R system plays a central role in the neuro-

endocrine regulation of reproduction. Loss of function

mutations of KISS1 were found to be associated with lack

of puberty onset and hypogonadotrophic hypogonadism in

humans and rodents, whereas activating mutations led to

precocious puberty [17–21]. There is compelling evidence

pointing to the hypothalamus, and specifically, the GnRH

neurons as the primary site of action of kisspeptins [22].

However, in addition to the GnRH mediated increase in LH

levels, there is mounting evidence that kisspeptins may

directly stimulate gonadotropin secretion at the pituitary

level [22]. KISS1 and KISS1R mRNA and protein have

been shown to be expressed in the rat pituitary [23, 24].

Furthermore, kisspeptin has been shown to elicit LH

secretion, albeit in a lower magnitude than the response to

GnRH, from pituitary cells in vitro from several species

[25], including non-human primates [26].

Given the high expression levels of KISS1 and KISS1R in

the hypothalamus and pituitary respectively, the involve-

ment of this system in gonadotropin secretion, and its effects

on cell growth, migration, motility and adhesiveness in other

organs, we hypothesize that KISS1 or its receptor may be

involved in pituitary tumorigenesis, and could possibly

affect the degree of tumor invasiveness and clinical behavior

of pituitary tumors. Although KISS1 and KISS1R expression

in pituitary tumors has been previously reported [27], its

relationship with tumor invasiveness has not been explored.

Therefore, in the present study, we set out to analyze the

pattern of mRNA expression of KISS1 and KISS1R in

pituitary adenomas, giving special emphasis to possible

associations with tumor clinical characteristics such as size,

invasiveness and hormonal secretion.

Materials and methods

Human normal pituitary gland and pituitary adenoma

tissue

A commercial panel of total RNA from various normal

pituitary tissues was obtained from CLONTECH (Human

Total Master Panel II and human pituitary gland poly-A

RNA; Palo Alto, Ca) pooled from 88 male/female Cauca-

sians. Pituitary tumor specimens were obtained during

transsphenoidal surgery at the Tel Aviv-Sourasky Medical

Center (n = 25). Following surgical excision, all tumors

were immediately snap-frozen in liquid nitrogen and stored

at -80 �C until analysis. Additional cDNA samples from

16 pituitary tumors were received from the Max-Plank

Institute of Psychiatry, Munich, Germany. This study was

approved by the institutional ethics committee of both

medical centers.

Tumor size and invasiveness were defined on the basis

of preoperative radiological investigations and operative

finding as follows: Grade I (microadenomas, \10 mm in

diameter), Grade II (enclosed macroadenomas with or

without suprasellar extension), Grade III (microadenomas

with local invasion of sphenoid and/or cavernous sinus)

and Grade IV tumors (macroadenomas with diffuse inva-

sion into the sella floor/cavernous sinus) [28, 29]. Tumors

of patients diagnosed with PRL-, ACTH- and GH- secret-

ing adenomas had positive staining for the respective over-

secreted hormones, as detected by routine immunohisto-

chemistry staining (IHC). Of the 17 clinically silent NPFA,

two stained positive for b-FSH, five were positive for both

b-LH and b-FSH, and five had negative staining for all

pituitary hormones. IHC data from five NPFA was missing.

Human placental tissue

Human placental tissues were obtained up to 30 min after

spontaneous placental delivery. The collected specimens

were transferred to Petri dishes and washed thoroughly with

physiological saline to remove any contamination with

maternal blood and amniotic fluid. Each tissue sample was

transferred to tubes containing 1.5 ml RNAlater solution

(RNA stabilization reagent, Qiagen GmbH, Germany) and

stored at -70 �C until tissue processing.

RNA isolation and reverse transcription (RT)

Total RNA was extracted from 30 to 200 mg frozen pitu-

itary tumor tissue homogenized in a Polytron 3000

homogenizer (Kinematica AG, Littau, Switzeland) using

Trizol reagent (Life Technologies, Inc., Gaithersburg,

MD), according to the manufacturer’s instructions. RNA

concentration was determined by absortiometry. One lg of

RNA was reverse transcribed using Advantage TM RT-for-

PCR kit (Clontech) and the final pellet was resuspended in

100 ll of DNA-free water. Five ll of this cDNA suspen-

sion together with specific primers in a final concentration

of 0.5 micromolar each, dNTPs 0.2 mM, MgCl2 1.5-

2.5 mM and AmpliTaq Gold polymerase (Perkin Elmer)

1 U were used in a hot start PCR reaction in a final volume

of 50 ll. PCR reactions were performed using the ABI

Pituitary

123

7500 Fast RT-PCR System (Applied Biosystems), using

the following cycling parameters: denaturation at 95 �C for

10 s followed by amplification for 35 cycles (95 �C at 30 s,

68 �C at 40 s). cDNA was amplified by PCR using specific

human primers for KISS1R (forward CGACTTCATGTGC

AAGTTCGTC, reverse CACACTCAATGGCGGTCAG

AG, PCR product size 82 bp), KISS1 (forward primer

AATTCTAGACCCACAGGCCA, and reverse primer

GCATGCTCTGACTCCTTTGGG, PCR product size

389 bp), and ß-actin (forward primer ACACTGTGCCCAT

CTACGAGG, reverse primer AGGGGCCGGACTCGTCA

TACT, PCR product size 621 bp) [4, 30]. PCR products

were fractionated in ethidium bromide stained 2 % agarose

gels for KISS1 and b actin, and in 4 % agarose gels for

KISS1R. Normal placenta, served as a positive control for

KISS1 and KISS1R mRNA expression. b-actin was used as

the endogenous internal control.

Statistical methods

Results are presented as mean ± standard deviation. The

presence of KISS1R expression in the different tumor types

was related to clinical variables, using the Chi square test

for categorical parameters and the non-parametric Mann–

Whitney test for continuous variables. Multivariate logistic

regression model was applied to the data to identify

parameters associated with KISS1R expression. Explana-

tory variables considered to be included in the model: age

at disease presentation, gender, macroadenoma and

microadenoma, grade, invasivity and tumor secretion type.

Three model building methods were used: forced entry,

forward and backward selection. All statistical analyses

were performed using the SAS for Windows, version 9.2.

A p value \0.05 was considered to be statistically

significant.

Results

Demographic and clinicopathological characteristics

The study sample comprised tumors from 39 patients, 21 of

which were female and 18 were male, with a mean age at

diagnosis of 47.5 years (median age 46.6 years; range

19–77 years). There were 17 nonfunctioning pituitary

adenomas (NFPAs), twelve GH-secreting adenomas, six

ACTH-secreting adenomas, and four prolactinomas. In

respect to morphology, four tumors were classified as

Grade I, thirteen were grade II, and twenty one were grade

IV tumors (sixteen non-invasive and twenty two invasive

adenomas). There were no Grade III tumors, and data from

one patient was missing; Tables 1, 2).

KISS1R mRNA expression in pituitary tumors

Expression of KISS1R was found in normal human pitui-

tary and in 26 (67 %) out of 39 analyzed pituitary tumors

samples. Sixteen (94 %) out of 17 clinically nonfunction-

ing pituitary tumors, four (67 %) out of six ACTH-

secreting adenomas, in one (25 %) out of four PRL-

secreting adenomas sample, and five (42 %) out of twelve

GH-secreting adenomas expressed KISS1R mRNA (Fig. 1

and supplementary figure, Tables 1, 2).

KISS1R expression was found more often in female

patients (81 vs. 50 % in male), p \ 0.05; and in NFPA (94

vs. 45.5 % in secreting tumors, respectively; p = 0.003).

Table 1 Demographic and clinical data according to tumor type and KISS1R expression

Tumor type/KISS1R

expression

Total no.

of tested samples

Gender F/M Mean

age ± SD (range)

Micro/macro Invasive/

noninvasive

NFPA 17

1 16 8/8 52.4 ± 15.4 (19–77) 0/16 11/5

- 1 0/1 60 0/1 1/0

ACTH 6

? 4 4/0 45.7 ± 13.8 (33–65) 3/1 1/3

- 2 1/1 29.2 ± 0.3 (29–29.4) 0/2 2/0

PRL 4

? 1 1/0 59 0/1 1/0

- 3 2/1 30.7 ± 7.6 (28–42) 0/3 2/n.k.

GH 12

? 5 4/1 48.2 ± 14.3 (24–60) 0/5 1/2

- 7 2/5 35.1 ± 9.7 (24–50) 1/6 4/3

NFPA non-functioning pituitary adenomas, - samples with negative expression of KISS1R, ? samples with positive expression of KISS1R, n.k.

grading data was not known for one tumor

Pituitary

123

Patients harboring tumors that expressed KISS1R mRNA

were older that those with negative expression (50.5 ± 1.4

vs. 38.1 ± 1.3 years at presentation, respectively;

p = 0.008; Table 1). There were no significant differences

in KISS1R expression according to invasiveness or tumor

grade (Table 2).

In the multivariate logistic regression model, factors

significantly associated with KISS1R expression included

female gender (OR 13.8, 95 % CI 1.22–155.9; p = 0.03)

and having a non-functioning pituitary adenoma (OR 24.7,

95 % CI 1.50–406.4; p = 0.02). Tumor size (microade-

noma or macroadenoma), invasivity and age at presentation

were not independently associated with KISS1R expres-

sion. The results of the multivariate analysis are summa-

rized in Table 3.

KISS1 mRNA was clearly expressed in normal human

placental tissue but was absent in normal pituitary tissue

and in 15 pituitary tumor samples analyzed (10 NFPA, two

GH secreting adenomas, two ACTH secreting tumors and

one prolactinomas), not shown.

Discussion

KISS1 neurons are central regulators of the hypothalamo-

pituitary gonadal axis through direct stimulation of

KISS1R expressing GnRH neurons [22]. The finding that

KISS1 and its receptors are expressed in rat pituitary cells,

and that kisspeptins may directly stimulate pituitary gon-

adotropin secretion in vitro, raised the hypothesis that there

may be another tier of regulation in addition to the well

established hypothalamic level [23, 24]. Kisspeptins have

also been shown to regulate cell growth and adhesion, and

loss of KISS1 expression in several human malignancies

has been linked to the development of a metastatic phe-

notype, and consequently a poor clinical outcome [7, 16].

Hence, the possibility that kisspeptins may also be involved

in the regulation of pituitary tumor development is attrac-

tive, as most pituitary tumors, even when large and locally

invasive do not metastasize.

Table 2 KISS1R expression in relation to clinicopathological tumor

characteristics

Variable No. of tested

samples

KISS1R expression (%)

N = 39

p

Expression ?

Number (%)

-

Number (%)

Adenoma type

NFPA 17 16 (94) 1 (6) 0.003*

ACTH 6 4 (67) 2 (33)

PRL 4 1 (25) 3 (75)

GH 12 5 (42) 7 (58)

Tumor size

Macro 35 23 (66) 12 (34) NS

Micro 4 3 (75) 1 (25) NS

Invasion

Invasive 22 14 (64) 8 (36) NS

Non-

invasive

16 12 (75) 4 (25) NS

Grade

I 4 3 (75) 1 (25) NS

II 13 10 (77) 3 (23) NS

III 0 0 0 NA

IV 21 13 (62) 8 (38) NS

Gender

Male 18 9 (50) 9 (50)

Female 21 17 (81) 4 (19) 0.008

NFPA non-functioning pituitary adenomas, - samples with negative

expression of KISS1R, ? samples with positive expression of

KISS1R

* p \ 0.003 NFPA versus other secreting tumors (ACTH-, PRL-,

GH-secreting tumors)

Fig. 1 PCR analysis of KISS1R mRNA expression in pituitary

adenomas. Lane 1 in all gels: ladder. a Lane 3 NFPA, lanes 6–7

prolactinoma, lane 8 ACTH-secreting adenoma, lane 9 GH-secreting

adenoma, lane 10 prolactinoma, lane 11 normal pituitary gland, lane

12 negative control; b lanes 2–6 NFPA, lane 8 NFPA, lanes 9–11

GH-secreting adenoma, lane 12 - negative control; c lanes 2–3

NFPA, lane 4 GH-secreting adenoma, lanes 5–6 NFPA, lane 7

prolactinoma, lane 8 NFPA, lane 10 NFPA, lane 11 placenta, lane 12

negative control; d lanes 2 and 4 NFPA, lanes 5–7 ACTH-secreting

adenoma, lane 8 NFPA, lanes 9–11 GH-secreting adenoma, lane 12

negative control; e lane 2 NFPA, lanes 3–6 GH-secreting adenoma,

lanes 7–8 ACTH-secreting adenoma, lane 9 negative control

Pituitary

123

In this study we found that KISS1R is expressed in

normal human pituitary, as previously reported by Muir

et al. [5]. Furthermore, the majority of NFPA also

expressed KISS1R, consistent with the gonadotroph cell

origin of these tumors, and with previous reports of

KISS1R co-localization with LH-b cells in rat pituitary

[23]. It should be noted, though, that in the latter study,

only 10 % of LH-b cells co-expressed KISS1R. Thus, it

could be postulated that NFPA gonadotrophs retained

KISS1R expression even after becoming adenomatous.

Nevertheless, the percentage of human gonadotrophs that

express KISS1R is unknown, and any pathophysiological

inference from another species could be inaccurate. Inter-

estingly, KISS1R expression was not restricted to NFPA,

but was also found, albeit at a lower rate, in GH, ACTH

and prolactin secreting tumors. Gutierrez-Pascual et al.

[24] have demonstrated that kisspeptin-10 induced a rise in

free cytosolic Ca2? concentration in rat somatotrophs.

Furthermore, kisspeptin-10 has been reported to stimulate

the secretion of both growth hormone and prolactin from

cultured bovine anterior pituitary cells [31]. Thus, although

this data indirectly implies functional KISS1R expression

in somatotrophs and lactotrophs from other species, it is

imperative that co-localization studies be performed in

normal human pituitary cells. Information thus obtained

could point to a possible mechanism by which KISS1R

could be involved in pituitary tumorigenesis, namely

through loss or de novo acquisition of its expression. The

lack of correlation between KISS1R expression and tumor

size or degree of invasiveness could infer that this gene is

not important for tumor progression. Nevertheless, our

analysis was not quantitative and we cannot rule out a more

subtle type of influence of KISS1R expression on tumor

behavior. That KISS1R expression was more prevalent in

female patients’ tumors suggests that sex steroids could

modulate its tumoral expression. Consistent with this line,

estrogen has been shown to modulate KISS1 and KISS1R

mRNA in rat pituitary [23].

In contrast to the information accumulated from rat

pituitary studies, we were unable to detected KISS1 mRNA

expression neither in the normal human pituitary nor in

pituitary tumor samples. Muir et al. [5], in their seminal

paper reporting the cloning of human KISS1R and the

identification of KISS1 as its ligand, also did not identify

KISS1 expression in the human pituitary. On the other hand,

Martınez-Fuentes et al. [27] reported KISS1 mRNA

expression both in normal human pituitary and roughly in

one third of pituitary tumors, irrespective of their secretory

profile. The discordance between our results may stem from

technical differences in tumor processing and primer sensi-

tivity. Similarly to our findings, Martınez-Fuentes et al. [27]

found KISS1R expression in all pituitary tumor types (with

the exception of two rare TSH-secreting tumors) irrespective

of size, albeit without the preponderant expression in NFPA

detected by us. Important limitations of our study are the

relatively small number of tumors examined, and the fact

that expression analysis was not quantitative.

In conclusion, we have demonstrated that the vast

majority of human NFPA express KISS1R, with lower

rates of expression in other types of pituitary tumors; and

that this expression was more often found in tumors

excised from female subjects and at a higher age of clinical

presentation. We could not prove the hypothesis that

KISS1R expression could impart a clinical beneficial tumor

phenotype, as it was not associated with tumor size or

invasiveness. Undoubtedly, additional studies are required

to elucidate the role of KISS1R in pituitary gland physi-

ology as well as in its pathological processes.

Conflict of interest The authors have no disclosures to declare and

they have no conflict of interest.

Ethical standard We declare that the experiments comply with the

current laws of our country.

References

1. Lee JH, Miele ME, Hicks DJ, Phillips KK, Trent JM, Weissman BE,

Welch DR (1996) KiSS-1, a novel human malignant melanoma

metastasis-suppressor gene. J Natl Cancer Inst 88:1731–1737

2. Lee JH, Welch DR (1997) Suppression of metastasis in human

breast carcinoma MDA-MB-435 cells after transfection with the

metastasis suppressor gene, KiSS-1. Cancer Res 57:2384–2385

3. Kotani M, Detheux M, Vandenbogaerde A, Communi D, Van-

derwinden JM, Le Poul E, Brezillon X, Tyldesley R, Suarez-

Table 3 Multivariate logistic analysis of the association between KISS1R expression and a set of demographic and clinical variables

Covariate Odds ratio (95 % CI) Estimate SE Wald beta p value

Macroadenoma versus microadenoma 0.678 (0.03–15.5) -0.194 0.7985 0.06 0.8

Grade 1.552 (0.01–223.8) 0.219 0.0301 0.03 0.9

Invasivity (invasive vs. non-invasive) 3.138 (0.01–713.5) 1.143 2.768 0.17 0.6

Secretory type (NFPA vs. others) 24.7 (1.50–406.4) 1.603 0.7143 5.04 0.02

Age at the presentation (\50 years vs. older) 1.076 (0.98–1.181) 0.073 0.0475 2.39 0.1

Gender (female vs. male) 13.79 (1.22–155.9) 1.312 0.6187 4.49 0.03

Pituitary

123

Huerta N, Vandeput F, Blanpain C, Schiffmann SN, Vassart G,

Parmentier M (2001) The metastasis suppressor gene KiSS-1

encodes kisspeptins, the natural ligands of the orphan G protein-

coupled receptor GPR54. J Biol Chem 276:34631–34636

4. Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, Kanehashi

K, Terao Y, Kumano S, Takatsu Y, Masuda Y, Ishibashi Y,

Watanabe T, Asada M, Yamada T, Suenaga M, Kitada C, Usuki

S, Kurokawa T, Onda H, Nishimura O, Fujino M (2001)

Metastasis suppressor gene KiSS-1 encodes peptide ligand of a

G-protein coupled receptor. Nature 411:613–617

5. Muir AL, Chamberlain L, Eshourbagy NA, Michalovich D,

Moore DJ, Calamari A, Szekeres PG, Sarau HM, Chambers JK,

Murdock P, Steplewski K, Shabon U, Miller JE, Middleton SE,

Darker JG, Larminie CGC, Wilson S, Bergsma DJ, Emson P,

Faull R, Philpott KL, Harrison DC (2001) AXOR12, a novel

human G protein-coupled receptor, activated by the peptide

KiSS-1. J Biol Chem 276:28969–28975

6. Lee DK, Nguyen T, O’Neill GP, Cheng R, Liu Y, Howard AD,

Coulombe N, Tan CP, Tang-Nguyen AT, George SR, O’Dowd

BF (1999) Discovery of a receptor related to the galanin recep-

tors. FEBS Lett 446:103–107

7. Shirasaki F, Takata M, Hatta N, Takehara K (2001) Loss of

expression of the metastasis suppressor gene KiSS1 during mel-

anoma progression and its association with LOH of chromosome

6q16.3-q23. Cancer Res 61:7422–7425

8. Dhar DK, Naora H, Kubota H, Maruyama R, Yoshimura H,

Tonomoto Y, Tachibana M, Ono T, Otani H, Nagasue N (2004)

Downregulation of KISS-1 expression is responsible for tumor

invasion and worse prognosis in gastric carcinoma. Int J Cancer

111:868–872

9. Ikeguchi M, Yamaguchi K, Kaibara N (2004) Clinical signifi-

cance of the loss of KiSS1 and orphan G-protein-coupled receptor

(hOT7T175) gene expression in esophageal squamous cell car-

cinoma. Clin Cancer Res 10:1379–1383

10. Sanches-Carbayo M, Capodieci P, Cordon-Cardo C (2003)

Tumor suppressor role of KiSS-1 in bladder cancer: loss of KiSS-

1 expression is associated with bladder cancer progression and

clinical outcome. Am J Pathol 162:609–617

11. Ringel MD, Hardy E, Bernet VJ, Burch HB, Schuppert F, Bur-

man KD, Saji M (2002) Metastin receptor is overexpressed in

papillary thyroid cancer and activates MAP kinase in thyroid

cancer cells. JCEM 87:2399

12. Nagai K, Doi R, Katagiri F, Ito T, Kida A, Koizumi M, Masui T,

Kawaguchi Y, Tomita K, Oishi S, Fujii N, Uemoto S (2009)

Prognostic value of metastin expression in human pancreatic

cancer. J Exp Clin Cancer Res 21:28–29

13. Hata K, Dhar DK, Watanabe Y, Nakai H, Hoshiai H (2007)

Expression of metastin and a G-protein-coupled receptor

(AXOR12) in epithelial ovarian cancer. Eur J Cancer

43:1452–1459

14. Ikeguchi M, Hirooka Y, Kaibara N (2003) Quantitative reverse

transcriptase polymerase chain reaction analysis for KiSS-1 and

orphan G-protein-coupled receptor (hOT7T175) gene expression

in hepatocellular carcinoma. J Cancer Res Clin Oncol

129:531–535

15. Martin TA, Watkins G, Jiang WG (2005) KiSS-1 expression in

human breast cancer. Clin Exp Metastasis 22:503–511

16. Makri A, Pissimissis N, Lembessis P, Polychronakos C, Koutsi-

lieris M (2008) The kisspeptin (KiSS-1)/GPR54 system in cancer

biology. Cancer Treat Rev 8:682–692

17. Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno

JS Jr, Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM,

Hendrick AG, Zahn D, Dixon J, Kaiser UB, Slaugenhaupt SA,

Gusella JF, O’Rahilly S, Carlton MB, Crowley WF Jr, Aparicio

SA, Colledge WH (2003) The GPR54 gene as a regulator of

puberty. N Engl J Med 349:1614–1627

18. Seminara SB (2005) Metastin and its G protein-coupled receptor,

GPR54: critical pathway modulating GnRH secretion. Front

Neuroendocrinol 26:131–138

19. de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL, Mil-

grom E (2003) Hypogonadotropic hypogonadism due to loss of

function of the KiSS1-derived peptide receptor GPR54. Proc Natl

Acad Sci USA 100:10972–10976

20. Teles MG, Bianco SD, Brito VN, Trarbach EB, Kuohung W, Xu

S, Seminara SB, Mendonca BB, Kaiser UB, Latronico AC (2008)

A GPR54-activating mutation in a patient with central precocious

puberty. N Engl J Med 358:709–715

21. Silveira LG, Noel SD, Silveira-Neto AP, Abreu AP, Brito VN,

Santos MG, Bianco SD, Kuohung W, Xu S, Gryngarten M,

Escobar ME, Arnhold IJ, Mendonca BB, Kaiser UB, Latronico

AC (2010) Mutations of the KISS1 gene in disorders of puberty.

JCEM 95:2276–2280

22. Pinilla L, Aguilar E, Dieguez C, Millar RP, Tena-Sempere M

(2012) Kisspeptins and reproduction: physiological roles and

regulatory mechanisms. Physiol Rev 92:1235–1316

23. Richard N, Galmiche G, Corvaisier S, Caraty A, Kottler ML

(2008) KiSS-1 and GPR54 genes are co-expressed in rat go-

nadotrophs and differentially regulated in vivo by oestradiol and

gonadotrophin-releasing hormone. J Neuroendocrinol 3:381–393

24. Gutierrez-Pascual E, Martınez-Fuentes AJ, Pinilla L, Tena-

Sempere M, Malagon MM, Castano JP (2007) Direct pituitary

effects of kisspeptin: activation of gonadotrophs and somato-

trophs and stimulation of luteinising hormone and growth hor-

mone secretion. J Neuroendocrinol 19:521–530

25. Navarro VM, Castellano JM, Fernandez-Fernandez R, Tovar S,

Roa J, Mayen A, Nogueiras R, Vazquez MJ, Barreiro ML, Magni

P, Aguilar E, Dieguez C, Pinilla L, Tena-Sempere M (2005)

Characterization of the potent luteinizing hormone-releasing

activity of KiSS-1 peptide, the natural ligand of GPR54. Endo-

crinology 146:156–163

26. Luque RM, Cordoba-Chacon J, Gahete MD, Navarro VM, Tena-

Sempere M, Kineman RD, Castano JP (2011) Kisspeptin regu-

lates gonadotroph and somatotroph function in nonhuman pri-

mate pituitary via common and distinct signaling mechanisms.

Endocrinology 152:957–966

27. Martınez-Fuentes AJ, Molina M, Vazquez-Martınez R, Gahete

MD, Jimenez-Reina L, Moreno-Fernandez J, Benito-Lopez P,

Quintero A, de la Riva A, Dieguez C, Soto A, Leal-Cerro A,

Resmini E, Webb SM, Zatelli MC, degli Uberti EC, Malagon

MM, Luque RM, Castano JP (2011) Expression of functional

KISS1 and KISS1R system is altered in human pituitary adeno-

mas: evidence for apoptotic action of kisspeptin-10. Eur J

Endocrinol 164:355–362

28. Wilson C (1990) Role of surgery in management of pituitary

tumors. Neurosurg Clin N Am 1:139–159

29. Asa SL (1998) Tumors of the pituitary gland. In: Rosai J (eds)

Atlas of tumor pathology, 3rd series Fascicle 22, Armed Forces

Institute of Pathology, Washington, pp 1–214

30. Yan C, Wang H, Boyd DD (2001) KiSS-1 represses 92-kDa type

IV collagenase expression by down-regulating NF-jB binding to

the promoter as a consequence of IjBa-induced block of p65/p50

nuclear translocation. J Biol Chem 276:1164–1172

31. Kadokawa H, Suzuki S, Hashizume T (2008) Kisspeptin-10

stimulates the secretion of growth hormone and prolactin directly

from cultured bovine anterior pituitary cells. Anim Reprod Sci

105:404–408

Pituitary

123