Catalase Expression in Azospirillum brasilense Sp7 Is Regulatedby a Network Consisting of OxyR and Two RpoH Paralogs andIncluding an RpoE1¡RpoH5 Regulatory Cascade

Ashutosh Kumar Rai,a Sudhir Singh,a Sushil Kumar Dwivedi,a Amit Srivastava,a Parul Pandey,a Santosh Kumar,a

Bhupendra Narain Singh,b Anil Kumar Tripathia

aSchool of Biotechnology, Institute of Science, Banaras Hindu University, Varanasi, IndiabDivision of Microbiology, Central Drug Research Institute, Lucknow, India

ABSTRACT The genome of Azospirillum brasilense encodes five RpoH sigma factors:two OxyR transcription regulators and three catalases. The aim of this study was tounderstand the role they play during oxidative stress and their regulatory intercon-nection. Out of the 5 paralogs of RpoH present in A. brasilense, inactivation of onlyrpoH1 renders A. brasilense heat sensitive. While transcript levels of rpoH1 were ele-vated by heat stress, those of rpoH3 and rpoH5 were upregulated by H2O2. Catalaseactivity was upregulated in A. brasilense and its rpoH::km mutants in response toH2O2 except in the case of the rpoH5::km mutant, suggesting a role for RpoH5 inregulating inducible catalase. Transcriptional analysis of the katN, katAI, and katAIIgenes revealed that the expression of katN and katAII was severely compromised inthe rpoH3::km and rpoH5::km mutants, respectively. Regulation of katN and katAII byRpoH3 and RpoH5, respectively, was further confirmed in an Escherichia coli two-plasmid system. Regulation of katAII by OxyR2 was evident by a drastic reduction ingrowth, KatAII activity, and katAII::lacZ expression in an oxyR2::km mutant. This studyreports the involvement of RpoH3 and RpoH5 sigma factors in regulating oxidativestress response in alphaproteobacteria. We also report the regulation of an induciblecatalase by a cascade of alternative sigma factors and an OxyR. Out of the threecatalases in A. brasilense, those corresponding to katN and katAII are regulated byRpoH3 and RpoH5, respectively. The expression of katAII is regulated by a cascade ofRpoE1¡RpoH5 and OxyR2.

IMPORTANCE In silico analysis of the A. brasilense genome showed the presence ofmultiple paralogs of genes involved in oxidative stress response, which included 2OxyR transcription regulators and 3 catalases. So far, Deinococcus radiodurans andVibrio cholerae are known to harbor two paralogs of OxyR, and Sinorhizobium melilotiharbors three catalases. We do not yet know how the expression of multiple cata-lases is regulated in any bacterium. Here we show the role of multiple RpoH sigmafactors and OxyR in regulating the expression of multiple catalases in A. brasilenseSp7. Our work gives a glimpse of systems biology of A. brasilense used for respond-ing to oxidative stress.

KEYWORDS sigma factor RpoH, transcriptional regulator OxyR, catalase, paralogs,cascade

Microorganisms living in a fluctuating environment are constantly exposed to awide variety of environmental stresses, which might be physical, chemical, or

biological. The ability of bacteria to sense and respond to the environmental fluctua-tions is crucial to their survival (1). Bacteria respond to environmental challenges bychanging their pattern of gene expression. To enable this, all bacteria harbor multiple

Received 22 July 2018 Accepted 1September 2018

Accepted manuscript posted online 14September 2018

Citation Rai AK, Singh S, Dwivedi SK, SrivastavaA, Pandey P, Kumar S, Singh BN, Tripathi AK.2018. Catalase expression in Azospirillumbrasilense Sp7 is regulated by a networkconsisting of OxyR and two RpoH paralogs andincluding an RpoE1¡RpoH5 regulatorycascade. Appl Environ Microbiol 84:e01787-18.https://doi.org/10.1128/AEM.01787-18.

Editor Robert M. Kelly, North Carolina StateUniversity

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Anil KumarTripathi, tripathianil@rediffmail.com.

A.K.R. and S.S. are co-first authors.

GENETICS AND MOLECULAR BIOLOGY

crossm

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 1Applied and Environmental Microbiology

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

sigma factors, which include a primary sigma factor and several alternative sigmafactors (2, 3). While the primary sigma factor is responsible for the expression ofhousekeeping genes, alternative sigma factors regulate the expression of specific set ofgenes needed to negotiate the environmental fluctuations (4, 5). The majority of sigmafactors belong to the �70 family, and a typical �70 factor consists of 4 conserveddomains (�1 to �4) and a nonconserved region (NCR) (6). Heat shock sigma factor (RpoHor �32) is a member of the �70 family which lacks �1 and NCR and recognizes promotershaving characteristic �10 and �35 elements. An RpoH protein can be divided intoseveral conserved regions which perform specific roles in the initiation of transcription;e.g., regions 2.1, 2.2, and 3.2 are involved in core binding (7, 8) and regions 2.3, 2.4, 3.1,and 4.2 are involved in strand opening, �10 recognition, DNA binding, and �35recognition, respectively (6). Region C and the RpoH box are the characteristic regionsof RpoH proteins which are absent in other sigma factors. Residues critical for bindingto DnaK and FtsH-mediated degradation are located in the highly conserved region 2.1and region C in the RpoH proteins (71). A stretch of amino acids located betweenregions 2 and 3 of �32 is known to participate in the binding of DnaK, which functionsas an anti-sigma factor of �32 (10).

Oxidative stress is one of the most common types of stress faced by aerobic bacteria.During aerobic respiration, movement of electrons from a substrate to the molecularoxygen occurs via various membrane-associated respiratory enzymes. In this process,some of the electrons leak out to produce reactive oxygen species (ROS) such as O2

�,H2O2, and ˙OH, which are detrimental to the cell, as they damage biomolecules likeDNA, protein, and lipid (11–13). Under normal conditions, cells produce antioxidantenzymes and proteins to detoxify ROS. When the level of ROS generated is higher thanthe intrinsic capability of cells to detoxify them, oxidative stress results. The levels ofROS in the cell are monitored by two types of transcription regulators. In response tothe elevated levels of ROS, DNA binding transcription regulators such as OxyR, SoxR, orOhrR activate oxidative stress-responsive genes by binding to their promoter upstreamregions (14). OxyR is a global transcriptional regulator of the LysR family which helps incoping with H2O2-induced oxidative damage by inducing expression of several genes(15, 16). It binds in the upstream region of the target gene promoter, acting as arepressor or activator (17–19). While Escherichia coli contains one copy of OxyR, somebacteria, such as Deinococcus radiodurans and Vibrio cholerae, harbor two paralogs eachof OxyR (72). Another class of regulators of oxidative stress includes zinc-bindinganti-sigma factors which bind and regulate the activity of their cognate extracytoplas-mic function (ECF) sigma factors. They possess a conserved HxxxCxxC zinc-bindingmotif, which acts as a redox switch to sense peroxide so as to bring a change in theirconformation, causing release of the ECF sigma factors they bind (21, 22). The releasedECF sigma factor then mediates the expression of genes involved in oxidative stressresponse (23).

Plant-associated bacteria have to cope with the ROS released by plants in responseto bacterial infection and colonization (24, 25). They employ multiple mechanisms forsensing ROS levels and regulating the expression of antioxidant enzymes. Catalase andalkyl hydroperoxide reductase (Ahp) are the two main enzymes in the armory ofbacteria which detoxify peroxides such as H2O2, organic peroxides, and peroxynitrite(26). While Ahp is more efficient at scavenging low levels of H2O2, catalases are involvedin the detoxification of high levels of H2O2 (27). Escherichia coli produces two types ofcatalases; one has only catalase activity (KatE; monofunctional catalase), and the otherhas both catalase and peroxidative activities (KatG; bifunctional catalase). Both cata-lases contain heme as a prosthetic group. A third type of catalase (pseudocatalase) isalso reported for some bacteria which contain Mn instead of heme as a prostheticgroup (28). Rhizobia such as Rhizobium etli and Bradyrhizobium japonicum possess onlyone catalase each (9, 29). Sinorhizobium meliloti, however, produces three catalases:KatA, KatB, and KatC. While KatA and KatC are monofunctional, KatB is bifunctional (30).Among the three catalases of S. meliloti, only KatA is inducible and regulated by OxyR(31).

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 2

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Azospirillum brasilense is a Gram-negative, plant growth-promoting rhizobacteriumwhich is known to promote the growth of nonlegume crops and grasses via nitrogenfixation and phytohormone production (32, 33). While residing in soil or in therhizosphere it faces a number of abiotic stresses, including change in pH, salinity,temperature, heavy metal, and ROS. During plant root colonization it has to cope withROS released by roots as a defense response of the host plant. The genome of A.brasilense codes for 1 housekeeping and 22 alternative sigma factors consisting of 10RpoE, 5 RpoH, 1 RpoN, and 6 FecI sigma factors. Out of the 10 RpoE sigma factors,RpoE1 and RpoE2 are involved in coping with photooxidative as well as oxidative stress(34, 35). Both of these RpoE sigma factors respond to photooxidative or oxidative stressthrough their cognate anti-sigma factors, which possess redox-active zinc-bindingmotifs (2). Earlier, we had shown for A. brasilense that carotenoid biosynthesis, whichconfers protection against photooxidative stress (36–38), is regulated by two cascadesof sigma factors, RpoE1¡RpoH2 and RpoE2¡RpoH1 (39). The genome of A. brasilensealso encodes two copies of OxyR regulators, of which one is involved in the negativeregulation of AhpC (40). In this study, we have shown that out of the 5 RpoH paralogsencoded in A. brasilense genome, only RpoH1 is responsible for coping with heat stress,while RpoH3 and RpoH5 are involved in the regulation of expression of catalases. Basedon this as well as earlier studies, we propose a scheme showing a regulatory networkthat is involved in the regulation of expression of enzymes involved in oxidative stressresponse in A. brasilense Sp7.

RESULTSBioinformatic analysis of five rpoH paralogs in the A. brasilense genome. A

BLASTp search of alphaproteobacterial genomes against E. coli RpoH protein revealedthat the genomes in the genus Azospirillum possess more RpoH paralogs than reportedso far for any other alphaproteobacterium. Azospirillum strain B510, A. brasilense Sp245,and Azospirillum amazonense harbor 5, 5, and 2 RpoH paralogs, respectively. Magne-tospirillum and Rhodospirillum, two genera closely related to Azospirillum, harbor 2RpoH paralogs each. The five RpoH paralogs, RpoH1, RpoH2, RpoH3, RpoH4, andRpoH5, encoded by the A. brasilense Sp245 genome contain 294, 300, 291, 296 and 299amino acids, respectively, which show 41%, 36%, 38%, 42%, and 38% identities with E.coli RpoH, respectively.

Comparison of the conserved domains in RpoH paralogs of A. brasilense Sp245.Multiple-sequence alignment of the deduced amino acid sequences of RpoH paralogsin A. brasilense Sp245 showed a high level of similarity in region 2.1 to the RpoH box(particularly regions C and 2.4) and in region 4.2, which are known to be highlyconserved among all sigma factors (Fig. 1, middle). Regions 1.2, 2.1, 3.1, 3.2, and 4.1 arerelatively less conserved. The 10 amino acid residues of the RpoH boxes of AbRpoH1and AbRpoH5 were identical (QKKLFFNLRR). RpoH2 (QKSLFFNLRR) and RpoH3 (QKKLFFSLRR) differed from RpoH1 at the third and seventh positions, respectively (under-lined). RpoH4 (QKKLFFGLSR) differed from RpoH1 at the seventh as well as ninthposition. A close examination of the RpoH boxes of all the five RpoH paralogs of A.brasilense revealed that like all other RpoH factors in alphaproteobacteria, they alsocontained a lysine (K) at the second position. As observed in other alphaproteobacteria,the third amino acid residue in RpoH paralogs of A. brasilense is a lysine except in caseof RpoH2, in which it is a serine. The 4th, 5th, and 6th residues (LFF) are stronglyconserved in all the 5 RpoH paralogs.

Complementation of an E. coli rpoH-null mutant with 5 rpoH paralogs of A.brasilense Sp7. In order to check if the five RpoH paralogs of A. brasilense, which showsequence homology with RpoH of E. coli, can complement the heat-sensitive pheno-type of an E. coli rpoH-null mutant, we cloned all the 5 rpoH genes in a broad-host-range expression vector, pMMB206, transformed into an E. coli rpoH-null mutant (CAG9333) and grown with isopropyl-�-D-thiogalactopyranoside (IPTG) at 42°C. Figure 2shows that an E. coli rpoH-null mutant harboring pMMB206 failed to grow at 42°C.However, the same mutant could grow at 42°C if it expressed any of the 5 rpoH paralogs

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 3

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

of A. brasilense (Fig. 2). This indicated that each of the five rpoH paralogs was able tocomplement an E. coli rpoH-null mutant for heat stress tolerance.

Effects of heat and H2O2 stress on the relative expression of rpoH paralogs. Tofind the role of 5 RpoH sigma factors of A. brasilense Sp7 in tolerating thermal oroxidative stress (generated by H2O2), we examined the effects of heat (40°C) and H2O2

(1 mM) stress on the expression of the 5 rpoH paralogs in A. brasilense cultures (Fig. 3).Results of the real-time reverse transcription-PCR (RT-PCR) analysis showed that heatstress caused 45-fold induction of rpoH1. However, the expression of other rpoHparalogs was induced only 3- to 7-fold. A. brasilense Sp7 cells treated with 1 mM H2O2

induced the levels of rpoH3 and rpoH5 18- and 58-fold, respectively.Effect of inactivation of rpoH paralogs on the ability of A. brasilense to tolerate

heat and H2O2 stress. To check the relative role of RpoH paralogs in the ability of A.brasilense to tolerate heat, we created A. brasilense mutants for each of the 5 rpoHparalogs by inserting a kanamycin resistance gene cassette in each rpoH paralog andplacing them in A. brasilense Sp7 by allele replacement. Comparison of the growth ofthe five rpoH::km mutants at 30°C showed that all of them grew on par with A. brasilenseSp7 except the rpoH5::km mutant, which grew relatively slower than the other 4

FIG 1 Multiple-sequence alignment of amino acid sequences of the 5 RpoH paralogs in Azospirillum brasilense with RpoH of E. coli K-12. The sequences belowbidirectional arrows indicate conserved regions in RpoH. The unique RpoH box is present within the region C in all the 5 RpoH sequences.

FIG 2 Plate assay showing effect of overexpression of five rpoH paralogs (H1 to H5) of A. brasilense onthe heat-sensitive phenotype of the rpoH-null mutant of E. coli CAG 9333. Vector pMMB206 was used asa negative control.

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 4

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

rpoH::km mutants (Fig. 4A). At 40°C, however, growth of rpoH1::km was affected mostadversely; the growth of the remaining four rpoH::km mutants was affected only marginally(Fig. 4B). The compromised growth of the rpoH1::km mutant was restored to normal byexpressing a cloned copy of the rpoH1 gene via an expression vector (Fig. 4C). Since onlyRpoH1 was found to be important in coping with heat stress, we compared growth of allthe rpoH:km mutants under stress caused by H2O2. While growth of the rpoH1::km,rpoH2::km, and rpoH4::km mutants in the presence of 1 mM H2O2 was on par with that ofthe parent, the rpoH3::km mutant showed a notable reduction in growth rate. The growthof the rpoH5::km mutant, however, was severely retarded (Fig. 4D), indicating thatRpoH5 was more important in coping with H2O2-induced oxidative stress than RpoH3.

FIG 3 Relative expression of rpoH paralogs determined by quantitative RT-PCR by using threshold cyclevalues obtained from RNA samples of treated (1 mM H2O2 and 40°C temperature) and untreated A.brasilense Sp7. For normalization, mRNA levels for rpoD (housekeeping sigma factor gene) were used asan internal standard.

FIG 4 (A) Comparison of the growth of A. brasilense Sp7 and its five rpoH::km mutants at 30°C. (B) Comparison of the growth of A. brasilense Sp7 and its fiverpoH::km mutants at 40°C. (C) Growth curve showing ability of the cloned copy of the rpoH1 gene to complement the rpoH1::km mutant at 40°C. (D) Comparisonof the growth of A. brasilense Sp7 and its five rpoH::km mutants treated with 1 mM H2O2. (E) Growth curve showing the ability of the cloned copy of the rpoH5gene to complement the rpoH5::km mutant in the presence of 1 mM H2O2. Each point of the curve shows the mean of triplicates of three independentexperiments, and error bars show SD at each point of the growth.

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 5

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

When a plasmid-borne cloned copy of rpoH5 was expressed in the rpoH5::km mutant,growth was restored to a level comparable to that of the parent (Fig. 4E).

Inactivation of rpoH5 leads to severe reduction in catalase activity. A compar-ison of the catalase activities present in A. brasilense Sp7 and its 5 rpoH::km mutants wascarried out with and without H2O2 treatment by in-gel activity staining (Fig. 5). WithoutH2O2 treatment, catalase activity in all the 5 rpoH::km mutants was on par with that ofthe parent. However, upon H2O2 treatment, catalase activity increased severalfold inthe parent and all the mutants except the rpoH5::km mutant, in which severe reductionin catalase activity was noticed. The level of activity in the rpoH5::km mutant treatedwith H2O2 was on par with that in untreated samples, indicating that the induciblecatalase activity was absent in the rpoH5::km mutant (Fig. 5). Catalase activity in therpoH3::km mutant treated with H2O2 was slightly lower than that observed in the parenttreated with H2O2.

Effect of inactivation of rpoH paralogs in A. brasilense Sp7 on the expression ofkatN::lacZ, katAI::lacZ, and katAII::lacZ fusions. In-gel catalase activity in A. brasilensewith or without H2O2 treatment indicated that A. brasilense possesses a constitutive aswell as an inducible catalase activity. A search of the A. brasilense genome for catalasesrevealed that its genome encodes three paralogs of catalase. In order to understandwhich of the 3 catalase paralogs are regulated by RpoH sigma factors, we constructedlacZ fusions with the promoter regions of the three catalase paralogs (katN, katAI, andkatAII) and mobilized them into A. brasilense Sp7 as well as in all the 5 rpoH::kmmutants. �-Galactosidase assays revealed that katN was not inducible, as treatmentwith H2O2 did not increase the activity in the parent or the mutants, except therpoH3::km mutant, which showed substantially compromised promoter activity with orwithout treatment with H2O2 (Fig. 6B). The katAI promoter activity in the parent as wellas in 5 rpoH::km mutants remained unaffected with or without treatment with H2O2

(Fig. 6C). The katAII promoter activity was upregulated by H2O2 treatment in the parentas well as 4 rpoH::km mutants; for the rpoH5::km mutant, the promoter activity with orwithout H2O2 treatment was reduced drastically (Fig. 6D).

Effect of overexpression of RpoH paralogs on the expression of katN::lacZ,katAI::lacZ, and katAII::lacZ fusions in an E. coli two-plasmid system. In order toconfirm the ability of RpoH sigma factors to activate the promoters of the threeparalogs of catalase genes (katN, katAI, and katAII), we used an E. coli DH5�-basedtwo-plasmid system in which each RpoH paralog was overexpressed individuallythrough a broad-host-range expression vector in E. coli DH5� harboring the katN::lacZ,katAI::lacZ, or katAII::lacZ fusion. Figure 7B shows that the expression of katN::lacZ wasupregulated severalfold by RpoH3, whereas katAII::lacZ expression was strongly up-regulated by RpoH5. katAI::lacZ expression remained unaffected by any of the five RpoH

FIG 5 In-gel assay showing catalase activity of A. brasilense Sp7 and its five rpoH::km mutants with orwithout 1 mM H2O2.

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 6

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

paralogs. These observations further confirmed the ability and specificity of RpoH3 andRpoH5 to activate the promoters of the katN and katAII genes.

Effect of inactivation of the two oxyR paralogs on growth and catalase activityin A. brasilense Sp7. Previously, we have shown that A. brasilense Sp7 genome encodestwo copies of the OxyR transcriptional regulator. The gene encoding OxyR1, wasoriented divergently to ahpC gene and shown to negatively regulate the expression ofahpC (40). The gene encoding OxyR2, however, is oriented divergently to the katAIIgene (AZOBR_31180). In this study, we constructed an oxyR2::km mutant in A. brasilenseSp7 by inserting a kanamycin resistance gene cassette in oxyR2 and mobilizing thegene into A. brasilense Sp7 genome by allele replacement as described earlier (40).Comparison of the growth of the two oxyR1::km mutants with that of their parentshowed that growth of the oxyR1::km mutant was on par with that of the parent. Thegrowth of the oxyR2::km mutant, however, was drastically compromised (Fig. 8A).Functional complementation with the cloned oxyR2 gene revealed that expression ofOxyR2 restored the growth of the oxyR2::km mutant (see Fig. S2 in the supplementalmaterial at http://www.cimap.res.in/ENGLISH/images/Director/Rai_et_al_2018_AEM_Suppl_Figures_S1_S2.pdf). When we carried out the in-gel catalase assay, we ob-served that the catalase activities of the two mutants and the parent were comparablein the absence of H2O2. In the presence of H2O2, however, the catalase activities wereinduced severalfold in A. brasilense Sp7 as well as the oxyR1::km mutant. Such aninduction of catalase activity, however, was absent in the case of the oxyR2::km mutant(Fig. 8C). We also compared peroxide levels in A. brasilense Sp7 and its two oxyR::kmmutants, which showed that the oxyR2::km mutant accumulated considerably higherlevels of peroxide, which might have adversely affected its growth (Fig. 8B). This alsoindicated that OxyR2 acts as a positive regulator of the expression of its divergentlytranscribed gene, katAII.

Expression of katN::lacZ, katAI::lacZ, and katAII::lacZ fusions in A. brasilenseSp7 and its oxyR1::km and oxyR2::km mutants. To study the role of OxyR paralogsin regulating the expression of three catalase paralogs, we mobilized katN::lacZ, katAI::lacZ, and katAII::lacZ fusions in A. brasilense Sp7 and its oxyR1::km and oxyR2::kmmutants. �-Galactosidase assays with or without H2O2 treatment showed that the

FIG 6 (A) Genetic organization of the three paralogs of catalase genes: katAII, katAI, and katN. (B to D) Comparison of �-galactosidaseactivities of katN::lacZ (B), katAI::lacZ (C), and katAII::lacZ (D) in A. brasilense Sp7 and its five rpoH::km mutants in the absence or presenceof 1 mM H2O2.

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 7

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

expression of katN::lacZ and katAI::lacZ was not affected by the inactivation of any ofthe two OxyRs (Fig. 9A and B). However, the expression of katAII::lacZ was severelyaffected in the oxyR2::km mutant (Fig. 9C). This observation further confirmed that outof the three catalase paralogs in A. brasilense Sp7, expression of only katAII wasregulated by OxyR2.

Identification of cis-acting regulatory elements of the inducible catalase generegulated by RpoH5. Since katAII was the catalase gene that was induced by H2O2 andregulated by RpoH5 as well as OxyR2, we determined the transcription start site (TSS)of katAII by 5= rapid amplification of cDNA ends (RACE) to predict the �10 and �35promoter elements. The TSS of katAII was located 46 nucleotides upstream of theinitiation codon AUG, and GGATTT and TTGGAT were predicted as �10 and �35elements, respectively (Fig. 10A). The �35 element of the katAII gene of A. brasilenseSp7 was identical to the �35 element of the previously characterized katA gene ofPseudomonas aeruginosa. To further confirm whether the predicted promoter elementswere correct, the �35 element TTGGAT was replaced with AAGGAT by site-directedmutagenesis. The native promoter (with TTGGAT as the �35 element) and the mutantpromoter (with AAGGAT as the �35 element) were transcriptionally fused with thepromoterless lacZ reporter in a broad-host-range vector and mobilized into A. brasilenseSp7. A �-galactosidase assay revealed that there was severe reduction in the promoteractivity from the mutated promoter compared to the native promoter, indicating that thepredicted �35 element was required for the promoter activity (Fig. 10B). Examination of theupstream region of the katAII promoter revealed presence of a TN11A motif which ischaracteristic of an OxyR binding site. The TN11A motif, however, was absent in the regionupstream of the initiation codons of katN and katAI. We also created two deletions, one (P2)

FIG 7 (A) Scheme of a two-plasmid system showing design for activation of the katN::lacZ, katAI::lacZ,and katAII::lacZ fusions by each of the five paralogs of the rpoH gene in E. coli. (B) �-Galactosidase assayshowing the ability of the 5 RpoH paralogs to activate the katN::lacZ, katAI::lacZ, and katAII::lacZ fusionsin E. coli.

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 8

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

carrying deletion of one arm of the TN11A motif and the second (P3) carrying deletion ofboth the arms of the TN11A motif. Fusion of both these deletions with lacZ showeddrastically reduced �-galactosidase activity in comparison to that shown by the nativekatAII promoter upstream region (Fig. 10C). This further indicated that the predicted TN11Amotif was important for the activation of the katAII gene.

FIG 8 (A) Comparison of the growth of A. brasilense Sp7 and its oxyR1::km and oxyR2::km mutants inMMAB. (B) Dichloro-dihydro-fluorescein diacetate (DCFH-DA) assay showing relative accumulation of ROSin A. brasilense Sp7 and its two oxyR::km mutants. (C) In-gel catalase assay of A. brasilense Sp7 and itsoxyR1::km and oxyR2::km mutants with or without 1 mM H2O2.

FIG 9 Comparison of �-galactosidase activity from the katN::lacZ (A), katAI::lacZ (B), and katAII::lacZ (C)fusions in A. brasilense Sp7 and its oxyR1::km and oxyR2::km mutants in the presence or absence of 1 mMH2O2.

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 9

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

DISCUSSION

Although the occurrence of two copies of genes encoding RpoH sigma factor is acharacteristic feature of alphaproteobacteria, A. brasilense possesses 5 paralogs ofRpoH, the maximum reported for any bacterium so far. While all members of gamma-proteobacteria, including E. coli, harbor a single copy of the rpoH gene, most alpha-proteobacteria possess two RpoH paralogs. Bacteria possessing two RpoH paralogsinclude rhizobia such as R. etli, S. meliloti, Magnetospirillum loti, and Rhizobium legumi-nosarum and nonrhizobial species such as Rhodobacter sphaeroides, Brucella melitensis,Rhodospirillum rubrum, and Bartonella quintana. Bradyrhizobium japonicum is the onlyalphaproteobacterium which was shown to harbor more than two copies of rpoH (41):RpoH1 was involved in the regulation of the heat stress response, while RpoH2 wasessential for the synthesis of cellular proteins under normal growth conditions (41, 42).In R. sphaeroides also, RpoH1 was involved in the regulation of the heat stress response,while RpoH2 was the major player in 1O2 stress response (43). In R. etli, however, RpoH1was involved in responding to heat shock as well as oxidative stress, but RpoH2 wasinvolved in osmotolerance (44).

Heat shock response is a universal phenomenon that enables living cells to over-come several environmental stresses, including heat stress, which causes proteins tounfold and aggregate (45, 46). E. coli possesses only one RpoH sigma factor, whichdrives the expression of more than 100 genes, including heat shock proteins (47).However, inactivation of rpoH in E. coli also leads to defects in coping with oxidativestress (48). In Salmonella enterica serovar Typhimurium also, inactivation of rpoH leadsto a sensitivity 10 times higher for H2O2 (49). This is because ROS generated duringoxidative stress often cause misfolding of proteins and enzymes (50). The presence ofmultiple RpoH sigma factors in alphaproteobacteria, therefore, is an evolutionaryadaptation to meet a biological need in the free-living or plant-associated aerobic

FIG 10 (A) Genetic organization of oxyR2-katAII. For determination of the transcription start site (boldfaceG) of katAII, we conducted 5= RACE to predict the �10 (GGATAA) and �35 (TTGGAT) elements of thepromoters. (B) �-Galactosidase activity from the promoter of the katAII gene with native �35 element andwith a mutant �35 element. (C) Effect of deletion of the promoter upstream region of katAII on the�-galactosidase activity from the katAII::lacZ fusion. P1 encompasses 186 nucleotides downstream TSS and61 nucleotides upstream of the TSS. P2 encompasses 186 nucleotides downstream TSS and 52 nucleotidesupstream of the TSS. P3 encompasses 186 nucleotides downstream TSS and 42 nucleotides upstream of theTSS. Conserved T and A nucleotides with a space of 11 nucleotides are underlined and are shown in bold.

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 10

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

bacteria, which are frequently exposed to oxidative stress. Exposure of cells to one typeof stress can confer protection against other stresses. For example, bacteria challengedwith elevated osmolarity acquire increased tolerance to elevated temperature and ROS(7, 27, 51–53). The level of oxidized glutathione also increases in bacteria after heatshock treatment (54). This is also the reason for the observed cross-protection providedby one type of stress by exposure to mild levels of other types of stresses (55, 56). InRhodobacter sphaeroides, RpoH2 is shown to be involved in controlling the oxidativestress defense system (43) Thus, having two sets of RpoH regulons, one committed forcoping with thermal stress and the other taking care of the oxidative stress, is a veryuseful adaptation, particularly for the plant-associated bacteria, which encounter ROSburst while colonizing the plant (25).

Duplication and divergence of rpoH in A. brasilense and other bacteria seem to havegenerated multiple copies, of which only one remains committed for the heat stress.The other RpoH paralogs, however, seem to have specialized in coping with differenttypes of stresses such as oxidative and photooxidative stress, which also leads tomisfolding of proteins. The process of duplication and divergence for the evolution ofmultiple RpoH paralogs runs the risk of cross talk in the form of leaky expression ofgenes of a different RpoH regulon (57, 58). For the leakproof and tightly regulatedexpression of each regulon, promoters of the target genes of each regulon need todifferentiate distinctly. At the same time, the amino acid residues of regions 2.4, 3.0, and4.2 of the RpoH, which are involved in the recognition of the �10, extended �10, and�35 promoter elements of the heat shock genes (14), also need to change accordinglyso as to recognize their target promoters and to insulate each regulon from the other(57, 58).

Individual RpoH family members from different bacteria can completely, or partially,complement the temperature sensitivity of the E. coli rpoH mutant, indicating that theyare functionally similar to �32. RpoH1 and RpoH2 sigma factors of R. sphaeroides andRhizobium meliloti complement the growth defect of the temperature-sensitive E. coli�32 mutant (44, 59, 60). In A. brasilense Sp7 also, all the 5 RpoH paralogs individuallycomplemented the heat-sensitive phenotype of the E. coli mutant, indicating that all ofthem are functional RpoH proteins. While creating rpoH::km mutants individually foreach rpoH paralog in A. brasilense, we anticipated that it might not be possible to isolatea heat-sensitive rpoH::km mutant, as other copies of rpoH paralogs might complementfor the inactivated copy of rpoH. However, interestingly, the growth of rpoH1::kmmutant was adversely affected at 40°C. However, the growth of the other 4 rpoH::kmmutants was affected only marginally at this temperature. To understand the reasonbehind the failure of the rpoH1::km mutant to grow at 40°C (although it harbors 4 otherfunctional copies of the rpoH gene), we carried out real-time RT-PCR to study theinducibility of expression of the 5 rpoH paralogs at 40°C. The results showed that heatstress induced the expression of only rpoH1 and not of the remaining 4 rpoH paralogs(Fig. 3), which might be the reason for the failure of rpoH1::km mutant to grow at 40°C.

Since only RpoH1 was found to be responsible for coping with heat stress in A.brasilense Sp7, we investigated the role of the other 4 RpoH paralogs in coping withother stresses; our findings showed different levels of expression of the 5 rpoH paralogsunder different abiotic stress conditions. Since oxidative and photooxidative stressesoften lead to the denaturation of proteins, it was hypothesized that other paralogsmight be involved in coping with stresses that cause protein denaturation. We havepreviously shown an involvement of RpoH2 in tolerating photooxidative stress in A.brasilense (36). In this study, the inability of rpoH3::km and rpoH5::km mutants to growat 1 mM H2O2 and severalfold induction of rpoH3 and rpoH5 transcripts by 1 mM H2O2

indicated that both RpoH3 and RpoH5 were involved in coping with H2O2 stress. Theobservation that the catalase activity of rpoH5::km mutant, even after treatment withH2O2, was on par with that of the untreated mutant, indicated that inactivation ofrpoH5 had led to the loss of inducible catalase activity in the rpoH5::km mutant. Thein-gel catalase activity clearly showed that the treatment of A. brasilense Sp7 with H2O2

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 11

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

leads to a substantially higher level of induction, indicating the important role playedby RpoH5 in regulating the expression of inducible catalase activity.

The A. brasilense Sp245 genome encodes 3 paralogs of catalases: KatN, KatAI, andKatAII. Expression studies with katN::lacZ, katAI::lacZ, and katAII::lacZ transcriptionalfusions in A. brasilense and its 5 rpoH::km mutants clearly revealed that katAII wasinducible and regulated by RpoH5. katN was regulated by RpoH3 but not inducible. Wealso reconfirmed these observations using a two-plasmid system in E. coli, in whicheach RpoH sigma factor was expressed via an inducible PtacUV5 promoter (39) to checktheir ability to activate the expression of the katN::lacZ, katAI::lacZ, and katAII::lacZfusions. This study also confirmed that the katN::lacZ and katAII::lacZ fusions wereactivated by RpoH3 and RpoH5 sigma factors, respectively.

Genes organized divergently to the genes encoding transcriptional regulators aremost often regulated by the divergently organized regulator(s) (61). Since katAII in A.brasilense was also organized divergently to the gene encoding OxyR2, we investigatedthe role of OxyR2 in regulating the H2O2 stress response. Previously, we had shown thatoxyR1, which is divergently organized to ahpC in A. brasilense Sp7, was involved in anegative regulation of ahpC expression (40). In this study, we showed that inactivationof oxyR2, even without H2O2 treatment, led to a drastic reduction in the growth of A.brasilense. Since the inducible catalase activity was absent in the oxyR2::km mutant, itmight have resulted in an accumulation of ROS leading to a severely compromisedgrowth. These observations suggested that OxyR2 is required for the expression ofkatAII. Expression of the katN::lacZ, katAI::lacZ, and katAII::lacZ fusions in A. brasilenseSp7 and its oxyR1::km and oxyR2::km mutants further confirmed that OxyR2 wasrequired for katAII expression.

Since KatAII was the most important enzyme involved in coping with H2O2 stress, wealso analyzed the katAII upstream region to show that the predicted �35 element ofthe katAII promoter was identical to that found upstream of the katAII promoter of P.aeruginosa (17). Similarly, we detected a TN11A motif, a potential OxyR binding site,truncation or deletion of which led to the loss of katAII promoter activity in A. brasilense.These studies revealed probable binding sites of RpoH5 and OxyR2 in the upstreamregion of the katAII gene in A. brasilense Sp7. However, whether RpoH5 and OxyR2actually bind to these putative binding motifs would need additional biochemicalevidence. Positive regulation of the target genes of OxyR is carried out by the bindingof OxyR to the operator elements which precede promoter element, and of sigmafactor to the promoter. Binding sites of the sigma factor RpoH5 and the transcriptionalregulator OxyR lie in juxtaposition encompassing a 65-bp sequence. Binding of thetetrameric OxyR to their operator elements is weak and degenerate so that underoxidizing or reducing conditions, it can bind or detach easily from the surface (62). Thisis why the operator sequence always deviates from the consensus so that OxyR canbind loosely to the operator sequence (62, 63). Thus, under oxidizing conditions, RpoH5probably binds to the identified promoter element (TTGGAT and GGATTT) and OxyR2to the TN11A motif preceding the promoter. Simultaneous and juxtaposed binding ofRpoH5 and OxyR2 might facilitate interaction of the � subunit of RpoH5 with the Cterminus of the OxyR protein, which is necessary for the maximal expression of KatAII(64).

A. brasilense is one of the most rhizocompetent bacteria and colonizes the roots ofa large number of crops and grasses (33). In order to combat the ROS released by plantsin response to microbial infection, root-colonizing bacteria need to be armed with arobust and fine-tuned mechanism of sensing ROS and inducing expression of antiox-idant enzymes and proteins. Our present and previous studies show that the A.brasilense genome encodes 2 paralogs of OxyR, 2 RpoE sigma factors whose activity iscontrolled by their cognate redox-sensitive, zinc-binding anti-sigma factors, 5 paralogsof RpoH, 3 paralogs of catalases, and 1 alkyl hydroperoxide reductase (34, 37, 39, 40).Based on these studies, we propose a scheme showing a regulatory network that isinvolved in the regulation of expression of enzymes involved in oxidative stressresponse in A. brasilense (Fig. 11). While OxyR1 negatively regulates the expression of

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 12

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

alkyl hydroperoxide reductase (62), OxyR2 positively regulated expression of the in-ducible catalase. While alkyl hydroperoxide reductase is known to detoxify alkyl hy-droperoxides as well as low levels of H2O2, inducible catalase (KatAII) deals with theenhanced levels of extracellular H2O2. The two zinc-binding anti-sigma factors (ChrR1and ChrR2) of A. brasilense, which regulate the activity of their cognate extracytoplas-mic sigma factors (RpoE1 and RpoE2), are sensitive to H2O2 (34) and participate in thephotooxidative and oxidative stress response. RpoE1 sigma factor regulates the expres-sion of RpoH2 and RpoH5, whereas RpoE2 regulates the expression of RpoH1 andRpoH4 (39). While the RpoE1¡RpoH2 cascade is involved in carotenoid biosynthesis aswell as in photooxidative stress response (39), this study shows that the RpoE1¡RpoH5cascade together with OxyR2 regulates the expression of KatAII, which is the mostpotent and important enzyme for coping with enhanced levels of H2O2. We do not yetknow how the expression of RpoH3 is regulated. This study clearly elucidates the roleof RpoH paralogs (RpoH3 and RpoH5) as well as a transcriptional regulator (OxyR2) inthe regulation of catalase expression in bacteria. The presence of multiple copies ofredox-responsive sigma factors such as RpoE, RpoH, OxyR, and catalases might provideA. brasilense a robust mechanism to protect itself against diverse types of stresses,including oxidative stress prevalent in soil and rhizosphere.

MATERIALS AND METHODSPlasmids, bacterial strains, and growth conditions. Azospirillum brasilense Sp7 was used as a

model organism, E. coli DH5� as a host for cloning and expression, and E. coli S17.1 for conjugativemobilization. While E. coli strains were grown on Luria-Bertani (LB) medium at 37°C, A. brasilense wasgrown on LB medium or MMAB minimal medium (67) at 30°C. Liquid cultures were grown with shakingat 200 rpm. Table 1 lists the strains and plasmids used in this study.

Chemical compounds and antibiotics. Wherever necessary, ampicillin (100 �g ml�1), tetracycline(10 �g ml�1), kanamycin (100 �g ml�1), chloramphenicol (40 �g ml�1), 5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside (X-Gal; 40 �g ml�1), or IPTG (1 mM) was added to the growth medium. H2O2 usedin this study was purchased from Merck, Germany. Enzymes used for DNA manipulation and cloningwere from New England BioLabs (NEB; UK), and those for RACE were from Thermo Scientific (USA).

Gene organization, sequence alignments, and phylogenetic analysis of RpoH paralogs. De-duced amino acid sequences of RpoH homologs were retrieved from the NCBI database (http://www.ncbi.nlm.nih.gov/) and used for clustal-W alignment at EBI server (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Similarity and identity were checked by Sequence Manipulation Suite.

FIG 11 Model showing cascades and network involved in regulating the peroxide stress response in A. brasilense.Two paralogs of rpoE, five paralogs of rpoH, and two paralogs of oxyR regulate the expression of three paralogs ofcatalase and one alkyl hydroperoxide reductase. RpoE1 regulates the expression of RpoH2 and RpoH5, and RpoE2regulates the expression of RpoH1 and RpoH4 (39). Expression of katAII is positively regulated by RpoH5 as well asOxyR2. At the bottom is an enlarged image showing OxyR2 binding to the operator region of katAII through theconserved TN11A motif and RpoH5 binding; the �35 and �10 regions are identified. RpoH3 positively regulates theexpression of katN. We have previously shown that OxyR1 is involved in the regulation of the ahpC gene (40).

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 13

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Effect of heat and H2O2 on relative expression of rpoH paralogs in A. brasilense Sp7. To checkthe effects of elevated temperature (37°C) and 1 mM H2O2 on the relative expression of the 5 rpoHparalogs, the transcript levels (mRNA) of each rpoH paralog were analyzed by real-time RT-PCR. The A.brasilense Sp7 culture was grown an 30°C up to an optical density at 600 nm (OD600) of 0.4 and thenshifted for growth at 37°C as well as in medium containing 1 mM H2O2 for 1 h (up to mid-log phase). Thewhole experiment was set in triplicate with controls. Cultures were harvested and cell pellets used forRNA extraction by the TRIzol method. To avoid DNA contamination in RNA, RNA extract was treated withDNase I (NEB) for 1 h at 37°C and heat inactivated using EDTA at 65°C for 10 min. RNA integrity wasconfirmed by denaturing agarose gel electrophoresis. DNA-free RNA was quantified in a NanoDrop(ND-1000). The cDNA was synthesized by using 2 �g of RNA according to the manufacturer’s instructions(Fermentas). PCR with Taq polymerase and the same set of RT primers was used to check the DNAcontamination for each RNA sample by PCR (ABI) using housekeeping gene rpoD. Expression of eachrpoH paralog was quantified by real-time PCR using SYBR green I (Roche) in a Light Cycler 480 IIinstrument. Quantitative PCR (qPCR) was carried out according to the manufacturer’s instructions(Roche). The protocol used was as follows. The real-time PCR mixture contained 5 �l of 2� Light Cycler480 SYBR green I, 0.5 �M each primer, and 1 �l (2 to 5 ng) of cDNA. The cycling conditions included aninitial incubation step at 95°C for 5 min, followed by 45 cycles of amplification for 10 s at 95°C, 10 s at62°C (single acquisition), and 12 s at 72°C. The final cooling step was at 40°C for 30 s. The housekeepinggene (rpoD) was set as a calibrator.

Inactivation of rpoH1, rpoH3, rpoH4, rpoH5, and oxyR2 in A. brasilense Sp7. Insertional mutantsof rpoH1, rpoH3, rpoH4, rpoH5, and the transcriptional regulator oxyR2 were constructed by inserting akanamycin resistance gene cassette in the middle of the open reading frame (ORF) of each gene and placedin the genome by allele replacement (39) (see Fig. S1 in the supplemental material available at http://www.cimap.res.in/ENGLISH/images/Director/Rai_et_al_2018_AEM_Suppl_Figures_S1_S2.pdf). Primers along withrestriction sites used are given in Table 2.

Growth curve. For plotting growth curves of A. brasilense Sp7 and its mutants, bacterial colonieswere freshly streaked on MMAB plates and incubated overnight. The next day, a single colony was pickedup, inoculated in 40 ml of MMAB in a 150-ml flask, and allowed to grow up to an OD of 0.4. A. brasilenseSp7 and its rpoH::km mutants were exposed to 1 mM H2O2. Optical density of the cultures was recordedat 600 nm at every 4 h up to 24 h in a UV-visible spectrophotometer (Thermo Scientific, USA). Similarly,to check the role of different paralogs of rpoH in heat stress, overnight grown cultures of the rpoH::kmmutants were diluted 100-fold in MMAB and incubated at 30°C and 40°C. Growth was recorded intriplicate at two independent times and plotted using GraphPad Prism.

TABLE 1 Bacterial strains and plasmids used

Strains or plasmids Description Source or reference

Bacterial strainsE. coli DH5� ΔlacU169 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Gibco-BRLE. coli S.17-1 Smr recA thi pro hsdR RP4-2(Tc::Mu; Km::Tn7) 53E. coli CAG 9333 Kmr Tetr; temperature-sensitive mutant (ΔrpoH) of E. coli 66A. brasilense

Sp7 Wild-type strain 70rpoH1::km mutant A. brasilense Sp7 rpoH1 gene disrupted by insertion of the kanamycin resistance gene cassette This workrpoH2::km mutant A. brasilense Sp7 rpoH2 gene disrupted by insertion of the kanamycin resistance gene cassette 36rpoH3::km mutant A. brasilense Sp7 rpoH3 gene disrupted by insertion of the kanamycin resistance gene cassette This workrpoH4::km mutant A. brasilense Sp7 rpoH4 gene disrupted by insertion of the kanamycin resistance gene cassette This workrpoH5::km mutant A. brasilense Sp7 rpoH5 gene disrupted by insertion of the kanamycin resistance gene cassette This workoxyR1::km mutant A. brasilense Sp7 oxyR1 gene disrupted by insertion of the kanamycin resistance gene cassette 40oxyR2::km mutant A. brasilense Sp7 oxyR2 gene disrupted by insertion of the kanamycin resistance gene cassette This work

PlasmidspSUP202 ColE1 replicon; mobilizable suicide vector for A. brasilense; Apr Cmr Tcr 53pUC4K Vector containing the kanamycin resistance gene cassette GE HealthcarepAKR14 rpoH1 disruption plasmid harboring the kanamycin resistance gene (npt) This workpAKR15 rpoH3 disruption plasmid harboring the kanamycin resistance gene (npt) This workpAKR16 rpoH4 disruption plasmid harboring the kanamycin resistance gene (npt) This workpAKR17 rpoH5 disruption plasmid harboring the kanamycin resistance gene (npt) This workpSS2 oxyR1 disruption plasmid harboring the kanamycin resistance gene (npt) This workpCZ750 pFAJ1700 containing the KpnI-AscIlacZ gene from the pCZ367 plasmid; Tetr Ampr 68pAKR18 katAI promoter sequence of A. brasilense Sp7 fused with lacZ in pCZ750 This workpAKR19 katN promoter sequence of A. brasilense Sp7 fused with lacZ in pCZ750 This workpAKR20 katAII promoter sequence of A. brasilense Sp7 fused with lacZ in pCZ750 This workpAKR21 katAII promoter �35 region (TT to AA) of A. brasilense Sp7 fused with lacZ in pCZ750 This workpMMB206 Cmr; broad-host-range, low-copy-number expression vector 69pAKR9 rpoH1 gene of A. brasilense Sp7 cloned at EcoRI and PstI into the pMMB206 vector 39pSNK10 rpoH2 gene of A. brasilense Sp7 cloned into the pMMB206 vector 36pAKR11 rpoH3 gene of A. brasilense Sp7 cloned into the pMMB206 vector 39pAKR12 rpoH4 gene of A. brasilense Sp7 cloned into the pMMB206 vector 39pAKR13 rpoH5 gene of A. brasilense Sp7 cloned into the pMMB206 vector 39

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 14

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

In-gel catalase activity. To compare catalase activities of A. brasilense Sp7 and its mutants,overnight-grown cultures were diluted 100-fold and allowed to grow up to mid-log phase, after whichhalf of the culture was treated with 1 mM H2O2 and grown for additional 1 h. Crude lysates wereprepared from the treated and untreated cultures, and 100 �g of protein was loaded for examiningcatalase activity. Protein was estimated using the Bradford assay (20). Briefly, each sample was loadedonto a native gel (7%) and resolved by electrophoresis at 4°C. The gel was washed three times withdistilled water for 10 min each at room temperature, followed by treatment with 0.003% (vol/vol) H2O2

for 10 min. The gel was then rinsed twice with water for 5 min. Equal volumes of 2% ferric chloride and2% potassium ferricyanide were poured on top of the gel for staining. After the appearance of the bandsshowing catalase activity, the stain was poured off and rinsed 3 or 4 times with water, and the image wascaptured in an Alpha imager.

Construction of lacZ fusions with the promoters of katN, katAI, and katAII. To understandregulation of the promoters of genes encoding three catalases by five paralogs of RpoH and two paralogsof OxyR in A. brasilense, �450-bp upstream regions (relative to initiation codon ATG) of catalase katN(AZOBR_140171), katAI (AZOBR_20017), and katAII (AZOBR_p440183) genes were amplified using primerpairs having restriction sites XbaI and HindIII (listed in Table 2). These amplified PCR products were

TABLE 2 Primers used in this studya

Primer Sequence (5=–3=)katAI F CCCAAGCTTGACGCCAACTTCGGCTACGkatAI R GCTCTAGACGCTTTCTCCCTGAACAGCkatNF CCCAAGCTTCGATGAAGCACACCATGTCGkatNR GCTCTAGAGCGTAGGAGCCCTCCCGCkatAII F CCCAAGCTTCTGGCTGACCGAGCAGCGkatAII R GCTCTAGAGACTCAACTCCTTACGTTTCkatAII-35 (TT¡AA) F CGAAGCATTTGAAACGATGTCAAGGATATATCAACGACACGGCGkatAII-35 (TT¡AA) R CGCCGTGTCGTTGATATATCCTTGACATCGTTTCAAATGCTTCGGSP1 GAATTCTGGTTGTCGGCGACGGGSP2 CCAGCTTCTCGATCAGGTGGSP3 CCTTGGCGTGCACCACCOligo(dT) anchor primer GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTVb

PCR anchor primer GACCACGCGTATCGATGTCGACrpoH1:AF EcoRI CGGAATTCCAGCACCGACCGCAAGAAGATGrpoH1:AR BglII GAAGATCTCGAAGCGCTTCACCGCCTGCrpoH1:BF BglII GAAGATCTACCCCGACCGCGGCTTCCGGrpoH1:BR PstI AACTGCAGCTGGCTGATCATGTACGGGTCrpoH2:AF PstI AAACTGCAGCTGACCCATCTCCCTTTTTCCTAACrpoH2:AR BglII GAAGATCTCTGAGTTCGCCCAGCGCCTCGrpoH2:BF BglII GAAGATCTGAGGCGCTGGGCGAACTCAGCrpoH2:BR EcoRI CGGAATTCGTCCGCCGCCTCTACACCACCrpoH3:AF EcoRI CGGAATTCCGACAGGCTGCGGTACAGCGCrpoH3:AR BglII GAAGATCTGTCCTGCAACTGCGCCTTCAGrpoH3:BF BglII GAAGATCTGCCGAGAACGGCACCTTCGGrpoH3:BR PstI AACTGCAGTCACGACGAACCGCTGGGTGrpoH4:AF EcoRI CGGAATTCCAGCAGGTCGAACTCATGGrpoH4:AR BglII GAAGATCTAACGTCGAGTTCCCGGGCGrpoH4:BF BglII GAAGATCTCCGGAAAGCGACGTGGTGGCrpoH4:BR PstI AACTGCAGTCGGGCGAGGTCCGCAACACrpoH5:AF PstI AACTGCAGGGTGGGGCCTCTCGCTTTGCGrpoH5:AR BglII GAAGATCTCAGGATGTATTCCTGTATGrpoH5:BF BglII GAAGATCTCTTCGTGGGTTCGTCGATTCGCrpoH5:BR EcoRI CGGAATTCCACAGCTGGTCCCTGGTGAAGoxyR2:AF PstI AAACTGCAGAGCTTCTGGAACTCGCTGoxyR2:AR BglII GAAGATCTCAGCAGCAGCAGATCATCoxyR2:BF BglII GAAGATCTGAGGACGGGCACTGCCTGoxyR2:BR EcoRI GGAATTCGACCGTGGACGACGTCTTCRT-rpoH1 F TCCAGGAAATCCGCAAGTTCCRT-rpoH1 R AGCCGGAGATGGCTGGTCACRT-rpoH2 F CCTACATCGACGATCCCGAGACTRT-rpoH2 R GGCCCGTTCGTCACCGCCCTRT-rpoH3 F ACGACTACCTCACTCCCGAGRT-rpoH3 R AGGCCGTAGCCCTGATAGCRT-rpoH4 F AGCAGGTCCACCGCTTCCCRT-rpoH4 R AGACGCAGATGGCTGGTCACRT-rpoH5 F TGCAGGCCGCTCAGAAATTCGATRT-rpoH5 R CATCTTCACCAGGGACCAGCTaUnderlined sequence used for cloning of insert. OE, overexpression; RT, reverse transcription.bV represents G, A, or C.

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 15

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

digested with restriction enzymes XbaI and HindIII and cloned into a similarly digested vector, pCZ750.Once clones were confirmed through restriction digestion, colony PCR, and sequencing, recombinantplasmids were isolated and transformed into E. coli S17.1, which was then used as a donor strain forconjugative mobilization of recombinant plasmids into A. brasilense Sp7 and its 5 rpoH::km mutants(rpoH1::km, rpoH2::km, rpoH3::km, rpoH4::km, and rpoH5::km) and 2 oxyR::km mutants (oxyR1::km andoxyR2::km). Exconjugants were selected on chloramphenicol plate for A. brasilense Sp7 and on chloram-phenicol and kanamycin plates for rpoH::km and oxyR::km mutants.

Two-plasmid system. To ascertain the regulation of promoters of katN, katAI, and katAII by the fiverpoH paralogs, we used an E. coli DH5� based two-plasmid assay system (9) in which each of the 5 rpoHparalogs was cloned downstream of the an IPTG-inducible promoter in pMMB206 and cotransformedindividually with the katN::lacZ, katAI::lacZ, and katAII::lacZ fusions in the vector pCZ750.

�-Galactosidase assay. A. brasilense Sp7 and its mutants were grown overnight in 3 ml of MMABmedium, and on the next day, cultures were diluted 100-fold into 40 ml of MMAB and allowed to growup to an OD600 of 0.4. Cultures were then divided equally into two flasks. One of the flasks was treatedwith 1 mM H2O2 and allowed to grow for additional 1 h. Cultures (2 ml) were pelleted from each samplein triplicate, and the �-galactosidase assay was carried out (65).

Determination of transcription start site by 5= RACE. In order to determine the transcriptional startsite (TSS) of the gene katAII, A. brasilense cultures were grown up to an OD of 0.4 (mid-log phase), treatedwith 1 mM H2O2, and grown for additional 1 h followed by the isolation of total RNA. To remove DNAcontamination, isolated RNA was treated with DNase. To ensure elimination of DNA in the samples,isolated RNA was used as the template for the amplification of the katAII gene using Taq polymerase. Theabsence of any amplification indicated that the isolated RNA was DNA free. To determine the TSS, threedifferent rounds of PCR were carried out. In the first round, cDNA was synthesized using a singlegene-specific primer (GSP3 [Table 2]) with reverse transcriptase (Thermo Scientific, USA). Formation ofcDNA was confirmed by obtaining a PCR product of a specific size using primer pair katAII F/GSP3 (Table2) with Taq polymerase. After the confirmation of cDNA synthesis, poly(A) tailing was carried out withterminal transferase (Thermo Scientific, USA). Once the poly(A) tail was added at the 3= end, a secondround of PCR was carried out using primer pair GSP2/oligo(dT) anchor primer (Table 2). To further specify,a third round of PCR was carried out using primer pair GSP1/anchor primer (Table 2). A specific size of PCRproduct was obtained from the third round of PCR, which was cloned into pGEM-T Easy vector andtransformed into the competent cells of E. coli XL-1 Blue. The next day, some of the randomly picked cloneswere processed for plasmid DNA isolation, followed by sequencing (Sci Genome, India) to map the TSS.

Site-directed mutagenesis. To validate the essentiality of the �35 element predicted on the basisof the TSS, we replaced the native hexameric sequence (TTGGAT) with the mutated hexameric sequence(AAGGAT), where underlined sequence was changed using site-directed mutagenesis, accomplished byusing cloned promoter of katAII in plasmid pCZ750 as a template. PCR cycling conditions used were asdescribed earlier (9). Primers used for site-directed mutagenesis are given in Table 2.

ACKNOWLEDGMENTSThis work was supported by Department of Biotechnology, Government of India. S.S.

and A.K.R. were supported by fellowships from DBT and ICMR, respectively.We appreciate the support received from the coordinator of the School of Biotech-

nology, Banaras Hindu University.We declare no conflicts of interest.

REFERENCES1. de Bruijn FJ, Biran D, Ron EZ, Van Nostrand JD, Zhou A, Zhou J, Ishihama

A, Sharma UK, Jin DJ, Cagliero C, Izard J. 2016. Stress and environmentalregulation of gene expression and adaptation in bacteria. Wiley-Blackwell, Hoboken, NJ.

2. Gross CA, Lonetto M, Losick R. 1992. Bacterial sigma factors, p 129 –176.In McKnight SL, Yamamoto KR (ed), Transcriptional regulation. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY.

3. Helmann JD, Chamberlin MJ. 1988. Structure and function of bacterial� factors. Annu Rev Biochem 57:839 – 872. https://doi.org/10.1146/annurev.bi.57.070188.004203.

4. Missiakas D, Raina S. 1998. The extracytoplasmic function sigma factors:role and regulation. Mol Microbiol 28:1059 –1066. https://doi.org/10.1046/j.1365-2958.1998.00865.x.

5. Rhodius VA, Suh WC, Nonaka G, West J, Gross CA. 2006. Conserved andvariable functions of the �E stress response in related genomes. PLoSBiol 4:e2. https://doi.org/10.1371/journal.pbio.0040002.

6. Gruber TM, Gross CA. 2003. Multiple sigma subunits and the partitioningof bacterial transcription space. Annu Rev Microbiol 57:441– 466. https://doi.org/10.1146/annurev.micro.57.030502.090913.

7. Burgess RR, Anthony L. 2001. How sigma docks to RNA polymerase andwhat sigma does. Curr Opin Microbiol 4:126 –131. https://doi.org/10.1016/S1369-5274(00)00177-6.

8. Joo DM, Nolte A, Calendar R, Zhou YN, Jin DJ. 1998. Multiple regions onthe Escherichia coli heat shock transcription factor sigma32 determinecore RNA polymerase binding specificity. J Bacteriol 180:1095–1102.

9. Panek HR, O’Brian MR. 2004. KatG is the primary detoxifier of hydrogenperoxide produced by aerobic metabolism in Bradyrhizobium japonicum.J Bacteriol 186:7874 –7880. https://doi.org/10.1128/JB.186.23.7874-7880.2004.

10. Narberhaus F, Balsiger S. 2003. Structure-function studies of Escherichiacoli RpoH (�32) by in vitro linker insertion mutagenesis. J Bacteriol185:2731–2738. https://doi.org/10.1128/JB.185.9.2731-2738.2003.

11. Boveris A, Chance B. 1973. The mitochondrial generation of hydrogenperoxide. Biochem J 134:707–716. https://doi.org/10.1042/bj1340707.

12. Imlay JA. 2003. Pathways of oxidative damage. Annu Rev Microbiol57:395– 418. https://doi.org/10.1146/annurev.micro.57.030502.090938.

13. Imlay JA, Fridovich I. 1991. Superoxide production by respiring mem-branes of Escherichia coli. Free Radic Res Comms 12:59 – 66. https://doi.org/10.3109/10715769109145768.

14. Kim J, Park C, Imlay JA, Park W. 2017. Lineage-specific SoxR-mediatedregulation of an endoribonuclease protects non-enteric bacteria fromredox-active compounds. J Biol Chem 292:121–133. https://doi.org/10.1074/jbc.M116.757500.

15. Schell MA. 1993. Molecular biology of the LysR family of transcriptional

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 16

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

regulators. Annu Rev Microbiol 47:597– 626. https://doi.org/10.1146/annurev.mi.47.100193.003121.

16. Zheng M, Wang X, Templeton LJ, Smulski DR, LaRossa RA, Storz G. 2001.DNA microarray-mediated transcriptional profiling of the Escherichia coliresponse to hydrogen peroxide. J Bacteriol 183:4562– 4570. https://doi.org/10.1128/JB.183.15.4562-4570.2001.

17. Heo YJ, Chung IY, Cho WJ, Lee BY, Kim JH, Choi KH, Lee JW, Hassett DJ,Cho YH. 2010. The major catalase gene (katA) of Pseudomonas aerugi-nosa PA14 is under both positive and negative control of the globaltransactivator OxyR in response to hydrogen peroxide. J Bacteriol 192:381–390. https://doi.org/10.1128/JB.00980-09.

18. Ieva R, Roncarati D, Metruccio MM, Seib KL, Scarlato V, Delany I. 2008.OxyR tightly regulates catalase expression in Neisseria meningitidisthrough both repression and activation mechanisms. Mol Microbiol70:1152–1165. https://doi.org/10.1111/j.1365-2958.2008.06468.x.

19. Loprasert S, Fuangthong M, Whangsuk W, Atichartpongkul S, Mongkol-suk S. 2000. Molecular and physiological analysis of an OxyR-regulatedahpC promoter in Xanthomonas campestris pv. phaseoli. Mol Microbiol37:1504 –1514. https://doi.org/10.1046/j.1365-2958.2000.02107.x.

20. Weydert CJ, Cullen JJ. 2010. Measurement of superoxide dismutase,catalase and glutathione peroxidase in cultured cells and tissue. NatProtoc 5:51. https://doi.org/10.1038/nprot.2009.197.

21. Greenwell R, Nam TW, Donohue TJ. 2011. Features of Rhodobactersphaeroides ChrR required for stimuli to promote the dissociation of�(E)/ChrR complexes. J Mol Biol 407:477– 491. https://doi.org/10.1016/j.jmb.2011.01.055.

22. Masloboeva N. 2012. Role of ECF � factors in stress response of Brady-rhizobium japonicum. Doctoral dissertation. ETH Zurich, Zurich, Swit-zerland.

23. Masloboeva N, Reutimann L, Stiefel P, Follador R, Leimer N, Hennecke H,Mesa S, Fischer HM. 2012. Reactive oxygen species-inducible ECF �factors of Bradyrhizobium japonicum. PLoS One 7:e43421. https://doi.org/10.1371/journal.pone.0043421.

24. Muñoz V, Ibáñez F, Figueredo MS, Fabra A. 2016. An oxidative burst andits attenuation by bacterial peroxidase activity is required for optimalestablishment of the Arachis hypogaea-Bradyrhizobium sp. symbiosis. JAppl Microbiol 121:244 –253. https://doi.org/10.1111/jam.13149.

25. Wojtaszek P. 1997. Oxidative burst: an early plant response to pathogeninfection. Biochem J 322:681– 692. https://doi.org/10.1042/bj3220681.

26. Poole LB. 2005. Bacterial defenses against oxidants: mechanisticfeatures of cysteine-based peroxidases and their flavoprotein reduc-tases. Arch Biochem Biophy 433:240 –254. https://doi.org/10.1016/j.abb.2004.09.006.

27. Imlay JA. 2013. The molecular mechanisms and physiological conse-quences of oxidative stress: lessons from a model bacterium. Nat RevMicrobiol 11:443– 454. https://doi.org/10.1038/nrmicro3032.

28. Zamocky M, Koller F. 1999. Understanding the structure and functionof catalases: clues from molecular evolution and in vitro mutagenesis.Prog Biophys Mol Biol 72:19 – 66. https://doi.org/10.1016/S0079-6107(98)00058-3.

29. Dombrecht B, Heusdens C, Beullens S, Verreth C, Mulkers E, Proost P,Vanderleyden J, Michiels J. 2005. Defence of Rhizobium etli bacteroidsagainst oxidative stress involves a complexly regulated atypical 2-Cysperoxiredoxin. Mol Microbiol 55:1207–1122. https://doi.org/10.1111/j.1365-2958.2005.04457.x.

30. Jamet AS, Sigaud G, Van de Sype A, Puppo A, Hérouart D. 2003.Expression of the bacterial catalase genes during Sinorhizobium meliloti-Medicago sativa symbiosis and their crucial role during infection process.Mol Plant Microbe Interact 16:217–225. https://doi.org/10.1094/MPMI.2003.16.3.217.

31. Luo L, Qi MS, Yao SY, Cheng HP, Zhu JB, Yu GQ. 2005. Role of OxyR fromSinorhizobium meliloti in regulating the expression of catalases. ActaBiochim Biophys Sin 37:421– 428. https://doi.org/10.1111/j.1745-7270.2005.00055.x.

32. Baldani JI, Krieg NR, Baldani VLD, Hartmann A, Dobereiner J. 1979. GenusII. Azospirillum Tarrand, Krieg and Dobereiner, 79AL, p 358 –359. InGarrity GM, Brenner DJ, Krieg NR, Staley JT (ed), Bergey’s manual ofsystematic bacteriology, vol 2. Springer, New York, NY.

33. Steenhoudt O, Vanderleyden J. 2000. Azospirillum, a free-living nitrogen-fixing bacterium closely associated with grasses: genetic, biochemicaland ecological aspects. FEMS Microbiol Rev 24:487–506. https://doi.org/10.1111/j.1574-6976.2000.tb00552.x.

34. Gupta N, Gupta A, Kumar S, Mishra R, Singh C, Tripathi AK. 2014.Cross-talk between cognate and non cognate RpoE sigma factors and

Zn2�-binding anti-sigma factors regulates photooxidative stress re-sponse in Azospirillum brasilense. Antioxid Redox Signal 20:42–59.https://doi.org/10.1089/ars.2013.5314.

35. Gupta N, Kumar S, Mishra MN, Tripathi AK. 2013. A constitutively ex-pressed pair of rpoE2-chrR2 in Azospirillum brasilense Sp7 is required forsurvival under antibiotic and oxidative stress. Microbiology 159:205–218.https://doi.org/10.1099/mic.0.061937-0.

36. Kumar S, Rai AK, Mishra MN, Shukla M, Singh PK, Tripathi AK. 2012.RpoH2 sigma factor controls the photooxidative stress response in anon-photosynthetic rhizobacterium, Azospirillum brasilense Sp7. Micro-biology 158:2891–2902. https://doi.org/10.1099/mic.0.062380-0.

37. Mishra MN, Kumar S, Gupta N, Kaur S, Gupta A, Tripathi AK. 2011. Anextracytoplasmic function sigma factor cotranscribed with its cognateanti-sigma factor confers tolerance to NaCl, ethanol and methylene bluein Azospirillum brasilense Sp7. Microbiology 157:988 –999. https://doi.org/10.1099/mic.0.046672-0.

38. Thirunavukkarasu N, Mishra MN, Spaepen S, Vanderleyden J, GrossCA, Tripathi AK. 2008. An extra-cytoplasmic function sigma factor andanti-sigma factor control carotenoid biosynthesis in Azospirillumbrasilense. Microbiology 154:2096 –2105. https://doi.org/10.1099/mic.0.2008/016428-0.

39. Rai AK, Dubey AP, Kumar S, Dutta D, Mishra MN, Singh BN, Tripathi AK.2016. Carotenoid biosynthetic pathways are regulated by a network ofmultiple cascades of alternative sigma factors in Azospirillum brasilenseSp7. J Bacteriol 198:2955–2964. https://doi.org/10.1128/JB.00460-16.

40. Singh S, Dwivedi SK, Singh VS, Tripathi AK. 2016. Expression of alkylhydroperoxide reductase is regulated negatively by OxyR1 and posi-tively by RpoE2 sigma factor in Azospirillum brasilense Sp7. Microbiology162:1870 –1883. https://doi.org/10.1099/mic.0.000363.

41. Narberhaus F, Krummenacher P, Fischer HM, Hennecke H. 1997. Threedisparately regulated genes for sigma 32-like transcription factors inBradyrhizobium japonicum. Mol Microbiol 24:93–104. https://doi.org/10.1046/j.1365-2958.1997.3141685.x.

42. Narberhaus F, Käser R, Nocker A, Hennecke H. 1998. A novel DNAelement that controls bacterial heat shock gene expression. Mol Micro-biol 28:315–323. https://doi.org/10.1046/j.1365-2958.1998.00794.x.

43. Nuss AM, Glaeser J, Klug G. 2009. RpoHII activates oxidative-stress de-fense systems and is controlled by RpoE in the singlet oxygen-dependent response in Rhodobacter sphaeroides. J Bacteriol 191:220 –230. https://doi.org/10.1128/JB.00925-08.

44. Martínez-Salazar JM, Sandoval-Calderón M, Guo X, Castillo-Ramírez S,Reyes A, Loza MG, Rivera J, Alvarado-Affantranger X, Sánchez F, GonzálezV, Dávila G, Ramírez-Romero MA. 2009. The Rhizobium etli RpoH1 andRpoH2 sigma factors are involved in different stress responses. Microbi-ology 155:386 –397. https://doi.org/10.1099/mic.0.021428-0.

45. Arsène F, Tomoyasu T, Bukau B. 2000. The heat shock response ofEscherichia coli. Int J Food Microbiol 55:3–9. https://doi.org/10.1016/S0168-1605(00)00206-3.

46. Baker TA, Grossman AD, Gross CA. 1984. A gene regulating the heatshock response in Escherichia coli also affects proteolysis. Proc Natl AcadSci U S A 81:6779 – 6783.

47. Nonaka G, Blankschien M, Herman C, Gross CA, Rhodius VA. 2006.Regulon and promoter analysis of the E. coli heat-shock factor, �32,reveals a multifaceted cellular response to heat stress. Gene Dev 20:1776 –1789. https://doi.org/10.1101/gad.1428206.

48. Kogoma T, Yura T. 1992. Sensitization of Escherichia coli cells to oxidativestress by deletion of the rpoH gene, which encodes the heat shock sigmafactor. J Bacteriol 174:630 – 632. https://doi.org/10.1128/jb.174.2.630-632.1992.

49. Bang IS, Frye JG, McClelland M, Velayudhan J, Fang FC. 2005. Alternativesigma factor interactions in Salmonella: �E and �H promote antioxidantdefenses by enhancing �S levels. Mol Microbiol 56:811– 823. https://doi.org/10.1111/j.1365-2958.2005.04580.x.

50. Cabiscol CE, Jordi TS, Joaquim RS. 2000. Oxidative stress in bacteria andprotein damage by reactive oxygen species. Int Microbiol 3:3– 8.

51. Gunasekera TS, Csonka LN, Paliy O. 2008. Genome-wide transcriptionalresponses of Escherichia coli K-12 to continuous osmotic and heatstresses. J Bacteriol 190:3712–3720. https://doi.org/10.1128/JB.01990-07.

52. Kourennaia OV, Tsujikawa L. 2005. Mutational analysis of Escherichia coliheat shock transcription factor sigma 32 reveals similarities with sigma70 in recognition of the 35 promoter element and differences in pro-moter DNA melting and 10 recognition. J Bacteriol 187:6762– 6769.https://doi.org/10.1128/JB.187.19.6762-6769.2005.

53. Simon R, Priefer U, Puehler A. 1983. A broad host range mobilization

Regulation of H2O2 Stress by RpoH Sigma Factors Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 17

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from

system for in vivo genetic engineering: transposon mutagenesis in Gramnegative bacteria. Biotechnology 1:784 –791. https://doi.org/10.1038/nbt1183-784.

54. Bochner BR, Lee PC, Wilson SW, Cutler CW, Ames BN. 1984. AppppAand related adenylylated nucleotides are synthesized as a conse-quence of oxidation stress. Cell 37:225–232. https://doi.org/10.1016/0092-8674(84)90318-0.

55. Jenkins DE, Schultz JE, Matin A. 1988. Starvation induced cross protec-tion against heat or H2O2 challenge in Escherichia coli. J Bacteriol 170:3910 –3914. https://doi.org/10.1128/jb.170.9.3910-3914.1988.

56. Völker U, Mach H, Schmid R, Hecker M. 1992. Stress proteins andcross-protection by heat shock and salt stress in Bacillus subtilis. J GenMicrobiol 138:2125–2135. https://doi.org/10.1099/00221287-138-10-2125.

57. Barnett MJ, Bittner AN, Toman CJ, Oke V, Long SR. 2012. Dual RpoHsigma factors and transcriptional plasticity in a symbiotic bacterium. JBacteriol 194:4983– 4994. https://doi.org/10.1128/JB.00449-12.

58. Nuss AM, Glaeser J, Berghoff BA, Klug G. 2010. Overlapping alterna-tive sigma factor regulons in the response to singlet oxygen inRhodobacter sphaeroides. J Bacteriol 192:2613–2623. https://doi.org/10.1128/JB.01605-09.

59. Green HA, Donohue TJ. 2006. Activity of Rhodobacter sphaeroides RpoHII,a second member of the heat shock sigma factor family. J Bacteriol188:5712–5721. https://doi.org/10.1128/JB.00405-06.

60. Karls RK, Brooks J, Rossmeissl P, Luedke J, Donohue TJ. 1998. Metabolicroles of a Rhodobacter sphaeroides member of the sigma32 family. JBacteriol 180:10 –19.

61. Beck CF, Warren RA. 1988. Divergent promoters, a common form of geneorganization. Microbiol Rev 52:318.

62. Tartaglia LA, Gimeno CJ, Storz G, Ames BN. 1992. Multi degenerate DNArecognition by the OxyR transcriptional regulator. J Biol Chem 267:2038 –2045.

63. Choi HJ, Kim SJ, Mukhopadhyay P, Cho S, Woo JR, Storz G, Ryu SE. 2001.

Structural basis of the redox switch in the OxyR transcription factor. Cell105:103–113. https://doi.org/10.1016/S0092-8674(01)00300-2.

64. Tao K, Fujita N, Ishihama A. 1993. Involvement of the RNA polymerase �subunit C-terminal region in co-operative interaction and transcriptionalactivation with OxyR protein. Mol Microbiol 7:859 – 864. https://doi.org/10.1111/j.1365-2958.1993.tb01176.x.

65. Miller JH. 1972. Experiments in molecular genetics: a laboratory manual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

66. Zhou YN, Kusukawa N, Erickson JW, Gross CA, Yura T. 1988. Isolation andcharacterization of Escherichia coli mutants that lack the heat shocksigma factor sigma 32. J Bacteriol 170:3640 –3649. https://doi.org/10.1128/jb.170.8.3640-3649.1988.

67. Vanstockem M, Michiels K, Vanderleyden J, Van Gool AP. 1987. Trans-poson 433 mutagenesis of Azospirillum brasilense and Azospirillumlipoferum: physical analysis 434 of Tn5 and Tn5-Mob insertion mutants.Appl Environ Microbiol 53:410 – 415.

68. Blanvillain SD, Boulanger A, Lautier M, Guynet C, Denancé N, Vasse J,Lauber E, Arlat M. 2007. Plant carbohydrate scavenging through tonBdependent receptors: a feature shared by phytopathogenic andaquatic bacteria. PLoS One 2:e224. https://doi.org/10.1371/journal.pone.0000224.

69. Morales VM, Bäckman A, Bagdasarian M. 1991. A series of wide host-range low-copy-number vectors that allow direct screening for recom-binants. Gene 97:39 – 47. https://doi.org/10.1016/0378-1119(91)90007-X.

70. Nur I, Yuval LS, Okon Y, Henis Y. 1981. Carotenoid composition andfunction in nitrogen-fixing bacteria of the genus Azospirillum. J GenMicrobiol 122:27–32.

71. Obrist M, Langklotz S, Milek S, Führer F, Narberhaus F. 2009. Region C ofthe Escherichia coli heat shock sigma factor RpoH (�32) contains aturnover element for proteolysis by the FtsH protease. FEMS MicrobiolLett 290:199 –208. https://doi.org/10.1111/j.1574-6968.2008.01423.x.

72. Wang H, Naseer N, Chen Y, Zhu AY, Kuai X, Galagedera N, Liu Z, Zhu J. 2017.OxyR2 modulates OxyR1 activity and Vibrio cholerae oxidative stress re-sponse. Infect Immun 85:e00929-16. https://doi.org/10.1128/IAI.00929-16.

Rai et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01787-18 aem.asm.org 18

on May 22, 2020 by guest

http://aem.asm

.org/D

ownloaded from