ca2+ clearance 2010

7/30/2019 Ca2+ Clearance 2010

http://slidepdf.com/reader/full/ca2-clearance-2010 1/13

53

INTRODUCTION

Opti neropthies re ommon se o vision

loss nd blindness. Indeed, ntionl impirmento the opti nerve ets the trnsmission o thevisl inormtion, olleted nd enoded by theretin, to the brin ortil reion devoted to vislinormtion nlysis. Retinl nlion ell (RGC)deth is the niyin etre o ll diseses o theopti nerve, inldin lomtos opti nerop-thy, one o the most ommon ses o blindness.

Ophthalmic Genetics, 31(2), 53–65, 2010

Copyright © 2010 Informa Healthcare USA, Inc.

ISSN: 1381-6810 print/ 1744-5094 online

DOI: 10.3109/13816811003698117

ORIGINAL ARTICLE

Characterization o Ca2+ Signalling in PostnatalMouse Retinal Ganglion Cells: Involvement o

OPA1 in Ca2+ Clearance

Govindn Dynithi1,2,3,4,*, Mrielle Chen-Ko-Chn1,2,3,*, Cedri Viero1,5,Christin Hmel1,2,3, Anès Mller1,2,3, nd Gy Leners1,2,3

1Institut des Neurosciences de Montpellier, INSERM U583, Montpellier, France2Université de Montpellier, Médicine 1, Montpellier France

3Université de Montpellier 2, Montpellier, France4Institute of Experimental Medicine, Academy of Sciences of the Czech Republic, Prague, Czech Republic

5

Wales Heart Research Institute, Cardiff, United Kingdom

AbSTRACT

Purpose: The reltion o C2+ entry nd removl is ne-tned proess whih remins not wellunderstood in mouse retinal ganglion cells (RGCs). The latter are known to be sensitive to dysunc-tions o mitohondri, ornelles plyin pivotl role in C2+ reptke.

Methods: We rst desribed the C2+ sinls o RGCs in response to vried drs with Fr-2imin, nd seondly tested the role o opti trophy 1 or OPA1, the ene responsible or Ato-somal Dominant Optic Atrophy, on mitochondrial ability to capture intracellular Ca2+ in cells trans-eted with the OPA1 smll intererin ribonlei ids (siRNAs).

Results: In ontrol RGCs, K+

-evoked [C2+

]i inrese ws bloked by the C2+

hnnel ntonists(Ni2++ Cd2+) nd GABAA

reeptor onist msimol-inded [C2+]iresponses were ttented by

the GABAA

reeptor ntonists, pirotoxin nd bzine. We lso prove the presene o NMDAand AMPA/Kainate (glutamate receptor agonists) responsive receptors in this model. Applicationo ylopizoni id, n inhibitor o C2+-ATPse pmps o the intrelllr C2+ stores, indedan increase in [Ca2+]

iwhile ryanodine or caeine had no eect on resting [Ca2+]

i. Spontaneous Ca2+

oscillations in contacting neurons highlighted the importance o cross-talks between RGCs duringmaturation. The mitochondrial respiration uncoupler, carbonyl cyanide 3-chlorophenylhydrazone(CCCP), inded robst rises o intrelllr C2+ ter K+ pplition, with more prononedeet in ells silened or OPA1, whih old led to ell deth.

Conclusions: Or reslts indite n importnt role o OPA1 in mitohondril dependent C2+ homeostsis nd ell srvivl in RGCs, sestin possible ptho-physioloil mehnisminvolved in inherited opti neropthies.

KEYWORDS: Retinal ganglion cells; Ca2+ homeostasis; Ca2+ clearance; Mitochondria; Optic atrophies

Reeived 24 November 2009; Revised 08 Jnry 2010;Aepted 11 Febrry 2010

* Eql ontribtors to this work.Correspondence: Guy Lenaers, INSERM U583, Institut des Neuro-sciences de Montpellier, BP 74103, 80 Rue Augustin Fliche, F-34091

Montpellier edex 5, Frne. E-mil: [email protected]

http://informahealthcare.com/doi/abs/10.3109/13816811003698117

mailto:[email protected]

mailto:[email protected]

http://informahealthcare.com/doi/abs/10.3109/13816811003698117

7/30/2019 Ca2+ Clearance 2010


54 G. Dayanithi et al.

Ophthalmic Genetics

In lom, there my be more thn one pthwyledin to RGC deth, bt mh ttention hs beenosed on ltmte-medited exitotoxiity.1 Innon-lomtos opti neropthies, mitohondrildysunction is considered as the central hallmark o theneuronal degeneration. This is particularly evident or

inherited optic neuropathies (ION), that to the presentdy re ll relted to enes enodin mitohondrilproteins.2 For maternally transmitted Leber ION, threeprincipal mutations in the mitochondrial DNA, mainlyin ND1, ND4 nd ND6 enes, etin the omplex I(NADH oxydo-redtse) rom the respirtory hin,re responsible or severe te opti nerve dysn-tion ollowed by RGC deenertion.3,4 In the se o Dominnt Opti Atrophies, whih re hroni IONs,mttions in the opti trophy 1 (OPA1) nd OPA3enes hve been identied, both enodin mitohon-dril proteins tin on the inner membrne.5,6

[C2+

]i plys mjor role in elllr sinllin7

ndin the ontrol o severl neronl ntions,8,9 drindevelopment o peripherl nervos system,10 in11 nd ell deth.12 The inrese in [C2+]

ileds to tiv-

tion o spei elllr ntions dependin on sev-erl elllr tors, whih o-ordinte the ontrol o C2+ homeostsis. Over or dedes, mitohondrihs been shown to be n importnt ornelle or C2+ homeostasis, acting as a major Ca2+ reservoir by takingup large Ca2+ loads.13 Aecting mitochondrial unctionn led to mny nerodeenertive diseses s dem-onstrated in MERFF syndrome (or Myoclonic Epilepsywith Red Red Fibers) nd Hntinton diseses.14

Althoh mitohondril dysntion in RGC is theprpose o mny stdies, the role o [C2+]

iin ION

ptho-physioloil onditions hs modestly beenddressed so r,15 nd nortntely the nderstnd-in o the C2+ sinllin nderlyin these deets stillremins poor.

[C2+]ireltion in nerons involves C2+ entry by

dierent reeptors, volte-ted C2+ hnnels lol-ized to the plsm membrne, nd C2+ relese romintrelllr stores, ollowed by dierent berinmechanisms to restore basal [Ca2+]

ilevel.16 Such mecha-

nisms inlde C2+ pmps in both plsm membrnend endoplsmi retilm (ER),17 plsm membrne

N+/C2+ exhners,18 s well s mitohondril C2+ ptke.19 To hieve the mitohondril lerne o cytoplasmic Ca2+, the mitochondrial network has to beproperly nd speilly distribted s “sptil b-ers” lose to C2+ enrihed miro domins, sittedin the viinity o plsm membrne C2+ hnnels ndthe ER.20,21 In ddition, or proper C2+ lerne, themintenne o the inner mitohondril membrneinterity nd in prtilr o the inner membrnepotentil is reqired by the low nity mitohondriluniporter, to import Ca2+ in the matrix.13 Consequently,

we n expet tht dysntion o OPA1, n innermitohondril dynmin, whih is involved in siono the mitohondril network, in mintenne o themitochondrial inner membrane potential (Δψ

m) and in

preventing pro-apoptotic cytochrome c release,22 couldseriosly et the mitohondril C2+ lerne23 in

RGCs.Thoh [C2+]

iresponses to onventionl onists,

developmental changes o voltage-gated Ca2+ currentsnd lobl C2+ dynmis were previosly desribedin retinl nlion ells,24–26 little is known bot themehnisms nderlyin the C2+ hndlin in thesesensory nerons, espeilly drin deenertiveremodellin.

In the present stdy, we rst hrterized the[C2+]

iinrese inded by vrios ionotropi nd

metbotropi onists nd then nlyzed the meh-nisms involved in [C2+]

ireltion in mose RGCs

primary cultures, isolated rom post natal (P2) animals,at a stage when the retina is still developing and RGCsre immtre, in whih we old knok down OPA1

by ene silenin. In these ells, we demonstrted di-erent plsm membrne hnnels nd intrelllr[C2+]

istores, nd hihlihted the ritil involvement

o mitohondri nd OPA1 in C2+ lerne. We s-gest that patho-physiological mitochondrial deects inC2+ lerne old be responsible o RGC deener-tion in OPA1 ptients.

MATERIALS AND METHODS

All niml experimenttions were perormed inordne to the ARVO Sttement or the Use o Animls in Ophthlmi nd Vision Reserh Frenh-Eropen reltions. Unless otherwise stted,ll the stndrd hemils were prhsed romSim-Aldrih-Frne.

Retinal Ganglion Cell Purifcation and Culture

Post ntl (P2) C57BL/6J mose (Jnvier Institte, LeGenest-St-Isle, Frne) were depitted, the retins

were removed nd trnserred in wrm (37°C) phos-phte bered sline (PBS, Gibo). Retins were thendissoited enzymtilly in PBS, or 30 min t 37°C,containing papain (33 U/ml, Worthington BiochemicalCorporation, NJ) and then mechanically and gently trit-urated in PBS containing 1% ovomucoid (WorthingtonBiohemil Corportion, NJ) nd DNse (100 U/ml).The dissoited RGCs were then inbted or 15 mint 4°C with mose nti-mose CD90 (Thy1.2) ntibod-ies onjted to mirobeds (Ms Cells SeprtionColmns, Miltenyi Bioteh, Frne) in PBS with 0.2%

7/30/2019 Ca2+ Clearance 2010


Ca2+ handling in mouse retinal ganglion neurones 55

© 2010 Informa Healthcare USA, Inc.

BSA. Ater wshin, ells were elted sin plner(Miltenyi Bioteh). Approximtely 20 000 ells per m2 o pried RGCs were ltred onto lss bottomdishes (HBSt or GWSt-3522 series; 22 mm dimeter,0.17 mm thikness; WillCo Wells BV, Netherlnds)oted with poly-D-lysine (20 µ/ml or 2h t 37°C).

Cells were inbted in spplemented Nerobsl spreviosly desribed27 t 37°C in 5% CO

2hmidied

tmosphere. [C2+]i

mesrements were perormedter 7 dys in ltre. Spontneos C2+ osilltionswere observed on 15 dy-old ltres inolted t density o 2 million ells per m2. siRNA trnsetionswere perormed ter 4 dys o ltre, nd ells wereproessed 7 dys lter or the [C2+]

imesrements.

Gene Silencing Strategy

For siRNA experiments, we ollowed a well-establishedmethod s previosly desribed by or rop.22,28 Briefy, tret-spei siRNA (AA(N19)UU) weredesined (5'-aagucaucagucugagccagguu-3') orre-spondin to position .1811-1833 o the mose OPA1open redin rme (GenBnk ession nmberAY510274) nd synthesized in dplex orm (Dhr-mond Reserh, CO, USA). The srmble siRNAs(5'- agguaguguaaucgccuuguu -3') were sed s netive ontrol.

biochemistry Analysis: Western blot

Western blotting was perormed on aliquots containing50 µ o proteins mixed with el lodin ber, sep-rated on 7.5% SDS-polyacrylamide gels electrophoresisand transerred onto PVDF (Polyvinylidene DifuorideHybond P membrne, Amershm Biosienes) mem-

branes. Membranes were blocked with 5% at-ree drymilk in between (0.5%) Tris buer at pH 7.5, incubatedoverniht with ntibodies inst monolonl moseβ-actin (1/50 000), and OPA1 (1/300),29 then incubatedwith pproprite nti-mose nd nti-rbbit IG ntibodies conjugated to alkaline phosphatase (1/5 000) atroom tempertre or 1 hor. Finlly, ntibodies were

reveled with BCIP-NBT (Sim-Aldrih) sbstrtend bnd intensities were qntied sin ImeJsotware (National Institutes o Health, Bethesda, MD,USA). Reslts re bsed on or independent siRNAtrnsetion experiments.

Conocal Analysis

For mitohondril strtre identition, ells wereinbted with 100 nM CMXros Mitotrker® Red

(Molecular Probes-Invitrogen, France) or 30 min, thenxed nd stined or DAPI. Mitohondril membrnepotential was assessed using JC1 labelling (5µg/ml) onlie ells or 30 min in norml rowth onditions.

TUNEL identition o poptoti ells wsperormed ordin to the mntre’s protool(Apopt Apoptosis Detetion Systems-Chemion).Fluorescence staining was recorded with a conocal sys-tem (Biorad MRC 1024) equipped with a Zeiss Axiovert100 mirosope. Ime qisition ws ndertkenwith the sotwre LserShrp (Biord).

Intracellular [Ca2+]iMeasurements

Stok soltions o ll drs sed were prepred inappropriate solvents as recommended by the suppliers,nd then dilted to workin soltions beore se. For

dye loading and measurement o [Ca2+

]i on single cells,the ltred RGCs were loded by inbtion with2 µM C2+-sensitive dye Fr-2/AM (dissolved inDMSO) pls 0.2% plroni F-127 (dissolved in wter;Molelr Probes In. Eene, OR, USA) in Loke’s

ber whih ontins (mM): NCl, 140; KCl, 5; MCl2,

1.2; CaCl2, 1.8; glucose, 10; HEPES, 10; pH 7.25 adjusted

with Tris. Ber osmolrity ws 300 mosmol/l. Dyeloading was carried out or 40 min at room temperature(22°C). The [C2+]

iin sinle nerons ws mesred s

previosly desribed.30 Briefy, foresene mesre-ments o [Ca2+]

iwere recorded with a Zeiss Microscope

Photometer System (FFP, Zeiss, Oberkochen, Germany),

coupled to an inverted microscope (Axiovert 100, Zeiss)eqipped or epiforesene nd 100 X oil immersionobjective (Plan-Neofuar /1.30, Zeiss). With fuorescencevles orreted or bkrond nd drk rrent,[C2+]

iws llted rom the rtio between 340 nd

380 nm reordins. The lltion o the foresenesinl, in terms o ree-C2+ onentrtion, ws bsedon well-known proedre.31 In RGCs, ter libr-tion t room tempertre, the prmeters K

d= 224 nm,

Rmin

= 0.196, Rmx

= 5.362 nd ß = 6.871 were sed to l-lte [C2+]

ivles rom mesred dt.

Drugs

Unless otherwise stted, ll hemils (ltmte,100 μM; NMDA, 100 μM; GABA, 100 μM; picrotoxin,50 μM; bzine, 10 μM; CCCP, 10 μM; nd ll theother compounds mentioned below) were purchasedrom Sigma-France. Concentrated stock DMSO solu-tions o ylopizoni id (CPA, 500 nM nd 1 µM)nd rynodine (100 nM; Alomone Lbs, Isrel) werestored t -20°C. Ceine (20 mM; Almone Lbs,Isrel) ws dissolved diretly in the workin ber

7/30/2019 Ca2+ Clearance 2010



Ophthalmic Genetics

t pproprite onentrtions. Msimol (sed t10 nd 50 μM) ws dilted with 0.05 N HCl. Testsoltions were prepred dily sin liqots romrozen stoks to obtin the workin onentrtions.

Drug Application

The ontrol nd test soltions were pplied sin mltiple pillry persion system (200 µm innerdiameter capillary Tygon tubing, fow rate 250 µl/min)pled in the lose proximity o eh ell (<0.2 mm).Ater montin the ltre dish onto the mirosopestage, selected neurons were subjected to a close proxi-mal constant buer perusion with an identical infownd otfow rtes in order to keep onstnt the b-er volme o bot 400 µl in the ltre dish. Ehpillry ws ed by reservoir sitted 60 m bovethe smple nd onneted to tempertre ontroldevie (Hrvrd-Frne). [C2+]

imesrements were

perormed t 35°C. With this devie, swithin thefow rom one capillary to the next resulted in completesolution change within a ew seconds. Ater each drugpplition, ells were wshed with ontrol ber sdesribed bove.

Data Analysis

The results are expressed as means ± S.E.M. The samplesize is iven in brkets. Sttistil sinine wsanalyzed using one-way ANOVA ollowed by Schee’spost-ho omprisons. The res (tres) show on-

line measurements o the [Ca2+]i levels beore and aterapplication o test substances. Dierences at the p<0.05level were considered statistically signicant. To avoiddesensitization phenomenon, a typical experiment on asinle ell omprised t lest two ontrol stimltions

beore nd ter the test stimltion with drs. Thereslts were then expressed with respet to the rstontrol stimltion.

RESULTS

Cell Culture and [Ca2+]iIncrease Evoked y

High K +

We tested the speiity o the mirobed method ndound that the purity o the cell culture was higher than98%. Indeed lmost ll ells were Thy1.2 positive ewdys ter strtin the RGC ltre (dt not shown).

In miee developin RGCs isolted rom post ntl(P2) nimls rom primry ltres, the men restinstate value o [Ca2+]

iwas 78 ± 12 nM (n = 37). To check or

the presene o VGCC (Volte-Gted Clim Chn-nels) on plasma membranes o RGCs, we rst recorded

the [C2+]i

inrese inded by exposre to hih K+ (50 mM KCl) t two dierent time intervls. Inresinthe K+ onentrtion in the persion soltion rom5 to 50 mM or 30s sed st nd lre inrese in[C2+]

iin ll ells tested (Fire 1A). The response ws

monophsi nd presented ler st trnsient hih

K+-evoked [Ca2+]i increase reaching 702 ± 23 nM (n = 14)with st trnsient [C2+]

idey the K+ onentrtion

was returned to 5 mM. Reduction o external Ca2+ rom2.2 mM to 100 nM in the persion soltion (beredwith 2 mM EGTA) did not et restin [C2+]

ibt

drastically reduced (90%; data not shown) the high K+-induced [Ca2+]

iincrease, suggesting that the major part

o the [C2+]iinrese depends on the C2+ infx nd

reslted rom C2+ entry throh VGCC.

Eect o Ca2+ Channel blockers

To investite the presene o hih nd low volte-ted (HVA / LVA) C2+ hnnels in RGCs, we testedthe hih K+-evoked [C2+]

iinrese in the presene o

100 µM Cd2+, which antagonizes HVA Ca2+ channels and50 µM Ni2+, which blocks LVA Ca2+ channels. Figure 1A shows a typical recording o the [Ca2+]

iincrease induced

by exposure to high K+. The cells were rst depolarizedwith high K+ as control stimulus and then pre-incubatedduring 2 min with the blockers beore challenging withhih K+. The hih K+-inded responses were similrto those observed previosly (pek 1 & 2, men pekvle: 754 ± 66 nM, n = 6), while in the presene o Cd2+

nd Ni2+, the hih K+-inded response ws deresed by more thn 90% (pek 3, pek vle: 52 ± 7 nM;p<0.001; n = 6). Ater wshin the Cd2+ nd Ni2+, theresponse to hih K+ ws restored (pek 4, men pekvle: 722 ± 87 nM; n = 6). These reslts onrm theexistene o volte-ted C2+ hnnels in RGCs.24

Presence o Ionotropic Glutamate Receptorsin RGCs

We urther investigated the presence o ionotropic gluta-mte reeptors in these nerons sin both non-sele-

tive physiological agonist (glutamate) and more selectiveexoenos onists (NMDA nd Kinte). The menresting [Ca2+]

iin these neurons was 98 ± 22 nM. An initial

50 mM K+ stimulation induced a robust increase in [Ca2+]i

(879 ± 101 nM ; n = 5) and was ollowed by three consecu-tive exposres to 100 µM ltmte tht enerted ninrese in [C2+]

i( Fire 1B, pek vle: 361 ± 20 nM;

n = 5). The ltmte-inded response ws bi-phsi,an initial low increase in [Ca2+]

iwas ollowed by an high

mplitde seond brpt [C2+]iresponse. These reslts

sest the presene o ntionl ionotropi lt-

7/30/2019 Ca2+ Clearance 2010




mte reeptors in RGCs. In nother set o experiments,we tested or the presene o NMDA reeptors sin100 µM NMDA. We observed st inrese o [C2+]

i

(men NMDA vles: 318 ± 9 nM; n = 4), ollowed by seond response in the bsene o NMDA probbly deto relese o C2+ rom intrelllr C2+ stores (Fire 1C). Furthermore, we stimulated the neurons with kain-te (100 µM) in order to test or the presene o AMPAreeptors. Applition o kinte (Fire 1D) inded

sinle monophsi st [C2+

]i inrese (men pekvles: 346 ± 22 nM; n = 5), ollowed by st dey. Ordt show tht ntionl NMDA nd AMPA/kinteresponsive reeptors oexist in these nerons.

GAbA and GAbAA

Agonist Induced [Ca2+]i

Increases in Immature RGCs

The eect o GABAA

receptor activation on [Ca2+]iwas

tested on RGCs. Fire 2A shows the [C2+]iresponse

inded by the pplition o 30s 100 µM GABA in seleted RGC tht ws responsive to hih K+. GABAinded st trnsient [C2+]

irelese, ollowed by

slow dey when ompred to tht o hih K+ stim-ls. The men pek vles or GABA, rst hih K+ nd seond hih K+ ter GABA were 228 ± 13 nM,622 ± 38 nM nd 572 ± 44 nM (n = 3), respetively.We then tested the eet o two onentrtions o msimol, spei GABA

Areeptor onist, (pek

vles 10 µM: 197 ± 18 nM; 50 µM: 297 ± 38 nM; n = 4)whih inded [C2+]iresponses in the similr (type/

e) ltre. When the RGCs were persed 2 min beore nd drin msimol stimltion with 50 µMpirotoxin (Fire 2C), GABA reeptor nto-nist, the msimol inded [C2+]

iresponse (pek

vle, 497 ± 123 nM; n = 3) ws reversibly inhibited by 65% ± 12 by pirotoxin (p<0.01). When the ellswere persed with 10 µM bzine, nother spe-i GABA

Areeptor ntonist, 2 min beore nd

drin msimol stimltion, omplete inhibition

0 100 200 300

100

200

300

400Kainate

(s)

A

C

B

0 200 400 600

0

200

400

D

NMDA

(s) (s)

0 200 400 600

(s)

K+

K+K+

K+

K+K+

KainateKainateNMDA

Glutamate

200

400

600

800

0200

400

600

800

1000

Cd2++ Ni2+

[ C a

2 + ] i ( n M )

[ C a

2 + ] i ( n M )

[ C a

2 + ] i ( n M )

[ C a

2 + ] i ( n M )

0 200 400 600

(s)

FIGURE 1 [Ca2+]iresponse induced by high K+ and glutamate receptor agonists in retinal ganglion cells in primary cultures.

(A) RGCs in Loke ber were stimlted twie with K+ (50 mM) or 30 s, then pre-inbted with Cd2+ (100 µM) pls Ni2+ (50 µM) or 2 min nd hllened with K+. Ater wshin o o Cd2+ nd Ni2+, the K+-inded [C2+]

iws lly restored

(n = 6). (B) Typil [C2+]i

proles observed ter one K+ nd three sessive ltmte (100 µM) stimltions t dierenttime intervls. (C) Typil [C2+]

iresponse to NMDA (100 µM; n = 4). (D) Tre showin hih K+ response ollowed by two

sessive exposres to 100 µM kinte (n = 5).

7/30/2019 Ca2+ Clearance 2010



Ophthalmic Genetics

o msimol-inded response ws observed. Aterwashing o the gabazine, the muscimol response wasnerly restored (Fire 2D, 1st pek vle or msi-mol: 255 ± 14 nM; n = 5). Neurones rom older cultures(up to 2 weeks) did not respond to GABA or muscimol(dt not shown). These reslts sest tht in RGCsisolated rom post natal (P2) animals, GABA exerts anexittory eet.

Intracellular [Ca2+]iActivators in RGCs

The biphasic [Ca2+]iresponses to glutamate and NMDA

stimuli observed in this study suggest the participationo both C2+ infx nd C2+ relese rom RGC intrel-llr C2+ omprtments. To exmine nd hrterizethese stores, drs tin on intrelllr C2+ pmpswere sed. The response to 500 nM (30s pplition)nd 1 µM (60s pplition) ylopizoni id (CPA),an inhibitor o the Ca2+-ATPase pump rom the ER andthereore depletor o the inositol 1,2,3 triphosphte(InsP

3)-sensitive intrelllr C2+ stores [10], showed

stron monophsi st [C2+]iinrese (392 ± 67 nM;

n = 6) (Fire 3A). The C2+ reptre ws st t CPAconcentration o 500 nM and apparently slower at 1 µM.However, when CPA ws pplied t hiher onentr-tion (10–25 µM) over loner period, the dey phsews very slow nd lsted severl mintes even terretrievl o the onist (dt not shown). These resltssest tht InsP

3-sensitive C2+ stores re importnt

in RGCs or ontrollin the C2+ sinls nder physi-ological conditions. In order to urther characterize theinvolvement o C2+ stores, we then tested the eet

o 20 mM eine (Fire 3B) nd 100 nM rynodine(Fire 3C), or the sessive ombintion o thesedrugs (Figure 3D) which are known to deplete caeine/ryanodine Ca2+ stores and thereby suppress subsequentCa2+ release rom such stores. Although high K+ controlstimls inded typil [C2+]

iresponses, s shown

beore, (Figures 3B, C and D), our data clearly show thatneither caeine (Figure 3B), nor ryanodine (Figure 3C),nor rynodine / eine (Fire 3D) hd sininteet on restin [C2+]

i, sestin tht the rynodine

reeptor is bsent or intive in these RGCs.

GABA

Picrotoxin(50µM)

100

200

300

400

500

0 300 600

Muscimol

0 100 200 300

100

200

300

200 400 600

100

200

300

Gabazine (10µM)

200

400

600

800

0 200 400 600

A B

C D

10µM 50µM

Muscimol

Muscimol

(s) (s)

(s)(s)

MuscimolMuscimol Muscimol

Muscimol

[ C a

2 + ] i ( n M )

[ C a

2 +

] i ( n M )

[ C a

2 + ] i ( n M

)

[ C a

2 + ] i ( n M

)

K+ K+

FIGURE 2 Involvement o GABAA reeptors in [C2+]ihomeostsis in RGCs. (A) [C2+]

iproles ter hih K+, GABA (100

µM) nd seond K+ stimltion. (B) Tres show the eet o msimol (10 µM nd 50 µM), GABAA onist, on [C2+]i

increase. (C) Inhibition o 50 µM muscimol-induced [Ca2+]iincrease by picrotoxin (50 µM), an antagonist o GABAA recep-

tor. (D) Traces showing [Ca2+]iresponses induced by 50 µM muscimol pre-incubated or not with 10 µM gabazine, a GABAA

bloker. Cells were then hllened with msimol ter wshin o the ntonist (n = 3).

7/30/2019 Ca2+ Clearance 2010




Spontaneous Ca2+ Oscillations in RGCsCa

2+

In prllel experiments, with dense two week-old RGCltres, we monitored remrkble spontneos [C2+]

i

osilltions in mny nerons (Fire 4). These osill-tions were observed only when neronl dendrites hdestblished onnetions with the neihborin ells, btwere not ond on individl nerons devoid o inter-onneted dendriti rboriztions. Interestinly, these

spontneos osilltions with n vere o one spikeevery 30 se, were mplied nd elerted by ppli-tions o 100 µM NMDA (Fire 4), sestin possibleinvolvement o NMDA reeptors, espeilly in the lihto the importne o these reeptors or the srvivl o rodent RGCs.24 No urther characterization o such [Ca2+]

i

oscillations in OPA1 silenced cells (see next paragraph inthe Reslts setion) were perormed de to the restri-tion in obtinin hih density primry ltres withonneted nerons. Indeed the nmber o “osilltin”

0 200 400 600

200

400

(s)

A

200

400

600

800

B

0 200 400 600

200

400

600

800

0 200 400 600

200

400

600

800

0 200 400 600

C D

Caffeine

CaffeineRyanodineRyanodine

(s)

(s)(s)

CPA

500nM CPA

1µM

K+

K+

K+

K+

K+

K+

[ C a

2 + ] i ( n M )

[ C a

2 + ] i ( n M

)

[ C a

2 + ] i ( n M

)

[ C a

2 + ] i

( n M )

FIGURE 3 Eect o intracellular endoplasmic reticulum Ca2+ activators in RGCs. (A) [Ca2+]iproles observed ater stimulations

o InsP3-activated Ca2+ stores by cyclopiazonic acid (CPA, 500 nM or 1 µM). (B) [Ca2+]iproles show high K+-induced responses

nd then exposed to eine (20 mM), rynodine reeptor onist. Cells were then sbjeted to seond K + stimls. (C)Tres showin the bsene o [C2+]

ihnes ter stimltion with rynodine (100 nM, n onist o its reeptors t low

onentrtion). (D) [C2+]i responses in ells respondin to hih K+, bsene o [C2+]i hnes ter exposre to 20 mM eineollowed by 100 nM rynodine (n = 6).

0

400

300

200

100

NMDA

5

(min)

10 15 20 25 30

[ C a

2 + ] i ( n M )

FIGURE 4 Spontneos [C2+]iosilltions in retinl nlion

nerones. Pried RGC were seeded t hiher onentrtion(2 million ells / m2) nd ltred or two weeks. The reord-ins show typil prole observed in sinle nerone over long period o spontaneous [Ca2+]

ioscillations. NMDA (100 µM)

ws pplied t vrios time intervls whih inded n mpli-tion o [C2+]

iosilltion reqeny nd mplitde. These

types o osilltions were observed in t lest 6 dierent ells.

7/30/2019 Ca2+ Clearance 2010



Ophthalmic Genetics

nerons in OPA1 siRNA ltres ws too low to be bleto et meninl mont o inormtion.

RGC Phenotype Associated with Mouse OPA1Silencing

In order to ssess the role o mitohondri in C2+ uptake, we used cells transected with a siRNA whichsilenes OPA1 expression or by ontrol srmblesiRNA. Silenin o OPA1 ws ssessed by western blot (Figure 5A) and demonstrated a strong inhibitiono OPA1 expression. The redtion o OPA1 expres-sion in the whole ltre ws reter thn 90%, sllted by western blot snnin (see Mterilnd Methods setion). The western blot (Fire 5A)showed the omplete dissiption o the bndsrevealed by OPA1 antibodies in neurons treated with

the OPA1 siRNA.In the orrespondin ells, we nlyzed the mito-chondrial network structure using the Mitotracker dye

nd showed onsiderble ssion o the mitohondrilnetwork (Fire 5B). The Mitotrker dye ws spe-illy stinin the mitohondril network. In OPA1siRNA treted ells, we observed tht the mitohon-dril network, insted o bein somewht niormlyspred lon the neritis similr to wht ws the se

in ontrol ells, ws reted in dots, sestintht the sion mehnisms were impired by OPA1bsene.

In prllel, the mitohondril membrne potentildissiption (illstrted in Fire 5C) ws ssessed bythe redtion o the orne foresene o the JC1dye in RGC som nd dendrites. Indeed the JC1 dyepresent norml reen foresene in mitohondri,whih is trned in red/orne when the membrnepotentil is hih.

Hence, we demonstrated, using the JC1 dye that theOPA1 silened RGCs hd drsti derese o Δψ

m

(Fire 5C).Finally we ound that the silencing o OPA1 induceda signicant increase o apoptosis as judged by counting

A B

scramble siRNA

siRNA

scr.

siRNA

OPA1

siRNA

scr.

siRNA

OPA1

OPA1

actin

C

scramble siRNA OPA1-siRNA

OPA1-siRNA

D

10 -

20 -

30 -

40 -

0 -

*

P e r c e n t a g e

o f t u n e l p o s i t i v e

c e l l s

TUNEL

positive RGCs

FIGURE 5 Down regulation o OPA1 induces mitochondrial ragmentation, loss o Δψm

and increases apoptosis. Primary cultureso RGCs were trnseted ter 4 dys o ltre, with the srmbled siRNAs nd the OPA1 siRNAs, nd nlyzed 7 dys lter(see Re.s 22 and 28 or detailed protocols). (A) Western blot using OPA1 and actin antibodies on total protein extracts. (B) Pictureso the mitohondril network lbeled with the Mitotrker dye, nd o the nles stined with DAPI. (C) RGCs stined withmembrane potential sensitive JC1 dye. (D) TUNEL positive (green fuorescence) wild-type cells and their percentages in the RGCltres trnseted with the srmbled nd the OPA1 siRNAs.

7/30/2019 Ca2+ Clearance 2010




TUNEL positive ells in the ltres (Fire 5D). Thehistorm shows the perente o TUNEL positiveRGCs trnseted with the OPA1 siRNAs (blk) ndthe srmble siRNAs (ry), 7 dys ter trnsetion(ANOVA test * p<0.005; n = 5).

Eects o the Mitochondrial Integrity on[Ca2+]

iResponse

To ssess the role o mitohondril C2+ ptke, theuncoupler carbonyl cyanide 3-chlorophenylhydrazone(CCCP) o mitochondrial respiratory chain was used.In ontrol srmbled siRNA trnseted ell ltres,we mesred rst the [C2+]

iresponses to hih K+

stimltion with or withot the sbseqent ppli-tion o 10 µM CCCP (Fire 6A). CCCP in this wyses rpid inrese in C2+ whih n resonbly

be interpreted s relese o C2+

rom mitohondriollowin their ptke drin the initil C2+ trn-sient. In these ells, CCCP sed smll inrese inrestin [C2+]

i(rom 72 ± 9 nM to 136 ± 22 nM; n = 12;

p<0.05; trace not shown) and induced a slight raise o the baseline ater high K+ stimulation, indicating thatmitohondri ply role in C2+ lerne. Srpris-inly, in OPA1 siRNA trnseted ells, no dierenews observed in the [C2+]

iresponses observed ter

hih K+ stimltion in bsene o CCCP or drin

CCCP application alone (data not shown). Conversely,treatment with CCCP during the recovery phase aterhih K+ stimltion, eted C2+ relese with vry-ing intensities rom a low eect (Figure 6B), to drasticeets (Fire 6C), tht ltimtely reslted in rndown and probably leading to cell death (Figure 6D).These reslts point tht ordin to ells nd prob-bly to the mont o OPA1 residl expression,mitohondri hve ritil role in RGC C 2+ ler-ne tht reqires norml tivity o OPA1. Ths,these data suggest that mitochondrial Ca2+ content can

be enhned in ells silened or OPA1 (with R bein

the ratio between the amplitudes o the K+

stimulationand the CCCP application, R = 1.89 ± 0.33 or scramblesiRNA, nd R = 0.93 ± 0.12 or OPA1 siRNA, p<0.05,n = 6 ells or eh ondition).

A

200

400

600

800

0

500

1000

1500

D

CCCP

200

400

600

800

6004002000

Time (s)

8006004002000

6004002000 6004002000

B

200

400

600

800

(s)

CCCP

C

CCCP

CCCP

(s)

(s)(s)

OPA1 siRNAOPA1 siRNA

[

C a

2 + ] i ( n M )

[ C a

2 + ] i ( n M )

K+ K+ K+

K+

K

+

K+

K+

scramble siRNA OPA1 siRNA

FIGURE 6 Eet o CCCP on K+-inded [C2+]iresponses on RGCs trnseted with the srmbled siRNAs nd the

OPA1 siRNAs. RGCs were proessed or [C2+]iresponse, 7 dys ter trnsetions with the srmbled siRNAs (A)

and the OPA1 siRNAs (B, C and D). The eect o the mitochondrial uncoupler, CCCP, was assessed on the K+-induced[C2+]

iresponse (n = 12). Tres show 3 dierent types o [C2+]

iresponses in RGC trnseted with the OPA1 siRNAs

(n = 6 or eh dierent stimltion protool). In (D), the ell died drin the sstined C2+ over lod (n = 4).

7/30/2019 Ca2+ Clearance 2010



Ophthalmic Genetics

DISCUSSION

In the present work, we investited ytosoli C2+ entry nd lerne mehnisms in RGCs rom 2 dy-old mouse pups. At this stage, the retina is undergoingmtrtion, with n inner nler lyer o dierenti-ted RGCs nd lre oter nler lyer o retino-

blsts nd ndierentited retinl nerons.32 RGCs,whih extend their xons throh the optil pths,hve not hieved ll mtrtion. Drin the moseretinal development, GABA provided excitatory actionthrough a chloride efux, which will later at P6 shit ton inhibitory stimls.33

Our results conrmed that GABA increases intracel-llr [C2+]

iby n infx o C2+ throh the plsm

membrane. This eect was mediated by GABAA

recep-tor sine msimol mimiked the GABA-evoked C2+ rise and GABA

Areceptor antagonists blocked muscimol

tivity. Throh depolriztion nd C2+

elevtion,GABA old ply ril role in the dierentition,srvivl nd synptoenesis34 o yon RGCs.

Gltmte is the prinipl nerotrnsmitter in theretina and mediates synaptic communication between

bipolr ells nd RGCs.35 In pried RGC ltres,ltmte inresed [C2+]

iin biphsi mnner s-

estin diret tivtion o NMDA-ted hnnelsnd sbseqent rpid tivtion o VGCC de toNMDA nd non NMDA ltmte reeptors. NMDAlone inded sinl omptible with n inrese in[Ca2+]

idue to external Ca2+ infux, ollowed by a slower

C2+ mobiliztion rom internl stores. Moreover, in

onnetin ells, NMDA stimlted spontneos C2+ osilltions, whih re typil o C2+ relese romInsP

3-sensitive internl stores.36 Bsed on or rrent

knowlede o the phenomenon, we re nble todemonstrte diret eet o OPA1 on C2+ osill-tions. At this ste o or investition, we n onlyindiretly link mitohondril OPA1 to spontneosC2+ osilltions. In t, the nmber o onnetednerons is deresed in OPA1 silened ell ltres.This is probably due to an increase o the apoptotic rates we show in the present work. Moreover, when thedensity o ells is low s it is when OPA1 is silened,the level o onnetions between nerons is lso lownd thereore the probbility to observe spontneosC2+ osilltions is deresed, sine we old only seethese oscillations in interconnected neurons and not inisolted nerons in wild type ltres.

In the retina, spontaneous electrical activity has beendesribed s rhythmi brsts o tion potentils thtspred between djent ells nd prode trnsientelevtions in [C2+]

i.37–39 These wves seem neessry

drin development or the ormtion o ppropritesynaptic connections by ganglion cells within the lateralenilte nles nd opti tetm.40 In embryoni

hik retin, this spontneos tivity o RGCs wsrelted by ionotropi ltmte reeptors s wells GABA

Areeptors.39 Retinl wves hrterized

by lim imin re sested to be importnt orerly tivity dependent ormtion o ntionl ir-its. Osilltions re present drin the period when

the inner plexiorm lyer beomes strtied. Retinlwves propte slowly ross retin, thereore om-mnition between lose nerons is more importntthn between distntly loted nerons.32

In most cell types, Ca2+ entry occurs both by receptor-operated and voltage-gated Ca2+ channels. In RGCs, wedemonstrted the presene o volte-ted hnnels,

bese the hih K+-evoked [C2+]ipek ws inhibited

by mixtre o Cd2+ nd Ni2+, inhibitors o HVA ndLVA C2+ hnnels respetively. In 1999, Shmid ndGenther proposed in n ex vivo model o RGCs thtvolte-ted C2+ rrents were exlsively o LVA

type at the embryonic stage E17, composed o HVA andLVA t the postntl ste, nd solely o HVA type indlt RGCs.25 This ssmption bsed only on eletro-physioloil reordins is onsistent with or dt onpostntl RGCs displyin blok o 20% o the hihK+ response in the presene o Ni2+. Inrese in [C2+]

i

reslts rom C2+ entry throh plsm membrne ndrom Ca2+ release rom intracellular stores. The responseto hih K+ showed residl inrese o [C2+]

iin the

presence o Cd2+/Ni2+, most likely suggesting the contri- btion o internl stores drin this response. The twomajor possibilities o internal Ca2+ mobilization involvethe InsP

3-sensitive and ryanodine-sensitive Ca2+ channels

present on the ER membrne. To hek their respetivepossible ontribtion to RGC C2+ inrese, we testedthe eet o diret pplition o CPA, dr whihdepletes the InsP

3-sensitive pool, nd eine nd/or

rynodine on restin [C2+]i. Srprisinly, CPA, bt not

eine nor rynodine nor their ssoition, inresedthe [C2+]

i, in these ells t this ste o development.

Consequently, although ryanodine receptors have beendesribed in other sensory nerons erly drin devel-opment10 and the presence o ryanodine receptors in ret-in hs been sested by reent stdies,41 we showedtht the ontribtion o rynodine reeptors in thismodel o RGCs is not sinint or the C2+ hndlin.

The role o mitohondri s C2+-berin systemshs been demonstrted in severl models by mnystdies (see or exmple [42,43]). Frthermore, thisws shown to be tre lso or retinl ells, espeillyor mrine ells.44 Thoh the likelihood tht mito-hondri behve like C2+-seqesterin ornelles inRGCs s well ws resonbly hih, no diret evideneso r old be ond in the litertre.

Thereore noteworthy ndin here is the dem-onstrtion nd onrmtion tht mitohondri ply mjor role s C2+-berin system in RGCs. The

7/30/2019 Ca2+ Clearance 2010




mitohondril nopler, CCCP, showed sininteets on the bsl C2+ level nd espeilly whenpplied drin the reovery phse o K+-inded[C2+]

i, sestin tht in these ells mitohondri

represent n importnt ornelle prtiiptin in theC2+ lerne mehnism.

Taking into account that the causative inherited opticneuropathies (ION) genes are ubiquitously expressed,the ptho-physioloil hypotheses tht hve beenproposed to explin the restrited deenertion o theRGCs in IONs, re bsed on proesses osin onRGC mitohondril prtilrities.4 The rst hypoth-esis is bsed on n RGC exeptionl reqirement orenery resores. These ells re hihly soliited dr-ing the visual process, and the RGC axon in the ocularlobe is devoid o myelin, reqirin hiher enery totransduce visual inormation.45 The second hypothesis,relted to the rst one, is bsed on n irrelr distri-

btion o mitohondri lon the RGC xon.46

In thecase o mitochondrial deects, low ATP production canderese the rte o xoplsmi trnsport nd onse-qently ompromise the trnsport o mitohondri,s well s o nerotrophi tors, jeoprdizin ellsrvivl. Finlly, the third hypothesis is relted to theunusual localization o RGCs in the eye. These cells arepermanently exposed to the pro-apoptotic eects o thelight and consequently, any mitochondrial deects thatwould aect susceptibility to apoptosis or ATP produc-tion, wold speilly vor RGC deenertion.47

Because OPA1 displays a prominent role not only inmaintaining the membrane potential required or Ca2+

entry into mitohondri, bt lso in prodin ATPnd in the dynmis o the mitohondril network,22 we monitored its role in RGC Ca2+ clearance. It is note-worthy that La3+, an inhibitor o the Na+/Ca2+ exchang-ers o the plsm membrne, did not et the hihK+-induced depolarization, indicating no contributiono the N+/C2+ exhners in the C2+ lerne o postnatal RGCs (data not shown). Down-regulation o OPA1 expression was induced by specic OPA1 siRNAtrnsetion nd led to rmented mitohondrilphenotype, which can be summarised by a signicantdissipation (decrease) o the δψ

m(using the JC-1 probe

nd ssessin the red to reen rtio), pntted

mitohondril network, nd inresed poptosis. InRGCs, the reltive silenin o OPA1 llowed normlC2+ lerne ter hih K+ stimltion, sestinthat the global mechanisms required or Ca2+ recapturestill ntion. Conversely, ddition o CCCP on ellssilened or OPA1 emphsized the enhned role o mitohondri on C2+ ptre, with dierent ptternsprobably resulting rom the dierent amounts o OPA1protein remaining per cell. Nevertheless, these resultssuggest that in the absence o a normal δψ

m, and in the

absence o OPA1 activity, Ca2+ recapture pathways are

highly deective, leading to drastic impairment in Ca2+ lerne nd ltimtely to ell deth. In this respet,the increase o Ca2+ recapture showed by the presenceo CCCP miht reslt rom the omplete distrbneo the δψ

m, possibly ombined with the redtion o

the ATP synthesis (whih old derese the tivity

o the other reptke systems within the ell) or withthe derelted mitohondri distribtion in the ell,induced by OPA1 silencing. These hypotheses should

be ddressed now in niml models with mttedOPA1. Noteworthy is tht OPA1 nd OPA3 proteinsre loted in the mitohondril inner membrne,nd in opti trophy, similr mehnism leds toRGC dysntion vi disrption o the mitohondrilrespirtory hin. Whether OPA1 silenin etsOPA3 ntion in mitohondril C2+ reltion isqestionble, nd the role o OPA3—in prtilrin C2+ lerne—is nder investition riht now.

However it is importnt to mention tht OPA1 is themjor ene involved in Dominnt Opti Atrophy(>80% o ll ses), wheres OPA3 is only involved inless thn 2% o ll ses.48

Tken toether, or dt indite tht RGCs reritilly dependent on OPA1 or C2+ lerne drinmouse retinal development. Since mutations o the OPA1ene re responsible or proressive deenertion o RGCs in patients suering rom dominant optic atrophy,it seems still speculative but highly conceivable that Ca2+ lerne old be impired s well, hene tkin prtin the degeneration o ganglion cells in patients with themtted OPA1 ene. Thereore, we propose here new

ondtion or ptho-physioloil mehnism thtmiht ont or RGC deenertion observed in someyoung OPA1 patients. However this requires obviouslyurther investigations, particularly the establishment o more physioloil niml models.

ACKNOWLEDGMENTS

We thnk Dr. H. Aptel (Institt de GenomiqeFontionelle, Montpellier, Frne) or ssistne ndhelpul discussions and Dr. Keith Langley (Montpellier,

France) or critical reading and language editing o themnsript.

Declaration of interest : The thors report no onfito interest. The thors lone re responsible or theontent nd writin o the pper.

REFERENCES

1. Bonne C, Mller A, Villin M. Free rdils in retinlishemi. Generl Phrmoloy 1998;30:275–280.

7/30/2019 Ca2+ Clearance 2010



Ophthalmic Genetics

2. Crelli V, Ross-Cisneros FN, Sdn AA. Opti nervedeenertion nd mitohondril dysntion: eneti ndacquired optic neuropathies. Neurochemistry International2002;40:573–584.

3. Chinnery PF. Inheritance o mitochondrial disorders. Mito-hondrion 2002;2:149–155.

4. Carelli V, Ross-Cisneros FN, Sadun AA. Mitochondrial dys-

unction as a cause o optic neuropathies. Progress in Retinalnd Eye Reserh 2004;23:53–89.

5. Delettre C, Leners G, Grioin JM, et l. Nler eneOPA1, enodin mitohondril dynmin-relted protein,is mtted in dominnt opti trophy. Ntre Genetis2000;26:207–210.

6. Reynier P, Amti-Bonne P, Verny C, et l. OPA3 enemttions responsible or tosoml dominnt optitrophy nd trt. Jornl o Medil Genetis2004;41:e110.

7. Berride MJ, Lipp P, Bootmn MD. The verstility nd ni-verslity o lim sinllin. Ntre Reviews MolelrCell Bioloy 2000;1:11–21.

8. Petersen OH, Mihlk M, Verkhrtsky A. Clim sinl-lin: pst, present nd tre. Cell Clim 2005;38:161–

169.9. Verkhratsky A. Physiology and pathophysiology o the cal-

cium store in the endoplasmic reticulum o neurons. Physi-oloil Review 2005;85:201–279.

10. Dynithi G, Mehly I, Viero C, et l. Intrelllr C2+ reltion in rt motonerons drin development. CellClim 2006;39:237–246.

11. Toes EC, Verkhrtsky A. Neronl ein rom n intr-neronl perspetive: roles o endoplsmi retilm ndmitohondri. Cell Clim 2003;34:311–323.

12. Berride MJ, Bootmn MD, Lipp P. Clim— lie nddeth sinl. Ntre 1998;395:645–648.

13. Duchen MR. Mitochondria and calcium: rom cell signallingto ell deth. Jornl o Physioloy 2000;529:57–68.

14. Shpir AH. Mitohondril disese. Lnet 2006;368:

70–82.15. Brini M, Pinton P, Kin MP, Dvidson M, Shon EA,Rizzto R. A lim sinlin deet in the ptho-enesis o mitohondril DNA inherited oxidtivephosphoryltion deieny. Ntre Mediine 1999;5:951–954.

16. Solovyov N, Veselovsky N, Toes EC, Verkhrtsky A.Ca(2+) dynamics in the lumen o the endoplasmic reticulumin sensory nerons: diret visliztion o C(2+)-indedC(2+) relese triered by physioloil C(2+) entry. TheEMBO Jornl 2002;21:622–630.

17. Sski N, Dynithi G, Shiby I. C2+ lerne meh-nisms in nerohypophysil terminls o the rt. Cell Cl-im 2005;37:45–56.

18. Lee SH, Kim MH, Park KH, Earm YE, Ho WK. K+-dependentN+/C2+ exhne is mjor C2+ lerne mehnism inaxon terminals o rat neurohypophysis. Journal o Neurosci-ene 2002;22:6891–6899.

19. Simpson PB, Rssell JT. Mitohondril C2+ ptke ndrelese infene metbotropi nd ionotropi ytosoliC2+ responses in rt oliodendroyte proenitors. Jornlo Physioloy 1998;508:413–426.

20. Rizzto R, Brini M, Mri M, Pozzn T. Mirodominswith high Ca2+ close to IP

3-sensitive channels that are sensed

by neihborin mitohondri. Siene 1993;262:744–747.21. Hajnoczky G, Csordas G, Madesh M, Pacher P. The machin-

ery o lol C2+ sinllin between sro-endoplsmiretilm nd mitohondri. Jornl o Physioloy2000;529:69–81.

22. Olichon A, Baricault L, Gas N, et al. Loss o OPA1 perturbatesthe mitohondril inner membrne strtre nd interity,ledin to ytohrome relese nd poptosis. Jornl o Bioloil Chemistry 2003;278:7743–7746.

23. Spt A. Clim mirodomins nd the ne ontrol o ellntion: n introdtion. Cell Clim 2006;40:403–404.

24. Sher NJ, Lei SZ, Lipton SA. Clim hnnel nto-

nists ttente NMDA reeptor-medited nerotoxi-ity o retinl nlion ells in ltre. Brin Reserh1991;551:297–302.

25. Shmid S, Genther E. Volte-tivted lim rrentsin rt retinl nlion ells in sit: hnes drin pren-tl nd postntl development. Jornl o Nerosiene1999;19:3486–3494.

26. Firth SI, Wn CT, Feller MB. Retinl wves: mehnismsnd ntion in visl system development. Cell Clim2005;37:425–432.

27. Meyer-Franke A, Kaplan MR, Prieger FW, Barres BA. Char-teriztion o the sinlin intertions tht promote thesrvivl nd rowth o developin retinl nlion ells inltre. Neron 1995;15:805–819.

28. Kmei S, Chen-Ko-Chn M, Czevieille C et l. Expres-

sion o the OPA1 mitohondril protein in retinl nlionells: its downreltion ses retion o the mito-hondril network. Investitive Ophthlmoloy & VislSiene 2005;46:4288–4294.

29. Olihon A, Emorine LJ, Desoins E, et l. The hmndynamin-related protein OPA1 is anchored to the mitochon-dril inner membrne in the inter-membrne spe.FEBS Letters 2002;523:171–176.

30. Viero C, Mechaly I, Aptel H et al. Rapid inhibition o Ca(2+)infx by nerosteroids in mrine embryoni sensory ne-rons. Cell Clim 2006;40:383–391.

31. Grynkiewiz G, Poenie M, Tsien RY. A new enertion o C2+ inditors with retly improved foresene proper-ties. Jornl o Bioloil Chemistry 1985;260:3440–3450.

32. Cepko CL, Astin CP, Yn X, Alexides M, Ezzeddine D.

Cell te determintion in the vertebrte retin. Proeed-ins o the Ntionl Ademy o Siene USA 1996;93:589–595.

33. Zhn LL, Pthk HR, Colter DA, Freed MA, Vrdi N.Shit o intracellular chloride concentration in ganglion andmrine ells o developin mose retin. Jornl o Ne-rophysioloy 2006;95:2404–2416.

34. Ben-Ari Y. Exittory tions o b drin development:the ntre o the nrtre. Ntre Revies Nerosiene2002;3:728–739.

35. Hrtwik AT, Llonde MR, Brnes S, Bldride WH.Adenosine A1-reeptor modltion o ltmte-indedlim infx in rt retinl nlion ells. InvestitiveOphthlmoloy & Visl Siene 2004;45:3740–3748.

36. Berride MJ. Inositol trisphosphte nd limosilltions. Biohemil Soil Symposi 2007;74:41–47.

37. Meister M, Won RO, Bylor DA, Shtz CJ. Synhronos bursts o action potentials in ganglion cells o the developingmmmlin retin. Siene 1991;252: 939–943.

38. Ctsis, M., Bonness, V., Beker, D., Mobbs, P., 1998.Spontneos C2+ trnsients nd their trnsmissionin the developin hik retin. Crrent Bioloy 8(5),283–286.

39. Wong WT, Sanes JR, Wong RO. Developmentally regulatedspontaneous activity in the embryonic chick retina. Journalo Nerosiene 1998;18:8839–8852.

40. Won RO. Retinl wves nd visl system development.Annl Review o Nerosiene 1999;22:29–47.

7/30/2019 Ca2+ Clearance 2010




41. Shoshn-Brmtz V, Orr I, Mrtin C, Vrdi N. Novelrynodine-bindin properties in mmmlin retin.Interntionl Jornl o Biohemil Cell Bioloy 2005;37:1681–1695.

42. Serent GP, Brdley E, Thornbry KD, MHle NG,Hollywood MA. Role o mitohondri in modltion o spontneos C2+ wves in reshly dispersed interstitil

ells o Cjl rom the rbbit rethr. Jornl o Physioloy2008;586:4631–4642.

43. Cobrn CG, Crrás-Collzo MC, Kodvnti PR. In vitroeects o environmentally relevant polybrominated diphenylether (PBDE) congeners on calcium buering mechanisms inrt brin. Nerohemil Reserh 2008;33:355–364.

44. Medler K, Gleson EL. Mitohondril C(2+) berinreltes synpti trnsmission between retinl mrineells. Jornl o Nerophysioloy 2002;87:1426–1439.

45. Yu Wai Man CY, Chinnery PF, Griths PG. Optic neurop-thies—importne o sptil distribtion o mitohon-dri s well s ntion. Medil Hypotheses 2005;65:1038–1042.

46. Andrews RM, Griths PG, Johnson MA, Trnbll DM.Histochemical localisation o mitochondrial enzyme activ-ity in hmn opti nerve nd retin. British Jornl o

Ophthlmoloy 1999;83:231–235.47. Osborne NN, Lascaratos G, Bron AJ, Chidlow G, Wood JP. A

hypothesis to sest tht liht is risk tor in lomnd the mitohondril opti neropthies. British Jornlo Ophthlmoloy 2006;90:237–241.

48. Ferré M, Bonne D, Mile D et l. Molelr sreenin o 980 ses o sspeted hereditry opti neropthy with report on 77 novel OPA1 mttions. Hmn Mttion2009;30:E692–705.

ca2+ clearance 2010

Documents