university of groningen wnt signaling in airway remodeling

University of Groningen

WNT signaling in airway remodeling in asthmaKumawat, Kuldeep

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Kumawat, K. (2015). WNT signaling in airway remodeling in asthma: novel roles for WNT-5A in airwaysmooth muscle. [S.n.].

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 30-04-2022

https://research.rug.nl/en/publications/bdf0489a-491c-4840-b497-3e279baef2c8

117 | P a g e

WNT-5A and WNT-11 drive TGF-β-

induced α-sm-actin expression in

smooth muscle via Rho kinase-actin-

MRTF-A signaling

Kuldeep Kumawat

Mark H. Menzen

Alita Prins

Marieke Smit

Andrew J. Halayko

Reinoud Gosens

4

Chapter 4

118 | P a g e

WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling

119 | P a g e

Abstract

Airway smooth muscle (ASM) remodeling is a key feature in asthma which includes changes

in smooth muscle specific gene and protein expression. The mechanisms governing ASM

remodeling are poorly understood. We have recently demonstrated increased abundance of

the noncanonical WNT ligand WNT-5A in ASM cells derived from asthmatics as compared

to healthy subjects. Here, we studied the functional interaction between noncanonical WNT

signaling and TGF-β in ASM cells and demonstrate that WNT-5A and WNT-11 are

preferentially expressed in contractile mycocytes and regulate α-sm-actin expression in ASM

cells. Knock-down of WNT-5A or WNT-11 attenuated TGF-β-induced α-sm-actin expression

in ASM cells and the presence of exogenous recombinant WNT-5A or WNT-11 augmented α-

sm-actin levels in the absence of TGF-β. Further, we demonstrate that TGF-β-induced α-sm-

actin expression is mediated by WNT-5A- and WNT-11-regulated induction of RhoA

activation and subsequent actin cytoskeletal remodeling as pharmacological inhibition of

either Rho kinase by Y27632 or actin remodeling by latrunculin A attenuated α-sm-actin

induction. Moreover, we show that TGF-β upregulates the expression and induces Rho

GTPase-dependent nuclear translocation of MRTF-A which, in turn, mediates α-sm-actin

expression in ASM cells. Finally, we demonstrate that MRTF-A nuclear translocation is

dependent on noncanonical WNT ligands. The present study, thus, demonstrates a WNT-

5A- and WNT-11-dependent Rho kinase-actin-MRTF-A signaling axis that regulates the

expression of α-sm-actin in ASM cells.

Introduction

Airway remodeling is a hallmark pathological feature of individuals with asthma and is

associated with airway obstruction [1], airway hyperresponsiveness [2] and declining lung

function in severe disease [3]. It is characterized by extensive structural changes in the

airway wall which include increased airway smooth muscle (ASM) mass, subepithelial

fibrosis, mucus hypersecretion, neovascularization and increased and altered extracellular

matrix (ECM) expression, contributing to airway wall thickening [4].

Increased ASM mass is a predominant feature of airway remodeling in asthma and correlates

with the severity of disease [5-7]. ASM cells show a remarkable phenotypic plasticity where

they can exist in a synthetic proliferative phenotype actively undergoing cell divisions and

also releasing a number of inflammatory and other mediators and growth factors. In

contrast, mature ASM cells have low proliferation index and high abundance of contractile

apparatus like sm-MHC, SM-22 and α-smooth muscle-actin (α-sm-actin) [8-10]. Increased

ASM mass and increased expression of contractile and contraction regulatory proteins are

important features of the asthmatic airway [7,11].

WNT signaling regulates a myriad of functions from embryonic development extending

throughout the lifespan of humans [12]. Intracellular WNT signaling is broadly classified

into canonical (β-catenin-dependent) and non-canonical (β-catenin-independent) branches.

The activation of canonical WNT signaling results in the cytosolic accumulation of the

transcriptional co-activator β-catenin which, in turn, translocates to the nucleus and

activates WNT-target gene transcription in association with the T-cell factor/lymphoid

Chapter 4

120 | P a g e

enhancer-binding factor (TCF/LEF) transcription factors. Noncanonical WNT signaling, on

the other hand, activates various signaling cascades independent of β-catenin and regulates

cell polarity, cell movements, cytoskeletal reorganization and gene transcription. WNT/Ca2+

and WNT/planar cell polarity (PCP) pathways are the best characterized members of

noncanonical WNT signaling. The WNT/Ca2+ signaling is transduced by activation of

calcium-dependent signaling molecules, including protein kinase C (PKC), Ca2+/calmodulin-

dependent protein kinase II (CaMKII) and nuclear factor of activated T-cell (NFAT), whereas

the WNT/PCP pathway is relayed by RhoA or activation of c-Jun N-terminal Kinases (JNKs)

via small Rho-GTPases [12].

We have recently reported high abundance of WNT-5A in asthmatic ASM cells as compared

to healthy subjects and demonstrated that WNT-5A mediates TGF-β-induced ECM

expression. Also, we have shown that noncanonical WNTs such as WNT-5A and WNT-11 are

transcriptional targets of TGF-β in ASM cells (Chapter 3). TGF-β is a potent inducer of

contractile proteins including α-sm-actin in ASM cells and regulates ASM maturation [13].

Whether noncanonical WNT signaling also participates in ASM maturation is unknown.

However, noncanonical WNT signaling induces extensive actin cytoskeletal reorganization

which can alter the G-actin/F-actin ratio [14,15]. In addition, WNT-11 has been shown to

mediate TGF-β-induced α-sm-actin expression in renal epithelial cells [16].

Here, we investigated the role of WNT-5A and WNT-11 in TGF-β-induced α-sm-actin

expression in ASM cells and demonstrate that the expression of these noncanonical WNT

ligands increases during maturation. Furthermore, we show that WNT-5A and WNT-11

mediate TGF-β-induced actin remodeling and activate Rho kinase signaling in ASM cells.

Finally, we demonstrate that WNT-5A and WNT-11 regulate myocardin-related

transcription factor –A (MRTF-A) dynamics and mediate α-sm-actin expression.

Materials and Methods

Reagents- Recombinant human TGF-β1, recombinant human WNT-5A and recombinant

human WNT-11 were from R&D systems (Abingdon, UK). siRNA specific for human WNT-

11 and human MRTF-A, rabbit anti-MRTF-A antibody, mouse anti-Lamin A/C antibody and

mouse anti-GAPDH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Anti-phospho-MYPT1 (Thr850) antibody was obtained from Cell Signaling Technology

(Beverly, MA, USA) and anti-β-actin antibody, anti-α-sm-actin antibody, HRP-conjugated

goat anti-mouse antibody and HRP-conjugated goat anti-rabbit antibody were obtained

from Sigma (St. Louis, MO, USA). Alexa Fluor 488-conjugated Phalloidin, Alexa Fluor 594-

conjugated DNAse I, Hoechst 33342 stain and ProLong Gold Antifade reagent were from

Life Technologies (Bleiswijk, The Netherlands). Fluorescein isothiocyanate (FITC)-

conjugated donkey anti-rabbit antibody and Cy3-conjugated donkey anti-mouse antibody

was procured from Jackson Immunoresearch Europe (Suffolk, UK). Human non-specific

control and human WNT-5A siRNAs were procured from Qiagen (Venlo, The Netherlands)

and X-tremeGENE siRNA transfection reagent was purchased from Roche Applied Science

(Mannheim, Germany). LL-Z1640-2, Y-27632 dihydrochloride and latrunculin A were from

Tocris (Bristol, UK). All other chemicals were of analytical grade.


121 | P a g e

Cell culture- Human ASM cell lines, immortalized by human telomerase reverse

transcriptase (hTERT) and primary ASM cells were used for all the experiments. The

primary cultured human ASM cells used to generate each hTERT immortalized cell line were

prepared as described previously [17]. All procedures were approved by the Human Research

Ethics Board (University of Manitoba). hTERT-ASM cell lines were maintained on uncoated

plastic dishes in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with

antibiotics (50 U/ml streptomycin, 50 µg/ml penicillin) and 10% (v/v) fetal bovine serum

(FBS). For each experiment, hTERT-ASM cell lines (ASM cells) derived from two to three

different donors were used for repeated measurements. Cells were serum-deprived in

DMEM supplemented with antibiotics and ITS (5 µg/ml insulin, 5 µg/ml transferrin, and 5

ng/ml selenium) before each experiment. When applied, inhibitors were added 30 min

before the TGF-β stimulation.

Primary ASM tissue and cells were derived from trachea and mainstem bronchus obtained

from healthy transplant donors. Selection criteria for healthy lung transplant donors are

listed in the Eurotransplant guidelines and include the absence of primary lung disease such

as asthma and COPD and no more than 20 pack years of smoking history. The ASM tissue

was snap frozen after isolation and stored at -80°C till further use. The primary ASM cell

cultures derived from the trachea and mainstem bronchus were prepared as described

previously (Chapter 3) and were cultured on uncoated plastic dishes in DMEM

supplemented with antibiotics, 1% MEM essential vitamins and 10% FBS.

siRNA transfection- ASM cells were grown to ~90% confluence in 6-well cluster plates

and transfected with 200 pmol of specific siRNA in serum and antibiotic free DMEM with

X-tremeGENE siRNA transfection reagent. Control transfections were performed using a

non-targeting control siRNA. After 6 hours of transfection, medium was replaced with

DMEM supplemented with antibiotics and ITS for a period of 42 hours before TGF-β

stimulation.

RNA isolation and real-time PCR- Total RNA was extracted using the Nucleospin

RNAII kit (Macherey-Nagel, Duren, Germany) as per the manufacturer’s instructions. Equal

amounts of total RNA were then reverse transcribed using the Reverse Transcription System

(Promega, Madison, USA). 1 µl of 1:2 diluted cDNA was subjected to real-time PCR, which

was performed with the Illumina Eco Personal QPCR System (Westburg, Leusden, the

Netherlands) using FastStart Universal SYBR Green Master Mix from Roche Applied Science

(Mannheim, Germany). Real time PCR was performed with denaturation at 94°C for 30

seconds, annealing at 59°C for 30 seconds and extension at 72°C for 30 seconds for 40 cycles

followed by 10 minutes at 72°C. Real time PCR data was analyzed using the comparative

cycle threshold (Cq: amplification cycle number) method. The amount of target gene was

normalized to the endogenous reference gene 18S ribosomal RNA (∆Cq). Relative differences

were determined using the equation 2(-∆∆Cq). Primers used to analyze gene expression are: α-

sm-actin Fwd 5’- GACCCTGAAGTACCCGATAGAAC -3’ and Rev 5’-

GGGCAACACGAAGCTCATTG -3’, MRTF-A Fwd 5’- GCCAGGTGAACTATCCCAAA -3’ and

Rev 5’- CACAGAACCCTGGGACTCAT -3’ and 18S rRNA Fwd 5’-

CGCCGCTAGAGGTGAAATTC -3’and Rev 5’- TTGGCAAATGCTTTCGCTC -3’.

Chapter 4

122 | P a g e

Immunofluorescence- Phalloidin was used to stain F-actin and DNAse I was used to stain

G-actin. ASM cells were cultured on coverslips or in Labtek 8-chamber slides. Post-

stimulation, cells were washed in warm PBS and fixed in 4% paraformaldehyde (PFA) plus

4% sucrose in PBS for 15 min. Cells were then incubated with 0.3% Triton X-100 in PBS for

2 min and blocked in 5% BSA in PBS for 1 hour following which cells were incubated with

Alexa Fluor 488-conjugated Phalloidin (1:500) plus Alexa Fluor 594-conjugated DNAse I

(1:500) in 1% BSA for 1 hour. Nuclei were stained with Hoechst stain (1:10000) diluted in

ddH2O. After staining, coverslips were mounted in ProLong Gold Antifade reagent.

Immunofluorescence was analyzed using a Leica microscope. For MRTF-A and α-sm-actin

immunofluorescence was done as described earlier [18] using specific antibodies (dilution

1:100) and donkey anti-rabbit FITC or donkey anti-mouse cy3 antibodies (dilution: 1:50).

Nuclear extract preparation- Nuclear extracts were prepared as described previously

(Chapter 3).

Preparation of cell lysates- The whole cell extracts were either prepared as described

previously (Chapter 3) using SDS lysis buffer or by direct lysis in 2X Laemmli loading

buffer.

Western analysis- Protein samples were subjected to electrophoresis, transferred to

nitrocellulose membranes, and analyzed for the proteins of interest using specific primary

and HRP-conjugated secondary antibodies. Bands were subsequently visualized using the G-

box gel documentation system (Syngene, Cambridge, UK) using enhanced

chemiluminescence reagents and were quantified by densitometry using Genetools software.

Data Analysis- Values reported for all data are represented as mean ± SEM. The statistical

significance of differences between means was determined by Student’s t-test or by 1-way

ANOVA followed by Student-Newman Keuls multiple comparisons test. Differences were

considered to be statistically significant when p<0.05.

Results

WNT-5A and WNT-11 in contractile ASM cells. Noncanonical WNT signaling is

implicated in cytoskeletal reorganization and cell movements. We first investigated whether

there is any possible link between noncanonical WNT ligands and the contractile phenotype

of ASM cells. We approached this question using human tracheal smooth muscle tissue,

cultured hTERT-ASM cells and a previously reported model of contractile phenotype

maturation in primary human ASM cells [19].

We cultured cells in serum-containing medium until 50% confluence and used these as the

serum-fed group expressing a proliferative smooth muscle phenotype or until 100%

confluence followed by a serum-deprivation for 7 days labeling these as the serum-starved

group expressing a contractile phenotype [19]. Accordingly, we found that serum-starved

primary human ASM cells showed increased expression of α-sm-actin in comparison to

serum-fed cells (Figure 1A). Interestingly, expression of both WNT-5A and WNT-11 were also

augmented significantly in serum-starved cells in comparison to serum-fed cells (Figure 1A).


123 | P a g e

ASM cells in culture tend to lose contractile characteristics and are less contractile than fresh

ASM tissue. In line with this, expression of α-sm-actin was significantly higher in fresh

tracheal smooth muscle tissue in comparison to cultured hTERT-ASM cells (Figure 1B).

Corroborating the link between the contractile phenotype and expression of WNTs, mRNA

abundance of WNT-11 was significantly higher in human tracheal smooth muscle tissue than

in the hTERT-ASM cells in culture (Figure 1B). WNT-5A, however, showed similar

expression levels in both the experimental samples (Figure 1B).

Our data, thus, suggest a link between contractile phenotype and the expression of WNT-5A

and WNT-11 in ASM cells.

Figure 1. WNT-5A and WNT-11 expression in contractile ASM cells. (A) Primary human ASM

cells were cultured with (proliferative phenotype) or without serum (contractile phenotype) as

described in the materials and methods section. α-sm-actin, WNT-5A and WNT-11 mRNA were

determined by qRT-PCR, corrected for 18S rRNA and expressed relative to the serum-fed culture

condition. Data represent mean ± SEM of 5 independent experiments. *p<0.05, ***p<0.001 compared

to serum-fed; 1-way ANOVA followed by Newman-Keuls multiple comparisons test. (B) α-sm-actin,

WNT-5A and WNT-11 mRNA expression were determined in hTERT-ASM cells in culture and in

freshly-isolated human ASM tissue by qRT-PCR and expressed as 18S rRNA corrected values. Note

that data are expressed as threshold cycle (Cq) values with highest values representing lowest mRNA

expression. Data represent mean ± SEM of 3-4 independent experiments. *p<0.05, ***p<0.001

compared to fresh ASM tissue; 1-tailed Student’s t test for unpaired observations.

WNT-5A and WNT-11 mediate TGF-β-induced expression of α-sm-actin. To

investigate the link between the co-expression of α-sm-actin and WNT ligands, we first

analyzed the effect of TGF-β on these genes in hTERT-ASM cells. TGF-β is known to induce

the expression of α-sm-actin in various cell types including ASM cells [13]. We have

previously shown that TGF-β-induces time- and dose-dependent increase in WNT-5A in

hTERT-ASM cells. We also confirmed expression kinetics of α-sm-actin and WNT-11 in

hTERT-ASM cells and observed the time- and dose-dependent increases in the expression

levels (Figure 2). We have earlier reported a similar time- and dose-dependent increase in

WNT-5A expression by TGF-β (Chapter 3).

α-sm-actin WNT-5A WNT-11

Re

lative

mR

NA

exp

ressio

n(f

old

of

se

rum

-fe

d)

0

1

2

3

4Serum-fed

Serum-deprived

***

* *

A

α-sm-actin WNT-5A WNT-11

Cq V

alu

es (

corr

ecte

d f

or

18S

)

0

5

10

15

20

25

Fresh ASM tissue

hTERT-ASM cell line

*

***

B

Chapter 4

124 | P a g e

WNT-11 has been shown to mediate TGF-β-induced expression of α-sm-actin in renal

epithelial cells [16]. We investigated whether WNT-5A and WNT-11 are involved in α-sm-

actin expression in ASM cells. Indeed, siRNA-mediated knock-down of WNT-5A or WNT-11

significantly attenuated TGF-β-induced expression of α-sm-actin in hTERT-ASM cells

(Figure 3A).

Having confirmed the requirement for WNT-5A and WNT-11 in TGF-β-induced α-sm-actin

expression, we wondered whether WNT-5A and WNT-11 can induce α-sm-actin in ASM cells.

We observed that recombinant WNT-5A and WNT-11 induce α-sm-actin in ASM cells (Figure

3B).

We have previously shown that TGF-β activated kinase 1 (TAK1) is required for the induction

of WNT-5A in hTERT-ASM cells (Chapter 5). Accordingly, TAK1 inhibition by LL-Z1640-2

attenuated TGF-β-induced expression of α-sm-actin mRNA and protein (Figure 3C, D).

Altogether, our data shows that both WNT-5A and WNT-11 are required for and mediate

TGF-β-induced α-sm-actin expression in ASM cells.

TGF-β-induced actin cytoskeleton remodeling is required for α-sm-actin

expression. As both TGF-β and noncanonical WNT signaling can induce cytoskeleton

reorganization, we hypothesized that actin remodeling is required for α-sm-actin induction

in response to TGF-β in ASM cells. To test this hypothesis, we pretreated hTERT-ASM cells

with an inhibitor of actin polymerization- latrunculin A which binds to and stabilizes the G-

actin fraction of actin pool. The stabilized G-actin fails to incorporate into the polymerizing

F-actin, preventing actin polymerization and thus inhibiting actin cytoskeletal remodeling.

We performed immunofluoroscence microscopy to visualize actin polymerization and

stained F-actin using fluorescently-labelled phalloidin and G-actin using fluorescently-

labelled DNAse I. The microscopy analysis revealed that TGF-β induces increase in actin

polymerization as reflected by an increased staining of phalloidin and appearance of more

filamentous structures in the hTERT-ASM cells (Figure 4A). In addition, a decrease in the

G-actin pool can be observed (Figure 4A). In line with its role in actin polymerization,

latrunculin A pretreatment abrogated TGF-β induction of phalloidin-stained F-actin

filaments and increased DNAse I-stained G-actin (Figure 4A).

We next addressed the requirement of actin polymerization in α-sm-actin expression in

hTERT-ASM cells. Interestingly, the presence of latrunculin A completely abrogated TGF-β-

induced α-sm-actin expression in hTERT-ASM cells as demonstrated by western blotting

(Figure 4B) and microcopy analysis (Figure 4C). The inhibition of actin polymerization,

however, had no effect on the expression levels of the β-actin pool of cytoskeleton (data not

shown). Collectively, our data suggest that TGF-β-induced actin cytoskeleton remodeling is

essential for α-sm-actin expression in ASM cells.

WNT-5A and WNT-11 mediate TGF-β-induced actin cytoskeleton remodeling

via Rho kinase signaling. Next, we investigated the role of WNT-5A and WNT-11 in the

regulation of TGF-β-induced cytoskeletal remodeling in ASM cells using various strategies.

TAK1 inhibition attenuates WNT-5A induction (Chapter 5) and accordingly, α-sm-actin


125 | P a g e

Figure 2. Expression kinetics of α-sm-actin and WNT-11 in ASM cells. (A, E) hTERT-ASM

cells were either left unstimulated or stimulated with TGF-β (2 ng/ml) for the indicated duration. α-

sm-actin mRNA (A) and WNT-11 mRNA (E) expression was determined by qRT-PCR, corrected for

18S rRNA and expressed relative to untreated cultures. Data represent mean ± SEM of 4 independent

experiments. *p<0.05, **p<0.01 compared to basal; 2-tailed Student’s t test for unpaired

observations. (B) hTERT-ASM cells were treated as mentioned above. Whole cell extracts (WCE) were

α-sm-actin

GAPDH

TGF-β concentration (ng/ml)

0 0.1 0.2 1.0 2.0 10.0

24h 48h

- + - +TGF-β

α-sm-actin

GAPDH

A B

C D

F

Duration of TGF-β stimulation (in hours)

0 4 8 12 16 20 24

α-s

m-a

ctin

mR

NA

exp

ress

ion

(fo

ld o

f co

ntr

ol)

0

1

2

3

4

5

**

****

Duration of TGF-β stimulation (in hours)

0 4 8 12 16 20 24

WN

T-1

1 m

RN

A e

xp

ressio

n(f

old

of

co

ntr

ol)

0

20

40

60

80

100

120

140

**

**

*

*

*

**

Basal 0.1 0.2 1.0 2.0 10.0

α-s

m-a

ctin

mR

NA

exp

ressio

n(f

old

of

ba

sa

l)

0

5

10

15

20

25

**

***

**

TGF-β (ng/ml)

**

***

E

Basal 0.1 0.2 1.0 2.0 10.0

WN

T-1

1 m

RN

A e

xpre

ssi

on

(fold

of

ba

sal)

0

1

2

3

4

5

**

TGF-β (ng/ml)

** ***

*

Chapter 4

126 | P a g e

analysed by western anaylsis to determine α-sm-actin abundance. Expression of GAPDH was used to

verify equal loading. (C, F) hTERT-ASM cells were either left unstimulated or stimulated with TGF-β

at the indicated concentrations for 24 hours. α-sm-actin mRNA (C) and WNT-11 mRNA (F) expression

was determined by qRT-PCR, corrected for 18S rRNA and expressed relative to untreated cultures.

Data represent mean ± SEM of 4 independent experiments. *p<0.05, **p<0.01, ***p<0.001 compared

to basal; 2-tailed Student’s t test for unpaired observations. (D) hTERT-ASM cells were either left

unstimulated or stimulated with TGF-β at indicated concentrations for 48 hours. WCE were analysed

by western anaylsis to determine α-sm-actin abundance. Expression of GAPDH was used to verify

equal loading.

induction by TGF-β (Figure 3B, C). In line with these observations, TAK1 inhibition also

attenuated TGF-β-induced augmentation in F-actin appearance indicating a requirement of

WNT-5A in this process (Figure 5A).

We next performed knock down of WNT-5A and WNT-11 and analyzed F-actin and G-actin

abundance in response to TGF-β. Interestingly, the presence of either WNT-5A- or WNT-11-

specific siRNA attenuated TGF-β-induced F-actin abundance confirming an upstream role

for WNT-5A and WNT-11 in TGF-β-induced actin remodeling in hTERT-ASM cells (Figure

5B).

Rho kinase signaling has been intrinsically linked to both cytoskeletal remodeling and α-sm-

actin expression. We confirmed the essential role of the Rho kinase cascade in TGF-β-

induced actin remodeling. Microscopy analysis of F- and G-actin further confirmed this

observation as the presence of Y27632 attenuated the TGF-β-induced increase in appearance

of F-actin filaments (Figure 6A). Also, pharmacological inhibition of Rho kinase by Y27632

completely reversed the TGF-β-induced increase in F-actin/G-actin ratio (data not shown).

Accordingly, Rho kinase inhibition also attenuated TGF-β-induced α-sm-actin expression

(Figure 6B).

Noncanonical WNT signaling also activates RhoA as part of the planar cell polarity pathway.

We next investigated whether WNT-5A and WNT-11 utilize the Rho signaling arm to mediate

actin remodeling. Interestingly, the presence of exogenous WNT-5A or WNT-11 induced

actin cytoskeletal remodeling as revealed by increase in the F-actin staining (Figure 6C). Of

note, pharmacological inhibition of Rho kinase attenuated WNT-5A- and WNT-11-induced

actin remodeling (Figure 6C). Our data thus shows that WNT-5A and WNT-11 mediate TGF-

β-induced actin remodeling in ASM cells by activation of Rho kinase signaling.

WNT-5A- and WNT-11-mediated MRTF-A nuclear translocation is required for

TGF-β-induced α-sm-actin expression. Our observations coupling actin remodeling to

α-sm-actin expression intrigued us to investigate the underlying mechanistic link. MRTF-A

is a transcription factor which is released from G-actin following actin polymerization and

translocates to the nucleus. Earlier reports have also shown its role in smooth muscle-

specific gene expression including α-sm-actin [20]. We found that TGF-β induced

upregulation of MRTF-A at both the mRNA and protein levels in hTERT-ASM cells (Figure

7A, B). Interestingly, TGF-β also induced nuclear translocation of MRTF-A as demonstrated


127 | P a g e

Figure 3. WNT-5A and WNT-11 are required for TGF-β-induced α-sm-actin expression.

(A) hTERT-ASM cells were transfected with a negative control siRNA or WNT-5A-specific or WNT-

11-specific siRNA. Subsequently, cells were stimulated with TGF-β (2 ng/ml) for 48 hours and WCE

were analyzed for α-sm-actin protein abundance by western blotting. Equal loading was verified by

analysis of GAPDH. Graph represents quantification of band intensities of α-sm-actin corrected for

GAPDH as percentage of TGF-β-induced expression in control siRNA-transfected cells. Data

represent mean ± SEM of 4-5 independent experiments. *p<0.05 compared to control siRNA-

transfected, untreated cells, #p<0.05 compared to negative control siRNA-transfected, TGF-β-

stimulated cells; 1-way ANOVA followed by Newman-Keuls multiple comparisons test. (B) hTERT-

ASM cells were either left untreated or stimulated with recombinant WNT-5A (100 ng/ml) or WNT-

11 (100 ng/ml) for 24 hours. WCE were analysed for α-sm-actin protein abundance. GAPDH

expression was used to verify equal loading. (C) hTERT-ASM cells were either left unstimulated or

stimulated with TGF-β (2 ng/ml) in the presence or absence of LL-Z1640-2 at the indicated

concentrations for 24 hours. α-sm-actin mRNA expression was determined by qRT-PCR, corrected

for 18S rRNA and expressed relative to vehicle treated cultures. Data represent mean ± SEM of 4

independent experiments. ***p<0.001 compared to vehicle basal, ###p<0.001 compared to TGF-β-

stimulated cells; 1-way ANOVA followed by Newman-Keuls multiple comparisons test. (D) WCE from

cells stimulated with TGF-β (2 ng/ml) in the presence or absence of LL-Z1640-2 (0.5 µM) were

analyzed for α-sm-actin protein abundance. GAPDH expression was verified for equal loading.

C

Basal TGF-β

α-s

m-a

ctin

mR

NA

expre

ssio

n

( fo

ld o

f b

asal ve

hic

le)

0

5

10

15

20

25Vehicle

LL-Z1640-2 (0.5 µM)

LL-Z1640-2 (1.0 µM)

***

# # #

# # #

Chapter 4

128 | P a g e

by its increasing abundance in the nuclear lysate (Figure 7C) confirming a functional effect

of TGF-β on MRTF-A.

To elucidate the requirement of MRTF-A in TGF-β-induced α-sm-actin expression, we

performed knock down of MRTF-A using specific siRNA. While TGF-β induced MRTF-A

expression in the presence of non-specific negative siRNA, its expression was reduced in the

presence of MRTF-A-specific siRNA (Figure 7D) confirming an efficient knock down.

Interestingly, MRTF-A knock down also abrogated TGF-β-induced α-sm-actin expression in

hTERT-ASM cells (Figure 7D) confirming the requirement of MRTF-A in α-sm-actin

induction.

We next sought to identify the upstream mediators and mechanisms of MRTF-A nuclear

translocation. As WNT-5A and WNT-11 activate Rho-kinase signaling and mediated TGF-β-

induced actin remodeling, the presence of Rho kinase inhibitor Y27632 attenuated TGF-β-

induced MRTF-A nuclear translocation (Figure 7E). More importantly, knock down of WNT-

11 completely abrogated TGF-β-induced nuclear translocation of MRTF-A confirming a role

for noncanonical WNT ligands in this phenomenon (Figure 7F).

Altogether, our data suggest that WNT-5A and WNT-11 mediate TGF-β-induced nuclear

translocation of MRTF-A via activation of a Rho kinase-actin polymerization pathway which

is required for α-sm-actin induction in ASM cells.

Discussion

In the present study, we demonstrate a novel role for the noncanonical WNT ligands WNT-

5A and WNT-11 in the regulation of TGF-β-induced α-sm-actin expression in ASM cells. We

show that WNT-5A and WNT-11 induce Rho kinase-dependent actin remodeling in ASM

cells which is required for TGF-β induction of α-sm-actin. Furthermore, TGF-β induces an

increase in the abundance and nuclear translocation of MRTF-A which is regulated by

noncanonical WNTs and is required for α-sm-actin expression in ASM cells.

TGF-β is a potent inducer of contractile proteins such as α-sm-actin, sm-MHC, calponin and

SM22 in ASM cells [13]. Moreover, WNT/β-catenin signaling is involved in differentiation

and the expression of contractile proteins. For example, WNT-7B-activated β-catenin

signaling is required for proper development and differentiation of bronchial SMCs [21].

Similarly, TGF-β-activated β-catenin regulates pulmonary fibroblast differentiation and

expression of α-sm-actin [18] whereas it partners with cAMP response element-binding

protein (CREB)-binding protein (CREBBP or CBP) and regulates TGF-β-induced α-sm-actin

expression in pulmonary alveolar epithelial cells [22]. Interestingly, WNT-3A augments

TGF-β-SMAD2 signaling via β-catenin leading to the expression of α-sm-actin in mouse

fibroblasts [23] further suggesting a crosstalk between these two pathways in the expression

of contractile proteins. We found that knock-down of either WNT-5A or WNT-11 attenuates

TGF-β-induced α-sm-actin expression and polymerization in ASM cells whereas stimulation

with recombinant WNT-5A or WNT-11 is able to increase α-sm-actin expression

demonstrating that WNT-5A and WNT-11 mediate TGF-β-induced α-sm-actin expression in

ASM cells. Our data add to these previous observations as we demonstrate that noncanonical


129 | P a g e

Figure 4. Actin remodeling is required for TGF-β-induced α-sm-actin expression. (A) hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) in the presence or absence of latrunculin A (0.1 µM) for 48 hours. F-actin, G-actin and nuclear stainings were done as described in materials and methods section. Green=F-actin, Red=G-actin and Blue=Nucleus. Magnification 20X. (B) hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) in the presence or absence of latrunculin A (0.1 µM). WCE were analysed for α-sm-actin protein abundance. GAPDH expression was used to verify equal loading. (C) hTERT-ASM cells were stimulated as described above. α–sm-actin (red) and nuclear (blue) staining were done as described in the materials and methods section and analysed by immunofluorescence microscopy. Magnification 20X.

Chapter 4

130 | P a g e

Figure 5. WNT-5A and WNT-11 mediate TGF-β-induced actin remodeling. (A) hTERT-

ASM cells were stimulated with TGF-β (2 ng/ml) in the presence or absence of LL-Z1640-2 (0.5

µM) for 48 hours. F-actin, G-actin and nuclear staining were done as described in the materials

and methods section. Green=F-actin, Red=G-actin and Blue=Nucleus. Magnification 20X. (B)

hTERT-ASM cells were transfected with a negative control siRNA or WNT-5A-specific or WNT-11-

specific siRNA. Subsequently, cells were stimulated with TGF-β (2 ng/ml) for 48 hours and stained

for F-actin, G-actin and nucleus and analyzed by immunofluorescence microscopy. Green=F-actin,

Red=G-actin and Blue=Nucleus. Magnification 20X.


131 | P a g e

WNT signaling plays a key role in the regulation of TGF-β induced α-sm-actin expression in

smooth muscle cells.

Noncanonical WNT/Ca2+ and WNT/planar cell polarity signaling are involved in cytoskeletal

reorganization and cell movements along with the transcriptional regulation of various

genes. While there is no direct evidence published implicating noncanonical WNT signaling

in the regulation of contractile proteins; NFAT and JNK, two of the mediators of

noncanonical WNT signaling are known to regulate α-sm-actin expression. NFAT activation

induces α-sm-actin expression in SMCs and inhibition of the calcineurin-NFAT pathway

attenuates it [24]. Similarly, JNK induces expression of α-sm-actin in response to

mechanical strain [25] and arginine vasopressin [26] in vascular SMCs. Most importantly,

the small GTPase RhoA, which mediates noncanonical WNT signaling and is also activated

downstream of TGF-β signaling, is an integral part of SMC differentiation and expression of

α-sm-actin [20]. Here, we show that WNT-5A and WNT-11 activate Rho kinase-dependent

noncanonical WNT signaling in ASM cells. Recombinant WNT-5A and WNT-11 increased

the phosphorylation of MYPT1 (data not shown) confirming Rho kinase cascade activation

in ASM cells. Rho kinase signaling is known to regulate the expression of contractile proteins

including α-sm-actin in SMCs [27,28]. In line with that, pharmacological inhibition of Rho

kinase signaling attenuated TGF-β-induced α-sm-actin expression in ASM cells.

Chapter 4

132 | P a g e

Figure 6. Rho kinase regulates TGF-β and WNT-5A/WNT-11-induced actin remodeling.

(A-B) Rho kinase regulates actin cytoskeletal remodeling. (A) hTERT-ASM cells were stimulated

with TGF-β (2 ng/ml) in the presence or absence of Y27632 (1.0 µM) for 48 hours. F-actin, G-actin

and nucleus were stained and analyzed by immunofluorescence microscopy. Green=F-actin,

Red=G-actin and Blue=Nucleus. Magnification 20X. (B) hTERT-ASM cells were treated as

described in (A) and western analysis was performed to detect the abundance of α–sm-actin in

WCE. Equal loading was verified by analyzing GAPDH expression. (C) hTERT-ASM cells were

stimulated with recombinant WNT-5A (100 ng/ml) or WNT-11 (100 ng/ml) in the presence or

absence of Y27632 (1.0 µM) for 2 hours. F-actin, G-actin and nuclear staining were done and

analyzed by immunofluorescence microscopy. Green=F-actin, Red=G-actin and Blue=Nucleus.

Magnification 20X.


133 | P a g e

Figure 7. Role for MRTF-A in TGF-β and WNT-5A/WNT-11-induced α-sm-actin

expression. (A) hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) for 24 hours and MRTF-

A mRNA expression was determined by qRT-PCR, corrected for 18S rRNA and expressed relative

to the basal. Data represent mean ± SEM of 4 independent experiments. **p<0.01 compared to

vehicle basal; 2-tailed Student’s t test for unpaired observations. (B) MRTF-A protein expression

was determined by western blotting. Equal loading was verified by GAPDH analysis. (C) Nuclear

translocation of MRTF-A. hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) for 16 and 24

hours. Nuclear extracts were prepared and analyzed for the presence of MRTF-A by western

blotting. Lamin A/C abundance was analysed to determine equal loading. (D) hTERT-ASM cells

were transfected with MRTF-A-specific or negative control siRNA. Subsequently, cells were

stimulated with TGF-β (2 ng/ml) for 48 hours, WCEs were prepared and western analysis was

performed to determine the expression of MRTF-A and α–sm-actin. Equal loading was verified by

GAPDH expression. (E) Nuclear extracts, prepared from the hTERT-ASM cells stimulated with

TGF-β (2 ng/ml) in the presence or absence of Y27632 (1.0 µM) for 24 hours, were analysed for

MRTF-A abundance by western blotting. Equal loading was verified by Lamin A/C expression. (F)

hTERT-ASM cells were transfected with WNT-11-specific or negative control siRNA. Subsequently,

Chapter 4

134 | P a g e

Noncanonical WNT signaling via small GTPases and the Ca2+ pathway regulates cytoskeletal

remodeling and stress fiber formation to promote cell migration. Studies including those

from our group have showed that inhibition of actin remodeling by latrunculin A or B

inhibits contractile protein expression [27,29]. We demonstrate that WNT-5A and WNT-11

promote actin remodeling by augmenting polymerized filamentous actin (F-actin)

abundance with a concomitant decrease in monomeric globular actin (G-actin) in a Rho

kinase-dependent manner. Moreover, inhibition of TGF-β-induced actin stress fiber

formation by latrunculin A attenuates α-sm-actin expression suggesting that TGF-induced

and noncanonical WNT-mediated actin dynamics are linked to the transcriptional control of

α-sm-actin.

The SMC-specific genes essentially contain CArG box DNA elements [CC(A/T)6GG] in their

promoters which are regulated by serum response factor (SRF) in association with

proliferative ternary complex factors or with myocardin family of transcription factors

(myocardin and myocardin-related transcription factors) driving contractile gene expression

programs [30]. While myocardin is constitutively nuclear, myocardin-related transcription

factors (MRTFs) remain associated with G-actin and stay primarily cytosolic. Actin

remodeling depletes the G-actin pool leading to the release of MRTFs and their nuclear

translocation where they associate with SRF and other transcriptional co-regulators to

activate target gene transcription [31,32]. TGF-β has been shown to regulate the Rho-actin-

MRTF axis [31,33-35], however, a direct link between noncanonical WNTs and MRTF

signaling is undocumented. We show that TGF-β induces expression and nuclear

translocation of MRTF-A in ASM cells where it drives TGF-β-induced α-sm-actin expression.

Of note, inhibition of Rho kinase or knock-down of WNT-11 attenuates TGF-β-induced

nuclear localization of MRTF-A validating a Rho kinase-dependent and WNT ligand-

mediated axis in MRTF-A nuclear shuttling. We provide the first evidence for the regulation

of a Rho kinase-actin-MRTF axis by noncanonical WNT ligands.

The TGF-β-induced and noncanonical WNT-mediated regulation of a Rho kinase-actin-

MRTF-A axis may have important implications in various processes in airway remodeling.

Clearly, noncanonical WNT signaling could contribute to contractile protein expression by

ASM. Further, as EMT is considered a contributing factor to the increased mesenchymal cell

population in asthmatic airways, the TGF-β and WNT-5A or WNT-11 crosstalk might also

contribute to this process. Indeed, MRTF-A is a critical mediator of TGF-β-induced EMT

[34,36] and epithelial-to-myofibroblast transition (EMyoT) [35]. Myofibroblasts are a rich

source of ECM proteins and MRTF-A is a key mediator of myofibroblast activation and can

regulate ECM expression. As demonstrated, MRTF-A induces collagen expression in lung

fibroblasts [37]. Thus, the TGF-β-noncanonical WNTs axis could also regulate ECM

expression in the airways. In support, we have demonstrated earlier that WNT-5A mediates

cells were stimulated with TGF-β (2 ng/ml) for 24 hours and immunostained using MRTF-A-

specific antibody (green) and a nuclear stain (blue). Immunofluroscence was performed to analyze

the abundance of MRTF-A. Magnification 20X.


135 | P a g e

TGF-β-induced ECM expression via noncanonical Ca2+-NFAT and JNK signaling further

suggesting a role for noncanonical WNT signaling in airway remodeling.

In conclusion, we demonstrate that noncanonical WNT signaling via WNT-5A and WNT-11

plays an important role in contractile protein expression in smooth muscle. WNT-5A and

WNT-11 are preferentially expressed in contractile myocytes and regulate TGF-β induced

expression of sm-α-actin via Rho kinase mediated actin polymerization and MRTF-A nuclear

translocation. These findings further support a role for noncanonical WNT signaling in

airway smooth muscle remodeling, implying that targeting this pathway may be a

therapeutic strategy worth pursuing.

Acknowledgements

This work was supported by a Vidi grant (016.126.307) from the Dutch Organization for

Scientific Research (NWO).

Chapter 4

136 | P a g e

References

1. Bumbacea D, Campbell D, Nguyen L, Carr D, Barnes PJ, et al. (2004) Parameters associated

with persistent airflow obstruction in chronic severe asthma. Eur Respir J 24: 122-128.

2. Kariyawasam HH, Aizen M, Barkans J, Robinson DS, Kay AB. (2007) Remodeling and airway

hyperresponsiveness but not cellular inflammation persist after allergen challenge in

asthma. Am J Respir Crit Care Med 175: 896-904.

3. Lazaar AL, Panettieri RA,Jr. (2003) Is airway remodeling clinically relevant in asthma? Am J

Med 115: 652-659.

4. Homer RJ, Elias JA. (2005) Airway remodeling in asthma: Therapeutic implications of

mechanisms. Physiology (Bethesda) 20: 28-35.

5. James AL, Elliot JG, Jones RL, Carroll ML, Mauad T, et al. (2012) Airway smooth muscle

hypertrophy and hyperplasia in asthma. Am J Respir Crit Care Med 185: 1058-1064.

6. Woodruff PG, Dolganov GM, Ferrando RE, Donnelly S, Hays SR, et al. (2004) Hyperplasia of

smooth muscle in mild to moderate asthma without changes in cell size or gene expression.

Am J Respir Crit Care Med 169: 1001-1006.

7. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. (2003) Airway structural

alterations selectively associated with severe asthma. Am J Respir Crit Care Med 167: 1360-

1368.

8. Halayko AJ, Salari H, MA X, Stephens NL. (1996) Markers of airway smooth muscle cell

phenotype. Am J Physiol 270: L1040-51.

9. Wright DB, Trian T, Siddiqui S, Pascoe CD, Johnson JR, et al. (2013) Phenotype modulation of

airway smooth muscle in asthma. Pulm Pharmacol Ther 26: 42-49.

10. Wright DB, Trian T, Siddiqui S, Pascoe CD, Ojo OO, et al. (2013) Functional phenotype of

airway myocytes from asthmatic airways. Pulm Pharmacol Ther 26: 95-104.

11. Leguillette R, Laviolette M, Bergeron C, Zitouni N, Kogut P, et al. (2009) Myosin, transgelin,

and myosin light chain kinase: Expression and function in asthma. Am J Respir Crit Care

Med 179: 194-204.

12. Baarsma HA, Konigshoff M, Gosens R. (2013) The WNT signaling pathway from ligand

secretion to gene transcription: Molecular mechanisms and pharmacological targets.

Pharmacol Ther 138: 66-83.

13. Oenema TA, Smit M, Smedinga L, Racke K, Halayko AJ, et al. (2012) Muscarinic receptor

stimulation augments TGF-beta1-induced contractile protein expression by airway smooth

muscle cells. Am J Physiol Lung Cell Mol Physiol 303: L589-97.

14. Kikuchi A, Yamamoto H, Sato A, Matsumoto S. (2012) Wnt5a: Its signalling, functions and

implication in diseases. Acta Physiol (Oxf) 204: 17-33.

15. Angers S, Moon RT. (2009) Proximal events in wnt signal transduction. Nat Rev Mol Cell Biol

10: 468-477.

16. Zhang P, Cai Y, Soofi A, Dressler GR. (2012) Activation of Wnt11 by transforming growth

factor-beta drives mesenchymal gene expression through non-canonical wnt protein

signaling in renal epithelial cells. J Biol Chem 287: 21290-21302.

17. Gosens R, Stelmack GL, Dueck G, McNeill KD, Yamasaki A, et al. (2006) Role of caveolin-1 in

p42/p44 MAP kinase activation and proliferation of human airway smooth muscle. Am J

Physiol Lung Cell Mol Physiol 291: L523-34.


137 | P a g e

18. Baarsma HA, Spanjer AI, Haitsma G, Engelbertink LH, Meurs H, et al. (2011) Activation of

WNT/beta-catenin signaling in pulmonary fibroblasts by TGF-beta is increased in chronic

obstructive pulmonary disease. PLoS One 6: e25450.

19. Gosens R, Stelmack GL, Bos ST, Dueck G, Mutawe MM, et al. (2011) Caveolin-1 is required for

contractile phenotype expression by airway smooth muscle cells. J Cell Mol Med 15: 2430-

2442.

20. Mack CP. (2011) Signaling mechanisms that regulate smooth muscle cell differentiation.

Arterioscler Thromb Vasc Biol 31: 1495-1505.

21. Cohen ED, Ihida-Stansbury K, Lu MM, Panettieri RA, Jones PL, et al. (2009) Wnt signaling

regulates smooth muscle precursor development in the mouse lung via a tenascin C/PDGFR

pathway. J Clin Invest 119: 2538-2549.

22. Zhou B, Liu Y, Kahn M, Ann DK, Han A, et al. (2012) Interactions between beta-catenin and

transforming growth factor-beta signaling pathways mediate epithelial-mesenchymal

transition and are dependent on the transcriptional co-activator cAMP-response element-

binding protein (CREB)-binding protein (CBP). J Biol Chem 287: 7026-7038.

23. Carthy JM, Garmaroudi FS, Luo Z, McManus BM. (2011) Wnt3a induces myofibroblast

differentiation by upregulating TGF-beta signaling through SMAD2 in a beta-catenin-

dependent manner. PLoS One 6: e19809.

24. Gonzalez Bosc LV, Layne JJ, Nelson MT, Hill-Eubanks DC. (2005) Nuclear factor of activated

T cells and serum response factor cooperatively regulate the activity of an alpha-actin

intronic enhancer. J Biol Chem 280: 26113-26120.

25. Tock J, Van Putten V, Stenmark KR, Nemenoff RA. (2003) Induction of SM-alpha-actin

expression by mechanical strain in adult vascular smooth muscle cells is mediated through

activation of JNK and p38 MAP kinase. Biochem Biophys Res Commun 301: 1116-1121.

26. Garat C, Van Putten V, Refaat ZA, Dessev C, Han SY, et al. (2000) Induction of smooth muscle

alpha-actin in vascular smooth muscle cells by arginine vasopressin is mediated by c-jun

amino-terminal kinases and p38 mitogen-activated protein kinase. J Biol Chem 275: 22537-

22543.

27. Mack CP, Somlyo AV, Hautmann M, Somlyo AP, Owens GK. (2001) Smooth muscle

differentiation marker gene expression is regulated by RhoA-mediated actin

polymerization. J Biol Chem 276: 341-347.

28. Schaafsma D, McNeill KD, Stelmack GL, Gosens R, Baarsma HA, et al. (2007) Insulin

increases the expression of contractile phenotypic markers in airway smooth muscle. Am J

Physiol Cell Physiol 293: C429-39.

29. Oenema TA, Maarsingh H, Smit M, Groothuis GM, Meurs H, et al. (2013) Bronchoconstriction

induces TGF-beta release and airway remodelling in guinea pig lung slices. PLoS One 8:

e65580.

30. Miano JM. (2003) Serum response factor: Toggling between disparate programs of gene

expression. J Mol Cell Cardiol 35: 577-593.

31. Olson EN, Nordheim A. (2010) Linking actin dynamics and gene transcription to drive cellular

motile functions. Nat Rev Mol Cell Biol 11: 353-365.

32. Parmacek MS. (2007) Myocardin-related transcription factors: Critical coactivators

regulating cardiovascular development and adaptation. Circ Res 100: 633-644.

33. Small EM. (2012) The actin-MRTF-SRF gene regulatory axis and myofibroblast

differentiation. J Cardiovasc Transl Res 5: 794-804.

Chapter 4

138 | P a g e

34. Morita T, Mayanagi T, Sobue K. (2007) Dual roles of myocardin-related transcription factors

in epithelial mesenchymal transition via slug induction and actin remodeling. J Cell Biol

179: 1027-1042.

35. O'Connor JW, Gomez EW. (2013) Cell adhesion and shape regulate TGF-beta1-induced

epithelial-myofibroblast transition via MRTF-A signaling. PLoS One 8: e83188.

36. Mihira H, Suzuki HI, Akatsu Y, Yoshimatsu Y, Igarashi T, et al. (2012) TGF-beta-induced

mesenchymal transition of MS-1 endothelial cells requires smad-dependent cooperative

activation of rho signals and MRTF-A. J Biochem 151: 145-156.

37. Luchsinger LL, Patenaude CA, Smith BD, Layne MD. (2011) Myocardin-related transcription

factor-A complexes activate type I collagen expression in lung fibroblasts. J Biol Chem 286:

44116-44125.

139 | P a g e

140 | P a g e

university of groningen wnt signaling in airway remodeling

Documents