trapidil inhibits monocyte cd40 expression by preventing ifn-γ-induced stat1 s727 phosphorylation

www.elsevier.com/locate/intimp

International Immunopharmacology 4 (2004) 863–871

Trapidil inhibits monocyte CD40 expression by preventing

IFN-g-induced STAT1 S727 phosphorylation

Ling Zhoua, Liliane Schandenea, Viatcheslav A. Mordvinova, Pierre Chatelainb,Olivier Pradiera, Michel Goldmana, Patrick Stordeura,*

aDepartment of Immunology-Hematology-Transfusion, Erasme Hospital, Universite Libre de Bruxelles, route de Lennik, 808,

Brussels, B-1070, BelgiumbDepartment of In Vitro Pharmacology, UCB Pharma, Braine l’Alleud, Belgium

Received 2 December 2003; received in revised form 4 December 2003; accepted 12 March 2004

Abstract

Trapidil is a triazolopyrimidine that has been found to prevent restenosis after vascular injury. Although its precise mode of

action is still unclear, several biological effects have been described including inhibition of IFN-g-induced CD40 expression on

monocytes. Herein, we investigated the molecular mechanisms by which Trapidil exerts this inhibitory action. First, we

observed that the inhibition of CD40 expression is associated with the suppression of CD40 gene transcription, as demonstrated

by a clear decrease of CD40 nuclear RNA (nRNA) levels and unchanged CD40 mRNA half-life. IFN-g-induced CD40

transcription has been shown to be mediated by STAT1a dimers (p91/p84) which, after nuclear translocation, bind to GAS

elements present in the promoter of IFN-g responsive genes. Electrophoresis mobility shift assay (EMSA) with both STAT1

consensus and CD40 mGAS probes showed that Trapidil did not affect the DNA binding ability of STAT1 dimers. STAT1

dimerization and activation are conferred by upstream phosphorylation of two amino acid residues of the STAT1 protein. The

subsequent studies on these two potential STAT1 phosphorylation sites (Tyr701, Ser727) revealed that Trapidil attenuated IFN-

g-induced Ser727 but not Tyr701 phosphorylation. The inhibition of CD40 transcription by Trapidil could at least partially

owing to the impaired Ser727 phosphorylation of STAT1, since IFN-g failed to trigger CD40 expression in U3A S727A cells, a

cell line displaying a point mutation at the Ser727 site. Collectively, our results indicate that phosphorylation of STAT1 at the

Ser727 site enhances CD40 transcription and that Trapidil might be used as a selective inhibitor that could differentially

modulate STAT1 target genes.

D 2004 Elsevier B.V. All rights reserved.

Keywords: CD40; Trapidil; STAT1; Serine phosphorylation; IFN-g

1. Introduction presenting cell (APC) and of T cell during immune

CD40 is a member of TNF receptor family which

plays an important role in the activation of antigen

1567-5769/$ - see front matter D 2004 Elsevier B.V. All rights reserved.

doi:10.1016/j.intimp.2004.03.007

* Corresponding author. Tel.: +32-2-555-38-62; fax: +32-2-

555-44-99.

E-mail address: [email protected] (P. Stordeur).

response. Engagement of CD40 on APC leads to the

synthesis of inflammatory cytokines such as TNF-a

and IL-12 as well as the up-regulation of MHC class II

and the co-stimulatory molecules CD80 and CD86

[1,2]. Consistent with this, the CD40/CD40L pathway

was shown to be involved in the pathology of several

disorders of immune origin, including multiple scle-

L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871864

rosis, rheumatoid arthritis and atherosclerosis [3,4].

Moreover, CD40-activated expression of tissue factor,

the coagulation cascade initiator, and of the chemo-

kine MCP-1 reinforces the possible role of the CD40/

CD40L pathway in pathogenesis of atherosclerosis

[5]. CD40 expression can be induced in many cell

types in vitro. Monocytes express CD40 in response

to IFN-g, IL-3 and GM-CSF, among which IFN-g is

the most potent inducer [6]. As other IFN-g-induced

genes, the regulation of CD40 expression is presumed

to be controlled mainly by the JAK1/2-STAT1(p91/

p84) pathway. Indeed, the study of the CD40 promot-

er sequence identified three potential GAS elements

among which at least two are essential to IFN-g-

induced CD40 expression [7].

Many cytokines including IFN-g use Janus kinase

(JAK) followed by signal transducer and activator of

transcription (STAT) as signaling pathway [8,9]. IFN-

g receptor engagement activates receptor-associated

tyrosine kinases JAK1 and JAK2 (JAK1/2) through

autophosphorylation. Once JAK1/2 are activated, they

subsequently phosphorylate a single tyrosine residue

(Tyr701) on STAT1 which pre-exists in the cytoplasm

in a latent form. Tyrosine phosphorylation of STAT1

leads to STAT1 dimerization (p91/p84) and nuclear

translocation of STAT1 dimers where these dimers

bind to the gamma-activated sequence (GAS) present

in the promoter of IFN-g responsive genes [10].

However, in most cases, Tyr701 phosphorylation is

not sufficient to initiate transcription. STAT1 must

also be phosphorylated on its serine site (Ser727) by a

serine kinase independent of tyrosine to acquire full

transcriptional activity, and thus to induce effective

STAT1-targeted gene transcription [11,12].

Trapidil is a triazolopyrimidine used in patients to

control angina pectoris or prevent platelet aggregation

[13,14]. Its large spectrum of biological activities

prompted us to explore new potential uses for this

drug. In a previous study, we showed that Trapidil

decreases IFN-g-induced CD40 expression on mono-

cytes [15]. The present study was undertaken to

approach the molecular mechanism of this inhibition.

We demonstrate here that the drug inhibits IFN-g-

induced CD40 expression on monocytes at the tran-

scriptional level. We also provide evidence showing

that this inhibitory effect could be due, at least

partially, to STAT1 Ser727 phosphorylation suppres-

sion, the rest of the JAK-STAT pathway being appar-

ently not affected. This novel mechanism of Trapidil

action might lead to new applications for this drug.

2. Materials and methods

2.1. Recombinant proteins and reagents

Recombinant human IFN-g and TNF-a were pur-

chased from R&D Systems Europe (Abingdon, UK).

Trapidil powder was received from UCB Pharma

(Braine l’Alleud, Belgium) and the solution was

prepared as described [15]. Actinomycin D (Roche

Applied Science, Brussels, Belgium) was dissolved in

ethanol and used at 5 Ag/ml. Anti-STAT1-Tyr701,

anti-STAT1-Ser727, anti-STAT1 and polyclonal per-

oxidase-conjugated goat anti-rabbit antibodies were

all purchased from Upstate Biotechnology (Mundol-

sheim, France).

2.2. Cell cultures

Monocytes were purified from peripheral blood

mononuclear cells (PBMC) isolated from healthy

donors and stimulated in the culture medium as

previously described [15]. 2fTGH and U3A-S727A

fibrosarcoma cells kindly provided by Prof. G.R.

Stark (Lerner Research Institute, Cleveland, OH) were

maintained in DMEM medium, 10% fetal bovine

serum (FBS) with 400 Ag/ml hygromycin B or 250

Ag/ml G418 (A.G. Scientific, San Diego, CA). U3A-

S727A is a 2fTGH-derived STAT1-null mutant U3A

cell line reconstituted with STAT1 possessing a

Ser727-Ala727 mutation [16].

2.3. Quantification of CD40 mRNAs and CD40

nRNAs by real time PCR

The methodology used for h-actin and CD40

mRNAs quantification, i.e. reverse transcription, real

time PCR on a Lightcycler instrument (Roche Applied

Science) and the choice of the primers and probes,

was identical to what we described for cytokines and

h-actin in a previous study [17]. The PCR parameters

specific for CD40 mRNA are listed in Table 1. For

GAPDH and CD40 nRNAs measurements, reverse

transcription was performed using the standard proto-

col ‘‘ThermoScript RT-PCR System For First-Strand

Table 1

Oligonucleotidesa

Primers and probes for real time PCR

RNA target Oligonucleotides (5V–3V)b Product size (bp) Final concentration (nM)c

CD40 mRNA F701: GGCCAAGAAGCCAACCAATAA

R777: CAGGAAGATCGTCGGGAAAAT

P727: 6Fam-CCCACCCCAAGCAGGAACCCC-Tamra-p

78 F 300 R 600

CD40 nRNA F1888: GATACCCAGGTTGAATGAGAGC

R1987: CATTTGTTTCTGCTTGCATGAT

P1932: 6Fam-ACAGCCAGCCAGGTAGCCGG-Tamra-p

100 F 600 R 900

GAPDH nRNA F2962: GGGAAGCTCAAGGGAGATAAA

R3039: CATTAAGAGGGCGAATGCAG

P2988: 6Fam-ACCTCTTGGGCCCTCCTGGG-Tamra-p

78 F 600 R 900

Primers for standard preparation by ‘‘classical’’ PCRd,e

RNA target Oligonucleotides (5V! 3V)b Product size (bp) Annealing temperatured

CD40 nRNA F1678: GGGAGTGAGAACTGGAGATTGA

R2088: GCAGGTTGGATTACGAAGATAAG

411 60

GAPDH nRNA F2716: TTGAGTTTGATGATGCTGAGT

R3185: GATGGCAACAATATCCACTTT

470 56

a For a full description, see 12.b F, R and P indicate forward and reverse primers and probes, respectively; numbers indicate the sequence position.c Final concentration of forward (F) and reverse (R) primers.d Standard curves were generated from serial dilutions of PCR products prepared by ‘‘classical’’ PCR for which specific conditions were as

follows: denaturation at 95 jC for 20 s, annealing (temperature as stated) for 20 s and elongation at 72 jC for 45 s, for a total of 35 cycles.

MgCl2 final concentration was 1.5 mM.e For CD40 mRNA, the standard curves were generated from serial dilutions of a plasmid purchased at the American Type Culture

Collection (Manassas, VA).

L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871 865

cDNA Synthesis’’ from Invitrogen life technologies

(Merelbeke, Belgium), starting from 500 ng of total

cellular RNA pretreated with deoxyribonuclease. We

used the same reverse primer as cDNA synthesis

template as for real time PCR (GAPDH R3039 or

CD40 R1987, Table 1, 6 AM). The real time PCR was

performed as described [17] using primers and probes

targeting intronic sequences (Table 1).

2.4. Electrophoresis mobility shift assay (EMSA)

After 1-h pre-incubation with Trapidil or solvent,

monocytes were activated with IFN-g for 30 min,

and the nuclear extracts were then prepared as

described by Osborn et al. [18]. The STAT1 p84/

p91 consensus and mutant oligonucleotides were

purchased from Santa Cruz biotechnology (Santa

Cruz, CA). The mGAS element probe was synthe-

sized according to the described sequence [7]. All

the double-strand oligonucleotides were end-labeled

with [g-32P] ATP (Amersham Pharmacia Biotech,

Rossendaal, The Netherlands) by T4 polynucleotide

kinase according to the manufacturer’s instructions

(Roche Applied Science). For the binding reaction,

10 Ag of nuclear extracts was incubated at room

temperature for 15 min with the reaction mixture

containing binding buffer (75 mM KCl; 2.5 mM

MgCl2; 0.1 mM EDTA; 10% glycerol; 0.25 mM

DTT; 10 mM Tris–HCl, pH 7.5), poly-dI–dC and

2000 cpm probe in a final volume of 20 Al. Boundor free DNA were resolved by electrophoresis

through a 6% polyacrylamide gel in Tris–borate

EDTA buffer. For competition and supershift analy-

sis, nuclear extracts were preincubated with

100� unlabelled probe or polyclonal anti-STAT1a

(p91) antibodies for 30 min. The gel was dried and

exposed to autoradiography film (Eastman Kodak,

Bornem, Belgium) at � 80 jC.

2.5. Western blot analysis

After stimulation by IFN-g in the presence of

Trapidil or solvent, 107 cells were lysed in 1 ml of

Radioimmunoprecipitation (RIPA) Buffer (50 mM


Tris–HCl, pH 7.4; 1% NP-40; 0.25% sodium deox-

ycholate; 150 mM NaCl; 1 mM EGTA; 1 mM PMSF;

1 Ag/ml aprotinin; 1 Ag/ml leupeptin; 1 Ag/ml pep-

statin; 1 mM Na3VO4; 1 mM NaF). The proteins were

separated by denaturing polyacrylamide gel (6%)

electrophoresis in the presence of SDS and then

transferred onto a nitrocellulose membrane. Immuno-

blot analysis used a primary anti-STAT1, anti-STAT1-

Tyr701 or anti-STAT1-Ser727 antibody, followed by a

polyclonal peroxidase-conjugated goat anti-rabbit an-

tibody. The membrane was subjected to the enhanced

chemiluminescence detection system (Amersham

Pharmacia Biotech) and exposed to X-ray film (East-

man Kodak).

2.6. The multiplex bead immunoassay

Akt phosphorylation at serine 473 was measured

by the ‘‘Phospho Akt, Jnk1/2, p38 MAPK 3-Plex

Kit’’ (Biosource Europe, Nivelles, Belgium). After

stimulation by IFN-g in the presence or in absence

of Trapidil for 15 and 60 min, 107 cells were lysed

by cell lysis buffer (50 mM Tris–HCl; pH 7.4; 1%

NP-40; 250 mM NaCl; 5 mM EDTA; 1 mM PMSF;

50 mM NaF; 1 mM Na3VO4; 10% protease inhibitor

cocktail). Cell lysis and phospho-protein measure-

ment were performed following manufacturer’s

instructions. The plate was read using a Luminex

XYk platform by counting 100 events/bead region,

and concentration of the unknown samples was

extrapolated from a standard curve. The ultimate

results were normalized against total protein quantity

contained in each sample.

2.7. Statistical analysis

Data were compared using Wilcoxon’s non-para-

metric test.

3. Results

3.1. Trapidil inhibits IFN-c-induced CD40 mRNA

accumulation

We previously showed, using a ‘‘classical’’ PCR

assay, that Trapidil attenuated CD40 mRNA increase

induced by IFN-g [15]. Taking advantage of the new

real time PCR methodology, we confirmed and quan-

tified the Trapidil-induced decrease of CD40 mRNA

levels. After IFN-g stimulation, about 65% of inhibi-

tion was observed at the different incubation times.

Moreover, in Trapidil-treated versus non-treated

monocytes, a decrease of basal CD40 mRNA amounts

was observed at 16 h, which was also statistically

significant (Fig. 1).

3.2. Trapidil inhibits IFN-c-induced CD40 gene

transcription

The CD40 mRNA decrease by Trapidil could be

due to CD40 mRNA destabilization. We thus ana-

lyzed Trapidil’s influence on CD40 mRNA stability in

monocytes stimulated by IFN-g. Precisely, transcrip-

tion was stopped by actinomycin D addition 4 h after

IFN-g stimulation and CD40 mRNA levels were

measured using real time PCR at different time points

following actinomycin D addition. CD40 mRNA half-

life was determined from the slope of decay. A half-

life of 3.9 h was calculated for IFN-g-induced CD40

mRNA in the absence of Trapidil versus 3.5 h in the

presence of Trapidil (Fig. 2A), indicating that CD40

mRNA stability is not affected by the drug.

In order to determine if Trapidil acts at the tran-

scriptional level, we quantified CD40 nRNA by real

time PCR. An increase of CD40 nRNA expression by

IFN-g was detected which reflects the transcriptional

induction of CD40 gene, as reported previously [7].

Trapidil inhibits CD40 nRNA expression in a dose-

dependent manner (Fig. 2B). Thus, we conclude that

Trapidil inhibits CD40 nRNA expression but does not

change mRNA half-life, suggesting that this drug

mainly inhibits CD40 gene transcription.

3.3. Trapidil does not change CD40 promoter DNA

binding activity of STAT1 dimers

Two GAS elements (mGAS and dGAS) in the

CD40 promoter have been shown to be important

for CD40 transcription induced by IFN-g. We thus

checked by EMSA whether Trapidil interferes with

the appropriate activation of STAT1 which could

impair its binding to GAS elements. Upon IFN-g

activation, nuclear extracts formed a complex with

the STAT1 (p91/p84) consensus probe or the mGAS

probe (Fig. 3A). This complex formation was pre-

Fig. 1. Trapidil inhibits IFN-g-induced CD40 mRNA accumulation. Real time PCR assay for CD40 mRNA quantification. Monocytes (5� 106)

were stimulated with or without IFN-g (1 ng/ml) up to 16 h in the presence of 100 AM Trapidil (open columns) or solvent (hatched columns).

RNAwas extracted after 0, 4, 8 and 16 h of culture. Quantitative PCR were performed for CD40 and h-actin mRNAs. CD40 mRNA levels are

normalized against endogenous h-actin mRNA and the values presented as relative number of copies by referring to negative control

(unstimulated cells) (100). The mean + S.E.M. of four independent experiments are represented. *p< 0.05, **p< 0.015, as compared to IFN-g

plus solvent treated samples.


vented by the addition of 100� unlabelled probe or

anti-STAT1 antibody but not by addition of the mutant

STAT1 probe (not shown). Trapidil was used at

Fig. 2. Trapidil inhibits IFN-g-induced CD40 gene transcription. (A) Real ti

stimulated with IFN-g (1 ng/ml) for 4 h in the presence of 100 AM of Tra

added at the end of 4 h; cells were then harvested at the indicated times th

represent the percentage of CD40 mRNA remaining in the sample by using

representative of three independent experiments are shown. (B) Real time P

stimulated with IFN-g (1 ng/ml) for 20 h in the presence of graded doses of

and GAPDH nRNAs quantification. The Y-axis values represent relative num

against GAPDH nRNA. The mean + S.E.M of seven independent experim

plus solvent treated samples.

concentrations up to 400 AM and did not prevent

the formation of DNA–protein complexes (Fig. 3A),

nor did it alter the binding to the dGAS element (data

me PCR assay for CD40 mRNA half-life. Monocytes (5� 106) were

pidil (continuous line) or solvent (dotted line). Actinomycin D was

at follow actinomycin D addition (1–8 h). The values of the Y-axis

mRNA level at time 0 as reference (100%). Data of one experiment

CR assay for CD40 nRNA quantification. Monocytes (5� 106) were

Trapidil (TPD) or solvent. Real time PCR was performed for CD40

bers of copies by referring to negative control (100) after correction

ents are represented. *p< 0.05, **p< 0.015, as compared to IFN-g

Fig. 3. Trapidil prevents IFN-g-induced Ser727 phosphorylation of STAT1. (A) EMSA experiment using STAT1 and mGAS probes. Monocytes

(5� 106) were stimulated with IFN-g (1 ng/ml) for 30 min in the presence of graded doses of Trapidil (TPD) or solvent. Nuclear extracts were

prepared and EMSAwas performed with labeled STAT1 consensus probe (upper panel) or CD40 mGAS probe (bottom panel). The data shown

are representative of three independent experiments. (B) Western blot detection of phospho-STAT1 Tyr701 and Ser727. Monocytes (5� 106)

were stimulated with IFN-g (1 ng/ml) for 30 min in the presence of graded doses of Trapidil (TPD) or solvent. Total protein extracts were

prepared and cell lysates were resolved by 6% SDS-PAGE. Western analyses were carried out with anti-phospho-Ser727-STAT1 (upper panel),

anti-phospho-Tyr701-STAT1 (medium panel) or anti-STAT1 (bottom panel) antibodies. The data of one experiment representative of three

independent experiments are shown.

Fig. 4. CD40 mRNA expression is impaired in U3A-S727A cells.

2fTGH and U3A-S727A cells of 2� 106 per 10-cm dish were treated

with 100 ng/ml IFN-g (black columns) or 10 ng/ml IFN-g+ 10 ng/ml

TNF-a (hatched columns) for 20 h. Quantitative real time PCR was

performed for CD40 and h-actin mRNAs quantification. The values

are presented as relative numbers of copies by referring to negative

controls (100%) after correction against h-actin. Negative controls

were unstimulated cells (open bars). The S.E.M. and the mean of six

independent experiments are represented.


not shown). This implies that the drug does not impair

dimerization, nucleus translocation or DNA binding

of STAT1.

3.4. Trapidil attenuates IFN-c-induced Ser727 phos-

phorylation of STAT1

STAT1 activation requires both phosphorylation on

tyrosine (Tyr701) and serine (Ser727) sites. IFN-g

treatment clearly induced STAT1 Tyr701 as well as

Ser727 phosphorylation, as observed by immunoblot

assays (Fig. 3B). Tyr701 phosphorylation was not

different in Trapidil-treated and untreated samples

which was consistent with the normal DNA binding

ability demonstrated by gel shift assay. On the con-

trary, a decrease in Ser727 phosphorylation was

observed in Trapidil-conditioned samples (Fig. 3B).

Taken together, these data demonstrate that this drug

alters IFN-g-induced JAK-STAT1 pathway by reduc-

ing Ser727 phosphorylation.

3.5. CD40 mRNA expression is impaired in U3A-

S727A cells

In order to determine whether STAT1 Ser727

phosphorylation is required for CD40 expression,

we measured CD40 mRNA expression in wild-type

2fTGH cells as well as in U3A-S727A cells, a mutant

cell line lacking the Ser727 phosphorylation site.

Upon stimulation by IFN-g alone or IFN-g plus

TNF-a, 2fTGH cells increased CD40 mRNA expres-

sion approximately two- to threefold, whereas CD40

expression was not inducible in U3A-S727A cells

(Fig. 4). These results confirm the importance of the

STAT1-Ser727 phosphorylation site for IFN-g-in-

duced CD40 expression.

Fig. 5. Trapidil does not prevent IFN-g-induced Akt serine 473 phosphorylation. Cells (107) were incubated with and without 10 ng/ml IFN-g

and Trapidil (concentration as stated), for 15 and 60 min. The cells were then lysed by cell lysis buffer. The amount of phosphorylated Akt

serine 473 was measured by multiplex bead immunoassay using a Luminex instrument. The concentration of unknown samples was normalized

against their total protein concentration, and is expressed in arbitrary units. The data of one representative experiment out of two are shown.


3.6. Trapidil does not prevent IFN-c-induced Akt

phosphorylation

In a previous study, Nguyen et al. [19] demonstrat-

ed that phosphatidylinositol 3-kinase (PI3K) and its

effector kinase Akt play an important role in the serine

phosphorylation of STAT1. We therefore studied the

effect of Trapidil on IFN-g-induced Akt phosphory-

lation by multiplex bead immunoassay. As shown in

Fig. 5, we found that IFN-g treatment induced a rapid

Akt phosphorylation already observed after 15 min

and still persisting after 60 min. The presence of

Trapidil did not prevent Akt phosphorylation either

after 15 or 60 min. We concluded that the inhibitory

effect of Trapidil on STAT1 serine phosphorylation

was not due to a direct inhibition of Akt activation.

4. Discussion

Based on our previous observations that Trapidil

suppresses IFN-g-induced CD40 expression [15], the

present work extended our study to the molecular

level, looking at the mechanisms of this inhibition.

CD40 up-regulation after IFN-g stimulation is mainly

controlled at transcriptional level. Accordingly, we

observed that the suppression of CD40 transcription

is the dominant effect of Trapidil whereas post-tran-

scriptional events do not seem to be altered. Hence,

the transcriptional inhibition of CD40 by Trapidil

could represent one of the most efficient ways to

prevent CD40 up-regulation.

The transcriptional regulation of CD40 gene was

first studied by Nguyen and Benveniste [7] on a

macrophage cell line. These authors demonstrated that

the binding of STAT1a to two GAS sites at � 521

[distal GAS (dGAS)] and � 483 [medial GAS

(mGAS)] in the CD40 promoter was critical for

IFN-g-induced CD40 transcription. Therefore, distur-

bance at any step of JAK1/2-STAT1 signal transduc-

tion pathway would theoretically prevent functional

activation of the STAT1 molecule and result in CD40

expression deficiency. We thus studied Trapidil’s

effects on DNA binding ability as well as on Ser727

and Tyr701 phosphorylation. In the presence of the

drug, the whole activation cascade occurred normally

except a weaker Ser727 phosphorylation. Actually,

Tyr701 phosphorylation leads to subsequent STAT1

dimerization, nuclear entrance and DNA binding, but

poorly activates transcription. On the other hand, the

Ser727 phosphorylation dramatically enhances the

transcriptional activity of STAT1 (p91/p84) without

affecting its DNA binding. Thus, in order to know if

CD40 expression could occur in the absence of


STAT1 Ser727 phosphorylation, we measured CD40

mRNA expression in wild-type and Ser727 mutant

cell lines. We found an obvious correlation between

STAT1 Ser727 phosphorylation and CD40 expression,

CD40 induction being impaired in mutant cells com-

pared to wild-type cells. Considering the multiple

effects of Trapidil, other mechanisms could also be

involved. Nevertheless, the decreased Ser727 phos-

phorylation could explain, at least partially, the inhib-

itory effect of the drug.

The exact mechanisms by which serine phosphor-

ylation enhances transcription activity are not clear.

An interesting hypothesis is that this site may be

directly involved in the STAT1 interaction with other

proteins such as transcription co-activators. Among

these co-activators, MCM5 and BRCA1 were

reported to bind preferentially S727-phosphorylated

STAT1 and to synergize with STAT1 for maximal

gene transcription in a promoter specific manner

[20,21]. In fact, a serine phosphorylation defect dif-

ferently affects STAT1 targeted genes, as demonstrat-

ed by Kovarik et al. [22] who observed a variable

sensitivity of several IFN-g inducible genes to the

absence of Ser727 phosphorylation. Moreover, IFN-

a/h-induced transcription factor ISGF3, a complex

formed by STAT1, STAT2 and p48, displays normal

biological activity when STAT1 Ser727 phosphoryla-

tion is deficient [23]. Along this line, among the

proteins coded by IFN-g inducible genes we tested,

CD40, MHC class II and CD54 but not CD80 or

CD86 are susceptible to Trapidil’s inhibitory effect.

This phenomenon could be explained by the different

requirements in co-activators of transcription.

The serine kinase that relays IFN-g signal to STAT1

is not clearly identified. Mitogen-activated kinases

ERK1/2 and p38 have been proposed as the mediators

of STAT1 Ser727 phosphorylation following various

stimuli, however, with contradictory results [24,25].

Interestingly, using U0126 or SB203580, specific

inhibitors to ERK kinase (MEK1/2) or p38 pathways,

respectively, we observed the prevention of STAT1

Ser727 phosphorylation by U0126 but not by

SB203580 (data not shown). U0126 also inhibited

CD40 expression at the cell surface as well as at the

messenger level. These results are in line with the

previous studies in which Trapidil has been found to

inhibit ERK kinase [26,27], leading to the speculation

that Trapidil-mediated suppression of CD40 expres-

sion as well as STAT1 Ser727 phosphorylation might

be related to its effect on ERK activation. Further

studies should be conducted to learn about the exact

role of ERK1/2 in IFN-g-induced STAT1 Ser727

phosphorylation. Apart from these pathways, the phos-

phatidylinositol 3V-kinase (PI3K) pathway was also

identified to induce STAT1 Ser727 phosphorylation

[19]. This finding was further supported by Deb et al.

[28] who showed that protein kinase C (PKC) family

of proteins was activated downstream the PI3 kinase.

We thus investigated the effect of Trapidil on IFNg-

induced Akt phosphorylation and found, contrary to

what was expected, that Trapidil did not directly

inhibit Akt activation.

In conclusion, we demonstrate here the important

role of STAT1 Ser727 phosphorylation in the induc-

tion of CD40 gene transcription and identify a novel

molecular target for Trapidil. We show that Trapidil

acts as an inhibitor of the JAK-STAT pathway affect-

ing the serine phosphorylation arm. In the future, this

drug might be useful to selectively inhibit a group of

genes whose transcription strictly requires serine

phosphorylation of STAT1 molecules. This paves

the way to new potential clinical applications espe-

cially in inflammatory diseases and immune system

disorders.

Acknowledgements

We thank Prof. G.R. Stark from the Lerner

Research Institute of Cleveland for providing us with

the 2fTGH and U3A-S727A cell lines. We are greatly

indebted to Claire Debusscher for kindly revising the

English version of the manuscript.

This work was supported by UCB Pharma

Belgium.

References

[1] Diehl L, Den Boer AT, Van VD, Melief CJ, Offringa R, et al.

The role of CD40 in peripheral T cell tolerance and immunity.

J Mol Med 2000;78:363–71.

[2] van Kooten C, Banchereau J. CD40-CD40 ligand. J Leukoc

Biol 2000;67:2–17.

[3] Laman JD, de Smet BJ, Schoneveld A, van Meurs M. CD40-

CD40L interactions in atherosclerosis. Immunol Today 1997;

18:272–7.

,


[4] Noelle RJ, Mackey M, Foy T, Buhlmann J, Burns C. CD40

and its ligand in autoimmunity. Ann N Y Acad Sci

1997;815:384–91.

[5] Pradier O, Willems F, Abramowicz D, Schandene L, de Boer M

M, et al. CD40 engagement induces monocyte procoagulant

activity through an interleukin-10 resistant pathway. Eur J

Immunol 1996;26:3048–54.

[6] Alderson MR, Armitage RJ, Tough TW, Strockbine L, Fans-

low WC, et al. CD40 expression by human monocytes: regu-

lation by cytokines and activation of monocytes by the ligand

for CD40. J Exp Med 1993;178:669–74.

[7] Nguyen VT, Benveniste EN. Involvement of STAT-1 and ets

family members in interferon-gamma induction of CD40 tran-

scription in microglia/macrophages. J Biol Chem 2000;275:

23674–84.

[8] Leonard WJ. Role of Jak kinases and STATs in cytokine signal

transduction. Int J Hematol 2001;73:271–7.

[9] Ortmann RA, Cheng T, Visconti R, Frucht DM, O’Shea JJ.

Janus kinases and signal transducers and activators of tran-

scription: their roles in cytokine signaling, development and

immunoregulation. Arthritis Res 2000;2:16–32.

[10] Bromberg JF, Horvath CM,Wen Z, Schreiber RD, Darnell JEJ.

Transcriptionally active Stat1 is required for the antiprolifera-

tive effects of both interferon alpha and interferon gamma.

Proc Natl Acad Sci U S A 1996;93:7673–8.

[11] Wen Z, Zhong Z, Darnell JEJ. Maximal activation of tran-

scription by Stat1 and Stat3 requires both tyrosine and serine

phosphorylation. Cell 1995;82:241–50.

[12] Decker T, Kovarik P. Serine phosphorylation of STATs. On-

cogene 2000;19:2628–37.

[13] Maresta A, Balducelli M, Cantini L, Casari A, Chioin R, et al.

Trapidil (triazolopyrimidine), a platelet-derived growth factor

antagonist, reduces restenosis after percutaneous transluminal

coronary angioplasty. Results of the randomized, double-blind

STARC study. Studio Trapidil versus Aspirin nella Restenosi

Coronarica. Circulation 1994;90:2710–5.

[14] Okamoto S, Inden M, Setsuda M, Konishi T, Nakano T.

Effects of trapidil (triazolopyrimidine), a platelet-derived

growth factor antagonist, in preventing restenosis after percu-

taneous transluminal coronary angioplasty. Am Heart J

1992;123:1439–44.

[15] Zhou L, Ismaili J, Stordeur P, Thielemans K, GoldmanM, et al.

Inhibition of the CD40 pathway of monocyte activation by

triazolopyrimidine. Clin Immunol 1999;93:232–8.

[16] Kumar A, Commane M, Flickinger TW, Horvath CM, Stark

GR. Defective TNF-alpha-induced apoptosis in STAT1-null

cells due to low constitutive levels of caspases. Science

1997;278:1630–2.

[17] Stordeur P, Poulin LF, Craciun L, Zhou L, Schandene L, et al.

Cytokine mRNA quantification by real-time PCR. J Immunol

Methods 2002;259:55–64.

[18] Osborn L, Kunkel S, Nabel GJ. Tumor necrosis factor alpha

and interleukin 1 stimulate the human immunodeficiency virus

enhancer by activation of the nuclear factor kappa B. Proc

Natl Acad Sci U S A 1989;86:2336–40.

[19] Nguyen H, Ramana CV, Bayes J, Stark GR. Roles of phos-

phatidylinositol 3-kinase in interferon-gamma-dependent

phosphorylation of STAT1 on serine 727 and activation of

gene expression. J Biol Chem 2001;276:33361–8.

[20] Ouchi T, Lee SW, Ouchi M, Aaronson SA, Horvath CM.

Collaboration of signal transducer and activator of transcrip-

tion 1 (STAT1) and BRCA1 in differential regulation of IFN-

gamma target genes. Proc Natl Acad Sci U S A 2000;97:

5208–13.

[21] Zhang JJ, Zhao Y, Chait BT, Lathem WW, Ritzi M, et al.

Ser727-dependent recruitment of MCM5 by Stat1alpha in

IFN-gamma-induced transcriptional activation. EMBO J

1998;17:6963–71.

[22] Kovarik P, Mangold M, Ramsauer K, Heidari H, Steinborn R,

et al. Specificity of signaling by STAT1 depends on SH2 and

C-terminal domains that regulate Ser727 phosphorylation, dif-

ferentially affecting specific target gene expression. EMBO

2001;20:91–100.

[23] Muller M, Laxton C, Briscoe J, Schindler C, Improta T, et al.

Complementation of a mutant cell line: central role of the 91

kDa polypeptide of ISGF3 in the interferon-alpha and -gamma

signal transduction pathways. EMBO J 1993;12:4221–8.

[24] Kovarik P, Stoiber D, Eyers PA, Menghini R, Neininger A,

et al. Stress-induced phosphorylation of STAT1 at Ser727

requires p38 mitogen-activated protein kinase whereas IFN-

gamma uses a different signaling pathway. Proc Natl Acad

Sci U S A 1999;96:13956–61.

[25] Takaoka A, Tanaka N, Mitani Y, Miyazaki T, Fujii H, et al.

Protein tyrosine kinase Pyk2 mediates the Jak-dependent ac-

tivation of MAPK and Stat1 in IFN-g, but not IFN-a, signal-

ing. EMBO J 1999;18:2480–8.

[26] Bonisch D, Weber AA, Wittpoth M, Osinski M, Schror K.

Antimitogenic effects of trapidil in coronary artery smooth

muscle cells by direct activation of protein kinase A. Mol

Pharmacol 1998;54:241–8.

[27] Jaster R, Sparmann G, Emmrich J, Liebe S. Extracellular sig-

nal regulated kinases are key mediators of mitogenic signals in

rat pancreatic stellate cells. Gut 2002;51:579–84.

[28] Deb DK, Sassano A, Lekmine F, Majchrzak B, Verma A, et al.

Activation of protein kinase C delta by IFN-gamma. J Immu-

nol 2003;171:267–73.

trapidil inhibits monocyte cd40 expression by preventing ifn-γ-induced stat1 s727 phosphorylation

Documents