the role of discoidin domain receptor 1 ( ddr1 ) on ... · the role of discoidin domain receptor 1...

The Role of Discoidin Domain Receptor 1 (Ddr1) on

Macrophages in Adhesion and Cytokine production

By

Karen Elma Britto, B.Sc.

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Department of Laboratory Medicine and Pathobiology

Faculty of Medicine

University of Toronto

© Copyright by Karen Britto. 2010.

ii

The Role of Discoidin Domain Receptor 1 (Ddr1) on Macrophages in

Adhesion and Cytokine production

Karen Elma Britto

Master of Science

Department of Laboratory Medicine and Pathobiology

University of Toronto

2010

Abstract

Atherosclerosis is an inflammatory disease of the cardiovascular system. Discoidin

domain receptor 1 is a receptor tyrosine kinase that binds collagens. Previous work in

our lab has shown that deleting DDR1 in a mouse model results in attenuation of

atherosclerosis, with fewer macrophages in the plaque. The aim of this study was to

determine what changes in macrophage behaviour due to the lack of DDR1 was

attenuating plaque development.

In order to carry out experiments, primary mouse peritoneal macrophages were used.

DDR1-deficient macrophages adhered significantly less to type IV collagen and

fibronectin compared to DDR1-expressing cells. In addition, when plated on type IV

collagen and fibronectin, DDR1-deficient macrophages produced decreased levels of

MCP-1 protein, a cytokine known to be important in plaque development, particularly in

leukocyte recruitment to plaque. These results suggest that DDR1 is an important

mediator in macrophage adhesion to matrix and macrophage cytokine production.

iii

Acknowledgments

This thesis and the work behind it would not have been possible without the

help of a great many people, and I take pleasure in this opportunity to acknowledge and

thank them for their contributions.

It is difficult to overstate my gratitude to my supervisor, Dr. Michelle Bendeck.

Her scientific training, enthusiasm and great patience helped to constantly provide

sound advice, guidance and encouragement, especially during times when hurdles

seemed insurmountable. Her confidence in me helped me cultivate confidence in

myself, and more than anything, I take that away from 2 years under her tutelage.

Particular thanks are also due to the members of my advisory committee – Dr.

Myron Cybulsky and Dr. Craig Simmons for their insightful comments, and hard

questions.

I am grateful to my many colleagues in the Bendeck lab for providing a

stimulating and enjoyable environment in which to learn and grow. Thanks in particular

to Dr. Guang Pei Hou for many long discussions, to Dan Trcka for his friendship and to

Dr. Antonio Rocca for unwaveringly trying to teach me what exactly a coffee break

entailed and so much more.

Technical assistance from Ms. Sarah Fodor from the Division of Comparative

Medicine was invaluable. Thanks also to Mr. Brent Steer for help with experimental

setup and troubleshooting.

Thanks are also due to members of the LMP department administrative staff, in

particular Louella D’Cunha, Rama Ponda and Ferzeen Dharas, for assistance in many

ways.

Thanks to Dr. Anja Lowrance for starting me on the path to research and to Dr.

Michael Arts for his supervision during my internship at his lab, without which I would

not have chosen to pursue graduate research.

Lastly and most importantly, I would like to thank my family, and in particular my

parents Malcolm and Eliza Britto for their constant encouragement, patience and

support during my studies. Without them, none of this would be possible.

iv

Table of Contents

Abstract ........................................................................................................................................... ii

Acknowledgments.......................................................................................................................... iii

Table of Contents ........................................................................................................................... iv

List of Tables and Figures .............................................................................................................. vii

List of abbreviations and acronyms ............................................................................................... ix

1 Literature Review .......................................................................................................................1

1.1 Introduction .........................................................................................................................2

1.2 Atherosclerosis .....................................................................................................................2

1.2.1 Introduction .............................................................................................................2

1.2.2 Initiation of atherosclerosis .....................................................................................3

1.2.3 Progression ..............................................................................................................5

1.3 Extracellular matrix in atherosclerosis.................................................................................6

1.3.1 Proteoglycans ...........................................................................................................6

1.3.2 Fibronectin – an adhesive glycoprotein ...................................................................7

1.3.3 Collagens ..................................................................................................................8

1.4 Collagen Receptors ..............................................................................................................9

1.4.1 Integrins .................................................................................................................10

1.4.2 Discoidin Domain receptors ...................................................................................11

1.5 Discoidin Domain Receptor 1 ............................................................................................11

1.5.1 Structure ................................................................................................................11

1.5.2 Regulation and Signaling ........................................................................................12

1.5.3 Functions ................................................................................................................15

1.5.4 Role in atherosclerosis ...........................................................................................17

v

1.6 Major Mouse models of atherosclerosis ...........................................................................18

1.6.1 The Apolipoprotein E deficient mouse model .......................................................18

1.6.2 The Low Density Lipoprotein Receptor deficient mouse model ...........................18

1.7 Rationale ............................................................................................................................19

1.8 Hypotheses: .......................................................................................................................20

1.9 Figures ................................................................................................................................22

2 Materials and methods ............................................................................................................25

2.1 Generation of mice ............................................................................................................26

2.2 To obtain macrophages from the peritoneal cavity of mice .............................................26

2.3 Static adhesion assays........................................................................................................27

2.4 Flow adhesion experiments ...............................................................................................29

2.5 RT-PCR experiments ...........................................................................................................30

2.6 ELISA experiments..............................................................................................................31

2.7 Figures ................................................................................................................................33

3 Results .......................................................................................................................................36

3.1 Macrophage adhesion to collagen and fibronectin ...........................................................37

3.2 Macrophage adhesion to collagen and fibronectin in the presence of an

integrin β1 blocking antibody .............................................................................................38

3.3 Macrophage adhesion under shear stress ........................................................................39

3.4 mRNA levels for cytokines and growth factors involved in atherosclerosis .....................40

3.5 Figures ................................................................................................................................42

4 Discussion .................................................................................................................................58

4.1 Discussion...........................................................................................................................59

4.2 Limitations and Future directions ......................................................................................64

5 References ................................................................................................................................66

vi

6 Appendices ...............................................................................................................................75

6.1 Flow cytometry to determine if differences exist in macrophage recruitment

to the peritoneal cavity: .....................................................................................................76

6.1.1 Rationale ................................................................................................................77

6.1.2 Materials and Methods ..........................................................................................77

6.1.3 Results ....................................................................................................................78

6.1.4 Discussion...............................................................................................................78

6.1.5 Figure: ....................................................................................................................79

6.2 Attempts to immunoblot for DDR1 ...................................................................................80

6.2.1 Rationale: ...............................................................................................................81

6.2.2 Materials and Methods:.........................................................................................81

6.2.3 Results and Discussion ...........................................................................................82

6.2.4 Figure: ....................................................................................................................83

vii

List of Tables and Figures

Figure 1.9.1: The development of atherosclerosis. .......................................................... 23

Figure 1.9.2: Structure of DDR1 ........................................................................................ 24

Figure 2.7.1: Image of microfluidic channel device used in flow adhesion experiments 34

Table 2.7.2: Primer sequences used in RT-PCR experiments ........................................... 35

Figure 3.5.1: Peritoneal macrophages did not adhere to type I collagen ........................ 43

Figure 3.5.2: Ddr1-/-

macrophages adhered significantly less to type IV collagen ........... 44


macrophages adhered significantly less to fibronectin ................... 45


macrophages adhered significantly less to type IV collagen in the

presence of a β1-integrin blocking antibody ..................................................................... 46

Figure 3.5.5: There was no difference in adhesion seen on type IV collagen when using

MHC class II or IgM control antibodies. ............................................................................ 47


macrophages adhered significantly less to fibronectin in the

presence of a β1-integrin blocking antibody ..................................................................... 48

Figure 3.5.7: There was no difference in adhesion seen on fibronectin when using MHC

class II or IgM control antibodies ...................................................................................... 49

Figure 3.5.8: Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages after shear

stress ................................................................................................................................. 50


macrophages produced increased levels of mRNA for MCSF, TNF-α,

TGF-β and PDGF immediately following isolation from the peritoneal cavity ................. 51

viii


macrophages produced increased levels of mRNA for MCP1, MCSF,

PDGF and decreased TGF-β after 3 days in culture with type I collagen ......................... 52


macrophages produced increased levels of mRNA for inflammatory

cytokines after 7 days in culture with type I collagen ...................................................... 53


macrophages produced decreased amounts of MCP-1, MCSF and

PDGF when cultured for 3 days on type IV collagen ........................................................ 54


macrophages produced increased amounts of TGF-β and PDGF

when cultured for 3 days on fibronectin .......................................................................... 55


macrophages produce decreased levels of MCP-1 on type I and

type IV collagen and fibronectin ....................................................................................... 56


macrophages produce decreased levels of TGF-β on collagen and

increased TGF-β on fibronectin. ....................................................................................... 57

Figure 6.1.5.1: There is no difference in macrophage recruitment to the peritoneal cavity

1 day after thioglycollate injection ................................................................................... 79

Figure 6.2.4.1 The C-20 Santa Cruz DDR1 antibody is not specific for DDR1 .................. 83

ix

List of abbreviations and acronyms

APOE apolipoprotein E

ARP1 acidic ribosomal protein 1

BrdU bromodeoxyuridine

Cdc42 cell division cycle protein 42

DAPI 4',6-diamidino-2-phenylindole

DARPP-32 dopamine & cyclic AMP regulated phosphoprotein

DC dendritic cell

DDR discoidin domain receptor

ECM extracellular matrix

EC endothelial cells

EDTA ethylenediaminotetracetic acid

ELISA enzyme-linked immunosorbent assay

EMT epithelial to mesenchymal transition

ERK1/2 extracellular regulated kinase 1 and 2

FAK focal adhesion kinase

FBS fetal bovine serum

FITC fluorescein-5-isothiocyanate

GAG glycosaminoglycan

HRP horseradish peroxidase

ICAM-1 intercellular adhesion molecule 1

IL-6 interleukin-6

JNK c-jun N-terminal kinase

LDL low-density lipoprotein

LDLR low-density lipoprotein receptor

Ly6-C lymphocyte antigen complex 6 loci C

MAPK mitogen-activated protein kinase

MCSF macrophage colony stimulating factor

MCP-1 monocyte chemotactic protein 1

x

MMP matrix metalloprotease

NF-κB nuclear factor kappa B

oxLDL oxidized low-density lipoprotein

PBS phosphate-buffered saline

PCR polymerase chain reaction

PDGF platelet-derived growth factor

PDMS Polydimethylsiloxane

PECAM-1 platelet-endothelial cell adhesion molecule 1

PFA paraformaldehyde

PG proteoglycan

PI3K phosphitidylinositol 3 kinase

PS penicillin/streptomycin

Pyk2 proline-rich tyrosine kinase 2

RT-PCR real time – polymerase chain reaction

SDS sodium dodecyl sulfate

Shc-A Src homology 2 domain-containing protein A

SHP-2 Src homology 2 domain-containing tyrosine phosphatase

SMC smooth muscle cell

STAT signal transducer and activator of transcription

TGF-β transforming growth factor beta

TIMP tissue inhibitor of metalloprotease

TNF-α tumor necrosis factor alpha

VCAM-1 vascular cell adhesion molecule 1

VE-Cadherin vascular endothelial cell cadherin

VEGFR2 vascular endothelial cell growth factor receptor 2

Wnt wingless-related MMTV integration site

1

Chapter 1:

1 Literature Review

2

1.1 Introduction

The atherosclerotic plaque is a rich milieu of different cell types and extracellular

matrix (ECM) proteins that interact with each other to form a complex lesion. The ability

of cells to respond to changes in the extracellular environment, particularly to changes

in matrix composition, controls the development of the plaque. Cells are able to

respond to changes in their extracellular matrix environment though the action of

receptors like integrins and discoidin domain receptors. Over the course of this review,

the initiation and progression of atherosclerosis will be discussed, along with a review of

the major ECM proteins that are abundantly synthesized in the plaque. Next we will

review the two major classes of collagen receptors – Integrins and Discoidin Domain

Receptors (DDR’s), followed by a more in-depth look at what is known about Discoidin

Domain Receptor 1 (DDR1).

1.2 Atherosclerosis

1.2.1 Introduction

Atherosclerosis is an inflammatory disease of the vasculature. It usually affects

medium to large size arteries and can lead to several important human vascular

disorders, including coronary artery disease, cerebrovascular disease and diseases of the

peripheral arterial circulation (Ross, 1999). The underlying pathology of atherosclerosis,

described visually in figure 1.9.1, is the formation of a large neointimal lesion or plaque

that can eventually cause stenosis of the artery lumen, cause thrombosis, and impair

the ability of the vessel to respond to hemodynamic stresses. The mature plaque exists

in the arterial intima as a thickened protrusion of the intima into the lumen. Inside is a

core of lipid material known as the necrotic core, surrounded by lipid-laden

macrophages and smooth muscle cells (SMCs). The plaque itself is rich in oxidized lipid,

3

large amounts of cytokines and secreted growth factors and also contains abundant

amounts of extracellular matrix in the form of glycoproteins, fibronectin and collagens.

1.2.2 Initiation of atherosclerosis

The initiation of atherosclerosis usually begins in lesion-prone or ‘atheroprone’

areas of the vasculature like bifurcation sites, branch points and convex areas of

bending arteries where shear stresses are low or variable (Giddens et al., 1993). One

possible reason for this is the existence of a mechanosensory complex on endothelial

cells (ECs). On the luminal surface of blood vessels ECs form a trimolecular complex of

platelet-endothelial cell adhesion molecule 1 (PECAM1), vascular endothelial cell

cadherin (VE cadherin) and vascular endothelial cell growth factor receptor 2 (VEGFR2).

PECAM1 acts as the transmitter of mechanical force, VE cadherin serves as an adaptor

molecule, while VEGFR2, independent of its ligand, causes the activation of the

phosphotidylinositol 3 kinase (PI3K) pathway, causing integrin activation and

subsequent activation of nuclear factor kappa B (NF-κB) leading to inflammatory

pathway activation (Tzima et al., 2005).

In these atheroprone areas, the basement membrane of ECs is also modified –

under high flow; normal basement membrane is made up of a protein network

comprised mainly of type IV collagen and vascular laminins (laminin-8 and laminin-10),

connected by interactions with molecules like the heparin sulphate proteoglycan

perlecan (Costell, 1999). ECs under low or variable shear produce fibronectin and

fibrinogen in their basement membrane – integrin activation and binding to the

fibronectin further induces the activation of the NF-κB pathway in ECs (Orr et al., 2005),

downstream targets of which include multiple cytokines including monocyte

chemoattractant protein 1 ( MCP-1) and adhesion molecules like vascular cell adhesion

molecule 1 (VCAM1) and E-selectin (Collins et al., 1993) which together mediate

recruitment of leukocytes necessary for lesion formation. ‘Activated’ endothelium under

4

low shear also has increased cellular turnover and impaired alignment - this is thought

to be responsible for enhanced permeability (Hahn and Schwartz, 2008). This allows for

the infiltration of lipid in the form of low density lipoprotein (LDL) particles through the

endothelium into the subendothelial space (Iiyama et al., 1999), where it is sequestered

from plasma antioxidants and can undergo oxidative modifications. Thus, oxidized LDL

(ox-LDL) is formed in the subendothelial space. Oxidation also better enables the LDL to

remain associated with the artery wall through interacting with the ECM and in

particular the proteoglycans present in the intimal area (Hurt et al., 1990). These lipid

deposits form the initial lesions of atherosclerosis, called ‘fatty streaks’ because of their

gross morphological appearance.

The next stage in plaque development is the recruitment of circulating

monocytes into the fatty streak area – adhesion molecules like P-selectin and E-selectin

mediate initial ‘rolling’ of leukocytes along the endothelium by interacting with

glycosylated ligands on the monocyte surface (Berliner et al., 1990). Leukocyte rolling on

the endothelium allows for integrin activation, after which adhesion molecules like

intercellular adhesion molecule 1/2 and VCAM1 allow for the rapid arrest of rolling and

the diapedesis of monocytes / macrophages into the subendothelial space (Ley et al.,

2007). Activated ECs also secrete cytokines like MCP-1 which help to recruit

inflammatory cells to the fatty streak area (Gu et al., 1998). Once in the intimal area,

recruited monocytes can differentiate into macrophages through the action of

macrophage colony stimulating factor (MCSF) (Becker et al., 1987). In the initial stages

of atherosclerosis, the infiltration of macrophages plays a key role in plaque

development and it is known that the expression of cytokines plays a significant role –

lack of MCSF or MCP-1 in mouse models of atherosclerosis both resulted in significantly

attenuated plaque development, with reduced levels of macrophage accumulation to

the plaque area (Qiao et al., 1997; Gu et al., 1998).

More recently, reports have also implicated resident intimal dendritic cells (DCs),

present in atherosclerosis prone regions in the vasculature, as the initiators of

5

atherosclerosis. These cells can engulf lipid and contribute to the initial fatty streak,

characteristic as the initiating step in complex plaque development (Paulson et al.,

2010).

1.2.3 Progression

Activated macrophages now present in the intima can internalize and

accumulate ox-LDL via their scavenger receptors, forming large intracellular lipid filled

vesicles that cannot be broken down. The macrophages thus develop into characteristic

‘foam cells’ with accumulated lipid droplets (Gerrity, 1981). Foam cells can then secrete

large amounts of cytokines and growth factors which stimulate the migration of SMCs

from the medial layer of the artery into the intima, where they switch from a quiescent

phenotype characteristic in the uninjured vessel wall to a more synthetic phenotype

(Ross, 1993). Apart from the secreted factors, ox-LDL by itself is a known chemotactic

factor for SMCs (Autio et al., 1990) and also enhances proliferation (Augé et al.,

1995).These ‘synthetic’ SMCs secrete a matrix rich in elastin, various proteoglycans and

fibrillar collagens (particularly types I and III) which form a fibrous cap over the lesion

area and stabilize the plaque (Ross, 1999). Foam cells can also undergo apoptosis to

form extracellular deposits of lipid material, known as the lipid or necrotic core, which in

turn causes the recruitment of increasing numbers of inflammatory cells and SMCs in

what is a cyclical process (Seimon and Tabas, 2009).

The atherosclerotic lesion thus formed has a characteristic lipid / necrotic core

overlain by a fibrous cap of matrix proteins (mainly fibrillar collagens), with neo-intimal

SMC proliferation and continuing inflammatory cell recruitment that drives an increase

in lesion size. Thus macrophages play a vital role in the initiation and progression of

atherosclerosis.

6

1.3 Extracellular matrix in atherosclerosis

Apart from cellular recruitment to the developing plaque, a large part of lesion

volume is accounted for by the elaboration of extracellular matrix components in the

plaque, mainly through the action of synthetic SMCs. There is a continuing process of

matrix synthesis and degradation and the balance between these processes plays an

important role in influencing plaque development, particularly with regard to plaque

stability. Generally, the more organized the ECM in a plaque, particularly in the fibrous

cap, the more stable the lesion (Loree et al., 1992). There are two main classes of ECM

macromolecules that make up matrix – proteoglycans, which are polysaccharide chains

linked to protein, and fibrous proteins including the collagens, elastin, fibronectin and

laminin. Below is a short overview of the major ECM components found in the plaque.

1.3.1 Proteoglycans

Proteoglycans are made up of core proteins covalently linked to

glycoaminoglycans (GAGs) which are unbranched polysaccharide chains made up of a

repeating series of disaccharide units. Because of the sulphate or carboxyl groups on the

sugars, GAGs are highly negatively charged and highly hydrophillic, a property that

allows proteoglycans to occupy larger amounts of volume in the extracellular space

(Hardingham and Fosang, 1992). This highly negative charge also allows for the

association with and retention of ox-LDL in the plaque (Hurt et al., 1990). Proteoglycans

can also bind secreted signaling molecules like growth factors, proteases and protease

inhibitors and enhance or inhibit their activity (Evanko et al., 1998). Some proteoglycans

found in the plaque include chondroitin sulphates like verscian, dermatan sulphates like

decorin, and heparin sulphates like perlecan, which is an important component of the

vascular endothelial basement membrane (Evanko et al., 1998).

7

1.3.2 Fibronectin – an adhesive glycoprotein

Glycoproteins are made up of oligosaccharide chains (glycans) covalently

attached to a polypeptide side-chain. They can be important integral membrane

proteins. Glycoproteins can also be adhesive molecules – laminin, vitronectin and

fibronectin are all found in the atherosclerotic plaque.

Fibronectin is a large dimeric glycoprotein composed of two large subunits linked

at one end by disulphide bonding. There are several different forms of fibronectin, all

encoded by a single large gene containing 50 exons. Transcription produces a single

large molecule that can be alternatively spliced to produce different fibronectin

isoforms. The major repeating unit, called the type III fibronectin repeat, binds to

integrins. There is a specific tripeptide sequence – arginine- glycine- aspartic acid or RGD

which forms the central binding site. Excluding soluble plasma fibronectin, all other

forms assemble on the cell surface and are deposited in the ECM as fibronectin fibrils,

where fibronectin dimers are further cross linked by disulphide bonds to form the fibril

structure (Potts, 1994). Fibrils can only form on the surface of certain cells because of

the need of fibronectin binding integrins for assembly – tension exerted by the cell is

essential for fibril formation: stretching the fibrils allows for the exposure of cryptic

binding sites on these molecules that allow them to bind to each other (Hocking et al.,

1994).

In atherosclerosis, fibronectin is expressed at many stages in progression. Even

before initial stages, ‘activated’ endothelium modifies its basement membrane by

adding a fibronectin layer, which makes the endothelium more permissive to

atherosclerotic development (Orr et al., 2005). During the development of the plaque,

there is marked and sustained up regulation of fibronectin expression, often colocalized

with type III collagen (Shekhonin et al., 1987). Fibronectin is also known to promote the

synthetic phenotype of SMCs in the plaque, thus causing further matrix elaboration

(Hedin et al., 1989).

8

1.3.3 Collagens

Collagens are the major component of connective tissue and are the most

abundant protein found in mammals. They are mostly found in fibrous tissues like

tendons, ligaments and skin as well as being abundant in cartilage, cornea, bone and in

blood vessels. In the plaque, collagens are highly abundant and comprise up to 60% of

plaque area (Smith, 1965).

Collagen is a triple helical molecule made up of three alpha chains. Each chain is

about 1000 amino acids long and arranged as a left-handed helix, with 3 amino acids a

turn. Glycine is usually the third amino acid, and hence the sequence is often referred to

as Gly-X-Y where X is often proline and Y is hydroxyproline. Pro-alpha chains formed

within the cell associate to form a hydrogen-bonded triple helix called procollagen. After

secretion, through the action of proteolytic enzymes, procollagen is converted into

collagen molecules which self-assemble into fibrils. There are different types of

collagens. Types I, II, III, V and XI are the fibrillar collagens, so called because after being

secreted into the extracellular space, these helices assemble into collagen fibrils, which

can then aggregate into collagen fibers. Collagen types IX and XII are fibril-associated

collagens as they facilitate fibrillar collagen association and link to the other ECM

components. Type IV collagen is a network-forming collagen – it assembles into a mesh

that forms a major part of the basement membrane in the vasculature. It has a more

flexible structure than fibrillar collagen because the triple helix is interrupted, allowing

for multiple bends, allowing assembly into a flexible sheet-like network. (Gelse et al.,

2003)

During plaque development the expression of collagens is highly variable. In

early lesions (fatty streaks) there is very little collagen production while advanced

lesions are often called fibrous lesions because of the accumulation of large depositions

of collagens, particularly fibrillar collagens types I and III present in the fibrous cap, but

also of types IV and V (Shekhonin et al., 1987).

9

The presence of collagens in the native vessel wall can cause activation of

macrophages during the early stages of lesion development. Type I collagen stimulates

the differentiation of monocytes into macrophages, and also increases the ability of

macrophages to take up lipid, as well as increasing the lipid load the individual cell is

capable of carrying (Wesley et al., 1998). Adhesion to collagen can also increase

phagocytotic uptake of LDL, as well as the production of matrix degrading enzymes like

matrix metalloproteinases (MMPs), which allow the macrophages and SMCs that

produce them to remodel the matrix they are imbedded in (Wesley et al., 1998).

Collagen degradation, particularly type I and type III degradation is also important to

plaque stability- high risk or rupture-prone plaques are characterized by a large lipid /

necrotic core under a thin fibrous cap, usually with high macrophage content,

particularly in the shoulder region on the plaques (Loree et al., 1992). The proteolytic

activity of macrophages in the plaque, particularly by the action of MMPs acting on

collagens causes the weakening and degradation of the fibrous cap, making it more

prone to rupture and hence thrombotic events (Galis et al., 1994).

1.4 Collagen Receptors

Being one of the most common proteins in the body, cellular interactions with

collagens are fittingly extremely diverse, and as expected, there are a number of

collagen receptors that regulate cellular interaction with collagens. In this review, I will

discuss two important types of collagen receptors – the integrin family of receptors and

the discoidin domain family of collagen receptors.

10

1.4.1 Integrins

The main receptors on animal cells for binding ECM are integrins. Integrins are a

family of transmembrane glycoproteins. They are heterodimeric, made up of non-

covalently associated α and β subunits. These receptors are adhesive in nature –they

have a large extracellular domain with which they interact with matrix proteins and a

short intracellular domain via which they link the matrix to the cell cytoskeleton via

cytoskeletal proteins. Different combinations of α and β subunits make up integrins with

different matrix molecule specificity – there are 9 beta subunits and 24 types of alpha

subunits. However, integrin selectivity has considerable overlap – many ECM proteins

such as fibronectin and type I collagen can be bound by more than one type of integrin

receptor – conversely many integrins can bind to more than one matrix type. (Hynes,

1992)

The binding of integrins to ligand also depends on the availability of extracellular

divalent cations – there are divalent cation-binding domains in the extracellular regions

of the α and β subunits, affecting the affinity and specificity of ligand binding (Hynes,

1992). Some common integrin ligands and their receptors are α5β1 for fibronectin, α2β1

for type I collagen and α1β1 for type IV collagen.

Integrins bind their ligands with low affinity – adhesion strength is controlled by

clustering of integrins. Integrins are connected to actin filament bundles – after ligand

binding, the cytoplasmic domains of the receptor bind several intracellular proteins like

talin and filamin which can then bind directly to actin or other anchor proteins linking

the integrin receptor to the cytoskeleton (Danen and Sonnenberg, 2003). This linking

can lead to a clustering of integrins causing the formation of focal adhesions in the cell,

thus mediating cell-matrix adhesion. Integrins also activate a variety of downstream

signaling pathways – during clustering, a tyrosine kinase protein Focal Adhesion Kinase

(FAK) is recruited by the integrin receptor. The FAK molecules cross-phosphorylate each

other creating docking sites for Src, which continue to phosphorylate FAK and other

recruited signaling proteins (Danen and Sonnenberg, 2003)

11

1.4.2 Discoidin Domain receptors

Discoidin domain receptors (DDRs) are a class of collagen-binding receptor

tyrosine kinases that contain an extracellular domain homologous to the Discoidin 1

protein of the slime mould Dictyostelium discoideum (Vogel et al., 1997). In mammals

there are 2 known genes encoding DDRs – Ddr1 and Ddr2. Ddr2 encodes a single gene

product, while Ddr1 in humans can produce 5 different isoforms (Alves et al., 2001). The

general structure of the protein includes an N-terminal discoidin domain, a stalk region,

a transmembrane domain, a juxtamembrane domain and a C-terminal catalytic kinase

domain (Figure 1.9.2). DDR1 and DDR2 exhibit different specificity in their collagen

binding ability – DDR1 has been shown to bind to collagen types I – V and VIII, while

DDR2 can bind to collagen types I, II, III and X (Vogel et al., 1997; Hou et al., 2001;

Leitinger and Kwan, 2006). Collagen binding has been shown to trigger activation of the

kinase domain and further downstream signaling events (Vogel et al., 1997). The focus

of this thesis is the effect of the deletion of Ddr1 on macrophages and a more complete

review of Ddr1 is presented in the following section.

1.5 Discoidin Domain Receptor 1

1.5.1 Structure

The Ddr1 gene is located on human chromosome 6 and mouse chromosome 17

(Valent et al., 1996; Perez et al., 1994). There are 5 known isoforms of DDR1 produced

via alternative splicing, described in figure 1.9.2 – DDR1d and e are kinase dead due to

lack of the kinase domain in DDR1d and the lack of the ATP binding site in DDR1e (Alves

et al., 2001). DDR1 a is the shortest functional isoform at 876 amino acids – DDR1b and c

have a 37 amino acid insertion in the juxtamembrane region, while DDR1c at 919 amino

acids has an additional 6 amino acid insertion in the kinase domain (Alves et al., 2001).

Dimerization of the DDR1 receptor is known to be essential for collagen binding

12

(Leitinger, 2003) and distinct from other tyrosine kinase receptors, dimerization occurs

prior to localization of the protein to the cell surface (Noordeen et al., 2006)

Dimerization is facilitated by disulphide bridges in the stalk regions or a leucine zipper

motif in the transmembrane domain (Noordeen et al., 2006; Abdulhussein et al., 2008).

The stalk region is known to be essential for receptor activation and may depend on

glycosylation (Curat et al., 2001). The exact crystallized structure of DDR1 has not yet

been resolved - models predict an 8-stranded beta barrel stabilized by disulphide

bridging similar to the structure of DDR2 (Ichikawa et al., 2007). The exact collagen

binding sequence of DDR1 has also not been determined to date, though for the DDR2

receptor, collagen recognition was independent of the integrin collagen recognition

sequence (Konitsiotis et al., 2008).

1.5.2 Regulation and Signaling

Not much is known about the transcriptional control of DDR1 expression.

Previous work has shown that culture of cells in the presence of serum is sufficient to up

regulate the expression of DDR1 (Kamohara et al., 2001). Also, treatment with

inflammatory cytokines such as tumor necrosis factor α (TNFα), interleukin 1α and MCSF

all increased the level of DDR1 expression (Kamohara et al., 2001) . DDR1 expression has

also been linked to the DNA-binding protein p53, and a feed-forward mechanism

whereby DDR1 signaling through the mitogen-activated protein kinase (MAPK) pathway

causes an up regulation of p53 has been proposed (Ongusaha et al., 2003). DDR1 is

different from most receptor tyrosine kinases (RTKs) in terms of its unusual signaling

kinetics. While most RTKs are activated within seconds to minutes after ligand binding,

DDR1 activation peaked 90 – 120 minutes after DDR1 stimulation with collagen in 293T

fibroblast cells, and activation was maintained for up to 18 hours post-stimulation

(Vogel et al., 1997). Phosphorylation of DDR1 has also been shown to be anchorage

dependent, where cells grown in suspension are activated more rapidly than cells

adherent to collagen (L'hote et al., 2001). The authors of this work point to the action of

13

phosphatases on DDR1 in the adherent state as being responsible for the delay in

activation – robust DDR1 phosphorylation even in the absence of collagen was observed

in cells treated with a phosphatase inhibitor, suggesting a mechanism of regulation

whereby DDR1 is activated in the unstimulated condition, but signaling is kept in check

by the action of phosphatases until the binding to collagen inhibits phosphatase action

on DDR1.

Much of the work with DDR1 has focused on elucidating downstream signaling

pathways. One of the first proteins identified to be involved in DDR1 signalling was the

Src homology 2 domain-containing protein A (Shc-A) adaptor protein in 293T cells (Vogel

et al., 1997), which was later confirmed in a human monocytic leukemic cell line (THP-1

cells), where binding of the Shc-A protein was implicated in the downstream activation

of NF-κB and p38α signaling pathways (Matsuyama et al., 2003, 2004). A complicating

factor in these studies has been the apparent isoform-specific downstream signaling

involving DDR1: activation of the different isoforms produces different responses in

THP-1 cells (Kamohara et al., 2001). One possible reason for this is that the 37 amino

acid insertion in DDR1b contains a Shc-A binding domain. DDR1 activation in human

macrophages causes the up-regulation of interleukin 8, macrophage migration

inhibitory factor-1-alpha (MIF α) and MCP-1 in a p38, NF-κB-dependent manner. p38

activation is dependent on the recruitment of the Shc-A adaptor protein to DDR1 again

suggesting that DDR1a cannot mediate this effect (Matsuyama et al., 2004). In

mammary epithelial cells, signaling through Wnt activated DDR1 via G protein-coupled

receptors and DDR1 signaling promoted adhesion to collagen as well as a reduction in

migration through the action of PI3K (Jonsson and Andersson, 2001; Dejmek et al.,

2003). More recent work has pinpointed the tyrosine kinase Src as being an essential

regulator of DDR1-controlled smooth muscle cell migration (Lu et al. in press).

DDR1 has also been shown to modulate integrin signaling pathways in the cell,

both cooperatively and antagonistically. DDR1 inhibits phosphorylation of signal

transducers and activators of transcription (STAT 1/3) and hence cell migration, acting

14

antagonistically to the α2β1 receptor. When cells are plated on type I collagen, a docking

sequence on unactivated DDR1 allows SHP2 - the src homology 2 domain-containing

phosphotyrosine phosphatase - to be sequestered in the inactive state. Upon ligand

binding, DDR1 activation activates SHP2, allowing it to act on STAT 1/3 (which has been

activated by integrin signaling) and inactivate it (Wang et al., 2006). More recently, it

has been demonstrated that α2β1 integrin signaling and DDR1 signaling, acting through

separate pathways, both converge to up regulate the cell-cell adhesion molecule N

cadherin. FAK downstream of integrins and FAK-related protein tyrosine kinase (Pyk2)

downstream of DDR1 together signal through the c-jun N-terminal kinase (JNK) to

upregulate N-cadherin causing epithelial to meschenchymal transformation in

pancreatic epithelial tumor cells (Shintani et al., 2008). In kidney epithelial cells, when

cultured on type I collagen, DDR1 inhibited the small G protein cell division cycle protein

42 (Cdc42) and hence inhibited cell spreading, acting in opposition to the α2β1 receptor

which activates Cdc42 by the action of FAK (Yeh et al., 2009).

Some scaffolding and adaptor proteins involved in DDR1 signaling have also been

identified. Apart from Shc-A, mentioned above, DDR1 interacts with p130Cas (Shintani

et al., 2008), dopamine and cAMP-regulated neuronal phosphoprotein (DARPP-32)

(Hansen et al., 2006) and KIBRA (Hilton et al., 2008). While Shc-A and p130Cas associate

with DDR1 only upon collagen stimulation, DARPP-32 and KIBRA are found to be basally

associated with unactivated DDR1 and are released upon stimulation with collagen.

Activation of DDR1 releases the scaffold proteins, freeing them to participate in the

upregulation of MAPK activation with KIBRA (Hilton et al., 2008) or to inhibit cell

migration, as is the case with DARPP-32 (Hansen et al., 2006). These are all examples of

how unstimulated DDR1, through the sequestering of scaffolding proteins, can affect

other signaling pathways.

15

1.5.3 Functions

The DDR1 receptor has been shown to mediate cell adhesion – DDR1-deficient

smooth muscles and mesanglial cells adhered significantly less to type I collagen when

compared to wild type cells (Hou et al., 2001; Curat and Vogel, 2002). In the THP-1

monocytic leukemic cell line, overexpression of DDR1a or DDR1b enhanced adhesion to

collagen– blocking integrins in these cells did not affect the ability of DDR1 to promote

adherence to collagen, and adhesion was also shown to require active downstream

signaling (Kamohara et al., 2001). DDR1 in mammary epithelial cells, downstream of the

Wnt signaling pathway caused increased adhesion and decreased migration (Jonsson

and Andersson, 2001).

DDR1 has been shown to play an essential role in cell migration. Overexpression

of DDR1a in THP-1 cells resulted in the enhanced ability to invade 3-D collagen gels

(Kamohara et al., 2001). One of the phenotypes of Ddr1-/-

mice is aberrant mammary

gland development, where mammary epithelial cells fail to invade the fat pad (Vogel et

al., 2001). In kidney epithelial cells, DDR1 inhibits cell migration, acting antagonistically

to the migration signaling of the integrin receptors (Wang et al., 2006). DDR1 has

recently been shown to interact with the non-muscle myosin IIA heavy chain, and this

interaction is dependent on the kinase domain – DDR1 was important in inhibiting cell

spreading and promoting cell migration in fibroblasts (Huang et al., 2009).

DDR1 is also known to have effects on cell proliferation: DDR1-deficient

mammary epithelial cells (Vogel et al., 2001) and mesanglial cells (Curat and Vogel,

2002) exhibited increased proliferation compared to wild type controls and DDR1

overexpressing kidney epithelial cells had attenuated proliferation compared to wild

type cells (Wang et al., 2005) – these results point to a role for DDR1 in inhibiting

proliferation. DDR1 can also affect cell differentiation – in mouse myoblasts, DDR1

inhibition reduces cell differentiation (Curat and Vogel, 2002) and in mesenchymal stem

cells, DDR1 inhibition in a 3D collagen gel inhibited osteogenic differention (Lund et al.,

16

2009). DDR1 is also thought to be anti-apoptotic – Ongusaha et al. in 2003 showed that

DDR1 expression protected against p53 mediated apoptosis in osteosarcoma cells and

Wang et al. in 2005 demonstrated that kidney epithelial cells expressing a dominant

negative form of DDR1 experienced increased rates of apoptosis when plated on type I

collagen.

DDR1 is also thought to play an important role in inflammation: activation of

DDR1 in human macrophages causes the upregulation of interleukin 8, MIF α and MCP1

in a p38, NFkB-dependent manner (Matsuyama et al., 2004). NFkB is also known to be

an important transcription factor controlling the expression of many cytokines and

growth factors (Blackwell and Christman, 1997). Other work with DDR1 in renal disease

suggests that the absence of DDR1 reduced leukocyte recruitment as well as reduced

LPS-induced MCP-1 expression (Flamant et al., 2006), and work with DDR1 knockouts in

a model of lung fibrosis suggested that deletion of DDR1 reduced inflammatory cell

recruitment as well as decreased the expression of inflammatory cytokines like MCP-1

and IL-6 (Avivi-Green et al., 2006).

Relevant to atherosclerosis, the process of matrix remodelling is essential to the

process of invasion and cell migration. One important class of matrix-degrading enzymes

produced by cells are the MMPs – DDR1-deficient smooth muscle cells have been shown

to have reduced levels of MMP 2 and 9 (Hou et al., 2001; Bendeck et al., 2004), while

DDR1-deficient macrophages express reduced levels of MMPs 2, 9 and 14 (Franco et al.,

2008).

DDR1 also undergoes receptor shedding after collagen stimulation (Vogel, 2002).

Cleavage occurs in the extracellular region causing the formation of a shed ectodomain

and leaving part of the receptor in the cell surface – the exact function of these shed

domains has yet to be determined. The cleaved receptors on the cell surfaces were

shown to remain active up to 4 days following stimulation suggesting continual receptor

17

signaling (Vogel, 2002). Shedding is known to be Src-kinase dependent and possibly due

to the action of MMPs (Slack et al., 2006).

From this review it is apparent that the long term activation of DDR1 and the

extensive signaling pathways that it activates indicate an important and essential role

for the DDR1 receptor in the responses of cells to extracellular matrix cues under both

normal and diseased conditions.

1.5.4 Role in atherosclerosis

DDR1 has been identified on both macrophages (Kamohara et al., 2001) and

smooth muscle cells (Hou et al., 2001), both cells types are essential and major

components of the atherosclerotic plaque. DDR1 protein has also been found in the

plaques of non human primates (Ferri et al., 2004). Studies have shown that DDR1 is up

regulated during inflammation – DDR1 can regulate dendritic cell antigen presentation

(Matsuyama et al., 2003) as well as nitric oxide production (Kim et al., 2007) and MMP

expression (Franco et al., 2008). In macrophages, DDR1 has been implicated as being

important for adhesion to type I collagen, a matrix molecule highly up =regulated in the

plaque (Kamohara et al., 2001). DDR1-deficient smooth muscle cells have reduced

migration and proliferation rates – both important behaviours in the development of

atherosclerosis (Hou et al., 2001). Previous work in our lab with a Ddr1-/-

; Ldlr-/-

mouse

model demonstrated that DDR1-deficient animals have reduced plaque burden with

smaller overall lesion area (Franco et al., 2008). This points to a significant role for DDR1

in the development of atherosclerosis - more detailed results of the DDR1 systemic

knockout atherosclerosis studies are presented in section 1.7.

18

1.6 Major Mouse models of atherosclerosis

There are two main mouse models of atherosclerosis currently in widespread

use – the apolipoprotein E (Apo E)-deficient mouse model and the low density

lipoprotein receptor (LDLR) deficient mouse model. These mice develop lesions similar

to human plaques with similar areas of predisposition in the vasculature, thus providing

an efficient way of monitoring the development of atherosclerosis in a mammalian

model.

1.6.1 The Apolipoprotein E deficient mouse model

Apolipoprotein E is a class of apolipoprotein found in chylomicrons, very low

density lipoproteins and intermediate density lipoproteins. ApoE can bind to specific

receptors on liver and peripheral cells including the low density lipoprotein receptor

(LDLR) which helps clear ApoE lipoproteins from the circulation (Brown and Goldstein,

1986). Developed by (Zhang et al., 1992), ApoE-deficient mice are spontaneously

hypercholesterolemic, leading to the formation of atherosclerosis. However, since

hypercholesterolemia is spontaneous, there is no control over the initiation of plaque

development

1.6.2 The Low Density Lipoprotein Receptor deficient mouse model

The LDLR is a receptor for ApoE-expressing lipoproteins and ApoB100-expressing

lipoproteins, which aids in the clearance of these lipoproteins from the circulation. The

LDLR mouse model was developed by Ishibashi et al (1993). LDLR -/-

mice on a regular

chow diet developed only a 2-fold increase in plasma cholesterol levels and did not

develop lesions, while APOE-/-

mice develop hypercholesterolemia and lesions on a

regular chow diet. This makes it possible to pinpoint the start of lesion development in

19

the LDLR knockouts, but not in APOE-deficient mice. Using this mouse model thus allows

for the control of the onset of plaque formation as well as the ability to analyze the early

development of atherosclerosis.

1.7 Rationale

Our lab has characterized the development of atherosclerotic lesions in a DDR1-

deficient animal model using the Ldlr-/-

mouse model of atherosclerosis – where, as

previously discussed in section 1.1.5.2, the absence of the LDL receptor allows for an

animal model in which atherosclerosis is inducible by feeding a high fat diet. By crossing

Ddr1-/-

mice with an Ldlr-/-

strain, the lab has established lines of mice that are either

Ddr1+/+

; Ldlr-/-

or Ddr1-/-

; Ldlr-/-

on a mixed C57Bl6 / SV129 background.

When these mice were fed a high fat diet, Ddr1-/-

; Ldlr-/-

mice developed smaller

plaques, with a reduced proportion of macrophages but the same proportion of smooth

muscle cells and increased matrix deposition when compared to Ddr1+/+

; Ldlr-/-

mice

(Franco et al., 2008). With this observation as the stimulus, bone marrow transplant

experiments were carried out in order to understand the contribution of DDR1

expressed on bone marrow derived cells to the development of atherosclerosis. Ddr1-/-

;

Ldlr-/-

bone marrow was transplanted into Ddr1+/+

; Ldlr-/-

mice (Ddr1-/-

→+/+

: bone

marrow deletion group). These mice now had the Ddr1 deletion only in bone marrow-

derived cells, including macrophages, whereas the vessel wall cells, including smooth

muscle cells remained Ddr1+/+

. Compared with control transplants of Ddr1+/+

; Ldlr-/-

marrow into Ddr1+/+

; Ldlr-/-

animals (Ddr1+/+

→+/+

: control group), the Ddr1-/-

→+/+

transplant animals had significantly smaller lesions with fewer macrophages and no

change in matrix accumulation (Franco et al., 2009). The reciprocal experiment was also

performed where Ddr1+/+

; Ldlr-/-

bone marrow was transplanted into Ddr1-/-

; Ldlr-/-

mice

(Ddr1+/+

→-/-

: vessel wall deletion group).These mice now had the Ddr1 deletion in vessel

wall cells, while macrophages remained Ddr1 replete. Compared with control

20

transplants of Ddr1+/+

; Ldlr-/-

marrow into Ddr1+/+

; Ldlr-/-

animals (Ddr1+/+

→+/+

: control

group), the Ddr1+/+

→-/-

transplant animals had significantly larger plaques with

pronounced increases in matrix accumulation. A model was proposed where deletion of

DDR1 on macrophages caused decreased infiltration into the plaque and deletion of

DDR1 on smooth muscle cells promoted migration and synthesis of matrix by SMCs.

Our lab has also measured the early recruitment of monocytes to the plaque in

Ldlr-/-

mice. Bromodeoxyuridine (BrdU) is a synthetic thymine analog and is used to

detect proliferating cells in tissue – BrdU is incorporated into DNA during replication,

and can be detected using immunostaining. A single pulse injection of BrdU into Ddr1+/+

;

Ldlr-/-

and Ddr1-/-

; Ldlr-/-

mice that had been fat fed for two weeks was used to label

proliferating cells. Mice were sacrificed at 2 hours after injection to measure baseline

proliferation rate in the plaque, or at 24 hours to measure the number of bone marrow-

derived cells recruited into the plaque. Ddr1-/-

; Ldlr-/-

mice had significantly fewer BrdU-

positive cells accumulated in the plaque 24 hours after labeling (Franco et al., 2009).

Taken together, this data suggests that macrophage behavior in atherosclerosis

was altered in the absence of DDR1 receptor, resulting in the reduced accumulation of

macrophages in the atherosclerotic plaque. In our investigation, we focus on two

macrophage behaviors particularly important in the development of atherosclerosis –

macrophage adhesion to matrix and macrophage cytokine production. Any perturbation

in either of these might be expected to significantly affect plaque development.

1.8 Hypotheses:

1. DDR1 mediates macrophage adhesion to matrix

In order to test this hypothesis, the adhesion of macrophages from Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

mice to type I collagen, type IV collagen and fibronectin were

tested to determine whether Ddr1-/-

; Ldlr-/-

macrophages were deficient in

21

adhesion to important matrix components found within the atherosclerotic

plaque.

2. DDR1 affects the ability of macrophages to produce cytokines and growth factors.

In order to test this hypothesis, macrophages from Ddr1+/+

; Ldlr-/-

and Ddr1-/-

;

Ldlr-/-

mice were stimulated with type I collagen, type IV collagen and fibronectin

and then assayed for differences in the production of cytokines known to be

involved in atherosclerosis.

22

1.9 Figures

23

Figure 1.9.1: The development of atherosclerosis.

A) Migrating smooth muscle cells from the medial layer. B) Foam cells. C) Necrotic core

D) Fibrous cap development E) Adhesion and migration of leukocytes into plaque area.

(Adapted from Ross,R. NEJM 1999)

24

Figure 1.9.2: Structure of DDR1

a) General structure of DDR1. b) isoforms of DDR1: DDR1b and DDR1c have an

additional 37 aa insertion in the juxtamembrane domain, DDR1c has a 6 aa insertion in

the tyrosine kinase domain. DDR1d lacks the kinase domain and DDR1e is kinase dead

due to the lack of an ATP-binding domain

a)

b)

25

Chapter 2:

2 Materials and methods

26

2.1 Generation of mice

Male DDR1-/-

mice on a C57Bl6 background (backcrossed at least 5 times, a

donation from Dr. Wolfgang Vogel) were crossed with female Ldlr-/-

mice that were also

on a C57Bl6 background (backcrossed greater than 10 times) to generate mice that

were Ddr1+/-

;Ldlr +/-

, with a combined genetic background that was >97% C57Bl6. These

heterozygous mice were then mated to produce mice that were Ddr1-/-

; Ldlr-/-

and

control mice that were Ddr1+/+

; Ldlr-/-

.

2.2 To obtain macrophages from the peritoneal cavity of mice

One ml of sterile 4% thioglycollate solution (Becton, Dickinson and Company:

Brewers modified thioglycollate) was injected into the peritoneal cavity of Ddr1+/+

; Ldlr-/-

or Ddr1-/-

; Ldlr-/-

mice. The 4% thioglycollate solution was aged for at least 3 months at

room temperature and protected from light, prior to the start of experiments. The

thioglycollate acts as a sterile irritant and elicits an immune response that recruits

macrophages from the circulation into the peritoneal cavity. Three - four days after

thioglycollate injection, mice were sacrificed by CO2 inhalation and the peritoneal cavity

was exposed by removing the abdominal skin. Using a 10 ml syringe with a 25 gauge

needle the peritoneal cavity was flushed forcefully with ice cold RPMI-1640, a type of

media used for the culture of lymphocytes. The force of the fluid helped detach cells

that were bound to the peritoneal wall and organs. Using the same syringe with a 23

gauge needle, as much fluid as possible was aspirated out. The fluid was centrifuged at

1500 rpm for 5 minutes and if the presence of red blood cells was detected, as

evidenced by a red streak or clump in the cell pellet, the cells were re-suspended in 5 ml

cold red blood cell lysis buffer for 5 minutes. Cells were then centrifuged again and

washed with 5 ml Hanks Balanced Salt Solution, following which they were re-

suspended in RPMI + 10% Fetal Bovine Serum (FBS) + 2% Penicillin-streptomycin (RPMI-

10%FBS-2%PS). Total cell number isolated was quantified using a haemocytometer after

27

staining a small aliquot of cell solution with a 1:1 volume of Trypan blue, following which

cells were immediately used for experiments, or plated on 10 cm tissue culture dishes at

a density of 6x106 cells per plate.

To determine the percentage of cells in the peritoneal lavage that were

macrophages, immunostaining for the Mac-2 macrophage antigen was carried out.

Peritoneal lavage cells were allowed to adhere to glass cover slips for 2 hours, following

which cover slips were washed in PBS and fixed for 10 minutes in 4 % PFA at room

temperature. After washing, cells were permeabilized with 0.1 % Triton-X in PBS and

then blocked for 30 minutes in 2% milk in PBS with normal goat serum (1:100. Vector,

Q1018). Cover slips were then incubated for 1 hour at room temperature with either

1:100 rat anti-mouse mac-2 (Cedar Lane Labs, CL8942AP) or normal rat IgG (1:1100.

Jackson Labs, 012-000-003) diluted in blocking solution. After this, cover slips were

incubated in Cy3 donkey anti-rat IgG (1:500 Jackson Labs, 712-165-153) in PBS with

1:1000 Hoechst 33258 at room temperature in the dark. After washing in PBS, cover

slips were air dried and mounted onto slides with Prolong Gold Antifade (Invitrogen, P-

7481). Cells were found to be greater than 95 % macrophages.

2.3 Static adhesion assays

For all experiments, substrate protein solution was prepared at the required

concentrations by dilution of stock solutions of type I collagen (PurCol bovine type I

collagen– 3 mg/ml), type IV collagen (Sigma – 1 mg/ml) and fibronectin (Sigma – 1

mg/ml) in sterile Phosphate buffered saline (PBS). Type I collagen was plated at 100 nM,

200 nM, 300 nM, 400 nM, 600 nM, 800 nM and 1000 nM, type IV collagen was plated at

100 nM, 200 nM, 300 nM, 400 Nm and 600 nM, and fibronectin was plated at 5nM, 10

nM, 15 Nm, 20 nM and 25 nM. 50 µl of each solution was added to wells in a 96 well

plate. Plates were incubated at 37° C, 5 % CO2 for 1 hour to coat wells and then used

immediately or left overnight at 4°C. The protein solution was then suctioned out and

28

wells were washed with 100 µl PBS solution per well. Harvested peritoneal macrophages

were counted using a haemocytometer, centrifuged at 1500 rpm fpr 5 minutes and the

cell pellet was resuspended in an appropriate volume of RPMI-10%FBS-2%PS, such that

100 µl of media contained 100,000 cells. 100 µl of RPMI-10%FBS-2%PS was added to

each well, after which 100 µl of cell suspension was added, such that 100,000 cells were

plated per well. Cells were incubated for 2 hours at 37° C, 5 % CO2. For experiments

where β1 integrin was blocked, cells were incubated in the 96 well plates with an anti

CD29 antibody (Becton, Dickinson and Company, 555002) as well as with a no antibody

control, a IgM antibody control (Biolegend, 401002) and an anti major

histocompatability complex type II antibody control (Ebiosciences, 14-5980), all at

concentrations of 20 µg/ml for 30 minutes. The time allowed for adhesion was shorter

in these experiments in order to measure adhesion at an earlier time point. After this,

wells were flooded with PBS to remove non-adherent cells. The PBS wash was repeated

and cells were then fixed by adding 100 µl of 4% paraformaldehyde (PFA) for 5 minutes.

PFA was aspirated out and 50 µl of 0.5% toluidine blue in PFA was added and left for 5

minutes to stain adherent cells. The plate was then washed twice with dH20 to remove

excess stain, and 100 µl of 1% SDS was added to lyse the cells, thus releasing the

toluidine blue. The plate was then read on a Molecular Devices Vmax kinetic microplate

reader for absorbance reading at 595 nm, where the absorbance was proportional to

the number of adherent cells. The experiments were performed in triplicate and

repeated three times. Comparisons were performed by Student’s t-test or one way

ANOVA using SigmaPlot 11.0. For t-test, data that did not fit a normal distribution were

analyzed by the non-parametric Mann-Whitney U test. For ANOVA, comparisons made

were between genotype or between antibody treatment, with group means compared

using the Holm-Sidak method.

29

2.4 Flow adhesion experiments

Microfluidic shear devices constructed from Polydimethylsiloxane (PDMS) and

glass were obtained from the lab of Dr. Craig Simmons – glass permitted attachment of

cells and protein, as well as ease of imaging, while the PDMS allowed for gas exchange

while the cells were being cultured. Devices were made using a modified protocol from

(Young et al., 2007) – channels were 500 µm wide x 100 µm high x 50,000 µm long. An

image of the device is pictured in Figure 2.7.1

Fluid was injected into the channels via inlet ports, using a 1 ml plastic syringe

with a 20 gauge needle. Channels were rinsed twice with 70% ethanol for 5 minutes

each time, then washed twice with PBS without calcium or magnesium for 5 minutes

each wash. 200 µl of Matrix protein solution was then loaded into the channels at the

desired concentration – 15 nM fibronectin, 500 nM type I collagen and 500 nM type IV

collagen and the matrix was allowed to coat channels for 30 minutes at room

temperature. The channels were then flushed clear using RPMI. 10 million peritoneal

lavage cells were incubated in a test tube with Hoechst dye (1:5000) in 10 ml of RPMI

for 30 minutes, after which cells were checked for fluorescence by imaging a small

aliquot of cells in a 96 well plate under a fluorescent microscope. Stained cells were

then washed with PBS and allowed to recover in RPMI-10%FBS-2%PS for 30 minutes at

37°C, following which they were resuspended in RPMI-10%FBS-2%PS at a seeding

density of 10 million cells /ml and then injected into the channels using a 1 ml plastic

syringe with a 20 gauge needle (about 200 µl cell solution /channel). Cells were then

allowed to adhere in the channels for 2 hours at 37°C. Following this, the channels were

connected to a syringe pump (Cole-Parmer® ten-syringe infusion/withdrawal pump EW-

74900-45) loaded with six 10 ml syringes filled with RPMI-10%FBS-2%PS and cells were

subjected to an initial shear of 1 dyne / cm2 for 3 minutes to remove non-adherent cells

and debris. Channels were then imaged at 3 different finite points along the length using

an Olympus IX71, under DAPI at 10x; image positions were selected based on etchings in

the glass made during the manufacturing of the devices, and cells were subjected to

30

increasing shear forces of 5, 10 and 100 dynes / cm2 for 3 minutes each time, with

channels being imaged at each interval after shear at the same 3 initial locations. The

total number of cells remaining in all three view fields after each shear ramp was

counted. The experiment was performed three times.

2.5 RT-PCR experiments

Harvested peritoneal lavage cells were either used immediately after isolation or

plated on 10 cm dishes that were uncoated or coated with 15 nM fibronectin or on 6 cm

dishes coated with 100 nM type IV collagen, at a seeding density of 4 million cells per 10

cm dish and 2 million cells per 6 cm dish. Cells were incubated for 2 hrs at 37° C, 5% CO2,

following which non-adherent cells were aspirated off, leaving macrophages adherent

on the plate. Adherent macrophages on uncoated plates were then stimulated with 50

ng/ml of soluble type I collagen. Cells were cultured for 3 days in 10 ml of RPMI-10%FBS-

2%PS 2 hrs at 37° C, 5% CO2. In addition, plates treated with soluble type I collagen were

cultured for 7 days.

At the appropriate time point (immediately after isolation, 3 days after isolation

or 7 days after isolation) RNA was harvested from cells using the Ambion RNeasy Midi

Kit and RNA quantity and quality were assessed using a spectrophotometer to read the

A260/A280 absorbance ratio. 1 μg of RNA was then treated with DNase 1 (Fermentas)

and used in a reverse transcription reaction (Invirtogen SuperScript II First-Strand

Synthesis System for RT-PCR) to obtain cDNA. cDNA obtained was diluted 1:2 in

DNase/RNase free water and subjected to real time quantitative PCR on an ABI Prism

7900HT sequence detection system (Applied Biosystems) and using primers listed in

Table 2.7.2. The final volume of each PCR reaction was 10 μl and contained the

indicated concentration of forward and reverse primer (Table 2.5.2) and 1X SYBR green

master mix reagent (Clontech).

The PCR reaction steps were: step 1: 10 minutes at 95 °C, step 2: cycle 40 times

at 95 °C for 15 seconds, then 60 °C for 1 minute. Following PCR, amplified DNA was

31

denatured and data collected determined the melting temperature of the amplicon,

allowing verification that a single product was formed. Acidic ribosomal protein (ARP)

mRNA was used as an endogenous control. Cycle threshold number, Ct, for the real-time

quantification was defined to be in the exponential phase of the PCR amplification and

was determined using SDS 2.1 software (Applied Biosystems). Relative gene copy

number was assessed using the ΔΔCt method, where the relative expression of the gene

of interest in a sample is expressed as a fold change over the control sample.

The data for each gene analyzed was normalized to the control gene ARP and

changes in Ddr1-/-

; Ldlr-/-

macrophage gene expression are expressed as fold change

relative to Ddr1+/+

; Ldlr-/-

and cells. Experiments were done in triplicate and repeated 3

times. Comparisons between genotypes were performed by Student’s t-test using

SigmaPlot 11.

2.6 ELISA experiments

Harvested peritoneal lavage cells were plated on 10 cm dishes that were

uncoated or coated with 15 nM fibronectin or on 6 cm dishes coated with 100 nM type

IV collagen, at a seeding density of 4 million cells per 10 cm dish and 2 million cells per 6

cm dish. The cells were incubated for 2 hrs at 37°C with 5% CO2, following which non-

adherent cells were aspirated off, leaving macrophages adherent on the plate. Adherent

macrophages on uncoated plates were stimulated with 50 ng/ml of soluble type I

collagen. Cells were cultured for 3 days in 10 ml of RPMI-10%FBS-2%PS. At 3 days, 2 ml

of conditioned media was aspirated off the cells and stored at -80 °C till used in

experiments.

MCP-1 and TGF-β Enzyme-linked immunosorbent assay (ELISA) kits were

obtained from EBiosciences (88-7391 and 88-7344), and assays were done according to

manufacturer’s instructions. 96 well plates were coated with capture antibody (1:2500)

diluted in coating buffer overnight at 4 °C. Plates were then washed with wash buffer (1

32

x PBS, 0.05% Tween-20) and blocked for one hour in blocking solution (Assay Dilutent

solution), after which standards and samples were added to the plate (100 µl /well). For

the TGF-β ELISA, media samples were acid-activated with 20 µl of 1N HCl, incubated for

10 minutes and then neutralized with 20 µl of 1N NaOH. This was done to inactivate

latent TGF-β present in the media. Plates were incubated for 16 hours at 4 °C then

washed with wash buffer. 100 µl /well of detection antibody (1:1000) was added and

incubated for 1 hour at room temperature. After washing with wash buffer, 100 µl /well

of Avidin-HRP was added and left at room temperature for 30 minutes. After another

wash cycle, 100 µl /well of substrate solution was added and incubated at room

temperature for 15 minutes. Finally, 50 µl / well of stop solution (2 M H2SO4) was added

and plates were read on a Molecular Devices Vmax kinetic microplate reader for

absorbance reading at 450 nm. Experiments were done in duplicate and repeated 3

times. Comparisons between genotypes were performed by Student’s t-test using

SigmaStat 11. Data that did not fit a normal distribution were analyzed by the non-

parametric Mann-Whitney U test.

33

2.7 Figures

34

Figure 2.7.1: Image of microfluidic channel device used in flow adhesion experiments

A) Inlet / outlet to channel: Openings for introduction of flow through the chambers.

Matrix and cell solutions are introduced into the channels through these inlets. After

adhesion, syringe pumps are attached to one side of the channel and liquid is injected

through at calculated shear forces. B) Channels are 500 µm wide x 100 µm high x 50,000

µm long

B) Channel

A) Inlet /

Outlet

35

gene Forward Sequence Reverse Sequence Source

DDR1 CTGCTCTTTACTGAAGGCTC TCCATAGACCAGAGGGATC (Franco, 2009)

ARP AGACCTCCTTCTTCCAGGCTTT CCCACCTTGTCTCCAGTCTTTATC (Franco, 2009)

MCP-1 CAGCCAGATGCAGTTAACGC GCCTACTCATTGGGATCATCTTG (Franco, 2009)

MCSF CACATGATTGGGAATGGACA CAGCTGTTCAGGTTATTGGA (Ezure et al., 1997)

PDGF CTGTATGAAATGCTGAGCGACCA GCATTGCACATTGCGGTTATTGC (Akai et al., 1994)

TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC (Overbergh et al., 1999)

TGF-β TGACGTCACTGGAGTTGTACGG GGTTCATGTCATGGATGGTGC (Overbergh et al., 1999)

Table 2.7.2: Primer sequences used in RT-PCR experiments

36

Chapter 3

3 Results

37

3.1 Macrophage adhesion to collagen and fibronectin

The first step to asses for DDR1 dependent differences in adhesion was to determine

the optimal conditions to assay. Initial static adhesion assays were carried out to

determine optimal cell number per well. Analysis showed a very good correlation

between increasing cell number plated and corresponding change in the optical density

reading (R2 = 0.99), and the optimal cell density for assay was chosen to be 100,000 cells

/ well. Further experiments were conducted to test for optimal matrix concentration to

be used for experiments to measure adhesion. Ranges chosen were between 100 –

1000 nM for type I collagen, between 100 and 600 nM for type IV collagen and between

5 and 25 nM for fibronectin.

Type I collagen: Peritoneal macrophages did not adhere to type I collagen, but adhered

well to tissue culture plastic. Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages showed no

significant differences in adhesion to type I collagen. Ddr1-/-

; Ldlr-/-

macrophages showed

significantly reduced adhesion to tissue culture plastic compared to Ddr1+/+

; Ldlr-/-

macrophages (Figure 3.5.1).

Type IV collagen: Peritoneal macrophages adhered well to type IV collagen and Ddr1-/-

;

Ldlr-/-

macrophages adhered significantly less (on average about 50 % less) to type IV

collagen than Ddr1+/+

; Ldlr-/-

macrophages (Figure 3.5.2).

Fibronectin: Fibronectin is not a known ligand for the DDR1 receptor. As such, it was

included as a positive control – both the Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages

were expected to bind equally well to fibronectin. Macrophages isolated from the

peritoneum adhered to fibronectin, however Ddr1-/-

; Ldlr-/-

macrophages adhered

significantly less (on average 43 % less) to fibronectin than Ddr1+/+

; Ldlr-/-

macrophages

(Figure 3.5.3).

38

3.2 Macrophage adhesion to collagen and fibronectin in the

presence of an integrin β1 blocking antibody

In order to determine what part of the decrease in adhesion seen in the DDR1-deficient

cells was attributable solely to the action of DDR1, rather than to DDR1 acting through

cross talk with integrin receptors, a blocking antibody experiment was designed. β1

integrins were blocked by treating with an anti-CD29 antibody that has previously been

shown to block β1 integrin-mediated adhesion of cells (Hou et al., 2000) by binding to

and blocking the β1 integrin subunit of integrin receptors. Differences in adhesion

observed after this could not be due to differences in expression or affinity of the β1

integrin receptors in the absence of DDR1. We chose to block the β1 integrin because

the major integrin receptors for the 2 matrix proteins being tested (the α5β1 receptor for

fibronectin and the α1β1 receptor for type IV collagen) all contain the β1 integrin subunit.

Type IV collagen: Ddr1-/-

; Ldlr-/-

macrophages adhered significantly less to wells coated

with type IV collagen at concentrations of 100 and 400 nM compared to Ddr1+/+

; Ldlr-/-

macrophages. Blocking the β1 integrin receptor did not eliminate these differences in

adhesion. Ddr1+/+

; Ldlr-/-

macrophages still adhered to type IV collagen when the β1

integrin receptor was blocked. Adding the β1 integrin receptor-blocking antibody to

Ddr1+/+

; Ldlr-/-

macrophages resulted in an average 23% decrease in adhesion of these

cells to type IV collagen ( 100 nM and 400 nM). However adding the blocking antibody

to Ddr1-/-

; Ldlr-/-

macrophages resulted in an average 74 % decrease in the adhesion of

these cells to type IV collagen (Figure 3.5.4).

Treatment with antibodies against MHC II, or IgM did not affect the adhesion of the

macrophages suggesting that the anti CD 29 antibody was specifically affecting the

β1integrin receptor (Figure 3.5.5). MHC II was used as a control to determine the effect

of targeting a non adhesive cell surface receptor on macrophages, and the IgM was

included as an isotype control.

39

Fibronectin: Ddr1-/-

; Ldlr-/-

macrophages adhered significantly less to wells coated with 5,

15 or 25 nM fibronectin compared to Ddr1+/+

; Ldlr-/-

macrophages. Blocking the β1

integrin receptor did not eliminate these differences in adhesion. Ddr1+/+

; Ldlr-/-

macrophages still adhered to fibronectin when the β1 integrin receptor was blocked.

Adding the β1 integrin receptor blocking antibody to Ddr1+/+

; Ldlr-/-

macrophages

resulted in an average 27% decrease in adhesion of these cells to fibronectin (5, 15 and

25 nM). However adding the blocking antibody to Ddr1-/-

; Ldlr-/-

macrophages resulted

in an average 46% decrease in the adhesion of these cells to fibronectin (Figure 3.5.6).

Treatment with antibodies against MHC II, or IgM did not affect the adhesion of the

macrophages suggesting that the anti CD 29 antibody was specifically affecting the

β1integrin receptor (Figure 3.5.7). MHC II was used as a control to determine the effect

of targeting a non adhesive cell surface receptor on macrophages, and the IgM was

included as an isotype control.

3.3 Macrophage adhesion under shear stress

These experiments were carried out to model the in vivo condition, where shear forces

exerted by the flowing blood may affect macrophage adhesion and also in order to

gauge strength of adhesion of these cells to matrix – subjecting cells to step increases in

shear and counting the cells remaining indicates the strength of matrix binding.

A representative data set from one experiment is shown in Figure 3.5.8. There was a

consistent trend towards decreased adhesion of Ddr1-/-

; Ldlr-/-

cells compared to Ddr1+/+

;

Ldlr-/-

cells on both type IV collagen and fibronectin. Also, macrophages did not adhere

well to type I collagen. Examination of the number of adherent cells remaining after

each step increase in shear force suggests that the cells that do adhere are well

adherent, even in the absence of the DDR1 receptor. Not many cells were lost while

increasing shear to 5 and 10 dynes/cm2, and even at the very high shear of 100 dynes

40

/cm2

a significant number of the cells remained adherent, suggesting strong adhesion.

There was extremely high variability between repeats of the experiments due to

technical issues.

3.4 mRNA levels for cytokines and growth factors involved in

atherosclerosis

The production of cytokines and growth factors by macrophages are essential to the

development of the plaque. The levels of mRNA for 5 different factors were measured in

Ddr1-/-

; Ldlr-/-

and Ddr1+/+

; Ldlr-/-

macrophages. MCP-1, MCSF, tumor necrosis factor α

(TNF-α), transforming growth factor β (TGF- β) and platelet derived growth factor

(PDGF) mRNAs were measured immediately after cell isolation, and after 3 and 7 days in

culture with soluble type I collagen. mRNA levels were also measured after plating cells

for 3 days on 15 nM fibronectin or 100 nM type IV collagen.

mRNA levels measured in macrophages immediately after isolation from the peritoneal

cavity are shown in Figure 3.5.9. We observed significant increases in MCSF, TNF-α, TGF-

β and PDGF mRNA expression in Ddr1-/-

; Ldlr-/-

macrophages compared to Ddr1+/+

; Ldlr-/-

cells. Expression of MCP-1 was not different between the two genotypes. mRNA levels

measured in macrophages after being cultured with soluble type I collagen in vitro for 3

days are shown in Figure 3.5.10. There was a significant increase in the production of

MCP-1, MCSF and PDGF by Ddr1-/-

; Ldlr-/-

macrophages and a slight decrease in TGF- β

mRNA compared to Ddr1+/+

; Ldlr-/-

cells. mRNA levels measured after culture with

soluble type I collagen in vitro for 7 days are shown in Figure 3.5.11.The increases in

MCP-1, MCSF and PDGF persisted at 7 days, however, there was no difference in TGF- β

mRNA at this time. Expression of TNF-α was not different between Ddr1-/-

; Ldlr-/-

and

Ddr1+/+

; Ldlr-/-

macrophages at either time point.

mRNA levels measured in macrophages after being cultured on 100 nM type IV collagen

for 3 days are shown in Figure 3.5.12. There was a significant decrease in the expression

41

of MCP-1, MCSF and PDGF mRNA by Ddr1-/-

; Ldlr-/-

macrophages compared to Ddr1+/+

;

Ldlr-/-

cells. When cultured on 15 nM fibronectin for 3 days (Figure 3.5.13), there were

significant increases in TGF-β and PDGF mRNA in Ddr1-/-

; Ldlr-/-

macrophages compared

to Ddr1+/+

; Ldlr-/-

macrophages, and a trend towards an increase in TNF-α mRNA

expression. There was no change in MCP-1 or MCSF mRNA expression between Ddr1-/-

;

Ldlr-/-

and Ddr1+/+

; Ldlr-/-

macrophages on fibronectin.

Protein levels of MCP-1 and TGF-β secreted into the media by Ddr1+/+

; Ldlr-/-

and Ddr1-/-

;

Ldlr -/-

macrophages after 3 days culture with soluble type I collagen or plated on 15 nM

fibronectin, or 100 nM type IV collagen were measured using ELISAs. Relative changes in

MCP-1 protein levels are presented in Figure 3.5.14. Ddr1-/-

; Ldlr-/-

macrophages

produce significantly reduced levels of MCP -1 compared to Ddr1+/+

; Ldlr-/-

macrophages

when cultured for 3 days with soluble type I collagen (63 % decrease) or plated on 100

nM type IV collagen (48 % decrease) or on 15 nM fibronectin (56% decrease). Relative

changes in TGF-β1 protein levels are presented in Figure 3.5.15. Ddr1-/-

; Ldlr-/-

macrophages produce significantly reduced levels of TGF-β compared to Ddr1+/+

; Ldlr-/-

macrophages when cultured for 3 days with with soluble type I collagen (28% less) and

when plated on 100 nM type IV collagen (43 % less), but had significantly increased

production of TGF-β1 protein when plated on 15 nM fibronectin (23 % increase).

42

3.5 Figures

43

Figure 3.5.1: Peritoneal macrophages did not adhere to type I collagen

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to type I collagen. Plates

were coated with the indicated concentration of type I collagen. Adhesion was

quantified by toluidine blue staining where the absorbance of toluidine blue at an

optical density of 595 nm is proportional to the number of adherent cells. Values are

mean ± SEM (n=3). Comparisons between genotypes were performed by Student’s t-

test. Significant differences (p < 0.05) are indicated by a (*)

44


macrophages adhered significantly less to type IV collagen

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to type IV collagen. Plates

were coated with the indicated concentration of type IV collagen. Adhesion was



mean ± SEM (n=3). Comparisons between genotypes were performed by Student’s t-

test. Significant differences (p < 0.05) are indicated by a (*)

45


macrophages adhered significantly less to fibronectin

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to fibronectin. Plates were

coated with the indicated concentration of fibronectin. Adhesion was quantified by

toluidine blue staining where the absorbance of toluidine blue at an optical density of

595 nm is proportional to the number of adherent cells. Values are mean ± SEM (n=3).

Comparisons between genotypes were performed by Student’s t-test. Significant

differences (p < 0.05) are indicated by a (*)

46


macrophages adhered significantly less to type IV collagen in the

presence of a β1-integrin blocking antibody

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to type IV collagen, with or

without the presence of an antibody that blocks the β1 integrin receptor. When

indicated, macrophages were incubated with β1-blocking antibody at a concentration of

20 µg/ml. Plates were coated with the indicated concentration of type IV collagen.

Adhesion was quantified by toluidine blue staining where the absorbance of toluidine

blue at an optical density of 595 nm is proportional to the number of adherent cells.

Values are mean ± SEM (n=3). Comparisons were performed by one way ANOVA using

the Holm-Sidak method. Significant differences (p < 0.05) between genotypes are

indicated by an (*), significant differences with or without antibody treatment are

indicated by an (x)

47

Figure 3.5.5: There was no difference in adhesion seen on type IV collagen when using

MHC class II or IgM control antibodies.

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to type IV collagen, with or

without the presence of a MHC class II antibody or an IgM antibody administered at

concentrations of 20 µg/ml. Plates were coated with the indicated concentration of type

IV collagen. Adhesion was quantified by toluidine blue staining where the absorbance of

toluidine blue at an optical density of 595 nm is proportional to the number of adherent

cells. Values are mean ± SEM (n=3). Comparisons were performed by Student’s t-test.

There were no significant differences comparing with or without antibody treatment.

48


macrophages adhered significantly less to fibronectin in the

presence of a β1-integrin blocking antibody

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to fibronectin with or without

the presence of an antibody that blocks the β1 integrin receptor. When indicated,

macrophages were incubated with β1-blocking antibody at a concentration of 20 µg/ml.

Plates were coated with the indicated concentration of fibronectin. Adhesion was



mean ± SEM (n=3). Comparisons were performed by one way ANOVA using the Holm-

Sidak method. Significant differences (p < 0.05) between genotypes are indicated by a

(*), with or without antibody treatment are indicated by an (x)

49

Figure 3.5.7: There was no difference in adhesion seen on fibronectin when using MHC

class II or IgM control antibodies

Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages to fibronectin, with or

without the presence of a MHC class II antibody or an IgM antibody administered at

concentrations of 20 µg/ml. Plates were coated with the indicated concentration of

fibronectin. Adhesion was quantified by toluidine blue staining where the absorbance of

toluidine blue at an optical density of 595 nm is proportional to the number of adherent

cells. Values are mean ± SEM (n=3). Comparisons were performed by Student’s t-test.

There were no significant differences comparing with or without antibody treatment.

50

Type of matrix molecule

Type I collagen Type I collagen Type IV collagen Type IV collagen FN FN

Number of cells remaining adherent

0

200

400

600

800

1000

1 dyne / cm2

5 dynes / cm 2

10 dynes / cm2

100 dynes / cm2

Type of matrix molecule

Figure 3.5.8: Adhesion of Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages after shear

stress

Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

peritoneal macrophages were tested for strength of

adhesion to type I collagen, type IV collagen and fibronectin by subjecting adherent cells

to 1, 5, 10 and 100 dynes / cm2

of shear force in microfluidic channels. Channels were

coated with 500nM collagen or 15nM fibronectin. The total number of cells still

adherent after each step increase in shear force was counted.

Type I collagen Type IV collagen fibronectin

DDR1 +/+ DDR1

-/-

DDR1 +/+

DDR1 -/-

DDR1 +/+ DDR1

-/-

51


macrophages produced increased levels of mRNA for MCSF, TNF-

α, TGF-β and PDGF immediately following isolation from the peritoneal cavity

Fold changes in the mRNA levels of MCP-1, MCSF, TNF-α, TGF-β and PDGF between

Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages immediately following isolation from the

peritoneal cavity, 4 days after thioglycollate injection. Values are mean ± SEM (n=3).



52


macrophages produced increased levels of mRNA for MCP1,

MCSF, PDGF and decreased TGF-β after 3 days in culture with type I collagen


Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages 3 days after culture with 50 ug/ml soluble

type I collagen. Values are mean ± SEM (n=3). Comparisons between genotypes were

performed by Student’s t-test. Significant differences (p < 0.05) are indicated by a (*)

53


macrophages produced increased levels of mRNA for

inflammatory cytokines after 7 days in culture with type I collagen


Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages 7 days after culture with 50 ug/ml soluble

type I collagen. Values are mean ± SEM (n=3). Comparisons between genotypes were


54


macrophages produced decreased amounts of MCP-1, MCSF and

PDGF when cultured for 3 days on type IV collagen


Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages after 3 days in culture on type IV collagen

(100nM). Values are mean ± SEM (n=3). Comparisons between genotypes were


55


macrophages produced increased amounts of TGF-β and PDGF

when cultured for 3 days on fibronectin


Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

macrophages after 3 days in culture on fibronectin (15

nM). Values are mean ± SEM (n=3). Comparisons between genotypes were performed

by Student’s t-test. Significant differences (p < 0.05) are indicated by a (*)

56


macrophages produce decreased levels of MCP-1 on type I and

type IV collagen and fibronectin

Fold changes in the secreted protein levels of MCP-1 between Ddr1+/+

; Ldlr-/-

and Ddr1-/-

;

Ldlr-/-

macrophages after 3 days in culture in the presence of type I collagen (50 µg/ml),

or on type IV collagen (100nM) or fibronectin (1 5 nM). Values are mean ± SEM (n=3).



57


macrophages produce decreased levels of TGF-β on collagen and

increased TGF-β on fibronectin.

Fold changes in the secreted protein levels of TGF-β between Ddr1+/+

; Ldlr-/-

and Ddr1-/-

;

Ldlr-/-

macrophages after 3 days in culture in the presence of type I collagen (50 µg/ml),

or on type IV collagen (100nM) or fibronectin (15 nM). Values are mean ± SEM (n=3).



58

Chapter 4

4 Discussion

59

4.1 Discussion

Adhesion studies

We have shown that DDR1-deficient macrophages are deficient in adhesion to

type IV collagen. This is particularly significant because type IV collagen is a major

component of the basement membrane of endothelial cells in the artery wall and is thus

an important matrix protein barrier that macrophages first encounter when they begin

to transmigrate into the intimal space. This makes macrophage adhesion to type IV

collagen a particularly relevant characteristic in atherosclerosis. Deficiency in adhesion

to type IV collagen may contribute to an inability of macrophages to invade into the

plaque because cells need to adhere in order to migrate. It is known that the ability of

macrophages to adhere to matrix plays an important role in macrophage transmigration

(Dangerfield et al., 2002). However, to date, no one has determined whether

endogenous DDR1 mediates the adhesion of macrophages to matrix components found

within the atherosclerotic plaque.

Previous work with systemic deletion of DDR1 showed reduction in macrophage

accumulation or recruitment into the atherosclerotic plaques of Ddr1-/-

; Ldlr-/-

mice

(Franco et al., 2008). In addition, a previous study observing the effect of deletion of the

α1 integrin receptor on atherosclerosis demonstrated that the lack of the α1 receptor in

an ApoE-deficient model of atherosclerosis resulted in smaller plaques with fewer

macrophages, suggesting that the α1β1 receptor, also important for adhesion to type IV

collagen, was an important mediator in macrophage recruitment to the plaque

(Schapira et al., 2005). Hence, the deficit seen in DDR1-/-

macrophages in adhering to

type IV collagen is consistent with a role for DDR1 in mediating macrophage invasion

into the plaque.

In order to determine what portion of the differences in adhesion seen were

mediated by DDR1 vs. integrin-mediated adhesion, a blocking antibody experiment

60

using a β1-integrin blocking antibody was conducted using a C29 antibody that has been

shown to block adhesion (Mendrick et al., 1993). Ddr1-/-

; Ldlr-/-

macrophages adhered

significantly less to type IV collagen compared to Ddr1+/+

; Ldlr-/-

macrophages and

blocking the β1 integrin receptor did not eliminate the difference in adhesion. Ddr1+/+

;

Ldlr-/-

macrophages still adhered to type IV collagen when the β1 integrin receptor was

blocked, suggesting that DDR1 does mediate adhesion to type IV collagen.

In this study we show that DDR1-deficient macrophages adhere significantly less

to fibronectin. In order to determine what portion of the difference in adhesion was

mediated by DDR1 vs. integrin-mediated adhesion, an assay using a β1 blocking

antibody was conducted. Ddr1-/-

; Ldlr-/-

macrophages adhered significantly less to

fibronectin compared to Ddr1+/+

; Ldlr-/-

macrophages and blocking the β1 integrin

receptor did not eliminate the difference in adhesion. Ddr1+/+

; Ldlr-/-

macrophages still

adhered to fibronectin when the β1 integrin receptor was blocked suggesting that DDR1

does mediate adhesion to fibronectin. Therefore we have found new evidence

suggesting an interaction between DDR1 and fibronectin – to date fibronectin has not

been shown to be a direct ligand for DDR1 (Vogel et al., 1997). Recent work has shown

that in the vasculature, endothelial cells under atheroprone shear conditions can

produce a thin layer of fibronectin overlying their basement membrane (Orr et al.,

2005). Therefore we speculate that deficiency in ability of DDR1-deficient macrophages

to adhere to fibronectin could affect macrophage ability to enter the plaque.

We have found that freshly isolated peritoneal macrophage cells do not adhere

to type I collagen. Reports in the literature on the adhesion of macrophages to type I

collagen vary widely, often depending on the source of macrophages used. Adhesion of

monocyte / macrophage to type I collagen was seen in THP-1 cells transfected to over

express DDR1 (Kamohara et al., 2001), in human peripheral blood monocytes (Newman

and Tucci, 1990) and in THP-1 cells (Lin et al., 1995). However, similar to results seen

here, the human macrophage monoblastic cell line U937 was poorly adhesive to type I

collagen (Koyama et al., 2000). In another study, RAW 264 and peritoneal thioglycollate-

61

induced macrophages adhered poorly to fibrillar type I collagen (Gowen et al., 2000). In

studies of atherosclerosis, deletion of the α2 integrin receptor, which is an important

type I collagen integrin receptor had no effect on plaque development. More

importantly, no detectable α2 receptor was found on monocytes or macrophages in the

plaque area (Grenache et al., 2003), suggesting that macrophage adhesion to type I

collagen is not a critical factor in macrophage invasion into the plaque.

Using the microfluidic channel method to measure the strength of adhesion of

macrophages to matrix, we saw trends similar to the results obtained in the static

adhesion assays – peritoneal macrophages did not adhere well to type I collagen but did

adhere to fibronectin and type IV collagen. Furthermore, there was a trend towards

decreased adhesion of Ddr1-/-

; Ldlr-/-

cells compared to Ddr1+/+

; Ldlr-/-

macrophages.

Cytokine expression studies

For these studies, 5 cytokines were chosen for their potential impact on plaque

development. MCP-1 is a potent monocyte chemoattractant and deletion of this gene in

an LDLR-deficient model of atherosclerosis resulted in significantly reduced lesion size

with fewer macrophages present in the lesions (Gu et al., 1998), similar to results seen

in the systemic DDR1 knockout model (Franco et al., 2008). MCSF is known to aid in the

differentiation of monocytes into macrophages (Becker et al., 1987) once they enter the

plaque area and the deletion of MCSF resulted in smaller plaques with fewer

macrophages (Qiao et al., 1997). PDGF and TGF-β are potent inducers of SMC migration

and together with TNF-α can also induce smooth muscle cell proliferation (Raines and

Ross, 1993).

When plated on type IV collagen, DDR1-deficient macrophages produced

decreased MCP-1, MCSF and PDGF mRNA compared to DDR1-expressing cells.

Furthermore, protein levels of MCP-1 and TGF-β were also decreased in DDR1-deficient

cells plated on type IV collagen. Taken together, this suggests that DDR1 regulates the

62

expression of these cytokines in response to type IV collagen. The consistent results for

MCP-1 down regulation at both the mRNA and protein level suggest that DDR1 may

control MCP-1 expression at the level of transcription – DDR1 can signal through NFkB

(Matsuyama et al., 2004), which is known to be an important transcription factor

controlling the expression of many cytokines including MCP-1 (Blackwell and Christman,

1997). When plated on fibronectin, DDR1-deficient macrophages had increased

expression of TGF-β and PDGF mRNA compared to DDR1-expressing cells, but no change

in MCP-1 mRNA expression. When plated on fibronectin, DDR1-deficient cells produce

increased levels of TGF-β protein consistent with mRNA results. However, DDR1-

deficient macrophages produced decreased levels of MCP-1 protein compared to DDR1-

expressing cells. This suggests that, when plated on fibronectin, DDR1 regulates MCP-1

through post-transcriptional mechanisms, different from regulation when plated on

type IV collagen. TGF-β is increased at both the mRNA and protein level in DDR1-

deficient cells when compared to DDR1-expressing cells, which may suggest a role for

DDR1 in transcriptional repression of TGF-β when macrophages are exposed to

fibronectin.

In freshly isolated DDR1-deficient cells, there was an increase in MCSF, TNF-α,

TGF-β and PDGF compared to DDR1-expressing macrophages. This increase in cytokine

expression at the mRNA level was carried forward after culturing with soluble type I

collagen for 3 days and 7 days (increased MCP-1, MCSF and PDGF). This suggests that

differences seen between DDR1-deficient and expressing cells were elicited in the

mouse due to unknown factors and persisted during culture.

In vivo work done in our lab shows that the systemic deletion of DDR1 leads to

decreased mRNA levels of MCP-1 in the atherosclerotic plaque (Franco et al., 2008), a

finding that agrees well with the data presented here. Other work also suggests that

DDR1 mediates leukocyte recruitment to sites of inflammation. Work with DDR1 in renal

disease suggests that the absence of DDR1 reduced leukocyte recruitment as well as

reduced LPS-induced MCP-1 expression (Flamant et al., 2006), furthermore work with

63

DDR1 knockouts in a model of lung fibrosis suggested that deletion of DDR1 reduced

inflammatory cell recruitment as well as decreased the expression of inflammatory

cytokines like MCP-1 and IL-6 in the bronchoalveolar lavage fluid from DDR1-deficient

mice compared to bronchoalveolar lavage fluid from DDR1-expressing mice (Avivi-Green

et al., 2006).

Overall, when faced with type IV collagen and fibronectin, two important matrix

molecules found in the endothelial basement membrane that macrophages would come

into contact with during transmigration into the plaque area, DDR1-deficient

macrophages produced significantly decreased levels of the potent monocyte

chemoattractant MCP-1. Previous work has shown that a systemic deletion of MCP-1 in

mice attenuates lesion formation and in particular reduces the recruitment of

macrophages to the atherosclerotic plaque (Gosling et al., 1999; Gu et al., 1998). This

deficit in the production of MCP-1 and other inflammatory cytokines may contribute to

reduced recruitment of inflammatory cells from the circulation into the plaque, thus

attenuating plaque development.

Conclusion

In these experiments we have shown that DDR1-deficient macrophages adhered

significantly less to type IV collagen and fibronectin compared to DDR1-expressing cells.

In addition, when plated on these matrix components, DDR1-deficient macrophages

produce decreased levels of MCP-1 protein, a cytokine known to be very important in

plaque development. The inability of DDR1-deficient macrophages to adhere to type IV

collagen and fibronectin, both important components of endothelial basement

membrane in atheroprone areas of the vasculature, as well as their potential inability to

attract further leukocyte recruitment to the plaque area due to a decrease in MCP-1

expression could contribute to decreased macrophage recruitment into the plaque, and

hence the attenuated development of atherosclerosis.

64

4.2 Limitations and Future directions

Static adhesion studies: these experiments occur under static conditions and on one

thin layer of matrix that is adherent to tissue culture plastic, whereas in vivo,

macrophages adhere to endothelium and basement membrane while under flow, and

basement membrane and the plaque extracellular matrix is a complex mix of various

ECM components. Further testing should use matrix more similar to that found in vivo

such as Matrigel, and perhaps use 3D matrix models where cells are imbedded in matrix

to track adhesion and invasion of these cells

Flow adhesion studies: These experiments have been complicated by various technical

issues which cause high variability between repeats – the occurrence of bubbles in the

microchannel devices, while hard to avoid, skews results because of the ability of the

bubbles to rip cells and matrix from the channel walls. In addition, we are currently

collaborating with Dr. Craig Simmons to develop microfluidic devices that can mimic

shear stresses that macrophages are exposed to, and eventually more closely mimic the

in vivo structure of an artery in a microfluidic channel. Future experiments should aim to

optimize this valuable tool by incorporating bubble traps into the design of the channels

to provide more consistency in results.

In these experiments, we show that DDR1-deficient macrophages are deficient in

adhesion to fibronectin. Because fibronectin is not a known DDR1 ligand, further

investigation into this is necessary. In order to conclusively prove that DDR1 is affecting

the change in adhesion seen, and not some other integrin receptor, either more

blocking antibody experiments must be carried out, or DDR1 can be transfected into a

cell type that does not express any other fibronectin receptors, such as the

neuroblastoma cell line LAN-1. The ability or inability of this transfected cell to adhere to

fibronectin may shed more light on the role of DDR1 in fibronectin adhesion. In addition,

the effect of fibronectin binding by DDR1 should be determined by assessing the

phosphorylation status of DDR1 to determine if DDR1 signaling is being activated.

65

RT-PCR and ELISA studies: Once again, these experiments were carried out on a thin

layer of matrix that is adherent to tissue culture plastic, whereas in vivo, macrophages

would be exposed to a complex mix of various ECM components. Further testing should

use matrix more similar to that found in vivo such as matrigel, and perhaps use 3D

matrix models where cells are imbedded in matrix to better simulate the in vivo

condition. In addition, verification of these results with other cell sources, and in

particular bone marrow-derived macrophages, which is a cell type more analogous to

circulating monocytes found in the vasculature, will further add credence to these

findings.

66

5 References

Abdulhussein, R., Koo, D. H. H., and Vogel, W. F. (2008). Identification of disulfide-linked

dimers of the receptor tyrosine kinase DDR1. Journal of Biological Chemistry 283, 12026

-12033.

Akai, Y., Iwano, M., Kitamura, Y., Shiki, H., Dohi, Y., Dohi, K., Moriyama, T., and

Ynoemasu, K. (1994). Intraglomerular expressions of IL-1α and platelet-derived growth

factor (PDGF-B) mRNA in experimental immune complex-mediated glomerulonephritis.

Clinical & Experimental Immunology 95, 29-34.

Alves, F., Saupe, S., Ledwon, M., Schaub, F., Hiddemann, W., and Vogel, W. (2001).

Identification of two novel, kinase-deficient variants of discoidin domain receptor 1:

differential expression in human colon cancer cell lines. FASEB J., 00-0626fje.

Augé, N., Pieraggi, M. T., Thiers, J. C., Nègre-Salvayre, A., and Salvayre, R. (1995).

Proliferative and cytotoxic effects of mildly oxidized low-density lipoproteins on vascular

smooth-muscle cells. Biochem. J. 309, 1015-1020.

Autio, I., Jaakkola, O., Solakivi, T., and Nikkari, T. (1990). Oxidized low-density

lipoprotein is chemotactic for arterial smooth muscle cells in culture. FEBS Letters 277,

247-249.

Avivi-Green, C., Singal, M., and Vogel, W. F. (2006). Discoidin domain receptor 1-

deficient mice rre resistant to bleomycin-induced lung fibrosis. Am. J. Respir. Crit. Care

Med. 174, 420-427.

Becker, S., Warren, M., and Haskill, S. (1987). Colony-stimulating factor-induced

monocyte survival and differentiation into macrophages in serum-free cultures. J

Immunol 139, 3703-3709.

Bendeck, M. P., Hou, G., Chen, J., Nejat, S., and Adiguzel, E. (2004). Matrix, matrix

metalloproteinases and smooth muscle cell function in atherosclerosis. International

Congress Series 1262, 486-489.

Berliner, J. A., Territo, M. C., Sevanian, A., Ramin, S., Kim, J. A., Bamshad, B., Esterson,

M., and Fogelman, A. M. (1990). Minimally modified low density lipoprotein stimulates

monocyte endothelial interactions. J Clin Invest 85, 1260-1266.

Brown, M., and Goldstein, J. (1986). A receptor-mediated pathway for cholesterol

homeostasis. Science 232, 34-47.

Collins, T., Palmer, H. J., Whitley, M. Z., Neish, A. S., and Williams, A. J. (1993). A

67

common theme in endothelial activation: Insights from the structural analysis of the

genes for E-selectin and VCAM-1. Trends in Cardiovascular Medicine 3, 92-97.

Costell, M. (1999). Perlecan maintains the integrity of cartilage and some basement

membranes. The Journal of Cell Biology 147, 1109-1122.

Curat, C. A., Eck, M., Dervillez, X., and Vogel, W. F. (2001). Mapping of epitopes in

discoidin domain receptor 1 critical for collagen binding. J. Biol. Chem 276, 45952-

45958.

Curat, C. A., and Vogel, W. F. (2002). Discoidin Domain Receptor 1 Controls Growth and

Adhesion of Mesangial Cells. J Am Soc Nephrol 13, 2648-2656.

Danen, E. H., and Sonnenberg, A. (2003). Integrins in regulation of tissue development

and function. J. Pathol. 200, 471-480.

Dangerfield, J., Larbi, K. Y., Huang, M., Dewar, A., and Nourshargh, S. (2002). PECAM-1

(CD31) homophilic interaction up-regulates α6β1 on transmigrated neutrophils in vivo

and plays a functional role in the ability of α6 integrins to mediate leukocyte migration

through the perivascular basement membrane. The Journal of Experimental Medicine

196, 1201 -1212.

Dejmek, J., Dib, K., Jonsson, M., and Andersson, T. (2003). Wnt-5a and G-protein

signaling are required for collagen-induced DDR1 receptor activation and normal

mammary cell adhesion. International Journal of Cancer 103, 344-351.

Evanko, S. P., Raines, E. W., Ross, R., Gold, L. I., and Wight, T. N. (1998). Proteoglycan

distribution in lesions of atherosclerosis depends on lesion severity, structural

characteristics, and the proximity of platelet-derived growth factor and transforming

growth factor-beta. Am J Pathol 152, 533-546.

Ezure, T., Ishiwata, T., Asano, G., Tanaka, S., and Yokomuro, K. (1997). Production of

macrophage colony-stimulating factor by murine liver in vivo. Cytokine 9, 53-58.

Ferri, N., Carragher, N. O., and Raines, E. W. (2004). Role of Discoidin Domain Receptors

1 and 2 in Human Smooth Muscle Cell-Mediated Collagen Remodeling: Potential

Implications in Atherosclerosis and Lymphangioleiomyomatosis. Am J Pathol 164, 1575-

1585.

Flamant, M., Placier, S., Rodenas, A., Curat, C. A., Vogel, W. F., Chatziantoniou, C., and

Dussaule, J. (2006). Discoidin domain receptor 1 null mice are protected against

hypertension-induced renal disease. J Am Soc Nephrol 17, 3374-3381.

Franco, C. (2009). A functional role for discoidin domain receptor 1 (Ddr1) in the

68

regulation of inflammation and fibrosis during atherosclerotic plaque development.

Franco, C., Britto, K., Wong, E., Hou, G., Zhu, S., Chen, M., Cybulsky, M. I., and Bendeck,

M. P. (2009). Discoidin Domain Receptor 1 on Bone Marrow-Derived Cells Promotes

Macrophage Accumulation During Atherogenesis. Circ Res 105, 1141-1148.

Franco, C., Hou, G., Ahmad, P. J., Fu, E. Y., Koh, L., Vogel, W. F., and Bendeck, M. P.

(2008). Discoidin domain receptor 1 (Ddr1) deletion decreases atherosclerosis by

accelerating matrix accumulation and reducing inflammation in low-density lipoprotein

receptor-deficient mice. Circ Res 102, 1202-1211.

Galis, Z. S., Sukhova, G. K., Lark, M. W., and Libby, P. (1994). Increased expression of

matrix metalloproteinases and matrix degrading activity in vulnerable regions of human

atherosclerotic plaques. J Clin Invest 94, 2493-2503.

Gelse, K., Po ¨schl, E., and Aigner, T. (2003). Collagens—structure, function, and

biosynthesis. Advanced Drug Delivery Reviews 55, 1531-1546.

Gerrity, R. G. (1981). The role of the monocyte in atherogenesis: I. Transition of blood-

borne monocytes into foam cells in fatty lesions. Am J Pathol 103, 181-190.

Giddens, D. P., Zarins, C. K., and Glagov, S. (1993). The role of fluid mechanics in the

localization and detection of atherosclerosis. J. Biomech. Eng. 115, 588-594.

Gosling, J., Slaymaker, S., Gu, L., Tseng, S., Zlot, C. H., Young, S. G., Rollins, B. J., and

Charo, I. F. (1999). MCP-1 deficiency reduces susceptibility to atherosclerosis in mice

that overexpress human apolipoprotein B. J Clin Invest 103, 773-778.

Gowen, B. B., Borg, T. K., Ghaffar, A., and Mayer, E. P. (2000). Selective adhesion of

macrophages to denatured forms of type I collagen is mediated by scavenger receptors.

Matrix Biology 19, 61-71.

Grenache, D. G., Coleman, T., Semenkovich, C. F., Santoro, S. A., and Zutter, M. M.

(2003). {alpha}2{beta}1 integrin and development of atherosclerosis in a mouse model:

assessment of risk. Arterioscler Thromb Vasc Biol 23, 2104-2109.

Gu, L., Okada, Y., Clinton, S. K., Gerard, C., Sukhova, G. K., Libby, P., and Rollins, B.

(1998). Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low

density lipoprotein receptor deficient mice. Molecular Cell 2, 275-281.

Hahn, C., and Schwartz, M. A. (2008). The role of cellular adaptation to mechanical

forces in atherosclerosis. Arterioscler Thromb Vasc Biol 28, 2101-2107.

Hansen, C., Greengard, P., Nairn, A. C., Andersson, T., and Vogel, W. F. (2006).

69

Phosphorylation of DARPP-32 regulates breast cancer cell migration downstream of the

receptor tyrosine kinase DDR1. Experimental Cell Research 312, 4011-4018.

Hardingham, T., and Fosang, A. (1992). Proteoglycans: many forms and many functions.

FASEB J. 6, 861-870.

Hedin, U., Bottger, B. A., Luthman, J., Johansson, S., and Thyberg, J. (1989). A substrate

of the cell-attachment sequence of fibronectin (Arg-Gly-Asp-Ser) is sufficient to promote

transition of arterial smooth muscle cells from a contractile to a synthetic phenotype.

Developmental Biology 133, 489-501.

Hilton, H. N., Stanford, P. M., Harris, J., Oakes, S. R., Kaplan, W., Daly, R. J., and

Ormandy, C. J. (2008). KIBRA interacts with discoidin domain receptor 1 to modulate

collagen-induced signalling. Biochimica et Biophysica Acta (BBA) - Molecular Cell

Research 1783, 383-393.

Hocking, D. C., Sottile, J., and McKeown-Longo, P. J. (1994). Fibronectin's III-1 module

contains a conformation-dependent binding site for the amino-terminal region of

fibronectin. Journal of Biological Chemistry 269, 19183 -19187.

Hou, G., Mulholland, D., Gronska, M. A., and Bendeck, M. P. (2000). Type VIII collagen

stimulates smooth muscle cell migration and matrix metalloproteinase synthesis after

arterial injury. Am J Pathol 156, 467-476.

Hou, G., Vogel, W., and Bendeck, M. P. (2001). The discoidin domain receptor tyrosine

kinase DDR1 in arterial wound repair. J. Clin. Invest. 107, 727-735.

Huang, Y., Arora, P., McCulloch, C. A., and Vogel, W. F. (2009). The collagen receptor

DDR1 regulates cell spreading and motility by associating with myosin IIA. J Cell Sci 122,

1637-1646.

Hurt, E., Bondjers, G., and Camejo, G. (1990). Interaction of LDL with human arterial

proteoglycans stimulates its uptake by human monocyte-derived macrophages. J. Lipid

Res. 31, 443-454.

Hynes, R. O. (1992). Integrins: Versatility, modulation, and signaling in cell adhesion. Cell

69, 11-25.

Ichikawa, O., Osawa, M., Nishida, N., Goshima, N., Nomura, N., and Shimada, I. (2007).

Structural basis of the collagen-binding mode of discoidin domain receptor 2. EMBO J

26, 4168-4176.

Iiyama, K., Hajra, L., Iiyama, M., Li, H., DiChiara, M., Medoff, B. D., and Cybulsky, M. I.

(1999). Patterns of vascular cell adhesion molecule-1 and intercellular adhesion

70

molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites

predisposed to lesion formation. Circ Res 85, 199-207.

Ishibashi, S., Brown, M. S., Goldstein, J. L., Gerard, R. D., Hammer, R. E., and Herz, J.

(1993). Hypercholesterolemia in low density lipoprotein receptor knockout mice and its

reversal by adenovirus-mediated gene delivery. J Clin Invest 92, 883-893.

Jonsson, M., and Andersson, T. (2001). Repression of Wnt-5a impairs DDR1

phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci 114,

2043-2053.

Kamohara, H., Yamashiro, S., Galligan, C., and Yoshimura, T. (2001). Discoidin domain

receptor 1 isoform-a (DDR1a) promotes migration of leukocytes in three-dimensional

collagen lattices. FASEB J.

Kim, S., Lee, S., Suk, K., Bark, H., Jun, C., Kim, D., Choi, C., and Yoshimura, T. (2007).

Discoidin domain receptor 1 mediates collagen-induced nitric oxide production in

J774A.1 murine macrophages. Free Radical Biology and Medicine 42, 343-352.

Konitsiotis, A. D., Raynal, N., Bihan, D., Hohenester, E., Farndale, R. W., and Leitinger, B.

(2008). Characterization of high affinity binding motifs for the discoidin domain receptor

DDR2 in collagen. J. Biol. Chem 283, 6861-6868.

Koyama, Y., Norose-Toyoda, K., Hirano, S., Kobayashi, M., Ebihara, T., Someki, I., Fujisaki,

H., and Irie, S. (2000). Type I collagen is a non-adhesive extracellular matrix for

macrophages. Arch. Histol. Cytol 63, 71-79.

Leitinger, B. (2003). Molecular Analysis of Collagen Binding by the Human Discoidin

Domain Receptors, DDR1 and DDR2. Journal of Biological Chemistry 278, 16761 -16769.

Leitinger, B., and Kwan, A. P. (2006). The discoidin domain receptor DDR2 is a receptor

for type X collagen. Matrix Biology 25, 355-364.

Ley, K., Laudanna, C., Cybulsky, M. I., and Nourshargh, S. (2007). Getting to the site of

inflammation: the leukocyte adhesion cascade updated. Nat Rev Immunol 7, 678-689.

L'hote, C. G. M., Thomas, P. H., and Ganesan, T. S. (2001). Functional analysis of

discoidin domain receptor 1: effect of adhesion on DDR1 phosphorylation. FASEB J.

Lin, T. H., Rosales, C., Mondal, K., Bolen, J. B., Haskill, S., and Juliano, R. L. (1995).

Integrin-mediated Tyrosine Phosphorylation and Cytokine Message Induction in

Monocytic Cells. Journal of Biological Chemistry 270, 16189 -16197.

Loree, H., Kamm, R., Stringfellow, R., and Lee, R. (1992). Effects of fibrous cap thickness

71

on peak circumferential stress in model atherosclerotic vessels. Circ Res 71, 850-858.

Lu, K. K., Trcka, D., and Bendeck, M. P. Collagen stimulates discoidin domain receptor 1-

mediated migration of smooth muscle cells through Src. Cardiovascular Pathology In

Press, Corrected Proof. Available at:

http://www.sciencedirect.com/science/article/B6T13-4Y7NDN1-

3/2/047b46cf1213a88da33c87005055c795.

Lund, A., Stegemann, J., and Plopper, G. (2009). Mesenchymal stem cells sense three

dimensional type I collagen through discoidin domain receptor 1. Open Stem Cell J 1, 40-

53.

Matsuyama, W., Faure, M., and Yoshimura, T. (2003). Activation of discoidin domain

receptor 1 facilitates the maturation of human monocyte-derived dendritic cells through

the TNF receptor associated factor 6/TGF-beta-activated protein kinase 1 binding

protein 1 beta/p38 alpha mitogen-activated protein kinase signaling cascade. J.

Immunol 171, 3520-3532.

Matsuyama, W., Wang, L., Farrar, W. L., Faure, M., and Yoshimura, T. (2004). Activation

of discoidin domain receptor 1 isoform b with collagen up-regulates chemokine

production in human macrophages: role of p38 mitogen-activated protein kinase and

NF-kappa B. J. Immunol 172, 2332-2340.

Newman, S. L., and Tucci, M. A. (1990). Regulation of human monocyte/macrophage

function by extracellular matrix. Adherence of monocytes to collagen matrices enhances

phagocytosis of opsonized bacteria by activation of complement receptors and

enhancement of Fc receptor function. J. Clin. Invest 86, 703-714.

Noordeen, N. A., Carafoli, F., Hohenester, E., Horton, M. A., and Leitinger, B. (2006). A

transmembrane leucine zipper Is required for activation of the dimeric receptor tyrosine

kinase DDR1. Journal of Biological Chemistry 281, 22744 -22751.

Ongusaha, P. P., Kim, J., Fang, L., Wong, T. W., Yancopoulos, G. D., Aaronson, S. A., and

Lee, S. W. (2003). p53 induction and activation of DDR1 kinase counteract p53-mediated

apoptosis and influence p53 regulation through a positive feedback loop. EMBO J 22,

1289-1301.

Orr, A. W., Sanders, J. M., Bevard, M., Coleman, E., Sarembock, I. J., and Schwartz, M. A.

(2005). The subendothelial extracellular matrix modulates NF-κB activation by flow. The

Journal of Cell Biology 169, 191 -202.

Overbergh, L., Valckx, D., Waer, M., and Mathieu, C. (1999). Quantification if murine

cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11,

305-312.

72

Paulson, K. E., Zhu, S., Chen, M., Nurmohamed, S., Jongstra-Bilen, J., and Cybulsky, M. I.

(2010). Resident intimal dendritic cells accumulate lipid and contribute to the initiation

of atherosclerosis. Circ Res 106, 383-390.

Perez, J. L., Shen, X., Finkernagel, S., Sciorra, L., Jenkins, N. A., Gilbert, D. J., Copeland, N.

G., and Wong, T. W. (1994). Identification and chromosomal mapping of a receptor

tyrosine kinase with a putative phospholipid binding sequence in its ectodomain.

Oncogene 9, 211-219.

Potts, J. R. (1994). Fibronectin structure and assembly. Current Opinion in Cell Biology 6,

648-655.

Qiao, J., Tripathi, J., Mishra, N., Cai, Y., Tripathi, S., Wang, X., Imes, S., Fishbein, M.,

Clinton, S., Libby, P., et al. (1997). Role of macrophage colony-stimulating factor in

atherosclerosis: studies of osteopetrotic mice. Am J Pathol 150, 1687-1699.

Qureshi, R., and Jakschik, B. (1988). The role of mast cells in thioglycollate-induced

inflammation. J Immunol 141, 2090-2096.

Raines, E. W., and Ross, R. (1993). Smooth muscle cells and the pathogenesis of the

lesions of atherosclerosis. Br Heart J 69, S30-S37.

Ross, R. (1999). Atherosclerosis — An inflammatory disease. New England Journal of

Medicine 340, 115-126.

Ross, R. (1993). The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature

362, 801-809.

Seimon, T., and Tabas, I. (2009). Mechanisms and consequences of macrophage

apoptosis in atherosclerosis. J. Lipid Res. 50, S382-387.

Shekhonin, B., Domogatsky, S., Idelson, G., Koteliansky, V., and Rukosuev, V. (1987).

Relative distribution of fibronectin and type I, III, IV, V collagens in normal and

atherosclerotic intima of human arteries. Atherosclerosis 67, 9-16.

Shintani, Y., Fukumoto, Y., Chaika, N., Svoboda, R., Wheelock, M. J., and Johnson, K. R.

(2008). Collagen I–mediated up-regulation of N-cadherin requires cooperative signals

from integrins and discoidin domain receptor 1. The Journal of Cell Biology 180, 1277 -

1289.

Slack, B. E., Siniaia, M. S., and Blusztajn, J. K. (2006). Collagen type I selectively activates

ectodomain shedding of the discoidin domain receptor 1: Involvement of Src tyrosine

kinase. Journal of Cellular Biochemistry 98, 672-684.

73

Smith, E. B. (1965). The influence of age and atherosclerosis on the chemistry of aortic

intima: Part 2. Collagen and mucopolysaccharides. Journal of Atherosclerosis Research

5, 241-248.

Tzima, E., Irani-Tehrani, M., Kiosses, W. B., Dejana, E., Schultz, D. A., Engelhardt, B., Cao,

G., DeLisser, H., and Schwartz, M. A. (2005). A mechanosensory complex that mediates

the endothelial cell response to fluid shear stress. Nature 437, 426-431.

Valent, A., Meddeb, M., Danglot, G., Duverger, A., Nguyen, V. C., and Bernheim, A.

(1996). Assignment of the NTRK4 (trkE) gene to chromosome 6p21. Human Genetics 98,

12-15.

Vogel, W., Gish, G. D., Alves, F., and Pawson, T. (1997). The Discoidin Domain Receptor

Tyrosine Kinases Are Activated by Collagen. Mol. Cell. Biol. 13-23.

Vogel, W. F. (2002). Ligand-induced shedding of discoidin domain receptor 1. FEBS

Letters 514, 175-180.

Vogel, W. F., Aszodi, A., Alves, F., and Pawson, T. (2001). Discoidin domain receptor 1

tyrosine kinase has an essential role in mammary gland development. Mol. Cell. Biol. 21,

2906-2917.

Voisin, M., Woodfin, A., and Nourshargh, S. (2009). Monocytes and neutrophils exhibit

both distinct and common mechanisms in penetrating the vascular basement

membrane in vivo. Arterioscler Thromb Vasc Biol 29, 1193-1199.

Wang, C., Hsu, Y., and Tang, M. (2005). Function of discoidin domain receptor I in HGF-

induced branching tubulogenesis of MDCK cells in collagen gel. Journal of Cellular

Physiology 203, 295-304.

Wang, C., Su, H., Hsu, Y., Shen, M., and Tang, M. (2006). A Discoidin Domain Receptor

1/SHP-2 Signaling Complex Inhibits {alpha}2beta1-Integrin-mediated Signal Transducers

and Activators of Transcription 1/3 Activation and Cell Migration. Mol. Biol. Cell 17,

2839-2852.

Wesley, R. B., Meng, X., Godin, D., and Galis, Z. S. (1998). Extracellular matrix modulates

macrophage functions characteristic to atheroma : collagen type I enhances acquisition

of resident macrophage traits by human peripheral blood monocytes in vitro.

Arterioscler Thromb Vasc Biol 18, 432-440.

Yeh, Y., Wang, C., and Tang, M. (2009). Discoidin domain receptor 1 activation

suppresses alpha2beta1 integrin-dependent cell spreading through inhibition of Cdc42

activity. Journal of Cellular Physiology 218, 146-156.

74

Young, E. W. K., Wheeler, A. R., and Simmons, C. A. (2007). Matrix-dependent adhesion

of vascular and valvular endothelial cells in microfluidic channels. Lab Chip 7, 1759-1766.

Zhang, S., Reddick, R., Piedrahita, J., and Maeda, N. (1992). Spontaneous

hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258,

468-471.

75

6 Appendices

76

6.1 Flow cytometry to determine if differences exist in

macrophage recruitment to the peritoneal cavity:

77

6.1.1 Rationale

Previous work has shown that in various models of inflammation, a systemic

deletion of DDR1 leads to a decrease in the number of recruited macrophage cells – this

has been shown in models of lung inflammation (Avivi-Green et al., 2006), renal

inflammation (Flamant et al., 2006) and by our lab in atherosclerotic plaque

development (Franco et al., 2008). In order to determine if the absence of DDR1 on

macrophages would affect macrophage recruitment in a simpler model of inflammation,

we chose to examine macrophage recruitment to the peritoneal cavity in response to a

thioglycollate injection. Thioglycollate is known to cause an acute inflammatory reaction

upon injection into the peritoneal cavity, with monocyte / macrophage accumulation

beginning about 16 hours following injection, and peaking 4 days after (Qureshi and

Jakschik, 1988). By analyzing cellular composition of the peritoneal lavage at an early

timepoint after injection (24 hours) we sought to determine if there were differences in

recruitment of monocyte/macrophages in response to the injection of the irritant

stimulus.

6.1.2 Materials and Methods

1 ml of 4% thioglycollate was injected into the peritoneal cavity of Ddr1+/+

; Ldlr-/-

and

Ddr1-/-

; Ldlr-/-

mice and 24 hours later were subjected to a peritoneal lavage with 10ml

PBS supplemented with 1mM EDTA. From the total lavage, aliquots of 1,000,000 cells in

1% BSA in RPMI were then incubated with unlabeled mAb or directly conjugated

primary mAb for 30 min on ice. Staining was carried out using the following markers:

CD115-phycoerythrin (1:100, eBioscience), Ly6C-biotin (1:200, BMA Biomedical). After

washing in 0.5% FBS / 1 mM EDTA/PBS, samples that had been stained with biotinylated

primary antibodies were incubated with Streptavidin-allophycocyanin (SA-APC, 1:800,

Becton-Dickinson). Samples were analyzed on a Beckman Coulter FC500 flow cytometer

at the following wavelengths: PE: 560 nm – 590 nm, APC: 660 nm – 690 nm. Cells that

78

were CD115+ and Ly6C+ were labelled as monocyte / macrophages. The experiment was

conducted with n = 4 for each genotype.

6.1.3 Results

The results of these experiments are summarized in Figure 6.1.5.1 below. While

there is a trend to a decreased number of macrophages in the Ddr1-/-

; Ldlr-/-

mice, with

a 20% reduction in the number of CD115+/Ly6C+ labelled monocyte /macrophages in

the peritoneal lavage of Ddr1-/-

; Ldlr-/-

mice, the difference is not significant.

6.1.4 Discussion

We chose this model of inflammation in order to determine if, as with other

more complicated models of chronic inflammation, DDR1-deficient macrophages would

have reduced accumulation to the site of inflammation. However, we were unable to

see a significant difference between the DDR1-deficient and the DDR1 expessing mice,

though we do see a trend towards a decrease in accumulation of macrophages in the

DDR1-deficient mice

One possible reason for this is that , recently it has been shown that monocytes

preferentially pass through postcapillary venules at sites called matrix protein low

expression regions (LERs) which have reduced basement membrane protein, and that

monocyte transmigration at these sites may not require proteases (Voisin et al., 2009).

It is possible that the requirement of proteases for monocyte transmigration at matrix

rich arterial locations accounts for differences seen when comparing this simpler model

of recruitment to infiltration in atherosclerotic plaques – previous work has shown that

DDR1-deficient macrophages produce decreased levels of the MMP family of proteases

(Franco et al., 2008).

79

6.1.5 Figure:

Figure 6.1.5.1: There is no difference in macrophage recruitment to the peritoneal

cavity 1 day after thioglycollate injection

Percent positive CD115+/Ly6C+ labeled cells (macrophages) in peritoneal lavage of

Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

mice 1 day after thioglycollate injection into the

peritoneal cavity. Values are mean ± SEM (n=4 for each genotype)

80

6.2 Attempts to immunoblot for DDR1

81

6.2.1 Rationale:

These experiments were carried out using a polyclonal goat antibody which

recognizes an epitope mapping to the C- terminus of human DDR1, in order to

characterize the expression of DDR1 on peritoneal macrophages at different time points

and under different stimulations. We have previously used this antibody to detect a 120

kDa corresponding to DDR1 in mouse vascular smooth muscle cells.

6.2.2 Materials and Methods:

Ddr1+/+

; Ldlr-/-

and Ddr1-/-

; Ldlr-/-

mice were injected with 1 ml of 4% thioglycollate

medium in the peritoneal cavity, and 4 days later a peritoneal lavage was carried out as

previously described ( Section 2.2) Macrophages were plated at a density of 6 million

cells / 10 cm dish and 3 days later, total cellular protein was extracted using a lysis

buffer made up of a 50 mm Tris – buffer solution (pH 7.6), with 1% SDS, 10 μg/mL

leupeptin and 0.01 nM phenylmethanesulfonylfluoride. Lysate was collected from the

plate with a cell scraper and homogenized by passing though a 20 gauge needle 3-4

times. Protein quantification of cell lystates was carried out using a BioRad Detergent

Compatible Microplate Assay. Equal amounts (30 ug) of protein were mixed with a 2X

solution of sample buffer (20% 0.5M Tris (pH 6.8), 20 % glycerol, 5% SDS, 0.005%

bromophenol blue), electrophoresed through a 10% SDS-polyacrylamide gel and

transferred overnight at 30 volts to a nitrocellulose membrane (BioRad). The membrane

was blocked in 0.5% T-TBS solution containing 5% non-fat milk for 1 hour and then

incubated overnight with antibodies directed against DDR1 (Santa-Cruz C-20) diluted

1:500 in TTBS containing 5% non-fat milk. The following day, the membrane was

incubated in horseradish peroxidase-conjugated antibodies directed against rabbit IgG

diluted 1:2000 for 1 hour and protein expression was detected using enhanced

chemiluminescence (Perkin-Elmer)

82

6.2.3 Results and Discussion

The results from one repeat of these experiments is shown in Figure 6.2.4.1

below. There were multiple bands present in the DDR1 immunoblots, with none of the

bands showing a good correlation with the expected 120 kDa weight of the DDR1

protein. In addition there were multiple bands present in the DDR1 knockout cell

lystates (DDR1 knockout status was confirmed by RT-PCR).

Multiple different lots of the C-20 antibody were tested, all with similar results.

We conclude that this antibody does not identify DDR1 expressed in mouse

macrophages.

83

6.2.4 Figure:

Figure 6.2.4.1 The C-20 Santa Cruz DDR1 antibody is not specific for DDR1

Lane A) Ddr1+/+

; Ldlr-/-

cell lysate showing multiple bands present in lane, with no 120 kb

band. Lane B) Ddr1-/-

; Ldlr-/-

cell lysate showing multiple bands present, demonstrating

that the antibody is not DDR1 specific.

A B

230 kb

130 kb

95 kb

72 kb

56 kb

36 kb

28 kb

the role of discoidin domain receptor 1 ( ddr1 ) on ... · the role of discoidin domain receptor 1...

Documents