Contents lists available at ScienceDirect

Stem Cell Research

journal homepage: www.elsevier.com/locate/scr

Generation of human induced pluripotent stem cell (iPSC) lines from threepatients with von Hippel-Lindau syndrome carrying distinct VHL genemutations

Jens Schuster⁎, Ambrin Fatima, Franziska Schwarz1, Joakim Klar, Loora Laan, Niklas Dahl⁎

Uppsala University, Department of Immunology, Genetics and Pathology and Science for Life Laboratory, Uppsala, Sweden

A B S T R A C T

Von Hippel-Lindau (VHL) syndrome is a familial cancer syndrome caused by mutations in the tumor suppressor gene VHL. We generated human iPSC lines fromprimary dermal fibroblasts of three VHL syndrome patients carrying distinct VHL germ line mutations (c.194C>G, c.194C>T and nt440delTCT, respectively).Characterization of the iPSC lines confirmed expression of pluripotency markers, trilineage differentiation potential and absence of exogenous vector expression. Thethree hiPSC lines were genetically stable and retained the VHL mutation of each donor. These iPSC lines, the first derived from VHL syndrome patients, offer a usefulresource to study disease pathophysiology and for anti-cancer drug development.

Resource table.

Unique stem cell linesidentifier

UUIGPi001-AUUIGPi002-AUUIGPi003-A

Alternative names of st-em cell lines

VHL2-10 (UUIGPi001-A)VHL3-9 (UUIGPi002-A)VHL4-10 (UUIGPi003-A)

Institution Uppsala UniversityContact information of

distributorJens Schuster, jens.schuster@igp.uu.seNiklas Dahl, niklas.dahl@igp.uu.se

Type of cell lines Human induced pluripotent stem cells (hiPSC)Origin HumanCell Source FibroblastsClonality ClonalMethod of reprogram-

mingSendai virus

Multiline rationale Same disease, non-isogenic cell linesGene modification YESType of modification HereditaryAssociated disease von Hippel-Lindau syndrome, OMIM #193300Gene/locus von Hippel-Lindau tumor suppressor (VHL); chr3p25.3Method of modification N/AName of transgene or r-

esistanceN/A

Inducible/constitutivesystem

N/A

Date archived/stock da-te

2015

Cell line repository/ba-nk

N/A

Ethical approval Obtained from Regional ethics committee, Uppsala,November 18, 2009. Registration number: 2009/319

Resource utility

Little is known about the molecular pathophysiology in VHL syn-drome (van Leeuwaarde et al., 2018). The iPSC lines presented hereinoffer a useful resource to study molecular mechanisms behind tumorprogression and for drug development to improve treatment of patientswith VHL syndrome.

Resource details

Von Hippel-Lindau (VHL) syndrome is characterized by variousmalignant and benign neoplasms mainly derived from the neural crestlineage (e.g. hemangioblastomas of the brain and spinal cord; renalcysts and clear cell renal carcinoma; pheochromocytoma, pancreaticcysts and neuroendocrine tumors; endolymphatic sac tumors) (vanLeeuwaarde et al., 2018). The syndrome is caused by mutations in thetumor suppressor gene VHL and approximately 80% of cases are fa-milial. The VHL protein is involved in the ubiquitination and de-gradation of hypoxia-inducible-factor (HIF) that regulates gene ex-pression by oxygen (Kaelin Jr., 2005). Detailed investigations ofmolecular mechanisms underlying disease pathophysiology and cancerprogression in VHL, with the aim to develop novel drugs, have beenhampered by lack of accessible human disease models. To this end, we

https://doi.org/10.1016/j.scr.2019.101474Received 29 April 2019; Received in revised form 11 May 2019; Accepted 28 May 2019

⁎ Corresponding authors.E-mail address: jens.schuster@igp.uu.se (J. Schuster).

1 current address: Helmholtz-Zentrum Dresden-Rossendorf (HZDR) Institute of Radiooncology - OncoRay, Dresden, Germany.

Stem Cell Research 38 (2019) 101474

Available online 30 May 20191873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

T

identified three unrelated patients diagnosed with VHL syndromecaused by distinct heterozygous VHL germ-line mutations [c.194C>G(p.Ser65Trp), c.194C>T (p.Ser65Leu) and nt440delTCT (p.del76Phe),respectively]. We generated human iPSC lines from primary fibroblastsof each patient (VHL2-10, VHL3-9 and VHL4-10) using the Sendai virusreprogramming system (Tables 1–3). The three hiPSC lines VHL2-10,VHL3-9 and VHL4-10 were expanded as monolayers in tight coloniesand showed typical iPSC morphology with large nucleus-to-cytoplasmratio, prominent nuclei and defined luminescent borders as seen byBright-field microscopy (Fig. 1A; size bar: 50 μm).

Endogenous expression of the pluripotency markers Nanog, Sox2,TRA-1-60 and SSEA4 was demonstrated at protein level by im-munocytochemistry and flow cytometry in the three hiPSC lines, re-spectively (Fig. 1C and B; size bar: 100 μm). Cell authentication using aset of 16 polymorphic short tandem repeats (STRs) confirmed that the

established iPSC lines matched the donor fibroblasts (data availableupon request). Additionally, the three VHL syndrome patient derivedhiPSC lines VHL2-10, VHL3-9 and VHL4-10 were confirmed free ofSendai reprogramming vector by RT/PCR (Fig. 1D).

Analysis of the three hiPSC lines using scorecards confirmed anexpression pattern of pluripotency markers corresponding to an un-differentiated state using a reference set of 23 pluripotent stem cell lines(Fig. 1E)(Fergus et al., 2016). In order to assess the differentiationpotential of the three hiPSC, an embryoid body (EB) differentiationassay was performed. The expression of specific markers for ectoderm,mesoderm and endoderm was carried out by scorecard analysis. Theanalysis confirmed that the hiPSC lines are capable of differentiatinginto the three germ layers (Fig. 1E).

Each of the hiPSC lines VHL2-10, VHL3-9 and VHL4-10 retained thepathogenic VHL gene variant (c.194C>G, c.194C>T and

Table 1Summary of lines.

iPSC line names Abbreviation in figures Gender Age (years) Ethnicity VHL Genotype Disease

VHL2-10 (UUIGPi001-A) VHL2-10 male 19 Caucasian c.194C>G; heterozygous von Hippel-Lindau syndromeVHL3-9 (UUIGPi002-A) VHL3-9 male 37 Caucasian c.194C>T; heterozygous von Hippel-Lindau syndromeVHL4-10 (UUIGPi003-A) VHL4-10 male 30 Caucasian nt440delTCT; heterozygous von Hippel-Lindau syndrome

Table 2Characterization and validation.

Classification Test Result Data

Morphology Photography All iPSC lines appear normal Fig. 1 panel APhenotype Qualitative analysis (Immunocytochemistry) All iPSC lines are positive for pluripotency markers Nanog and Sox2 Fig. 1 panel C

Qualitative analysis (scorecards) All lines are pluripotent and undifferentiated compared to a referenceset of 23 PSC lines

Fig. 1 panel F

Quantitative analysis (Flow Cytometry) All iPSC lines are positive for cell surface markers TRA-1-60(VHL2–10 99,3%; VHL3–9 89,5%; VHL4–10 91,4%) and SSEA4(VHL2–10 99,6%; VHL3–9 96,6%; VHL4–10 97,0%)

Fig. 1 panel B

Genotype CytoScan™HD array (resolution > 1Mb) No acquired genomic aberrations detected Supplementary File 1Identity STR analysis (AmpFLSTR™ Identifiler™ PCR

Amplification Kit)DNA profiling performed for 16 polymorphic STRs Fig. 1 panel DAll iPSC lines matched their corresponding donor fibroblast line

Mutation analysis (IFAPPLICABLE)

Sanger Sequencing iPSC lines retain the VHL mutation present in fibroblasts Fig. 1 panel GSouthern Blot OR WGS N/A

Microbiology and virology Mycoplasma testing by luminescence (MycoAlertMycoplasma Detection Kit, Lonza).

All iPSC lines are negative Supplementary File 2

Differentiation potential Embryoid body formation and differentiationfollowed by Scorecard analysis

Expression of all three germ layers detected after four weeks ofdifferentiation

Fig. 1 panel F

Donor screening (OPTIONAL) HIV 1+2 Hepatitis B, Hepatitis C N/AGenotype additional info

(OPTIONAL)Blood group genotyping N/AHLA tissue typing N/A

Table 3Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry

Antibody Dilution Company Cat # and RRID

Pluripotency Markers Mouse IgG anti-NANOG 1:200 Millipore Cat# MABD24, RRID:AB_11203826Pluripotency Markers Mouse IgG anti-SSEA4 1:100 Thermo Fisher Scientific Cat# 41-4000, RRID:AB_2533506Pluripotency Markers Mouse IgM anti-TRA-1-60 1:100 Thermo Fisher Scientific Cat# 41-1000, RRID:AB_2533494Pluripotency Markers Goat IgG anti-SOX2 1:500 R and D Systems Cat# AF2018, RRID:AB_355110Secondary Antibodies AF488 Goat anti-mouse IgM 1:1000 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069Secondary Antibodies AF555 Goat anti-mouse IgG 1:1000 Thermo Fisher Scientific Cat# A-21426, RRID:AB_2535847Secondary Antibodies AF647 donkey anti-mouse IgG 1:1000 Thermo Fisher Scientific Cat# A-31571, RRID:AB_162542Secondary Antibodies AF488 donkey anti-goat IgG 1:1000 Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102

Primers

Target Forward/Reverse primer (5′-3′)

SeV-F and SeV-R (RT/PCR) Sendai virus genome GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATCGAPDH-F and GAPDH-R (RT/PCR) Glyceraldehyde-3-phosphate dehydrogenase (pos control) TCCACCCATGGCAAATTCCA/AAATGAGCCCCAGCCTTCTC

J. Schuster, et al. Stem Cell Research 38 (2019) 101474

2

nt440delTCT, respectively) of the donor as confirmed by Sanger se-quencing (Fig. 1F). Genomic integrity was investigated by CytoS-can™HD DNA array and no acquired chromosomal aberration was de-tected in any of the three iPSC lines (Supplementary File 1) (Mills et al.,2011; Wong et al., 2007). All three iPSC lines tested free of Mycoplasmainfection using MycoAlert™ Mycoplasma detection kit.

The three different VHL syndrome patient derived iPSC lines gen-erated here will offer a useful resource to study disease pathology,cancer progression and for drug development.

Materials and methods

Culture conditions

Fibroblasts were cultured in DMEM, Sigma cat no: D5796, 10% fetalbovine serum, ThermoFisher Scientific, cat no: 10500056, 2mMGlutaMAX™, ThermoFisher Scientific, cat no: 35050038, 1% penicillin/streptomycin, ThermoFisher Scientific, cat no: 15140122 in a humidi-fied atmosphere with 5% CO2 at 37 °C and passaged using TrypLE™

NANOGDAPI

MergeSOX2

VHL2-10

NANOGDAPI

MergeSOX2

VHL3-9

NANOGDAPI

MergeSOX2

VHL4-10

VH

L2-1

0

-pos.

con

trol

VH

L4-1

0

VH

L3-9

M VH

L2-1

0

-pos.

con

trol

VH

L4-1

0

VH

L3-9

M

GAPDH SeV

Sample Name Self-renewal Ectoderm Mesoderm Endoderm

iPSC: VHL2-10 -0,59 0,01 -0,93 -0,86

EB: VHL2-10 -4,33 1,83 3,83 2,29

iPSC: VHL3-9 -0,12 0,44 -0,13 -1,03

EB: VHL3-9 -5,05 2,03 5,59 2,05

iPSC: VHL4-10 -0,98 0,52 -0,91 -0,98

EB: VHL4-10 -1,66 1,73 4,88 1,69

Upregulated Comparable Downregulated

x>1.5 1.0<x<=1.5 0.5<x<=1.0 -0.5<=x<=0.5 -1.0<=x<-0.5 -1.5<=x<-1.0 x<-1.5

Gene expression rela�ve to the reference standard

C

D

E

F[c.194C>G]VHL2-10

[c.194C>T]VHL3-9

[nt440delTTC]VHL4-10

A

B VHL2-1099,2%0,1%

0,2% 0,4%

VHL3-989,5%0,0%

3,6% 7,1%

VHL4-1091,3%0,1%

3,0% 5,7%

SSEA4

TRA

-1-6

0VHL4-10VHL2-10 VHL3-9

Fig. 1. Characterization of the three VHL patient derived iPSC lines.

J. Schuster, et al. Stem Cell Research 38 (2019) 101474

3

Express, ThermoFisher Scientific, cat no: 12604039, and DefinedTrypsin Inhibitor, ThermoFisher Scientific, cat no: R007100.

hiPS cells were cultured in Essential-8™ medium, ThermoFisherScientific, cat no: A1517001, on Vitronectin-XF™, Stem CellTechnologies, cat no: 07180, coated plates (5%CO2, 37 °C) and pas-saged with Gentle Cell Dissociation Reagent, Stem Cell Technologies,cat no: 07174. hiPSC lines were subsequently adapted to culture onhuman Laminin-521, Biolamina, Cat no: LN-521, and passaged usingTrypLE™ Expressand Defined Trypsin Inhibitor.

For embryonic body formation hiPSC were dissociated with accu-tase, Sigma cat no: A6964, seeded into an AggreWell™400 plate, StemCell Technologies, cat no: 34421, in AggreWell™ medium, Stem CellTechnologies, cat no: 05893, supplemented with 10 μM Rho-kinaseinhibitor Y27632, Stem Cell Technologies, cat no: 72304 according toprotocol. Formed embryoid bodies were transferred to non-adherentculture plates and further differentiated for four weeks.

Reprogramming

Fibroblasts were reprogrammed using CytoTune™-iPS 2.0 SendaiReprogramming Kit, ThermoFisher Scientific, cat no: A16517, expres-sing the four Yamanaka factors hKlf4, hc-Myc, hSox2, hOct3/4. hiPSCcolonies were manually picked for passage 1 to Vitronectin™-XL coateddishes and clonally expanded (see Culture conditions). EstablishedhiPSC lines were adapted to culture on LN-521 (see Culture Conditions)past passage P10.

Cell authentication

Cell authentication on DNA from fibroblasts and hiPSC lines wasperformed at Eurofins Genomics, Germany using AmpFLSTR™Identifiler™ PCR Amplification Kit, ThermoFisher Scientific, cat no:4322288.

Genome stability

Genome stability was analysed on DNA from the three hiPSC lines atUppsala University Hospital, Clinical Genetics unit, Uppsala, using theCytoScan™HD Array, ThermoFisher Scientific, cat no: 901835.

RT-PCR

RNA was isolated using miRNeasy micro kit, Qiagen, cat no:217084. cDNA was synthesized using High Capacity cDNA Synthesiskit, ThermoFisher Scientific, cat no: 4368814 from 1 μg of total RNA.

Detection of Sendai virus was performed by PCR on a “MyCycler”thermal cycler, BIORAD, by a total of 35 cycles (95 °C - 30 s, 55 °C -1min, 72 °C - 1min) with 1/10 of the cDNA reaction with primers SeV-F and SeV-R. GAPDH was used as positive control. Samples were runwithout template as negative control.

PCR products (expected sizes SeV: 195 bp (SeV), GAPDH: 325 bp)were visualized by 1% agarose gel electrophoresis. Ladder: GeneRuler100 bp DNA ladder, ThermoFisher Scientific, cat no: SM0243.

Immunofluorescence

Cells were fixed in 4% formaldehyde for 5min and pre-incubated in1xPBS, 1%BSA, 0,3% TritonX100. Primary antibodies (mouse anti-NANOG, rabbit anti-SOX2) were diluted in preincubation buffer andincubated at 4 °C overnight. Secondary antibodies (donkey anti-mouse

AF647, donkey anti-goat AF488) were incubated at room temperaturefor 60min. Nuclear marker, DAPI (1 μg/ml), Sigma cat no: D8417 wasincubated for 10min at room temperature and specimens weremounted onto microscope slides using CFM-3 mounting medium,Citifluor. Specimens were imaged using an AxioImager (Zeiss).

Flow cytometry

iPSCs were harvested with accutase, Sigma cat no: A6964 and wa-shed in 1%BSA/1xPBS. Primary antibodies (mouse-IgG anti-SSEA4,mouse-IgM anti TRA-1-60) were incubated at room temperature for30min. Secondary antibodies (goat anti-mouse IgM AF488, goat anti-mouse IgG AF555) were incubated for 20min at room temperature.Cells were analysed on a LSR-FORTESSA (BD).

Scorecard assay

RNA was extracted (see RT-PCR) and quality was assessed byAgilent BioAnalyzer. Samples were run on TaqMan® hPSC Scorecard™Panel, ThermoFisher Scientific, cat no: A15872/A15870 followingmanufacturer's protocol (Fergus et al., 2016). Scorecards were analysedwith company's software at https://apps.thermofisher.com/hPSCscorecard/home.htm.

Mycoplasma

Presence of mycoplasma in hiPSC lines was assessed on cell culturesupernatants using MycoAlert™ Mycoplasma Detection kit, Lonza, catno: LT07-318.

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2019.101474.

Acknowledgements

We thank the study participants. This work was supported by theSwedish Research Council 2015-02424 (to ND), Hjärnfonden FO2018-0100 (to ND) and the Sävstaholm Society (to LL). Image acquisition andflow cytometry were performed at the BioVis Platform and scorecardprocessing at the Genome Centre platform, Science for Life Laboratory,Uppsala University.

References

Fergus, J., Quintanilla, R., Lakshmipathy, U., 2016. Characterizing pluripotent stem cellsusing the TaqMan(R) hPSC scorecard(TM) panel. Methods Mol. Biol. 1307, 25–37.

Kaelin Jr., W.G., 2005. The von Hippel-Lindau protein, HIF hydroxylation, and oxygensensing. Biochem. Biophys. Res. Commun. 338, 627–638.

Mills, R.E., Walter, K., Stewart, C., Handsaker, R.E., Chen, K., Alkan, C., Abyzov, A., Yoon,S.C., Ye, K., Cheetham, R.K., Chinwalla, A., Conrad, D.F., Fu, Y., Grubert, F.,Hajirasouliha, I., Hormozdiari, F., Iakoucheva, L.M., Iqbal, Z., Kang, S., Kidd, J.M.,Konkel, M.K., Korn, J., Khurana, E., Kural, D., Lam, H.Y., Leng, J., Li, R., Li, Y., Lin,C.Y., Luo, R., Mu, X.J., Nemesh, J., Peckham, H.E., Rausch, T., Scally, A., Shi, X.,Stromberg, M.P., Stutz, A.M., Urban, A.E., Walker, J.A., Wu, J., Zhang, Y., Zhang,Z.D., Batzer, M.A., Ding, L., Marth, G.T., McVean, G., Sebat, J., Snyder, M., Wang, J.,Eichler, E.E., Gerstein, M.B., Hurles, M.E., Lee, C., McCarroll, S.A., Korbel, J.O., 2011.Mapping copy number variation by population-scale genome sequencing. Nature470, 59–65.

van Leeuwaarde, R.S., Ahmad, S., Links, T.P., Giles, R.H., May 17, 2000. Von Hippel-Lindau Syndrome. In: Adam, M.P., Ardinger, H.H., Pagon, R.A. (Eds.), GeneReviews.University of Washington, Seattle (WA) (updated 2018 Sep 6).

Wong, K.K., deLeeuw, R.J., Dosanjh, N.S., Kimm, L.R., Cheng, Z., Horsman, D.E.,MacAulay, C., Ng, R.T., Brown, C.J., Eichler, E.E., Lam, W.L., 2007. A comprehensiveanalysis of common copy-number variations in the human genome. Am. J. Hum.Genet. 80, 91–104.

J. Schuster, et al. Stem Cell Research 38 (2019) 101474

4