softag protein expression purification system - biocat gmbh · softag™ protein expression &...

Softag™ Protein Expression

& Purification System

IMPORTANT! -80°C, -20°C, and 4°C Storage Required

Immediately Upon Receipt

Lucigen® Corporation Advanced Products for Molecular Biology

2120 W. Greenview Drive Middleton, WI 53562 Toll Free (888) 575-9695 Phone (608) 831-9011 FAX (608) 831-9012 Email [email protected] www.lucigen.com

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE MA035 v 1.1

Softag™ Protein Expression and Purification System

Technical Support

Lucigen is dedicated to the success and satisfaction of our customers. Our products are tested to assure they perform as specified when used according to our recommendations. It is imperative that the reagents supplied by the user, especially the DNA targets to be cloned, are of the highest quality. Please follow the manual carefully or contact our technical service representatives for information on preparation and testing of the target DNA. We encourage you to contact us with your comments regarding the performance of our products in your applications. Thank you. Notice of Limited Label License, Copyright, Patents, Warranties, Disclaimers and Trademarks

Copyright© 2007 by Lucigen Corp. All rights reserved. pSMARTac 3N, UltraClone, CloneDirect, pcrSMART, pEZ, pEZSeq, cSMART, PCR-SMART, GC Cloning, pGC, EconoTaq, and Replicator are trademarks of Lucigen Corp. Lucigen, CloneSmart, ClonePlex, DNATerminator, E. cloni, PCRTerminator, CopyRight, NanoClone, and pSMART are registered trademarks of Lucigen Corp.. Protran is a registered trademark of Schleicher & Schuell. Softag is a trademark of NeoClone Biotechnology Corp., PowerPac is a trademark of Bio-Rad Laboratories, and SureLock is a trademark of Invitrogen.

Lucigen’s products are sold for research use only and are not to be used in humans or for medical diagnostics. Lucigen’s liability with respect to any CloneSmart product is limited to the replacement of the product. No other warranties of any kind, expressed or implied, including without limitation, any implied fitness for any particular use, are provided by Lucigen. Lucigen is not liable for any direct, indirect, incidental or consequential damages arising out of or in connection with the use or inability to use any of its CloneSmart products.

Limited Label License

This product is the subject of U.S. Patent #6,709,861 and pending patent applications owned by Lucigen Corporation, and U.S. Patent Reference Number 60/577944, assigned to NeoClone Biotechnology Corp. and exclusively licensed to Lucigen Corp. The consideration paid for this product grants a Limited License to use the product pursuant to the terms set forth in this Limited Label License. Academic, Not-for-Profit and For-Profit institutions acquire certain limited nontransferable rights with the purchase of this product (see below). The purchase price of this product includes limited, nontransferable rights to use only the purchased amount of the product to perform CloneSmart Blunt Cloning Technology and only as described in CloneSmart Blunt Cloning Kit Instruction Manual. This limited license specifically excludes manufacture of the pSMARTac 3N vector or derivatives thereof. Lucigen Corporation reserves all other rights; in particular, the purchaser of this product may not transfer or otherwise sell this product or its components or derivatives to a third party, and no rights are conveyed to the purchaser to use the product or its components or derivatives for commercial purposes. “Commercial purposes” includes any activity for which a party receives consideration and may include, but is not limited to, (1) use of the product or its components or derivatives in manufacturing, (2) use of the product or its components or derivatives for diagnostic purposes, (3) transfer or sale of vectors made with the product or components or derivatives of the product, (4) use of this product or materials made therefrom to provide a service, information, or data (e.g., DNA sequence) to a third party in return for a fee or other consideration, or (5) resale of the product or its components or derivatives, whether or not such product or its components or derivatives are resold for use in research. Academic, Not-for-Profit, and For-Profit institutions must obtain a separate license from Lucigen Corporation to use this product for any purpose other than those permitted above. It is the sole responsibility of the buyer to ensure that use of the product does not infringe that patent rights of third parties.

If the purchaser is not willing to accept these use limitations, Lucigen Corporation is willing to accept return of the product for a full refund. For information on obtaining a license, contact Lucigen Corporation, 2120 W. Greenview Dr., Middleton, WI 53562. Email: [email protected]. Phone: 608-831-9011. Fax 608-831-9012.

Lucigen® Corporation 2 (888) 575-9695 MA035 v 1.1 www.lucigen.com

Softag™ Protein Expression and Purification System Table of Contents

System Designations .......................................................................................................................... 4

Components & Storage Conditions ..................................................................................................... 4

System Description ............................................................................................................................. 5

pSMARTac™ 3N Vector....................................................................................................................... 6

E. cloni® 10GF´ Electrocompetent or Chemically Competent Cells..................................................... 6

Cloning Strategies............................................................................................................................... 7

Positive Control Insert ......................................................................................................................... 7

Phosphorylation of PCR Primers......................................................................................................... 8

Purification and Size Fractionation of DNA ......................................................................................... 8

Sensitivity of DNA to Short Wavelength UV Light ............................................................................... 8

Colony Screening................................................................................................................................ 9

Softag Protein Purification................................................................................................................... 9

Materials and Equipment Needed ....................................................................................................... 9

Detailed Protocol................................................................................................................................. 9

Preparation and Purification of Insert DNA.......................................................................................... 9

Ligation to the pSMARTac 3N Vector ............................................................................................... 11

Preparation for Transformation ......................................................................................................... 11

Electroporation of E. cloni 10GF´ Electrocompetent Cells................................................................. 12

Heat Shock Transformation of E. cloni 10GF´ Electrocompetent Cells ............................................. 13

Growing and Screening Recombinants............................................................................................. 14

DNA Isolation & Sequencing ............................................................................................................. 14

Induction of Target Protein ................................................................................................................ 14

PAGE Analysis/Western Blot Analysis .............................................................................................. 14

Softag Affinity Protein Purification ..................................................................................................... 16

References........................................................................................................................................ 17

Appendix A: Media Recipes .............................................................................................................. 17

Appendix B: Vector Map and Sequencing Primers ........................................................................... 18

Appendix C: Creating Blunt-NotI Fragments by PCR........................................................................ 19

Appendix D: Cloning Troubleshooting Guide .................................................................................... 20

Appendix E: Expression/Purification Troubleshooting Guide ............................................................ 21

Appendix F: Sequence of pSMARTac 3N ......................................................................................... 22

Appendix G: Technical Data: Softag3 Antibody and Affinity Resin.................................................... 23

Appendix H: Western Blot Protocol ................................................................................................... 24



System Designations The Softag Protein Expression and Purification System contains three kits that have been optimized to work together: the Softag Expression Cloning Kit, E. cloni 10GF´ Competent Cells, and the Softag3 Protein Purification kit. The Softag3 Protein Purification kit Softag antibody, and E. cloni Competent Cells are also sold separately. The catalog numbers are listed below.

Catalog Numbers of Softag Protein Expression and Purification Kits and Cell Combinations

Reactions Kit with 10GF´

Electrocompetent Cells

Kit with 10GF´ Chemically Competent

Cells 5 49801-1 49803-1 Softag Protein Expression &

Purification System 10 49801-2 49803-2

Catalog Numbers of Stand-Alone Softag Reagents Reactions Catalog Numbers

5 50001-1 Softag3 Protein Purification Kit 10 50001-2

50 μg 50012-1 200 μg 50012-2 Softag3 Antibody

1 mg 50012-3 E. cloni 10GF´ ELITE Electrocompetent Cells 12

24 60061-1 60061-2

E. cloni 10GF´ Chemically Competent Cells 12 24

60062-1 60062-2

Components & Storage Conditions The Softag Expression Cloning Kit (Container 1) includes the pSMARTac™ 3N Expression Vector and cloning components, a Positive Control Insert encoding a Red Fluorescence Inducing Protein (RFIP), Sequencing Primers, and Softag3 Antibody. This container should be stored at -20oC. The E. cloni 10GF´ Competent Cells (Container 2) includes E. cloni® 10GF´ Electrocompetent or Chemically Competent Cells, which must be stored at -80oC. The Softag3 Protein Purification Kit (Container 3) includes the Softag purification components, which should be stored at 4oC. Container 1: Expression Cloning Kit Store at -20°C 5 Reactions 10 Reactions 4X pSMARTac 3N Vector Premix

Includes Buffer, ATP, and pSMARTac 3N blunt/NotI cut (25 ng/μl)

12.5 μl

25 μl

CloneSmart® DNA Ligase (2 U/μl) 12 μl 24 μl Positive Control Insert DNA Blunt/NotI cut 5 μl 5 μl T4 Polynucleotide Kinase (10 U/μl) 20 μl 20 μl 10X T4 Polynucleotide Kinase Buffer (containing ATP) 20 μl 20 μl Sequencing Primers (200 reactions each) TacSeq F Primer (3.2 pmol/μl) TacSeq R Primer (3.2 pmol/μl)

200 μl 200 μl

200 μl 200 μl

Softag3 Antibody * 50 μg 50 μg



Container 2: E. cloni 10GF´ Competent Cells Store at -80°C 5 Reactions 10 Reactions

E. cloni 10GF´ ELITE Electrocompetent Cells or

E. cloni 10GF´ Chemically Competent Cells

12 (6 x 50 μl)

12 (6 x 80 μl)

24 (12 x 50 μl)

24 (12 x 80 μl) Transformation Control pUC19 DNA (1 ng/μl) Store at -20°C or -80°C.

5 μl 5 μl

Recovery Medium Store at -20°C or -80°C.

12 (1 x 12 ml) 24 ( 2 x 12 ml)

Container 3: Softag3 Protein Purification Kit Store at 4°C 5 Purifications 10 Purifications

Softag3 Agarose Resin * 1 ml 2 x 1 ml

Softag 10X Wash Buffer (15 ml) 1 x 15 ml 2 x 15 ml

Softag Elution Buffer (50 ml) 1 x 50 ml 2 x 50 ml

Polypropylene Column (For bed volumes up to 5 ml) 1 Column 2 Columns

* Manufactured for Lucigen by NeoClone Biotechnology

System Description The Softag Protein Expression and Purification System provides a simple, user-friendly method for efficient cloning, expression, and purification of proteins with a single column run (Figure 1). Open reading frames are directionally cloned into the pSMARTac™ 3N vector, behind the tac promoter and in frame with the amino-terminal Softag3 affinity peptide (Figure 2). The vector comes pre-processed with dephosphorylated blunt plus NotI ends, allowing same-day PCR amplification, ligation, and transformation. The E. cloni 10GF´ Competent Cells encode the lacIq repressor, which inhibits the Ptac promoter until expression is induced by addition of IPTG. The 8-residue Softag3 peptide provides fast and easy affinity purification of biologically active proteins and protein complexes to > 95% purity (1, 2). N C 5’ Gene Coding for Target Protein 3’

PCR Amplify Clone into pSMARTac 3N vector

Express Fusion Protein with Affinity Tag

Purification by Affinity Chromatography

Affinity Wash and Elute Column

Target Protein Figure 1. The Softag protein expression and purification process. N and C, amino and carboxy terminus of the recombinant protein, respectively; RBS, ribosome binding site; ATG, translation initiation site; Softag, 8 amino acid affinity peptide.

Purified Protein



Figure 2. pSMARTac 3N™ 3N expression vector with Softag affinity sequence. RBS, ribosome binding site; ATG, translation start site; Stop, translation end site; Kan, kanamycin gene; ROP, Repressor of Priming (for low copy number); Ori, origin of replication. CloneSmart® transcription terminators (T) prevent transcription into or out of insert. The 8-residue Softag3 affinity tag is at the amino terminus of the expressed protein.

pSMARTac 3N Vector

The pSMARTac 3N Vector is supplied pre-digested and dephosphorylated at blunt plus NotI sites for directional cloning of inserts (Figures 2 and 3). The pSMARTac 3N vector does not contain the lacZ alpha gene fragment, so it does not provide the blue/white colony screen. However, the background of empty vector is typically <5%, so no colony screening is necessary. Fragments with phosphorylated blunt plus NotI ends are ligated to the pSMARTac 3N vector, transformed into competent E. cloni® 10GF´ cells, and spread on plates containing kanamycin (30 µg/ml). IPTG should not be added to the plates, as early induction of gene expression may select against recombinant colonies. With the control insert, encoding the Red Fluorescence Inducing Protein (RFIP), ~80% of the clones will express the recombinant protein. The copy number of the pSMARTac 3N vector is similar to that of pBR322 plasmids (~20 copies/cell), yielding 0.5–1.0 µg of plasmid DNA per ml of culture.

E. cloni ® 10GF´ Electrocompetent and Chemically Competent Cells

E. cloni 10GF´ cells are an E. coli strain optimized for high efficiency transformation. The 10GF´ cells are ideal for cloning and propagation of BAC, cosmid, or plasmid clones. They give high yield and high quality plasmid DNA due to the endA1 mutation. E. cloni 10GF� cells harbor the F� plasmid, which confers tetracycline resistance and allows the cells to be infected with M13 for ssDNA production. The F´ plasmid also carries the lacIq repressor allele; therefore, IPTG is required to induce expression from the tac promoter. DNA inserted into the cloning site of pSMARTac 3N will be transcribed at high levels in the presence of IPTG; therefore plates used for screening recombinants should not contain IPTG to avoid any deleterious effects of expression.

E. cloni 10GF΄ Genotype: [F׳ proA+B+ lacIqZΔM15::Tn10 (TetR)] / mcrA Δ(mrr-hsdRMS-mcrBC) endA1 recA1 φ80dlacZΔM15 ΔlacX74 araD139 Δ(ara,leu)7697 galU galK rpsL nupG λ− tonA

E. cloni 10GF´ ELITE Electrocompetent Cells produce > 2 x 1010 cfu/µg supercoiled pUC19 DNA.

E. cloni 10GF´ Chemically Competent Cells produce ≥ 5 x 108 cfu/µg supercoiled pUC19 DNA.

As a control for transformation, E. cloni Competent Cells are provided with supercoiled pUC19 DNA at a concentration of 1 ng/μl. For transformation, dilute the plasmid 1:100 in dH2O to a final concentration of 10 pg/μl. Grow pUC19 transformants on plates containing ampicillin (100 µg/ml).



Cloning Strategies The pSMARTac™ 3N vector preparation provides a simple, universal strategy for precise fusion of a desired protein coding sequence immediately after the Softag peptide sequence. The vector is pre-digested with a blunt end immediately following the Softag sequence and a NotI end at the opposite end of the vector (Figure 3). The desired coding sequence must be constructed with a blunt, phosphorylated 5´ end and a NotI site at the 3´ end.

Several methods can be used to create the blunt site at the 5´ end of the gene. For example, 1) PCR can be performed with a Proofreading DNA polymerase and 5´ phosphorylated primers; 2) a PCR fragment can be created with a Non-proofreading polymerase (e.g., Taq, Tfl) followed by end-repair; or 3) a site for a blunt-cutting restriction enzyme can be incorporated at this end. These strategies are discussed in the Detailed Protocol.

VECTOR Start Codon Softag Affinity Peptide (blunt) M V T Q D P S R V G ...ATG GTG ACT CAG GAC CCG TCT CGT GTT GGT ...TAC CAC TGA GTC CTG GGC AGA GCA CAA CCA

INSERT First Stop Codon GENE Codon (NotI) GGA AAA.........TGA GC CCT TTT.........ACT CGCCGG

VECTOR (NotI) GGCCGCAAGACGCAT... CGTTCTGCGTA...

5´ [PO4]

CGCCGGCG

5´

Figure 3. Insertion of an insert into the pSMARTac 3N vector for expression.

Alternately, a simple PCR strategy can be used to create a NotI overhang (5´-GGCC) without restriction digestion (Appendix C). PCR can also be used to add a sequence-specific protein cleavage site to the amino terminus of the amplified gene. For example, the enterokinase protease recognizes a five amino acid sequence, Asp-Asp-Asp-Asp-Lys, cleaving just after the Lys residue. The 15 nucleotides encoding the enterokinase site can be added to the forward PCR primer. Digestion of the purified recombinant protein by enterokinase will remove the Softag as well as the enterokinase recognition site.



Positive Control Insert

The Positive Control Insert included with the Kit has blunt plus NotI ends and encodes RFIP. It therefore serves as a control for ligation efficiency, expression, and Softag affinity purification. The RFIP gene product is uroporphyrinogen III methyltransferase, a relative of the cobA or cysG gene. When expressed in E. coli, this enzyme leads to intracellular accumulation of red fluorescent porphyrinoid compounds. After colonies have grown to ~1 mm in diameter, the red fluorescence is readily detected using long or short wavelength UV light. Cultures grown overnight in LB broth will show a red color even in visible light. The RFIP gene product has the affinity tag, so it can be purified with the Softag reagents. The protein migrates at ~30 kD on SDS PAGE. Note that RFIP itself is not fluorescent, only its products are; therefore purified RFIP cannot be detected by UV illumination.

Phosphorylation of PCR Primers

The most efficient way to clone PCR products is to perform the amplification with a proofreading polymerase (e.g., Vent™ or Pfu DNA polymerase) using phosphorylated primers. Primers can be synthesized with 5’ phosphates, or they can be phosphorylated with T4 polynucleotide kinase (PNK). The protocol to kinase primers is supplied below, and the necessary reagents are provided in this Kit.

Purification and Size Fractionation of DNA DNA must be purified before ligation to the pSMARTac™ 3N Vector. Size selection on an agarose gel is highly recommended to remove contaminating DNA, truncated or aberrant PCR products, PCR primers, and DNA modifying enzymes. If end-repaired DNA is not fractionated by electrophoresis after repair or digestion, it must be purified by phenol/chloroform extraction or binding to a DNA purification column to remove the repair enzymes. However, aberrant PCR products will remain after column purification.

Sensitivity of DNA to Short Wavelength UV Light DNA resolved on agarose gels is generally stained with ethidium bromide and visualized by illumination with ultraviolet light. Exposure to short wavelength ultraviolet light (e.g., 254, 302, or 312 nm) can reduce cloning efficiencies by several orders of magnitude (Figure 4). Note that the wavelength of most UV transilluminators, even those designated specifically for DNA visualization, is typically 302 nm or 312 nm, and can cause significant damage to DNA.

Use a long wavelength (e.g., 360 nm) low intensity UV lamp and short exposure times when isolating DNA fragments from agarose gels.

No UV 30s 302nm 60s 302nm 120s 302nm 120s 360nm

100%

10%

1%

0.1%

0.01%

0.001%

Figure 4. Relative cloning efficiency of pUC19 after exposure to short or long wavelength UV light. Intact pUC19 DNA was transformed after no UV exposure (“No UV”) or exposure to 302 nm UV light for



30, 60, or 90 seconds (“30s 302nm, 60s 302nm,120s 302nm”) or to 360 nm UV light for 120 seconds (“120s 360nm”). Cloning efficiencies were calculated relative to un-irradiated pUC19 DNA.

Colony Screening The pSMARTac 3N vector is typically <1%, so screening is not necessary. Size analysis of uncut plasmid, restriction digestion, or PCR may be used to verify the presence of inserts. We strongly recommend sequence analysis of the insert to confirm the correct junction with the vector as well as the predicted coding sequence.

Protein Expression After identifying the proper recombinant clone, cultures are grown and protein expression is induced by addition of IPTG. Expression of Softag fusion proteins can be confirmed by using the Softag3 antibody to probe Western blots of crude cell lysates.

Softag Protein Purification The Softag fusion protein is purified by binding to the Softag3 affinity resin. The resin is poured into a column and washed, and the cell lysate is passed over it. Unbound proteins are removed by washing, and the Softag fusion protein is eluted with the supplied Elution Buffer.

Materials and Equipment Needed

The Softag Protein Expression & Purification Kit supplies many of the items needed to efficiently generate recombinant clones. While simple and convenient, successful use of the Kit requires proper planning for each step. Please read the entire manual and prepare the necessary equipment and materials before starting. It is assumed that common molecular biology equipment, supplies, and reagents are readily available. The following items are required for this protocol:

• Microcentrifuge and tubes. • If using E. Cloni 10GF´ Electrocompetent Cells: Electroporation apparatus and 0.1-cm cuvettes

(See Detailed Protocol for recommended manufacturers). or

If using E. Cloni 10GF´ Chemically Competent Cells: Water bath at 42°C. • Sterile 17 x 100 mm culture tubes. • LB Broth or YS Broth. • TY agar plates containing kanamycin (see Appendix for recipes). • Sonicator or cell lysis reagents.

Detailed Protocol

Preparation and Purification of Insert DNA

To achieve successful expression of a gene in the pSMARTac 3N vector, the 5´ end of the inserted fragment must be blunt and phosphorylated, and it must begin with the codon immediately following the ATG start codon. The 3’ end of the fragment must contain an overhang that is compatible with a NotI end (Figure 3). PCR amplification is the most convenient way to create these types of ends.

The forward primer must begin with the second codon of the gene, and the reverse primer must contain a NotI restriction site plus the stop codon of the gene (Figure 3). The reverse primer also needs approximately 8 additional “spacer” bases downstream of the NotI site for efficient restriction digestion. An alternate method of generating a NotI-compatible end by PCR is shown in Appendix C.



Creating a Blunt, Phosphorylated 5´ Terminus

There are two very useful PCR protocols to generate a blunt, phosphorylated end at the 5´ terminus of the fragment: 1) PCR with a Proofreading polymerase and 5´-phosphorylated primers; 2) PCR with non-phosphorylated primers followed by end-repair. These methods are described in more detail below

1) Proofreading PCR with Phosphorylated Primers

This strategy takes advantage of the Proofreading polymerases (e.g., Vent, Pfu), which leave blunt ends on PCR products. However, the ends are NOT phosphorylated, so the PCR is performed with phosphorylated primers. Most suppliers of oligonucleotides (e.g., Operon, IDT Technologies, etc.) can add 5´ phosphates to primers during chemical synthesis. These primers can be used directly for PCR.

Alternatively, 5´ phosphates can be added to standard non-phosphorylated primers by brief treatment with T4 polynucleotide kinase (T4 PNK). T4 PNK and T4 PNK Buffer (containing ATP) are included in the Softag Protein Expression and Purification Kit for this purpose. Perform the primer kinase reaction as follows:

Primer kinase reaction

4 μl Forward primer @ 100 pmol/μl 4 μl Reverse primer @ 100 pmol/μl 1 μl 10 X T4 PNK buffer mix 1 μl T4 PNK

10 μl total 37°C, 15 minutes

After the incubation, add 1-5 μl of this reaction directly to 50-100 µl of PCR mix and amplify according to standard protocols.

Size selection on an agarose gel is highly recommended to remove contaminating DNA, truncated or aberrant PCR products, and PCR primers. If the DNA is not gel fractionated, it can be purified using a commercial purification kit, although this method allows cloning of aberrant PCR products. The DNA should be eluted or dissolved in water.

2) Non-proofreading PCR

Alternately, the PCR may be performed with non-phosphorylated primers and the product can be subsequently end-repaired to generate a blunt phosphorylated fragment. Products created by a Proofreading polymerase will be blunt, so they will only need to be phosphorylated with T4 PNK. Use 1 μl of T4 PNK to phosphorylate up to 200 pmol of product.

Products created with a Non-proofreading polymerase will have a single 3´-A extension; these fragments must be made blunt AND phosphorylated. Lucigen’s PCRTerminator™ Kit can be used to properly end-repair such fragments. Other means of end-repair include treatment with a Non-Proofreading polymerase, T4 DNA polymerase, or Klenow fragment, followed by phosphorylation with T4 PNK (Ref. 3).

T4 PNK and end-repair enzymes must be removed from the PCR product before ligation to the pSMARTac 3N vector. Size selection on an agarose gel is highly recommended to remove these enzymes, as well as contaminating DNA, truncated or aberrant PCR products, and PCR primers. If the DNA is not gel fractionated, it can be purified using a commercial purification kit, although this method allows cloning of aberrant PCR products. The DNA should be eluted or dissolved in water.


Softag™ Protein Expression and Purification System After creating the blunt site on the 5´ end of the fragment, use NotI digestion to create the necessary 3´ terminus (below).

Creating a NotI Overhang at the 3´ Terminus

The 3´ end of the insert DNA must have a restriction site compatible with the NotI-digested end of the pSMARTac 3N vector. A NotI cleavage site (GCGGCCGC) can be easily incorporated into the reverse PCR primer. In addition, it is critical to add at least 8 additional bases downstream of the NotI site, because the NotI restriction enzyme does efficiently cleave a recognition site at the immediate end of the DNA.

If the desired gene has an internal NotI site, it is possible to created an extension on the PCR product that will be compatible with the vector’s NotI digest (see Appendix C).

CAUTION: It is essential to perform the NotI digest after end-repair of the 5´ end, because the end-repair reaction will fill in the NotI-digested site, leaving a blunt end. The end created by NotI digestion will contain a 5´ phosphate, so treatment with T4 PNK is not necessary.

Purification of Repaired Fragments

For best results, all PCR fragments should be gel isolated at some point in during their preparation for cloning. During gel fractionation, use of a short-wavelength UV light box (e.g., 254, 302, or 312 nm) must be avoided. Note that most UV transilluminators, including those sold for DNA visualization, use shortwave UV light. A hand-held lamp with a wavelength of 360 nm is very strongly recommended. After electrophoresis, DNA may be isolated using your method of choice.

Ligation to the pSMARTac™ 3N Vector

In the pSMARTac 3N ligation reaction, the pre-processed pSMARTac 3N Vector is ligated with an insert containing a blunt 5´ end and a NotI overhang at the 3´ end. Both ends of the insert must contain a 5´phosphate group. We recommend using 50-100 ng of DNA in the size range of 1,000 to 4,000 bp.. The ligation is performed as follows:

1. Briefly centrifuge the pSMARTac 3N Vector Premix before use. Mix by gently pipeting up and down several times.

2. Combine the following components in a 1.5-ml tube, adding the ligase last: x μl Insert DNA (50-100 ng blunt plus NotI ends, 5’-phosphorylated) y μl H2O 2.5 μl 4X pSMARTac 3N Vector Premix (pSMARTac 3N, ATP, buffer) 1.0 μl CloneSmart® DNA Ligase (2 U/μl) 10.0 μl total reaction volume

3. Mix by gently pipeting the reaction mixture up and down. Incubate at room temperature (21-25°C) for 30 minutes-2 hours. Essential: After ligation, heat denature 15 minutes at 70°C.

Optional Control Reactions include the following:

Positive Control Insert DNA To determine the ligation and transformation efficiency with a known insert, use 1 μl (80 ng) of RFIP DNA.

Vector Background

To determine the background of empty vector, use water instead of insert in the above reaction.

Preparation for Transformation 1. Heat denature the ligation reaction at 70°C for 15 minutes if you have not done so already.



2. Cool to room temperature for 15 seconds followed by 0-4°C for 15 seconds to condense water vapor inside the tube.

3. Spin 1 minute at 12,000 rpm to collect condensation and pellet any precipitated material.

4. The DNA in the soluble phase is ready for transformation; precipitating or purifying the DNA is not necessary.

To ensure optimal cloning results, we strongly recommend the use of Lucigen’s E. cloni ® 10GF´ Electrocompetent Cells. These cells yield > 2 X 1010 cfu/µg of pUC19 to maximize the number of transformants. If you do not possess an electroporator, we recommend the use of Lucigen’s 10GF´ Chemically Competent Cells. These cells yield ≥ 5 X 108 cfu/μg of pUC19. The following protocols are provided for transformation of E. cloni 10GF´ Competent Cells.

Electroporation of E. cloni ® 10GF´ Electrocompetent Cells E. cloni 10GF� ELITE Electrocompetent Cells are provided in 50µl aliquots (DUOs), sufficient for two transformations of 25 μl each.

Transformation is carried out in a 0.1 cm gap cuvette. Optimal settings for electroporation are listed in the table below. Typical time constants are 4.0 to 5.0 msec.

Optimal Setting Alternate Settings

(~ 20-50% lower efficiencies) 1.0 mm cuvette 10 μF 600 Ohms 1800 Volts

1.0 mm cuvette 25 μF 200 Ohms 1400 – 2000 Volts

Suggested Electroporation Systems: Bio-Rad Micro Pulser #165-2100; Bio-Rad E. coli Pulser #165-2102; Bio-Rad Gene Pulser II #165-2105; BTX ECM630 Electroporation System; Eppendorf Model 2510.

Optional transformation control reactions include electroporation with 10 pg of supercoiled pUC19 DNA (1 μl of a 1:100 dilution of the provided stock solution of Control pUC19 DNA).

To ensure successful transformation results, the following precautions must be taken:

• ESSENTIAL: After ligation, the reaction must be heat inactivated at 70°C for 15 minutes!

• Microcentrifuge tubes and electroporation cuvettes must be thoroughly pre-chilled on ice before use. Successful results are obtained with cuvettes from Eppendorf (Model 4307-000-569), BTX (Model 610), or BioRad (Cat. #165-2089). Users have reported difficulties using E. cloni cells with Invitrogen cuvettes (Cat. # 65-0030).

• The cells must be completely thawed on ice before use.

Transformation Protocol for Electrocompetent cells

1. Have Recovery Medium and 17 mm x 100 mm sterile culture tubes readily available at room temperature (one tube for each transformation reaction). Transformation efficiency may decrease with the use SOC or other media.

2. Place electroporation cuvettes (0.1 cm gap) and microcentrifuge tubes on ice (one cuvette and one tube for each transformation reaction).

3. Remove E. cloni cells from the -80°C freezer and place on wet ice until they thaw completely (10-15 minutes).



4. When cells are thawed, mix them by tapping gently. Add 25 μl of E. cloni cells to the chilled microcentrifuge tube on ice.

5. Add 1 μl of the heat-denatured ligation reaction to the 25 μl of cells on ice. Failure to heat-inactivate the ligation reaction will prevent transformation. Stir briefly with pipet tip; do not pipet up and down to mix, which can introduce air bubbles and warm the cells. Use of more than 2 μl of ligation mix may cause electrical arcing during electroporation.

6. Carefully pipet 25 μl of the cell/DNA mixture into a chilled electroporation cuvette without introducing bubbles. Quickly flick the cuvette downward with your wrist to deposit the cells across the bottom of the well. Electroporate according to the conditions recommended above.

7. Within 10 seconds of the pulse, add 975 μl of Recovery Medium to the cuvette and pipet up and down three times to resuspend the cells. Transfer the cells and Recovery Medium to a culture tube.

8. Place the tube in a shaking incubator at 250 rpm for 1 hour at 37°C.

9. Spread up to 1-100 μl of transformed cells on YT agar plates containing 30 μg/ml kanamycin.

10. Incubate the plates overnight at 37°C.

11. Transformed clones can be further grown in TB or in any other rich culture medium.

EXPECTED RESULTS USING E. cloni 10GF´ ELECTROCOMPETENT CELLS

Reaction Plate μl/Plate CFU/Plate Efficiency Experimental Insert (100 ng per ligation) 5, 20, & 100 variable NA pSMARTac™ 3N plus 80 ng blunt plus NotI RFIP Insert 5 > 500 > 99% inserts No-Insert Control (Vector Background) 50 < 25 <1% background Control pUC19 DNA (1 µl at 1:100 dilution) (10 pg, AmpR) 2 > 200 > 2 x 1010 cfu/μg

The results presented above are expected when cloning 80 ng of intact, purified RFIP DNA (Positive Control DNA), which contains phosphorylated blunt plus NotI ends, into Lucigen’s E. cloni 10GF´ ELITE Electrocompetent Cells (transformation efficiency > 2 x 1010 cfu/μg pUC19 DNA).The number of recombinant clones is typically 100-fold greater than the background of colonies from self-ligated pSMARTac 3N vector. The background number of empty pSMARTac 3N vector is constant (< 2 total colonies per 50 μl of cells plated), unless kinase or nuclease is introduced as a contaminant. However, use of too little insert DNA, or insert DNA that is improperly end-repaired, or modified DNA that is not repairable yields significantly lower recombinant cloning efficiencies. Cloning AT-rich DNA and other recalcitrant sequences may also lead to fewer colonies. With relatively few recombinant clones, the number of empty vector colonies becomes noticeable. For example, if the Experimental Insert ligation reaction produces only 250 colonies from 100 μl of cells plated, then the 2 colonies obtained from 50 μl of the No-Insert Control ligation will represent a background of 2%.

To assess the efficacy of cloning using the RFIP gene, place a long wavelength UV transilluminator over the plates to visualize red fluorescent colonies. Approximately 80% will fluoresce red, even though >99% of the colonies will have inserts. The majority of the colorless colonies have RFIP inserts that are out of frame or contain PCR-errors.

Use of competent cells with a transformation efficiency of less than 2 x 1010 cfu/µg will result in proportionately fewer colonies. In particular, most chemically competent cells will yield ~1% of the number of colonies shown above.



Heat Shock Transformation of E. cloni 10GF´ Chemically Competent Cells E. cloni 10GF´ Chemically Competent Cells are provided in 80 �l aliquots (DUOs), sufficient for two transformation reactions of 40 �l each. Transformation is performed by heat shock at 42ºC, followed by incubation on ice. To ensure successful transformation results, the following precautions must be taken:

• ESSENTIAL: After ligation, the reaction must be heat inactivated at 70°C for 15 minutes!

• Heat-killed ligation reactions can be used directly, without purification of the ligation products.

• All microcentrifuge tubes must be thoroughly pre-chilled on ice before use.

• The cells must be completely thawed on ice before use.

Transformation Protocol for Chemically Competent cells

1. Remove E. cloni cells from the -80°C freezer and thaw completely on wet ice (10-15 minutes).

2. Transfer 40 μl of thawed competent cells to a fresh microcentrifuge tube chilled on ice.

3. Add 2-4 μl of the heat-denatured cloning ligation reaction to the 40 μl of cells on ice. Failure to heat-inactivate the ligation reaction will prevent transformation. Stir briefly with pipet tip; do not pipet up and down to mix, which can introduce air bubbles and warm the cells.

4. Incubate on ice for 30 minutes.

5. Heat shock cells by placing them in a 42oC water bath for 45 seconds.

6. Return the cells to ice for 2 minutes.

7. Add 260 μl of room temperature Recovery Medium to the cells in the culture tube.

8. Place the tubes in a shaking incubator at 250 rpm for 1 hour at 37°C.

9. Plate 50-250 μl of transformed cells on YT agar plates containing 30 μg/ml kanamycin.

10. Incubate the plates overnight at 37°C.

Transformed clones can be further grown in TB or any other rich culture medium

EXPECTED RESULTS USING E. cloni 10GF´ CHEMICALLY COMPETENT CELLS

Plating chemically transformed cells and expected results. Reaction Plate μl/Plate CFU/Plate Efficiency

Experimental Insert (80 ng per ligation) 50 & 250 variable NA RFIP Insert (Positive Control) 100 > 300 > 99% inserts No-Insert Control (Vector Background) 200 < 30 <1% background Supercoiled pUC19 Transformation Control Plasmid (10 pg, AmpR) 2 > 200 > 1 x 108 cfu/μg

plasmid

The results presented above are expected when cloning 80 ng of intact, purified RFIP DNA, which contains phosphorylated blunt plus NotI ends, into Lucigen’s E. cloni 10GF� Chemically Competent Cells (transformation efficiency >5 x 108 cfu/μg pUC19 DNA). The number of recombinant clones is typically 100-fold greater than the background of self-ligated pSMARTac 3N vector. The background number of empty vector is constant (< 30 colonies per 200 μl of cells plated), unless kinase or nuclease is introduced as a contaminant. However, use of too little insert DNA, or insert DNA that is improperly end-repaired, or modified DNA that is not repairable yields significantly lower recombinant cloning efficiencies. Cloning AT-rich DNA and other recalcitrant sequences may also


Softag™ Protein Expression and Purification System lead to fewer colonies. With relatively few recombinant clones, the number of empty vector colonies becomes noticeable. For example, if the Experimental Insert ligation reaction produces only 250 colonies from 50 μl of cells plated, then the 30 colonies obtained from 250 μl of the No-Insert Control ligation will represent a background of 2%.

To assess the efficacy of cloning using the RFIP gene, place a long wavelength UV transilluminator over the plates to visualize red fluorescent colonies. Approximately 80% will fluoresce red, even though >99% of the colonies will have inserts. The majority of the colorless colonies have RFIP inserts that are out of frame or contain PCR-errors.

Getting More Recombinants Increasing the ligation reaction time to 2 hours and plating more transformed cells can increase the yield of recombinants by 4-5 fold. Ligation times beyond 2 hours will not improve the results further. Use of electrocompetent rather than chemically competent cells will greatly increase recombinant yields. Certain ORF products can prove recalcitrant to cloning due to a large size, toxic gene products, secondary structures, extremely biased base composition, or other unknown reasons.

Growing Transformed Cultures Colonies obtained from a pSMARTac 3N transformation typically can be grown in LB or YS broth. However if you suspect that your protein of interest may be a toxic protein, colonies should not be grown in rich media such as Terrific Broth. Terrific Broth contains high levels of lactose, which can inadvertently induce the expression of the protein from the tac promoter.

Screening for Recombinants Because the background of empty vector transformants is low, colonies can be picked at random for growth and plasmid purification. The size of the insert can be verified by restriction digestion of the plasmid. Direct sequencing of recombinant clones is essential to insure that the cloned insert has not incorporated PCR-based mutations.

DNA Isolation & Sequencing Grow transformants in LB medium plus 30 μg/ml kanamycin. Use standard methods to isolate plasmid DNA. The pSMARTac 3N plasmid contains the low copy number pBR origin of replication and produces DNA yields similar to that of pBR-based plasmids. E. cloni 10GF´ cells are recA and endA deficient to provide high quality plasmid DNA. Taqseq Forward and Reverse Sequencing Primers are provided with the Kit. Their sequence and orientation are shown in Appendix D.

Induction of Target Protein For small scale expression of genes in the pSMARTac 3N vector, inoculate 2-ml aliquots of LB broth containing 30 μg/ml kanamycin and shake at 220-250 rpm at 37ºC overnight. The next morning, pipet 100 μl of each culture into fresh 2-ml aliquots of the same medium. Grow the cultures at 37ºC with shaking at 220-250 rpm to an OD of 0.6 (approximately 3 hr.). Remove 100 μl of culture as a non-induced control and place on ice until needed for gel analysis. To the remainder of the culture, add IPTG to a final concentration of 1 mM. Incubate at 37ºC for 2-8 hours with shaking at 220-250 rpm. IPTG concentration and induction time may require optimization depending on the expressed gene. After induction, place the cultures on ice.

PAGE/Western Blot Analysis Pipet 20 µl of each sample into a fresh microcentrifuge tube. Add 20 µl of 2x SDS gel sample buffer (see Appendix A for recipe), and heat the tubes to 95ºC for 5 minutes. Load the uninduced and induced samples in adjacent lanes for analysis by SDS-PAGE. Run a duplicate set of samples for


Softag™ Protein Expression and Purification System Western blotting. After the gel has been run, stain one set of samples with Coomassie Brilliant Blue. Transfer the duplicate set of samples to a membrane for Western blot analysis (see Appendix H for detailed protocols). Probe the filter with a 1:1000 dilution of the Softag3 antibody included in the expression kit.

Softag Affinity Protein Purification For purification of Softag fusion proteins, grow 5 to 50 mls of recombinant E. cloni 10GF´ cells, depending on the expression level of the desired protein. Collect induced cells by centrifugation at 5000 x g for 10 minutes. Pour off the supernatant and process the cell pellet as described below.

Lyse the bacteria by sonication in 1X Softag Wash Buffer, or by using commercially available lysis reagents per manufacturer’s instructions. Sonication may denature some proteins, whereas detergent lysis may help to retain native structure and activity. The optimal lysis method for your specific protein will need to be determined empirically. Detergent lysis does not shear nucleic acids, so the lysate may be viscous, resulting in low column flow rates. Nucleic acids should be digested by an appropriate nuclease prior to proceeding.

Remove bacterial debris by centrifugation at 20,000 x g for 20 minutes. Decant the supernatant into a fresh centrifuge tube and repeat centrifugation until an insignificant pellet is observed. Excessive bacterial debris will clog the column. Centrifugal force may be increased if necessary. Cleared lysates that are frozen sometimes develop additional precipitates. If this is observed, repeat the centrifugation until a clear lysate is obtained.

Prepare the chromatography column by pouring the Softag3 Agarose Resin into the polypropylene column included with the Kit or into another appropriately sized column. Allow the storage buffer to drain by gravity flow. All subsequent wash and elution steps may be done by gravity flow. Columns should have a resin bed of at least 1-2 cm in height. Appropriate flow is 0.5–2ml/minute. Anticipate a capacity of 0.3 mg of purified recombinant protein per ml of Softag3 resin.

Equilibrate the Softag3 Agarose Resin with 5 column volumes of 1X Softag Wash Buffer. Do not allow the resin dry out. Drying and re-hydration of the resin may damage the agarose structure and impair antibody function, resulting in poor column performance.

Gently apply the cleared lysate to the column, taking care to avoid disturbing the resin bed. Save the flow-through for recovery of additional recombinant protein, as the amount of Softag fusion protein may exceed the column capacity. Wash the column with 10 volumes of 1X Softag Wash Buffer. Monitor the protein content of wash fractions to determine when background bacterial proteins have been removed from the column. Protein content can be assayed by absorbance (OD280) or by the Bradford or Lowry assays.

Elute the purified protein from the column with 5 ml of Softag Elution Buffer. The Elution Buffer is a proprietary formulation containing Tris, NaCl, propylene glycol, and EDTA. The eluate should be collected in fractions and analyzed for protein content to determine when all of the protein has been eluted from the column. Suggested fraction sizes are 250 μl to 1 ml. Assess protein concentration and purity by SDS-PAGE. Typically the majority of the purified protein is eluted in first few fractions. If elution is not complete, an additional 5 column volumes of elution buffer should be sufficient to remove the bound protein.

Protein may be stored in Softag Elution Buffer or dialyzed into the buffer of your choice. Store at -20°C to +4°C.

The column may be regenerated by washing with 10 column volumes of 1M NaCl followed by equilibration with 1X Softag Wash Buffer. Softag3 resin may be reused 5-6 times. It is not recommended to re-use the resin for purification of a tagged different protein. After regeneration, the resin may be stored in 1X Softag Wash Buffer containing 0.02% azide.



Protein Concentration After Purification

If necessary, the protein purified using Softag purification system can be concentrated by ultrafiltration. However, it is first necessary to lower the concentration of propylene glycol by dilution or dialysis. Two of several possible methods for protein dilution and concentration are as follows:

A) The peak protein fractions can be pooled, diluted with 4 volumes of TE buffer (10 mM Tris pH 8.0; 1 mM EDTA), and concentrated using Vivaspin ultrafiltration spin columns (VWR Cat #vs2002) according to the manufacturer’s protocol.

B) Alternately, the peak protein fractions can be pooled and dialyzed against 1-2 liters of TE buffer for 6 hours with two buffer changes. The dialyzed sample is then concentrated using Vivaspin ultrafiltration spin columns (VWR Cat #vs2002) according to the manufacturer’s protocol.

References 1. Thompson NE, Arthur TM and Burgess RR (2003). Development of an epitope tag for the gentle purification of proteins by immunoaffinity chromatography: application to epitope-tagged green fluorescent protein. Analytical Biochemistry 323, 171-9.

2. Duellman SJ, Thompson NE, and Burgess RR (2004). An epitope tag derived from human transcription factor IIB that reacts with a polyol-responsive monoclonal antibody. Protein Expression and Purification, 35, 147-55.

3. Sambrook J and Russell DW. Molecular Cloning: A Laboratory Manual (Third Edition). 2001. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

4. Paluh JL and Yanofsky C. (1986). High level production and purification of the E. coli trp repressor. Nucleic Acid Research 14, 7851-7860

5. Squires C, Krainer A, Barry G, Shen WF, and Squires CL (1981) Nucleotide sequence at the end of the gene for the RNA polymerase �’ subunit (rpoC). Nucleic Acid Research 9, 6827-6840.

Appendix A: Media Recipes

YT + kan Agar Medium for Plating of Transformants

Per liter: 8 g Bacto-tryptone, 5 g yeast extract, 5 g NaCl, 15 g agar. Mix components, autoclave and cool to 55°C. For pSMARTac 3N™ transformants, add kanamycin to a final concentration of 30 μg/ml. Pour into petri plates.

LB Culture Medium

Per liter: 10 g Bacto-tryptone, 5 g yeast extract, 5 g NaCl. Mix components and autoclave.

2x SDS Gel Sample Buffer

100 mM Tris-HCl (pH 6.5), 4% SDS, 0.2% bromophenol blue, 20% glycerol. Add dithiothreitol to a final concentration of 200 mM in the 2x buffer prior to use.

Growing Transformed Cultures

Colonies obtained from a pSMARTac 3N transformation should not be grown in rich medium, such as Terrific Broth. Terrific Broth contains high levels of lactose, which can inadvertently induce the expression of the protein from the tac promoter.



Appendix B: Vector Map and Sequencing Primers

The pSMARTac 3N™ Vector is supplied pre-digested, with blunt amino terminus and NotI carboxy terminus ends, both of which are dephosphorylated. Three CloneSmart® transcriptional terminators border the cloning site to prevent transcription from the insert into the vector. Another terminator at the 3’ end of the kanamycin resistance gene prevents this transcript from reading into the insert DNA. The GenBank accession number of pSMARTac 3N has not yet been assigned. The sequences of the TacSeq F and R primers are: TacSeq F 5’–GTT GAC AAT TAA TCA TCG GC–3’ TacSeq R 5’–CCA GAC CTG CGT TCA GCA GTT CTG–3’

TacSeq F primer GCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGTTGTGAGCGGATAACAATTATAATAGATTCAATTGTGAGCGGATAACAATTTCACA CGACAACTGTTAATTAGTAGCCGAGCATATTACACACCAACAATCGCCTATTGTTAATATTATCTAAGTTAACACTCGCCTATTGTTAAAGTGT

Start Softag Affinity Peptide (blunt) M V T Q D P S R V GCAGGAAACAGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATATCC ATG GTG ACT CAG GAC CCG TCT CGT GTT GGT... G TCCTTTGTCGATCTTTATTAAAACAAATTGAAATTCTTCCTCTATATAGG TAC CAC TGA GTC CTG GGC AGA GCA CAA CCA...

...(NotI) ...GGCCGCAAGACGCATCTGCCAGCCTGGCAGAACTGCTGAACGCAGGTCTGGGCGGTTCTGAT ... CGTTCTGCGTAGACGGTCGGACCGTCTTGACGACTTGCGTCCAGACCCGCCAAGACTA

TacSeq R primer



Appendix C: Creating Blunt-NotI Fragments by PCR NotI recognizes an 8-base sequence and is thus fairly rare. However, some genes may contain NotI sites and thus cannot be cloned using NotI digestion. In such cases, a simple PCR strategy can be utilized to generate a NotI-compatible overhang at the 3’ end of the fragment. This strategy requires one forward PCR primer and two reverse primers, which are used in two separate amplification reactions (Figure 5). The forward primer begins with the codon immediately following the ATG start codon of the desired protein. The reverse primers encode the stop codon. One of the reverse primers (Primer 3, below) must contain the four additional bases “5’-GGCC” at its 5´ end.

All PCR amplifications must be carried out with a Proofreading DNA polymerase (e.g., Vent, Pfu). The final product also must have 5´ phosphate groups, which can be added to the PCR primers or to the final product (see main text for details). Please note that a NON-proofreading polymerase such as Taq DNA polymerase must NOT be used, as it produces improper ends containing a 3´-A extension.

The PCR products from reactions 1 and 2 are gel purified to eliminate aberrant bands. They are then mixed, heat denatured, and re-anneal by cooling. A fraction of the molecules will consist of hybrids between the two PCR products, containing a single-stranded overhang. The mixture is used in the pSMARTac 3N ligation reaction.

PCR Product 1:

PRIMER 1 5´[P]-GGA AAA GTA TAC CTA GTT............GTG CAT GAA ATG ATG TGA GC CCT TTT CAT ATG GAT CAA............CAC GTA CTT TAG TAC ACT CG-5´[P]

PRIMER 2

PCR Product 2:

PRIMER 1 5´[P]-GGA AAA GTA TAC CTA GTT............GTG CAT GAA ATG ATG TGA GC GGCC CCT TTT CAT ATG GAT CAA............CAC GTA CTT TAG TAC ACT CG CCGG-5´[P]

PRIMER 3

MIX, denature, and re-anneal PCR Products 1+2 5´[P]-GGA AAA GTA TAC CTA GTT............GTG CAT GAA ATG ATG TGA GC CCT TTT CAT ATG GAT CAA............CAC GTA CTT TAG TAC ACT CG CCGG-5´[P]

Figure 5. Generation of NotI-compatible overhangs by PCR. Mixing and re-annealing PCR Products 1 and 2 creates hybrid molecules, which can be cloned into the pSMARTac 3N vector. T1 and 2 that re-anneal will not be cloned efficiently into the vector. Note: Primers 1, -2, and -3 are only shown as an example. Three specific primers must be created for each gene amplified by this method. It is critical that Primer 3 always contains the 5’-GGCC extension.



Appendix D: Cloning Troubleshooting Guide

Problem Probable Cause Solution Inefficient kinasing and or NotI restriction.

Check the insert DNA for self-ligation by gel electrophoresis. Repeat DNA fragment treatments using QC criteria before proceeding to the cloning step.

Contaminating enzymes in ligation reaction.

Heat-denature end repair reaction or restriction digest 10 minutes at 70oC. Purify DNA after end repair or restriction digestion reaction.

No DNA, degraded DNA, or insufficient amount of DNA.

Check insert DNA by gel electrophoresis. Determine concentration of insert and add the correct amount. Use the supplied control insert to test the system.

Ligation reaction failed.

Check the insert DNA for self-ligation by gel electrophoresis. Be sure insert DNA is phosphorylated. Use the supplied control insert to test ligation reaction.

Very few or no transformants

Inadequate heat denaturation after ligation reaction.

DO heat denature for 15 min at 70°C. Skipping this step may lower the number of transformants by 2-3 orders of magnitude.

Loss of DNA during precipitation.

DO NOT precipitate DNA after ligation reaction. It is not necessary with this protocol and these cells.

Incorrect recovery media.

DO NOT use TB (Terrific Broth) or SOC for recovery media. Only use the Recovery Medium supplied in the Kit.

Improper electroporation conditions.

Use pre-chilled electroporation cuvettes. Use cuvettes with a gap of 0.1 cm (BTX, Eppendorf, or BioRad brand). Add 1 μl of DNA to 25 μl of pre-aliquotted cells on wet ice; DO NOT add the cells to the DNA.

Incorrect amounts of antibiotic in agar plates. Wrong antibiotic used.

Add the correct amount of kanamycin to molten agar at 55oC before pouring plates. DO NOT spread antibiotic onto the surface of agar plates.

Contaminating enzymes in ligation reaction.

Purify DNA after DNA kinase plus NotI restriction reaction. DO NOT add T4 DNA Kinase to the ligation reaction.

Inserts are small or contain active promoters.

Analyze colonies by PCR or restriction digestion to confirm the presence of inserts.

High background of blue colonies or of transformants that do not contain inserts.

Inserts are unstable. Use 10GF´ cells and plate without IPTG. Grow at room temperature.

Incorrect amount of antibiotic in agar plates.

Add the correct amount of kanamycin to molten agar at 55oC before pouring plates. DO NOT spread antibiotic onto the surface of agar plates.



Appendix E: Expression/Purification Troubleshooting Guide

Problem Probable Cause Solution

Lysate not fully cleared Centrifuge lysate until no discernable pellet is observed. Gently resuspend top layers of agarose and remove from column.

Clogged column

Nucleic acids present in lysate

Treat lysate with an appropriate nuclease or sonicate. The lysate should not be viscous.

Softag3 agarose not properly equilibrated

Equilibrate the Softag3 agarose with 1X Softag wash buffer

Recombinant protein not overexpressed

Check lysate by SDS-PAGE and/or western blot to confirm overexpression of recombinant protein

Low recovery of recombinant protein

Epitope tag not present Recombinant proteins may be cleaved for various reasons during expression or lysate preparation. Use of protease inhibitors may prevent cleavage. Check lysate and column flow through by a combination of SDS-PAGE and western blot to confirm epitope tag is attached to the over expressed protein of the expected molecular weight.

Recombinant protein expressed in inclusion bodies

Lyse induced bacteria directly in an SDS-PAGE running buffer and check for over expression by SDS-PAGE and/or western blot. Compare these results to SDS-PAGE and/or western blot assays of cleared lysate. During IPTG induction incubate culture at room or lower temperature to obtain more soluble recombinant protein.



Appendix F: Sequence of pSMARTac™ 3N Vector (2390 bp) pSMARTac™ 3N Vector (2390 bp). The Softag sequence and NotI cloning site are underlined. CCTGAATGATATCAAGCTTGAATTCGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGTTGACAATTAATCATCGGCTCGTATAATGTGTGGTTGTGAGCGGATAACAATTATAATAGATTCAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATATCCATGGTGACTCAGGACCCGTCTCGTGTTGGTGCTTCCCATTAGAGCGGCCGCAAGACGCATCTGCCAGCCTGGCAGAACTGCTGAACGCAGGTCTGGGCGGTTCTGATAACGAGTAATCGTTAATCCGCAAATAACGTAAAAACCCGCTTCGGCGGGTTTTTTTATGGGGGGAGTTTAGGGAAAGAGCATTTGTCAGAATATTTAAGGAATTTCTGAATACTGACGAATTCTCTAGATATCGCTCAATACTGACCATTTAAATCATACCTGACCTCCATAGCAGAAAGTCAAAAGCCTCCGACCGGAGGCTTTTGACTTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGGCTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCAGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACGGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGGTGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCACTTGATGCTCGATGAGTTTTTCTAAATGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGATGAGCAAATGTAATCACCTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGATGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATTTTCTACCGAAGAAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCAGTCCAGTTACGCTGGAGTCTGAGGCTCGT



Appendix G: Technical Data- Softag3 Antibody and Affinity Resin Softag3 Antibody The Softag3 antibody recognizes an epitope derived from a subunit of eukaryotic transcription factor TFIIB. It is suitable for detecting recombinant proteins produced in bacterial hosts.

Technical Data Mouse Antibody Host IgG2a Isotype TQDPSRVG Epitope Yes Polyol-responsive IIB8 Clone

Cross reactivity Epitope tagged recombinant proteins Available size 50, 200, and 1000 μg purified antibody (Protein G)

Handling requirements 1 mg/ml in PBS pH 7.2 Concentration

Storage -20°C for short term use, -70°C for long term storage Avoid repeated freeze/thaw

Applications Yes Immunoaffinity chromatography Yes Immunoprecipitation

Western Blot Yes 1:1000

Softag3 Affinity Resin Softag3 Affinity Resin is an immunoaffinity resin appropriate for purifying tagged proteins from prokaryotic expression sources. The epitope is derived from a subunit of eukaryotic transcription factor TFIIB.

Technical Data 4% Cross-linked Agarose Resin TQDPSRVG Epitope 0.38 +/- 0.04 mg/ml (based on 28kD tagged GFP protein)

Binding Capacity

Elution Conditions Use 5 column volumes 1X Softag Elution Buffer

Handling requirements 1 X Softag Wash Buffer Storage Buffer

Storage Conditions 4°C until use. Use at Room Temperature. Stability At least 12 months if stored at 4°C

Notes

This resin is also appropriate for use in identifying proteins in a complex with the recombinant protein tagged with the Softag3 epitope.



Appendix H: Western Blot Protocol Materials needed: Unstained PAGE gel containing protein of interest. Do NOT use a Coomassie stained gel for Western blotting. Nitrocellulose transfer membranes [Schleicher & Schuell: Protran® membrane, 0.45µm BA85] Filter Paper Softag3 Antibody Anti-mouse IgG Secondary Antibody, e.g., Alkaline Phosphatase conjugated Anti-mouse IgG [Chemicon AP308A] Paper towels Solutions: Deionized H2O Towbin transfer buffer stored at 4°C [see Buffers] 1% dry skim milk in PBS (“BLOTTO”) store at 4ºC 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium pre-mix substrate (BCIP/NBT) [Sigma B-3804] Tris-buffered saline with Tween 20 (TBST) [see Buffers] Alkaline phosphatase buffer (AP Buffer) [See Buffers] Equipment needed: Xcell SureLock™ Mini-Cell system [Invitrogen EI0001, EI0020, EI0002] Bio-Rad PowerPac™ 300 [Bio-Rad Laboratories] Incubation tray [Fisher NC9412314] 4°C Refrigerator Lab-Line shaker (Fisher, Model # 1314) or equivalent

Blot Set-up:

1. To maintain the proper orientation of the samples, mark the upper left corner of both the PAGE gel and the nitrocellulose filter, unless a prestained MW marker was used on the gel.

2. Wet the nitrocellulose filter with Transfer Buffer.

3. Set up the Mini-Cell System in a tray containing Transfer Buffer, as follows: Support - Sponge - Filter paper - Gel - Nitrocellulose - Filter Paper - Sponge - Support. Make sure that the orientation marks on the Gel and the Nitrocellulose correspond to each other. Avoid air bubbles between the Gel and the Nitrocellulose.

4. Place the blot setup in the Mini-Cell System containing Transfer Buffer, with the Nitrocellulose toward the anode (red).

Transfer:

1. Using the Mini-Cell System & power pack, transfer the blot for 2 hours at 30V.

2. Turn off the power back & remove the filter from the Mini-Cell System. Block with BLOTTO for 1-2 hr at room temperature or overnight at 4°C. The blocked filter can be dried and used at a later time.

3. Dilute the Softag3 Antibody 1:1000 in BLOTTO (check product data sheet for lot specific dilution). React with blotted protein for about 1 hr at room temperature with gentle shaking.



4. Wash the filter 3 times with TBST in the tray on the shaker. Washes are about 5 minutes each.

Secondary Antibody:

1. Dilute the Secondary Antibody 1:2000 with BLOTTO.

2. React the diluted Secondary Antibody with the filter in the tray for about 1 hr at room temperature with gentle shaking.

3. Decant the Secondary Antibody from the filter. Wash the Blot 5 times with TBST. Washes are about 5 minutes each with gentle shaking.

4. Wash the filter once in AP Buffer for about 5 minutes with gentle shaking.

5. React with BCIP/NBT substrate with gentle shaking. This time will vary depending on the amount of protein and the secondary antibody.

6. Before the background gets too dark, wash the filter with 2 changes of dH2O. Dry on a paper towel.

Buffers and Reagents Towbin Transfer Buffer 2 liter250 mM Tris 60.55 g Tris 192 mM Glycine 28.20 g Glycine 20% Methanol Dissolve in 1400 ml dH2O Bring the volume to 1600 ml with dH2O Add 400 ml Methanol Blocking Agent1% protein solutions are generally made up in phosphate-buffered saline or Tris-buffered saline. (BLOTTO is 1% nonfat dry milk in PBS). Tris-buffered Saline with Tween 20 (TBST) 1 liter10 mM Tris HCl, pH7.4 10.0 ml 1M Tris-HCl, pH7.4 150 mM NaCl 37.5 ml 4M NaCl 0.1% mM Tween 20 1.0 ml Tween 20 Bring to 1 liter with dH2O Alkaline Phosphatase Buffer (AP Buffer) 1 liter100 mM Tris HCl, pH9.5 100 ml 1M Tris-HCl, pH9.5 100 mM NaCl 25 ml 4M NaCl 5 mM MgCl2 5 ml 1M MgCl2 Bring to 1 liter with dH2O


softag protein expression purification system - biocat gmbh · softag™ protein expression &...

Documents