softag protein expression purification...

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE MA035 v 1.0

Softag™ Protein Expression

& Purification System

IMPORTANT! -80°C, -20°C and 4°C Storage Required

Immediately Upon Receipt

Lucigen® Corporation The Molecular Cloning Company™

2120 W. Greenview Drive

Middleton, WI 53562 Toll Free (888) 575-9695 Phone (608) 831-9011 FAX (608) 831-9012

Email [email protected] www.lucigen.com

Softag™ Protein Expression and Purification System

Lucigen® Corporation 2 (888) 575-9695 MA035 v 1.0 www.lucigen.com

Technical Support

Lucigen is dedicated to the success and satisfaction of our customers. Our products are tested to assure they perform as specified when used according to our recommendations. It is imperative that the reagents supplied by the user, especially the DNA targets to be cloned, are of the highest quality. Please follow the manual carefully or contact our technical service representatives for information on preparation and testing of the target DNA. We encourage you to contact us with your comments regarding the performance of our products in your applications. Thank you. Notice of Limited Label License, Copyright, Patents, Warranties, Disclaimers and Trademarks Copyright© 2001-2006 by Lucigen Corp. All rights reserved. pSMARTac, UltraClone, CloneDirect, pcrSMART, pEZ, pEZSeq, cSMART, PCR-SMART, and Replicator are trademarks of Lucigen Corp. Lucigen, CloneSmart, ClonePlex, DNATerminator, E. cloni, PCRTerminator, CopyRight, NanoClone, and pSMART are registered trademarks of Lucigen Corp. Softag is a trademark of NeoClone Biotechnology Corp.

Lucigen’s products are sold for research use only and are not to be used in humans or for medical diagnostics. Lucigen’s liability with respect to any CloneSmart product is limited to the replacement of the product. No other warranties of any kind, expressed or implied, including without limitation, any implied fitness for any particular use, are provided by Lucigen. Lucigen is not liable for any direct, indirect, incidental or consequential damages arising out of or in connection with the use or inability to use any of its CloneSmart products.

Limited Label License

This product is the subject of U.S. Patent #6,709,861 and pending patent applications owned by Lucigen Corporation, and U.S. Patent Reference Number 60/577944, assigned to NeoClone Biotechnology Corp. and exclusively licensed to Lucigen Corp. The consideration paid for this product grants a Limited License to use the product pursuant to the terms set forth in this Limited Label License. Academic, Not-for-Profit and For-Profit institutions acquire certain limited nontransferable rights with the purchase of this product (see below). The purchase price of this product includes limited, nontransferable rights to use only the purchased amount of the product to perform CloneSmart Blunt Cloning Technology and only as described in CloneSmart Blunt Cloning Kit Instruction Manual. This limited license specifically excludes manufacture of the pSMARTac vector or derivatives thereof. Lucigen Corporation reserves all other rights; in particular, the purchaser of this product may not transfer or otherwise sell this product or its components or derivatives to a third party, and no rights are conveyed to the purchaser to use the product or its components or derivatives for commercial purposes. “Commercial purposes” includes any activity for which a party receives consideration and may include, but is not limited to, (1) use of the product or its components or derivatives in manufacturing, (2) use of the product or its components or derivatives for diagnostic purposes, (3) transfer or sale of vectors made with the product or components or derivatives of the product, (4) use of this product or materials made therefrom to provide a service, information, or data (e.g., DNA sequence) to a third party in return for a fee or other consideration, or (5) resale of the product or its components or derivatives, whether or not such product or its components or derivatives are resold for use in research. Academic, Not-for-Profit, and For-Profit institutions must obtain a separate license from Lucigen Corporation to use this product for any purpose other than those permitted above. It is the sole responsibility of the buyer to ensure that use of the product does not infringe that patent rights of third parties.

If the purchaser is not willing to accept these use limitations, Lucigen Corporation is willing to accept return of the product for a full refund. For information on obtaining a license, contact Lucigen Corporation, 2120 W. Greenview Dr., Middleton, WI 53562. Email: [email protected]. Phone: 608-831-9011. Fax 608-831-9012.



Table of Contents

Softag™ Protein Expression and Purification System Designations .................................................... 4

Components & Storage Conditions ..................................................................................................... 4

Softag Protein Expression and Purification System Description.......................................................... 6

pSMARTac™ Vector ............................................................................................................................ 6

E. cloni® 10GF’ Electrocompetent or Chemically Competent Cells ..................................................... 7

PCR Cloning Strategies ...................................................................................................................... 7

Red Fluorescent Inducing Protein (RFIP) Control Expression Gene Fragment .................................. 9

Kinasing Non-Phosphorylated PCR Primers ....................................................................................... 9

Purification and Size Fractionation of DNA ......................................................................................... 9

Sensitivity of DNA to Short Wavelength UV Light................................................................................ 9

Softag™ Protein Purification .............................................................................................................. 10

Materials and Equipment Needed ..................................................................................................... 10

Detailed Protocol ............................................................................................................................... 11

Preparation and Purification of Insert DNA........................................................................................ 11

Ligation to the pSmarTac Vector ....................................................................................................... 12

Preparation for Transformation.......................................................................................................... 12

Transformation Protocols .................................................................................................................. 12

Getting More Recombinants.............................................................................................................. 15

Growing Transformed Cultures ......................................................................................................... 15

Screening for Recombinants ............................................................................................................. 16

DNA Isolation & Sequencing ............................................................................................................. 16

Induction of Target Protein Using IPTG............................................................................................. 16

PAGE Analysis/Western Blot Analysis .............................................................................................. 16

Softag Affinity Protein Purification ..................................................................................................... 16

References........................................................................................................................................ 17

Appendix A: Media Recipes .............................................................................................................. 18

Appendix B: Vector Map and Sequencing Primers............................................................................ 19

Appendix C: Cloning Troubleshooting Guide .................................................................................... 20

Appendix D: Expression/Purification Troubleshooting Guide……………………………………………21

Appendix E: Sequence of pSMARTac............................................................................................... 21

Appendix F: Technical Data: Softag 3 Antibody …………………………………………… 24

Appendix G: Technical Data: Softag 3 Affinity Resin ……………………………………………24



Softag Protein Expression and Purification System Designations

The Softag Protein Expression and Purification System contains three kits that have been optimized to work together: an expression cloning kit, a competent cell transformation kit, and a protein purification kit. The Softag™ purification kit and Softag antibody are also sold separately. The catalog numbers are listed below.

Catalog Numbers of Softag Protein Expression and Purification Kits and Cell Combinations

ReactionsKit with 10G F’

Electrocompetent Cells

Kit with 10G F’ Chemically Competent

Cells 5 49801-1 49803-1 Softag Protein Expression &

Purification System 10 49801-2 49803-2

Catalog Numbers of Stand-Alone Softag Reagents Reactions Catalog Numbers

5 50001-1 Softag3 Purification Kit 10 50001-2

50 ug 50012-1 200 ug 50012-2 Softag3 Antibody

1 mg 50012-3 E. cloni 10GF’ ELITE Electrocompetent Cells

12 24

60061-1 60061-2

E. cloni 10GF’ Chemically Competent Cells

12 24

60062-1 60062-2

Components & Storage Conditions

The Expression Cloning Kit (Container 1) includes the pSMARTac™ Expression Vector cloning components, a Positive Control Insert containing a Red Fluorescent Inducing Protein (RFIP) for visualization of the expression system, Sequencing Primers, and Softag Antibody, which should be stored at -20oC. The Transformation Kit (Container 2) includes E. cloni® 10GF’ Electrocompetent or Chemically Competent Cells with the lacIq repressor for tight control of the tac promoter, which must be stored at -80oC. The Protein Purification Kit (Container 3) includes the Softag purification components, which should be stored at 4oC. Additional E. cloni Competent Cells, Softag Antibody, and Softag protein purification components may be purchased separately. Container 1: Expression Cloning Kit Store at -20°C 5 Reactions 10 Reactions 4X pSMARTac 3N Vector Premix

Includes Buffer, ATP, and pSMARTac blunt/NotI cut 12.5 μl

2 x 12.5 μl

CloneSmart® DNA Ligase (2 U/μl) 10 μl 2 x 10 μl Positive Control DNA Blunt/NotI cut 2 ul 2 ul T4 Polynucleotide Kinase (10 U/ul) 20 μl 20 μl 10X T4 Polynucleotide Kinase buffer (containing ATP) 20 μl 20 μl Sequencing Primers (200 reactions each) TacSeq F Primer (3.2 pmol/μl) TacSeq R Primer (3.2 pmol/μl)

200 μl 200 μl

200 μl 200 μl

Softag3 Antibody 50 ug 50 ug



Container 2: Transformation Kit Store at -80°C 5 Reactions 10 Reactions E. cloni 10GF’ ELITE Electrocompetent Cells

or E. cloni 10GF’ Chemically Competent Cells

12 (6 x 50 μl)

24 (12 x 80 μl)

24 (12 x 50 μl)

24 (12 x 80 μl) Control pUC19 DNA (1 ng/μl) store at -20°C or -80°C 10 (1 x 5 μl) 10 (1 x 5 μl)

Recovery Medium store at -20°C or -80°C

12 (1 x 12 ml) 24 (2 x 12 ml)

Container 3: Softag3 Protein Purification Kit Store at 4°C 5 Purifications 10 Purifications

Softag3 Resin 1 ml 2 ml Softag 10X Wash Buffer (15 ml) 1 x 15 ml 2 x 15 ml Softag Elution Buffer (50 ml) 1 x 50 ml 2 x 50 ml Polypropylene Column (For bed volumes up to 5 ml) 1 Column 2 Columns



Softag Protein Expression & Purification System Description The Softag Protein Expression and Purification System has been developed to provide a simple, user friendly method for the efficient cloning, expression and purification of proteins to greater than 95% purity with a single column run. The primary steps of this powerful system are outlined in Fig. 1. The pSMARTac 3N Vector (Fig. 2) is designed to simplify directional cloning of open reading frame-containing genes behind the tac promoter and in frame with the amino terminus Softag3 affinity peptide (3N). It comes pre-processed with blunt plus NotI cut ends that have been dephosphorylated. A universal method for PCR amplification of any gene is provided that facilitates direct cloning into the prepared pSMARTac 3N Vector, without restriction digestion. The preprocessed vector is cloning-ready, allowing same day PCR amplification, ligation, and transformation of the target gene. The E. cloni 10GF’ cells contain the lacIq gene, which codes for the Lac repressor. The repressor keeps expression from Ptac low in the absence of IPTG induction. Expression is induced at mid-log phase by the addition of IPTG. The small 8 amino acid Softag3 peptide at the amino terminus provides fast and easy affinity protein purification for single-pass recovery of biologically active, recombinant proteins and protein complexes at greater than 95% purity (1, 2). N C 5’ Gene Coding for Target Protein 3’

PCR Amplify Clone into pSMARTac

Express Fusion Protein with Affinity Tag

Purification by Affinity Chromatography

Affinity Wash and Elute Column Purified Protein

Figure 2. Schematic diagram of the pSMARTac 3N expression vector with Softag™ affinity sequence. Kan, kanamycin gene; ROP, Repressor of Priming (for low copy number); Ori, origin of replication; RBS, ribosome binding site; ATG, translation start site; Stop, translation end site; CloneSmart® transcription terminators (T) prevent transcription into or out of insert. The 8 amino acid Softag3 affinity binding site is at the amino terminus.

Target Protein Figure 1. Schematic diagram of the Softag protein expression and purification process. N and C, amino and carboxy terminus of protein, respectively; RBS, ribosome binding site; ATG, translation initiation site; Softag, 8 amino acid affinity peptide.



pSMARTac™ 3N Vector

The pSMARTac 3N Vector is supplied pre-processed with a blunt end for the amino terminus and NotI cut end for the carboxy terminus of the gene encoding target protein, both of which are dephosphorylated (Figure 2). This blunt – NotI arrangement allows for the directional cloning of any PCR amplified gene (additional details provided below). The efficiency of cloning genes that are in-frame and expressing is >80% using this vector preparation and the RFIP (red fluorescent inducing protein) included as a control. The pSMARTac copy number is similar to that of pBR322 plasmids (~20 copies/cell), yielding 0.5–1.0 μg of plasmid DNA per ml of culture. PCR-amplified genes containing amino terminal blunt ends and NotI cut carboxy terminal ends that are phosphorylated are ligated to the pSMARTac vector, transformed into competent E. cloni® 10GF’ cells, and spread on plates containing kanamycin. IPTG must not be added to avoid inducing the expression of the gene. As a control for cloning and expression, a red fluorescent inducing protein (RFIP) gene fragment that is processed for ligation is included. The pSMARTac vector does not contain the lacZ alpha peptide gene fragment and, therefore, will not give a blue/white screen for cloning.

E. cloni ® 10GF’ Electrocompetent and Chemically Competent Cells

E. cloni 10GF’ is an E. coli strain optimized for high efficiency transformation. The 10G cells are ideal for cloning and propagation of BAC, cosmid, or plasmid clones. They give high yield and high quality plasmid DNA due to the endA1 mutation. E. cloni 10GF΄ has the same chromosomal genotype as 10G, but it harbors the F΄ plasmid. This plasmid confers tetracycline resistance and allows the cells to be infected with M13 for ssDNA production. The F' plasmid also carries the lacIq repressor allele; therefore, IPTG must be added to induce expression from the tac promoter. Any DNA inserted into the cloning site of pSMARTac will be transcribed at high levels in the presence of IPTG; therefore plates used for screening recombinants should not contain IPTG to avoid any deleterious effects. E. cloni 10GF΄ Genotype: [F׳ proA+B+ lacIqZΔM15::Tn10 (TetR)] / mcrA Δ(mrr-hsdRMS-mcrBC) endA1 recA1 φ80dlacZΔM15 ΔlacX74 araD139 Δ(ara,leu)7697 galU galK rpsL nupG λ− tonA

E. cloni 10GF’ ELITE Electrocompetent Cells produce > 2 x 1010 cfu/µg supercoiled pUC19 DNA. E. cloni 10GF’ Chemically Competent Cells produce ≥ 5 x 108 cfu/µg supercoiled pUC19 DNA. As a control for transformation, E. cloni Competent Cells are provided with supercoiled pUC19 DNA at a concentration of 1 ng/μl. For transformation, dilute 1:100 in dH2O to a final concentration of 10 pg/μl.

PCR Cloning Strategies Many strategies have been developed for subcloning a protein-coding region of DNA into expression vectors. The most common strategy is to use two different unique restriction sites for cloning inserts in a defined orientation. There are two problems with this strategy: 1) the need for making a perfect fusion between the target gene and vector expression cassette often conflicts with the potential presence of the same restriction sites in the insert DNA; and 2) extraneous sequences located in the vector. The pSMARTac™ vector preparation utilizes a simple universal strategy for the precise blunt site fusion of the protein coding gene immediately after the Softag peptide sequence, which is also blunt. Using an appropriately designed PCR primer that ends with the desired in-frame amino terminus results in a universal fusion between the gene and the expression vector, free of restriction site constraints and extraneous sequences. The carboxy terminus of the insertion site is a NotI overhang. PCR fragments for expression cloning are generated using a proofreading DNA polymerase and designed to end as a blunt site at the amino terminus and to contain a NotI site (or EaeI or PspOMI) after the stop codon of the gene. The PCR fragment is then restricted with NotI (or EaeI or PspOMI) to generate the appropriate ends for cloning (see Figure 3 for details). Alternately, a simple strategy that does not use restriction digests but still provides a NotI overhang is described below.



VECTOR Start codon Softag Affinity Peptide M L T Q D P S R V G A Amino Terminus Blunt Site …ATG TTA ACT CAA GAT CCT TCT CGT GTT GGT GCC …TAC AAT TGA GTT CTA GGA AGA GCA CAA CCA CGG INSERT First Insert Stop Codon RFIP GENE Codon NotI/EaeI/PspOMI Overhang GGA AAA XXX XXX TGA GC CCT TTT XXX XXX ACT CGCCGG VECTOR Carboxy Terminus NotI Overhang GGCCGCAAGACGCAT… CGTTCTGCGTA… Figure 3. Diagram showing the orientation of an open reading frame, the RFIP in this case, and the flanking pSMARTac 3N vector sequences and how they come together.

Even though NotI recognizes an eight base sequence and is thus fairly rare, it is still likely that some genes will contain one or more NotI sites. To circumvent this likelihood, a simple PCR strategy can be utilized to generate a NotI overhang at the 3’ end without the use of a NotI restriction cut. This strategy requires three PCR primers instead of the usual two, two separate amplification reactions, and a mixture of the two amplification products that has been heated and annealed. The process is diagrammed in Figure 4. The two PCR primers at the carboxy terminus of the protein-encoding gene are designed to be offset by 4 bases, leaving a NotI overhang on the bottom strand. The top strand PCR primer will be four bases shorter than the bottom strand primer but otherwise homologous. The final PCR reactions 1 and 2 are purified, preferably by gel fractionation, mixed together, heat denatured, and slowly cooled to anneal as shown below. There will be three reaction products, as the original pairs from reaction 1 and 2 will also reform. The mixed PCR reaction template is the correct one that will ligate and form a recombinant clone. PRIMER 1 PCR GGAAAAGTATACCTAGTTXXXXXXXXXXXXXXXGGCGTGCATGAAATGATGTGAGC REACTION 1 CCTTTTCATATGGATCAAXXXXXXXXXXXXXXXCCGCACGTACTTTAGTACACTCG

PRIMER 2

PCR PRIMER 1 REACTION 2 GGAAAAGTATACCTAGTTXXXXXXXXXXXXXXXGGCGTGCATGAAATGATGTGAGCGGCC CCTTTTCATATGGATCAAXXXXXXXXXXXXXXXCCGCACGTACTTTAGTACACTCGCCGG

PRIMER 3 MIX PCR REACTIONS 1+2

GGAAAAGTATACCTAGTTXXXXXXXXXXXXXXXGGCGTGCATGAAATGATGTGAGC CCTTTTCATATGGATCAAXXXXXXXXXXXXXXXCCGCACGTACTTTAGTACACTCGCCGG

Figure 4. Diagram of PCR strategy to generate NotI overhangs without the use of restriction digestion. The ability to add a sequence-specific protein cleavage site to the amino terminus of the amplified gene is an option available in most cases. For example, enterokinase recognizes a five amino acid sequence, Asp-Asp-



Asp-Asp-Lys, cleaving just after the Lys residue. Adding another 15 nucleotides containing the enterokinase recognition sequence to the oligonucleotide used for PCR amplification of the gene to be expressed can be accomplished with minimal planning. This provides for easy removal of the Softag, should that be desired, by enterokinase treatment of the recombinant protein after purification. Red Fluorescent Inducing Protein (RFIP) Control Expression Gene Fragment A Postive Control insert DNA that is blunt-plus-NotI treated is provided as a control for the ligation reaction, expression, and Softag™ affinity protein purification. The gene product is a relative of the cobA or cysG gene, or uroporphyrinogen III methyltransferase. When expressed in E coli this enzyme results in the intracellular accumulation of red fluorescent porphyrinoid compounds. The red fluorescence is readily detected using a long wavelength, handheld UV lamp (or shortwavelength UV transilluminator) when the colonies are approximately 1 mm in diameter. Recombinant RFIP clones grown overnight in L Broth will be visibly red to the eye compared to a non-recombinant cell growth. Note that the RFIP is not itself fluorescent; only the intracellular by-products are. The RFIP gene is a simple tool to easily confirm the efficiency of cloning with the Softag Expression portion of the kit. The RFIP gene product will have the affinity tag at the amino terminus and can be purified with the Softag reagents. The size of the protein is estimated to be 30 kD by SDS PAGE. The protein is not fluorescent and can not be detected by UV.

Kinasing Non-Phosphorylated PCR Primers The most efficient way to clone PCR products is to perform the amplification with a proofreading polymerase (e.g., Vent™ or Pfu DNA polymerase) and use primers synthesized with 5’ phosphates or to kinase the primers beforehand. The protocol to kinase primers is supplied below, and the necessary reagents are provided with this Kit. Size selection on an agarose gel is highly recommended to remove contaminating DNA, truncated or aberrant PCR products, and PCR primers. We recommend purifying the DNA bands from the gel using a commercial purification kit. If the DNA is not gel fractionated, it can be purified using a commercial purification kit or by ethanol precipitation. The DNA should be eluted or dissolved in water.

Purification and Size Fractionation of DNA

DNA must be purified from restriction or repair enzymes before ligation to the pSMARTac™ Vector. Agarose gel electrophoresis, which is commonly used to size fractionate DNA fragments, is sufficient for purification. If end-repaired DNA is not fractionated by electrophoresis after repair or digestion, it must be purified by phenol/chloroform extraction or binding to a DNA purification column to remove the repair enzymes.

Sensitivity of DNA to Short Wavelength UV Light DNA resolved on agarose gels is generally stained with ethidium bromide and visualized by illumination with ultraviolet light. Exposure to short wavelength ultraviolet light (e.g., 254, 302, or 312 nm) can reduce cloning efficiencies by several orders of magnitude (Figure 5). Note that the wavelength of most UV transilluminators, even those designated specifically for DNA visualization, is typically 302 nm or 312 nm, and can cause significant damage to DNA. Use a long wavelength (e.g., 360 nm) low intensity UV lamp and short exposure times when isolating DNA fragments from agarose gels.



No UV 30s 302nm 60s 302nm 120s 302nm 120s 360nm

Figure 5. Relative cloning efficiency of pUC19 after exposure to short or long wavelength UV light. Intact pUC19 DNA was transformed after no UV exposure (“No UV”) or exposure to 302 nm UV light for 30, 60, or 90 seconds (“30s 302nm, 60s 302nm,120s 302nm”) or to 360 nm UV light for 120 seconds (“120s 360nm”). Cloning efficiencies were calculated relative to un-irradiated pUC19 DNA.

Softag™ Protein Purification Once the proper recombinant clone has been identified, grown and induced, the Softag fusion protein is ready for processing. Please ensure that your expressed protein contains the Softag-3 epitope by performing a confirmatory Western blot using crude cell lysates and the Softag3 Antibody provided in the Kit. The induced cells are concentrated by centrifugation and lysed by sonication or by using commercially available detergent reagents per the manufacturer’s instructions. The Softag affinity resin is poured into a column and washed in preparation for affinity purification. A clarified extract of the lysed cells is passed over the column, washed, and the purified protein is eluted using the supplied buffers. Materials and Equipment Needed The Softag Protein Expression & Purification Kit supplies many of the items needed to efficiently generate recombinant clones. While simple and convenient, successful use of the Kit requires proper planning for each step. Please read the entire manual and prepare the necessary equipment and materials before starting. It is assumed that common molecular biology equipment, supplies, and reagents are readily available. The following items are required for this protocol:

• Microcentrifuge and tubes. • If using the Kit with electrocompetent cells: Electroporation apparatus and cuvettes (0.1 cm, BTX Model

610, Eppendorf Cat.# 4307-000-569 or BioRad Cat.#165-2089 cuvettes are recommended. Invitrogen Cat.# 65-0300 are not recommended).

• Sterile 17 x 100 mm culture tubes. • LB Broth or YS Broth. • TY agar plates containing kanamycin (see Appendix for recipes). • Sonicator or cell lysis reagents.

Detailed Protocol

100%

10%

1%

0.1%

0.01%

0.001%



Preparation and Purification of Insert DNA Phosphorylated PCR Primers Reactions carried out with 5’-phosphorylated primers and a proofreading polymerase are suitable for the pSMARTac™ ligation reaction, as the PCR products are predominantly blunt-ended. However, size selection on an agarose gel is highly recommended to remove contaminating DNA, truncated or aberrant PCR products, and PCR primers. We recommend purifying the DNA bands from the gel by a commercial purification kit. If the DNA is not gel fractionated, it can be purified using a commercial purification kit. The DNA should be eluted or dissolved in water. PCR primers that do not contain 5’ phosphates can be enzymatically phosphorylated by T4 polynucleotide kinase (T4 PNK) before performing the PCR. T4 PNK enzyme and T4 PNK buffer mix (containing ATP) are included in the Softag Protein Expression and Purification Kits. Perform the primer kinase reaction as follows:

Primer kinase reaction

4 ul Forward primer @ 100 pmol/ul 4 ul Reverse primer @ 100 pmol/ul 1 ul 10 X T4 PNK buffer mix 1 ul T4 PNK 10 ul total

37°C, 15 minutes After the incubation, add 5 ul of this reaction directly to a 100 ul PCR mix and amplify according to standard protocols. Alternately, the PCR product may be amplified with non-phosphorylated primers and subsequently phosphorylated with T4 PNK. Use 1 ul of T4 PNK to phosphorylate up to 200 pmol of product. T4 PNK is not completely inactivated by heat treatment or thermal cycling. Traces of T4 PNK can carry over into the ligation reaction, resulting in a high background of self-ligated empty vector clones. Therefore, T4 PNK must be removed from the PCR product before ligation to the pSMARTac vector. Agarose gel electrophoresis can be used both to size-select the desired PCR product and to remove the T4 PNK. Other methods of DNA purification can be used if desired. Preparation of a 3’ NotI Overhang at the Carboxy Terminus Inadequate restriction of the NotI site will result in poor recombinant cloning efficiencies. The number of bases that extend beyond the NotI site is critical to achieving complete restriction. At least 8 bases of extra 3’ bases should be designed beyond the end of the NotI primer. Purification of Repaired Fragments If repaired or kinased fragments are subsequently fractionated by gel electrophoresis, no further purification is necessary to remove the repair and restriction enzymes. Use of short-wavelength UV light (e.g., 254, 302, or 312 nm) must be avoided. After electrophoresis, DNA may be isolated using your method of choice.

If the DNA is not fractionated by electrophoresis after end repair, it must be purified by extraction or binding to a purification column to remove the repair enzymes. Heat denaturation is NOT sufficient to inactivate the enzymes. Failure to completely remove residual enzymes may result in a large background of empty vector clones or greatly decreased ligation efficiency.

Ligation to the pSMARTac™ Vector



In the pSMARTac ligation reaction, the pre-processed pSMARTac 3N Vector is ligated with an insert containing an amino terminus blunt end and a carboxy terminus NotI overhang, both ends of which are phosphorylated, in a total volume of 10 μl. The amount of insert to use is 50-100 ng of DNA in the size range of 1,000 to 4,000 bp. The ligation is performed as follows:

1. Briefly centrifuge the pSMARTac 3N Vector Premix before use. Mix by gently pipeting up and down several times.

2. Combine the following components in a 1.5-ml tube, adding the ligase last: x μl Insert DNA (50-100 ng blunt plus NotI ends, 5’-phosphorylated) y μl H2O 2.5 μl 4X pSMARTac Vector 3N Premix (pSMARTac, ATP, buffer) 1.0 μl CloneSmart® DNA Ligase (2 U/μl) 10.0 μl total reaction volume

3. Mix by gently pipeting the reaction mixture up and down. Incubate at room temperature (21-25°C) for 30 minutes. If the maximum number of transformants is desired, ligation time can be extended to 2 hours.

Optional Control Reactions include the following:

Positive Control Insert DNA To determine the ligation and transformation efficiency with a known insert, use 1 μl (80 ng) of RFIP DNA.

Vector Background

To determine the background of empty vector, use water instead of insert in the above reaction.

Preparation for Transformation

1. Heat denature the ligation reaction at 70°C for 15 minutes if you have not done so already. 2. Cool to room temperature for 15 seconds followed by 0-4°C for 15 seconds to condense water vapor

inside the tube. 3. Spin 1 minute at 12,000 rpm to collect condensation and pellet precipitated material. 4. The sample is ready for transformation; precipitating the DNA is not necessary.

To ensure optimal cloning results, we strongly recommend the use of Lucigen’s E. cloni ® 10GF’ Electrocompetent Cells. These cells yield > 2 X 1010 of pUC19 to maximize the number of transformants. If you do not possess an electroporator, we recommend the use of Lucigen’s 10GF’ Chemically Competent Cells. These cells yield ≥ 5 X 108 cfu/ug of pUC19. The following protocols are provided for transformation of E. cloni 10GF’ Competent Cells.

Heat Shock Transformation of E. cloni 10GF’ Chemically Competent Cells

E. cloni 10GF’ Chemically Competent Cells are provided in 80 μl aliquots (DUOs), sufficient for two transformation reactions of 40 μl each. Transformation is performed by heat shock at 42ºC, followed by incubation on ice. To ensure successful transformation results, the following precautions must be taken:

• ESSENTIAL: After ligation, the reaction must be heat killed at 70°C for 15 minutes! • Heat-killed ligation reactions can be used directly, without purification of the ligation products.

• All microcentrifuge tubes must be thoroughly pre-chilled on ice before use.

• The cells must be completely thawed on ice before use.

Transformation Protocol for Chemically Competent cells 1. Remove E. cloni cells from the -80°C freezer and thaw completely on wet ice (10-20 minutes).

2. Transfer 40 μl of thawed competent cells to a fresh microcentrifuge tube chilled on ice.



3. Add 2-4 μl of the heat-denatured cloning ligation reaction to the 40 μl of cells on ice. Failure to heat-inactivate the ligation reaction will prevent transformation. Stir briefly with pipet tip; do not pipet up and down to mix, which can introduce air bubbles and warm the cells.

4. Incubate on ice for 30 minutes. 5. Heat shock cells by placing them in a 42oC water bath for 45 seconds. 6. Return the cells to ice for 2 minutes.

7. Add 260 μl of room temperature Recovery Medium to the cells in the culture tube.

8. Place the tubes in a shaking incubator at 250 rpm for 1 hour at 37°C.

9. Plate 50-250 μl of transformed cells on YT agar plates containing 30 μg/ml kanamycin. 10. Incubate the plates overnight at 37°C.

10. Transformed clones can be further grown in TB or any other rich culture medium EXPECTED RESULTS USING E. cloni 10G CHEMICALLY COMPETENT CELLS Plating chemically transformed cells and expected results.

Reaction Plate μl/Plate CFU/Plate Efficiency Experimental Insert (80 ng per ligation) 50 & 250 variable NA RFIP Insert (Positive Control) 100 > 300 > 99% inserts No-Insert Control (Vector Background) 200 < 30 <1% background Supercoiled pUC19 Transformation Control Plasmid (10 pg, AmpR) 2 > 200 > 1 x 108 cfu/μg

plasmid The results presented above are expected when cloning 80 ng of intact, purified RFIP DNA with blunt plus NotI ends and 5’ phosphate groups, into Lucigen’s pSMARTac Cloning vectors. When transforming E. cloni 10GF΄ Chemically Competent Cells (transformation efficiency >5 x 108 cfu/ug pUC19 DNA) the number of recombinant clones is typically 100-fold greater than the background of self-ligated vector. The background number of empty vector is constant (< 30 colonies per 200 μl of cells plated), unless kinase is introduced as a contaminant. However, use of too little insert DNA, or insert DNA that is improperly end-repaired, or modified DNA that is not repairable yields significantly lower recombinant cloning efficiencies. Cloning AT-rich DNA and other recalcitrant sequences may also lead to fewer colonies. With relatively few recombinant clones, the number of empty vector colonies becomes noticeable. For example, if the Experimental Insert ligation reaction produces only 250 colonies from 50 ul of cells plated, then the 30 colonies obtained from 250 ul of the No-Insert Control ligation will represent a background of 2%. When assessing the efficacy of cloning using the red fluorescent inducing protein gene, place a long wavelength UV transillumintor over the plates and score the number of colorless versus red fluorescent colonies. Approximately 70% will fluoresce red, even though >99% of the colonies will have inserts. The majority of the colorless colonies have authentic RFIP inserts that are out of frame or contain inserts that are too small to generate the colored product. Electroporation of E. cloni ® 10GF’ Electrocompetent Cells E. cloni 10GF΄ ELITE Cells are provided in 50µl (DUOs) aliquots, sufficient for two transformations of 25 μl each. Transformation is carried out in a 0.1 cm gap cuvette. Optimal settings for electroporation are listed in the table below. Typical time constants are 3.5 to 4.5 msec.

Optimal Setting Alternate Settings

(~ 20-50% lower efficiencies)



1.0 mm cuvette 10 μF 600 Ohms 1800 Volts

1.0 mm cuvette 25 μF 200 Ohms 1400 – 1600 Volts

Suggested Electroporation Systems: Bio-Rad Micro Pulser #165-2100; Bio-Rad E. coli Pulser #165-2102; Bio-Rad Gene Pulser II #165-2105; BTX ECM630 Electroporation System. Optional transformation control reactions include electroporation with 10 pg of supercoiled pUC19 DNA (1 μl of a 1:100 dilution of the provided stock solution of pUC19). To ensure successful transformation results, the following precautions must be taken:

• ESSENTIAL: After ligation, the reaction must be heat killed at 70°C for 15 minutes!

• Microcentrifuge tubes and electroporation cuvettes must be thoroughly pre-chilled on ice before use. Successful results are obtained with cuvettes from Eppendorf (Model 4307-000-569), BTX (Model 610), or BioRad (Cat. #165-2089). Users have reported difficulties using E. cloni cells with Invitrogen cuvettes (Cat. # 65-0030).

• The cells must be completely thawed on ice before use.

Transformation Protocol for Electrocompetent cells 1. Have Recovery Medium and 17 mm x 100 mm sterile culture tubes readily available at room temperature

(one tube for each transformation reaction). Transformation efficiency may decrease with the use SOC or other media.

2. Place electroporation cuvettes (0.1 cm gap) and microcentrifuge tubes on ice (one cuvette and one tube

for each transformation reaction). 3. Remove E. cloni cells from the -80°C freezer and place on wet ice until they thaw completely (10-15

minutes).

4. When cells are thawed, mix them by tapping gently. Add 25 μl of E. cloni cells to the chilled microcentrifuge tube on ice.

5. Add 1 μl of the heat-denatured ligation reaction to the 25 μl of cells on ice. Failure to heat-inactivate the

ligation reaction will prevent transformation. Stir briefly with pipet tip; do not pipet up and down to mix, which can introduce air bubbles and warm the cells. Use of more than 2 μl of ligation mix may cause electrical arcing during electroporation.

6. Carefully pipet 25 μl of the cell/DNA mixture into a chilled electroporation cuvette without introducing

bubbles. Quickly flick the cuvette downward with your wrist to deposit the cells across the bottom of the well. Electroporate according to the conditions recommended above.

7. Within 10 seconds of the pulse, add 975 μl of Recovery Medium to the cuvette and pipet up and down

three times to resuspend the cells. Transfer the cells and Recovery Medium to a culture tube. 8. Place the tube in a shaking incubator at 250 rpm for 1 hour at 37°C. 9. Spread up to 1-100 μl of transformed cells on YT agar plates containing 30 μg/ml kanamycin. 10. Incubate the plates overnight at 37°C. 11. Transformed clones can be further grown in TB or in any other rich culture medium. EXPECTED RESULTS USING E. cloni 10G ELECTROCOMPETENT CELLS



Plating electrocompetent transformed cells and expected results. Reaction Plate μl/Plate CFU/Plate Efficiency

Experimental Insert (100 ng per ligation) 5, 20 & 100 variable NA pSMARTac plus 80 ng blunt plus NotI RFIP Insert 5 > 500 > 99% inserts

No-Insert Control (Vector Background) 50 < 25 <1% background Supercoiled pUC19 Transformation Control Plasmid (10 pg, AmpR)

2 > 200 > 2 x 1010 cfu/μg plasmid

The results presented above are expected when cloning 80 ng of intact, purified FRIP DNA with blunt plus NotI ends and 5’ phosphate groups, into Lucigen’s E. cloni 10GF’ ELITE Electrocompetent Cells (transformation efficiency > 2 x 1010 cfu/ug pUC19 DNA).The number of recombinant clones is typically 1000-fold greater than the background of colonies from self-ligated pSMARTac™ vector. The background number of empty pSMARTac vector is constant (< 2 total colonies per 50 μl of cells plated), unless kinase or nuclease is introduced as a contaminant. However, use of too little insert DNA, or insert DNA that is improperly end-repaired, or modified DNA that is not repairable yields significantly lower recombinant cloning efficiencies. Cloning AT-rich DNA and other recalcitrant sequences may also lead to fewer colonies. With relatively few recombinant clones, the number of empty vector colonies becomes noticeable. For example, if the Experimental Insert ligation reaction produces only 250 colonies from 100 ul of cells plated, then the 2 colonies obtained from 50 ul of the No-Insert Control ligation will represent a background of 2%. When assessing the efficacy of cloning using the red fluorescent inducing protein gene, place a long wavelength UV transillumintor over the plates and score the number of colorless versus red fluorescent colonies. Approximately 70% will fluoresce red, even though >99% of the colonies will have inserts. The majority of the colorless colonies have authentic RFIP inserts that are out of frame or contain inserts that are too small to generate the colored product. Use of competent cells with a transformation efficiency of less than 2 x 1010 cfu/µg will result in proportionately fewer colonies. In particular, most chemically competent cells will yield ~1% of the number of colonies shown above.

Getting More Recombinants The simplest way to produce more recombinants is to increase the ligation reaction time to 2 hours and to plate more transformed cells. This can increase the yield of recombinants by 4-5 fold. Ligation times beyond 2 hours will not improve the results further. Use of higher transformation efficiency competent cells will also increase recombinant yields. Certain ORF products can prove recalcitrant to cloning due to a large size, the presence of toxic gene products or secondary structures, extremely biased base composition, or other unknown reasons.

Growing Transformed Cultures Colonies obtained from a pSMARTac transformation can typically be grown in LB or YS broth. However if you suspect that your protein of interest may be a toxic protein, colonies should not be grown in rich media such as Terrific Broth. Terrific Broth contains high levels of lactose, which can inadvertently induce the expression of the protein from the tac promoter. A suitable lactose-free media replacement for Terrific Broth is YS media (see Appendix A for recipe).

Screening for Recombinants Transformation by the empty pSMARTac cloning vector as well as recombinants other than the RFIP control insert provided here will result in white colored colonies. Because the background of empty vector transformants is low, colonies can be picked at random for growth and plasmid purification without using IPTG to induce the tac promoter. Verify that the plasmid contains the correctly sized insert by restriction digestion of the plasmid.



DNA Isolation & Sequencing Grow transformants in LB medium plus 30 μg/ml kanamycin. Use standard methods to isolate plasmid DNA. The pSMARTac™ plasmid contains the low copy number pBR origin of replication and produces DNA yields similar to that of pBR-based plasmids. E. cloni 10GF’ cells are recA and endA deficient to provide high quality plasmid DNA. pSMARTac For and Rev Sequencing Primers are provided with the Kit. Their sequences and orientations are shown in Appendix D.

Induction of Target Protein Using IPTG The following protocol is a general guide for expression of genes under the control of the IPTG-inducible tac promoter on a small scale (2 ml of induced culture). Inoculate 2 ml aliquots of LB or YS broth (see Appendix A for recipes) containing 30 μg/ml kanamycin and shake at 220-250 rpm at 37ºC overnight. The next morning, pipet 100 μl of each culture into fresh 2 ml aliquots containing the selection antibiotic. Incubate with shaking at 220-250 rpm at 37ºC until an OD of 0.6 (approximately 3 hr.). Remove 100 μl into a fresh tube and place on ice until needed for gel analysis as a non-induced control sample. To the rest of the culture sample, add IPTG to a final concentration of 1 mM. Incubate with shaking at 220-250 rpm at 37ºC for 2-8 hours. These values for IPTG concentration and induction time are guidelines and may require optimization depending on the gene expressed. After induction, place the cultures on ice.

PAGE/Western Blot Analysis Pipet 20 ul of each sample described above into a fresh microcentrifuge tube. Add 20 μl of 2x SDS gel sample buffer (see Appendix A for recipe) into each tube. Heat the tubes to 95ºC for 5 minutes. Load the uninduced and induced samples in adjacent lanes for analysis by SDS-PAGE (run two sets of uninduced and induced samples on the gel). After the gel has been run, cut the gel in half and stain one half of the protein gel with Coomassie Brilliant Blue Stain. Take the other half of the gel and transfer protein to nitrocellulose or PVDF. Perform a Western blot to confirm the presence of the Softag3 epitope on the protein of interest using the Softag3 antibody (mouse IgG2a monoclonal) included in the expression kit. It should be used at a 1/1000 dilution with extracts prepared as described above. A detailed western blot protocol can be found at: http://www.neoclone.com/support/protocols.

Softag™ Affinity Protein Purification For purification of your Softag labeled protein, a 50 ml culture of your recombinant E. cloni 10GF’ cells should provide you with a sufficient amount of starting material. Collect induced cells by centrifugation at 5000 x g for 10 minutes. Pour off the supernatant and process the cell pellet as described below. Lyse over-expressing bacteria by sonication in 1X Softag Wash Buffer (Prepare 1X Softag Wash Buffer by diluting the 10X Wash Buffer provided in the Softag Purification Kit with high quality deionized water), or by using commercially available, detergent lysis reagents per manufacturer’s instruction. Sonication may negatively impact the activity of some proteins, whereas detergent lysis methods may help to retain activity. The optimal lysis method for your specific protein will need to be determined empirically. When lysing bacteria by detergent methods, nucleic acids are not sheared, and the lysate may be viscous. Viscous lysates will impair column flow rates. The nucleic acids should be digested by an appropriate nuclease prior to proceeding. Clear the lysate by centrifugation at 20,000 x g. Decant the supernatant into a fresh centrifuge tube and repeat centrifugation as necessary until the lysate is cleared. Excessive bacterial debris will clog the column. Lysates should be centrifuged repeatedly until an insignificant pellet is observed. This pellet is often



glassy/clear in appearance. Centrifugal force may be increased as centrifuge tubes, rotors, and centrifuges allow. Cleared lysates that are frozen sometimes develop additional precipitates. If this is observed, repeat the centrifugation steps until a clear lysate is obtained. Prepare the chromatography column by pouring the Softag3 resin into a polypropylene column, included with the Kit, or another appropriately sized column. Allow the storage buffer to drain by gravity flow. All subsequent wash and elution steps may be done by gravity flow. Columns should have a resin bed of at least 1/2 inch to 1 inch in height. Appropriate gravity flow = 0.5ml – 2ml/minute. Equilibrate the Softag resin with 5 column-volumes of 1X Softag Wash Buffer. Avoid letting the resin dry out. Drying and re-hydration of the resin may negatively impact agarose structure and antibody function, and thus column performance. Apply the cleared lysate to the column. Avoid disturbing the resin bed by gentle application of lysate to the top of the resin. Wash the column with 10 column-volumes of 1X Softag Wash Buffer. The wash should be collected by fractionation and analyzed for protein content to determine when background bacterial proteins have been removed from the column. Monitoring the absorbance of the wash fractions at 280nm will confirm when background bacterial proteins have been completely removed. Alternately, Bradford or Lowry assays may be used to determine when background bacterial proteins have been completely removed from the column. Elute the purified protein from the column with Softag Elution Buffer. The Elution Buffer is a proprietary formulation containing Tris, NaCl, propylene glycol, and EDTA. The eluate should be collected in fractions and analyzed for protein content to determine when all of the protein has been eluted from the column. Suggested fraction sizes are 250 μl to 1 ml. Monitoring the absorbance of the elution fractions at 280nm will confirm which elution fractions contain purified protein. Alternately, Bradford or Lowry assays may be used to determine which elution fractions contain purified protein. Assess protein concentration and purity by SDS-PAGE. Protein may be stored in Softag Elution Buffer at -80°, -20°, or 4° C as necessary for your protein. Alternately, the protein may dialyzed into the buffer of your choice using dialysis tubing down to 8000 molecular weight cut off and stored as necessary for your protein. The column may be regenerated by washing with 10 column-volumes of 1M NaCl followed by equilibration with 1X Softag Wash Buffer as previously described. Softag3 resin may be reused 5-6 times. It is not recommended to use the resin for purification of a tagged different protein. After regeneration, the resin may be stored in 1X Softag Wash Buffer containing 0.02% azide. References 1. Thompson, N.E., Arthur, T.M. and Burgess, R.R. (2003). Development of an epitope tag for the gentle purification of proteins by immunoaffinity chromatography: application to epitope-tagged green fluorescent protein. Analytical Biochemistry 323, 171-9.

2. Duellman, S.J., Thompson, N.E., and Burgess, R.R. (2004). An epitope tag derived from human transcription factor IIB that reacts with a polyol-responsive monoclonal antibody. Protein Expression and Purification, 35, 147-55.

3. Sambrook, J. and Russell, DW. Molecular Cloning: A Laboratory Manual (Third Edition). 2001. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.



4.Paluh, J.L. and Yanofsky, C. (1986). High level production and purification of the E. coli trp repressor. Nucleic Acid Research 14, 7851-7860

5.Squires, C., Krainer, A., Barry, G., Shen, W.F. and Squires, C.L. (1981) Nucleotide sequence at the end of the gene for the RNA polymerase β’ subunit (rpoC). Nucleic Acid research 9, 6827-6840.

Appendix A: Media Recipes YT + kan Agar Medium for Plating of Transformants Per liter: 8 g Bacto-tryptone, 5 g yeast extract, 5 g NaCl, 15 g agar. Mix components, autoclave and cool to 55°C. For pSMARTac™ transformants, add kanamycin to a final concentration of 30 μg/ml. Pour into petri plates. LB Culture Medium Per liter: 10 g Bacto-tryptone, 5 g yeast extract, 5 g NaCl. Mix components and autoclave. YS Culture Medium Per liter: 8 g yeast extract, 8 g Peptone N-Z Soy BL7 (Sigma Cat# P6713), 5 g NaCl. Mix components and autoclave. 2x SDS Gel Sample Buffer 100 mM Tris-HCl (pH 6.5), 4% SDS, 0.2% bromophenol blue, 20% glycerol. Add dithiothreitol to a final concentration in the 2x buffer of 200 mM prior to use. Growing Transformed Cultures Colonies obtained from a pSMARTac transformation should not be grown in rich medium, such as Terrific Broth. Terrific Broth contains high levels of lactose, which can inadvertently induce the expression of the protein from the tac promoter.

SmarTac™ Expression/Softag™ Protein Purification Kit


Appendix B: Vector Map and Sequencing Primers

The pSMARTac™ Vector is supplied pre-digested, with blunt amino terminus and NotI carboxy terminus ends, both of which are dephosphorylated. Three CloneSmart®

transcriptional terminators border the cloning site to prevent transcription from the insert into the vector. Another terminator at the 3’ end of the kanamycin resistance gene prevents this transcript from reading into the insert DNA. The GenBank accession number of pSMARTac has not yet been assigned. The sequences of the TacSeq F and R primers are: TacSeq F 5’–GCTGTTGACAATTAATCATCGGC–3’ TacSeq R 5’–CCAGACCTGCGTTCAGCAGTTCTGCCA–3’

TacSeq F primer GCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGGATCCGAAGGAGATATACC CGACAACTGTTAATTAGTAGCCGAGCATATTACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCCTAGGCTTCCTCTATATGG

Start codon Softag Affinity Peptide M L T Q D P S R V G A Amino Terminus Blunt Site ATG TTA ACT CAA GAT CCT TCT CGT GTT GGT GCC TAC AAT TGA GTT CTA GGA AGA GCA CAA CCA CGG

Carboxy Terminus GGCCGCAAGACGCATCTGCCAGCCTGGCAGAACTGCTGAACGCAGGTCTGGGCGGTTCTGAT NotI Overhang CGTTCTGCGTAGACGGTCGGACCGTCTTGACGACTTGCGTCCAGACCCGCCAAGACTA TacSeq R primer



Appendix C: Cloning Troubleshooting Guide

Problem Probable Cause Solution Inefficient kinasing and or NotI restriction.

Check the insert DNA for self-ligation by gel electrophoresis. Repeat DNA fragment treatments using QC criteria before proceeding to the cloning step.

Contaminating enzymes in ligation reaction.

Heat-denature end repair reaction or restriction digest 10 minutes at 70oC. Purify DNA after end repair or restriction digestion reaction.

No DNA, degraded DNA, or insufficient amount of DNA.

Check insert DNA by gel electrophoresis. Determine concentration of insert and add the correct amount. Use the supplied control insert to test the system.

Ligation reaction failed.

Check the insert DNA for self-ligation by gel electrophoresis. Be sure insert DNA is phosphorylated. Use the supplied control insert to test ligation reaction.

Inadequate heat denaturation after ligation reaction.

DO heat denature for 15 min at 70°C. Skipping this step may lower the number of transformants by 2-3 orders of magnitude.

Loss of DNA during precipitation.

DO NOT precipitate DNA after ligation reaction. It is not necessary with this protocol and these cells.

Incorrect recovery media.

DO NOT use TB (Terrific Broth) or SOC for recovery media. Only use the Recovery Medium supplied in the Kit.

Improper electroporation conditions.

Use pre-chilled electroporation cuvettes. Use cuvettes with a gap of 0.1 cm (BTX, Eppendorf, or BioRad brand). Add 1 μl of DNA to 25 μl of pre-aliquotted cells on wet ice; DO NOT add the cells to the DNA.

Very few or no transformants

Incorrect amounts of antibiotic in agar plates. Wrong antibiotic used.

Add the correct amount of kanamycin to molten agar at 55oC before pouring plates. DO NOT spread antibiotic onto the surface of agar plates.

Contaminating enzymes in ligation reaction.

Purify DNA after DNA kinase plus NotI restriction reaction. DO NOT add T4 DNA Kinase to the ligation reaction.

Inserts are small or contain active promoters.

Analyze colonies by PCR or restriction digestion to confirm the presence of inserts.

Inserts are unstable. Use 10GF’ cells and plate without IPTG. Grow at room temperature.

High background of blue colonies or of transformants that do not contain inserts.

Incorrect amount of antibiotic in agar plates.

Add the correct amount of kanamycin to molten agar at 55oC before pouring plates. DO NOT spread antibiotic onto the surface of agar plates.



Appendix D: Expression/Purification Troubleshooting Guide

Appendix E: Sequence of pSMARTac 3N tac prom(46,74)>>> | 1 CCTGAATGATATCAAGCTTGAATTCGTTACGCGCGAGGCAGCTGTTGACAATTAATCATC 60 GGACTTACTATAGTTCGAACTTAAGCAATGCGCGCTCCGTCGACAACTGTTAATTAGTAG BamHI | 61 GGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGGATCCG 120 CCGAGCATATTACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCCTAGGC HpaI Insertion NotI | Site | 121 AAGGAGATATACCATGTTAACTCAAGATCCTTCTCGTGTTGGTGCC | GCGG 180 TTCCTCTATATGGTACAATTGAGTTCTAGGAAGAGCACAACCACGG CGCC BglI | 181 CCGCAAGACGCATCTGCCAGCCTGGCAGAACTGCTGAACGCAGGTCTGGGCGGTTCTGAT 240 GGCGTTCTGCGTAGACGGTCGGACCGTCTTGACGACTTGCGTCCAGACCCGCCAAGACTA

Problem Probable Cause Solution Lysate not fully cleared Centrifuge lysate until no discernable pellet is

observed. Gently resuspend top layers of agarose and remove from column.

Clogged column

Nucleic acids present in lysate

Treat lysate with an appropriate nuclease or sonicate. The lysate should not be viscous.

Softag3TM agarose not properly equilibrated

Equilibrate the Softag3TM agarose with 1X Softag wash buffer

Recombinant protein not overexpressed

Check lysate by SDS-PAGE and/or western blot to confirm overexpression of recombinant protein

Low recovery of recombinant protein

Epitope tag not present Recombinant proteins may be cleaved for various reasons during expression or lysate preparation. Use of protease inhibitors may prevent cleavage. Check lysate and column flow through by a combination of SDS-PAGE and western blot to confirm epitope tag is attached to the over expressed protein of the expected molecular weight.

Recombinant protein expressed in inclusion bodies

Lyse induced bacteria directly in an SDS-PAGE running buffer and check for over expression by SDS-PAGE and/or western blot. Compare these results to SDS-PAGE and/or western blot assays of cleared lysate. During IPTG induction incubate culture at room or lower temperature to obtain more soluble recombinant protein.



241 AACGAGTAATCGTTAATCCGCAAATAACGTAAAAACCCGCTTCGGCGGGTTTTTTTATGG 300 TTGCTCATTAGCAATTAGGCGTTTATTGCATTTTTGGGCGAAGCCGCCCAAAAAAATACC 301 GGGGAGTTTAGGGAAAGAGCATTTGTCAGAATATTTAAGGAATTTCTGAATACTGACGAA 360 CCCCTCAAATCCCTTTCTCGTAAACAGTCTTATAAATTCCTTAAAGACTTATGACTGCTT XbaI DraI | | 361 TTCTCTAGATATCGCTCAATACTGACCATTTAAATCATACCTGACCTCCATAGCAGAAAG 420 AAGAGATCTATAGCGAGTTATGACTGGTAAATTTAGTATGGACTGGAGGTATCGTCTTTC 421 TCAAAAGCCTCCGACCGGAGGCTTTTGACTTGATCGGCACGTAAGAGGTTCCAACTTTCA 480 AGTTTTCGGAGGCTGGCCTCCGAAAACTGAACTAGCCGTGCATTCTCCAAGGTTGAAAGT 481 CCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGC 540 GGTATTACTTTATTCTAGTGATGGCCCGCATAAAAAACTCAATAGCTCTAAAAGTCCTCG ORF_1 rf(2)(554,1369)>>> AvaI | | kan2 marker(554,1369)>>> XhoI | | 541 TAAGGAAGCTAAAATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAA 600 ATTCCTTCGATTTTACTCGGTATAAGTTGCCCTTTGCAGAACGAGCTCCGGCGCTAATTT NruI | 601 TTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATC 660 AAGGTTGTACCTACGACTAAATATACCCATATTTACCCGAGCGCTATTACAGCCCGTTAG 661 AGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACA 720 TCCACGCTGTTAGATAGCTAACATACCCTTCGGGCTACGCGGTCTCAACAAAGACTTTGT 721 TGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGGCTAAACTGGCTGAC 780 ACCGTTTCCATCGCAACGGTTACTACAATGTCTACTCTACCAGTCCGATTTGACCGACTG 781 GGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTT 840 CCTTAAATACGGAGAAGGCTGGTAGTTCGTAAAATAGGCATGAGGACTACTACGTACCAA 841 ACTCACCACTGCGATCCCAGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTC 900 TGAGTGGTGACGCTAGGGTCCCTTTTGTCGTAAGGTCCATAATCTTCTTATAGGACTAAG 901 AGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGT 960 TCCACTTTTATAACAACTACGCGACCGTCACAAGGACGCGGCCAACGTAAGCTAAGGACA 961 TTGTAATTGTCCTTTTAACGGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAAT 1020 AACATTAACAGGAAAATTGCCGCTAGCGCATAAAGCAGAGCGAGTCCGCGTTAGTGCTTA 1021 GAATAACGGTTTGGTTGGTGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGA 1080 CTTATTGCCAAACCAACCACGCTCACTAAAACTACTGCTCGCATTACCGACCGGACAACT 1081 ACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCA 1140 TGTTCAGACCTTTCTTTACGTATTCGAAAACGGTAAGAGTGGCCTAAGTCAGCAGTGAGT 1141 TGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGA 1200 ACCACTAAAGAGTGAACTATTGGAATAAAAACTGCTCCCCTTTAATTATCCAACATAACT 1201 TGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCT 1260



ACAACCTGCTCAGCCTTAGCGTCTGGCTATGGTCCTAGAACGGTAGGATACCTTGACGGA 1261 CGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCC 1320 GCCACTCAAAAGAGGAAGTAATGTCTTTGCCGAAAAAGTTTTTATACCATAACTATTAGG ROP other(1371,1561)>>> | 1321 TGATATGAATAAATTGCAGTTTCACTTGATGCTCGATGAGTTTTTCTAAATGACCAAACA 1380 ACTATACTTATTTAACGTCAAAGTGAACTACGAGCTACTCAAAAAGATTTACTGGTTTGT 1381 GGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGA 1440 CCTTTTTTGGCGGGAATTGTACCGGGCGAAATAGTCTTCGGTCTGTAATTGCGAAGACCT 1441 GAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCA 1500 CTTTGAGTTGCTCGACCTGCGCCTACTTGTCCGTCTGTAGACACTTAGCGAAGTGCTGGT 1501 CGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTG 1560 GCGACTACTCGAAATGGCGTCGACGGAGCGCGCAAAGCCACTACTGCCACTTTTGGAGAC ApaI pBR322 origin(1610,2225)<<< | | 1561 ATGAGGGCCCAAATGTAATCACCTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTGCTGGC 1620 TACTCCCGGGTTTACATTAGTGGACCGAGTGGAAGCCCACCCGGAAAGACGCAACGACCG 1621 GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGATGCTCAAGTCAGAG 1680 CAAAAAGGTATCCGAGGCGGGGGGACTGCTCGTAGTGTTTTTAGCTACGAGTTCAGTCTC 1681 GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT 1740 CACCGCTTTGGGCTGTCCTGATATTTCTATGGTCCGCAAAGGGGGACCTTCGAGGGAGCA 1741 GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG 1800 CGCGAGAGGACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAAGAGGGAAGCCC 1801 AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG 1860 TTCGCACCGCGAAAGAGTATCGAGTGCGACATCCATAGAGTCAAGCCACATCCAGCAAGC 1861 CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGG 1920 GAGGTTCGACCCGACACACGTGCTTGGGGGGCAAGTCGGGCTGGCGACGCGGAATAGGCC 1921 TAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC 1980 ATTGATAGCAGAACTCAGGTTGGGCCATTCTGTGCTGAATAGCGGTGACCGTCGTCGGTG AlwNI | 1981 TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG 2040 ACCATTGTCCTAATCGTCTCGCTCCATACATCCGCCACGATGTCTCAAGAACTTCACCAC 2041 GCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT 2100 CGGATTGATGCCGATGTGATCTTCTTGTCATAAACCATAGACGCGAGACGACTTCGGTCA 2101 TACCTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGT 2160 ATGGAGCCTTTTTCTCAACCATCGAGAACTAGGCCGTTTGTTTGGTGGCGACCATCGCCA 2161 GGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCT 2220 CCAAAAAAACAAACGTTCGTCGTCTAATGCGCGTCTTTTTTTCCTAGAGTTCTTCTAGGA



2221 TTGATTTTCTACCGAAGAAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCAGTC 2280 AACTAAAAGATGGCTTCTTTCCGGGTGGGCACTTCCACTCGGTCACTCAACTAACGTCAG 2281 CAGTTACGCTGGAGTCTGAGGCTCGT 2306 GTCAATGCGACCTCAGACTCCGAGCA Appendix F: Technical Data- Softag3 Antibody This antibody recognizes Softag3 epitope tagged proteins produced in bacterial hosts.

Technical Data Host Mouse Isotype IgG2a Epitope TQDPSRVG Polyol-responsive Yes Clone IIB8 Cross reactivity Epitope tagged recombinant proteins Available size 50, 200, and 1000 μg purified antibody (Protein G)

Handling requirements Concentration 1 mg/ml in PBS pH 7.2 Storage -20°C for short term use, -70°C for long term storage Avoid repeated freeze/thaw

Applications Immunoaffinity chromatography Yes Immunoprecipitation Yes Western Blot Yes 1:1000 Appendix G: Technical Data- Softag3 Affinity Resin Softag3 Affinity Resin is an immunoaffinity resin appropriate for purifying tagged proteins from prokaryotic expression sources. The epitope is derived from a subunit of eukaryotic transcription factor TFIIB.

Technical Data Resin 4% Cross-linked Agarose Epitope TQDPSRVG Binding Capacity 0.38 +/- 0.04 mg/ml (based on 28kD tagged GFP

protein) Elution Conditions Use 5 column volumes 1X Softag Elution Buffer

Handling requirements Storage Buffer 1 X Softag Wash Buffer Storage Conditions 4°C until use. Use at Room Temperature. Stability At least 12 months if stored at 4°C

Notes

This resin is also appropriate for use in identifying proteins associated with the recombinant protein tagged with the Softag3 epitope.

softag protein expression purification...

Documents