lable at ScienceDirect

Insect Biochemistry and Molecular Biology 54 (2014) 42e52

Contents lists avai

Insect Biochemistry and Molecular Biology

journal homepage: www.elsevier .com/locate/ ibmb

Expression and characterization of an epoxide hydrolase fromAnopheles gambiae with high activity on epoxy fatty acids

Jiawen Xu, Christophe Morisseau, Bruce D. Hammock*

Department of Entomology and Nematology, UC Davis Comprehensive Cancer Center, University of California, One Shields Avenue, Davis, CA 95616, USA

a r t i c l e i n f o

Article history:Received 19 July 2014Received in revised form8 August 2014Accepted 15 August 2014Available online 27 August 2014

Keywords:CharacterizationEpoxide hydrolaseAnopheles gambiaeEpoxy fatty acids

Abbreviations: EH, epoxide hydrolase; JH, juveepoxide hydrolase; mEH, microsomal epoxide hydrolepoxide hydrolase; AgEH, EH from Anopheles gambiapiens; MsEH, sEH from Mus musculus; RsEH, sEH frosEH1 from Strongylocentrotus purpuratus; SpEH2, spurpuratus; AtEH, sEH from Arabidopsis thaliana; GsEHsEH from Solanum tuberosum; CeEH1, sEH1 from CasEH2 from Caenorhabditis elegans; HmEH, mEH fromfrom Rattus norvegicus; DmEH, mEH from Drosophilafrom Manduca sexta; BmJHEH-r1, JHEH-r1 from Bomoxide; t-SO, trans-stilbene oxide; t-DPPO, trans-depoxyeicosatrienoic acids; EpOME, epoxy octadecadamantan-1-yl-ureido) dodecanoic acid;trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-bentrifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl* Corresponding author. Tel.: þ1 530 752 7519; fax

E-mail address: bdhammock@ucdavis.edu (B.D. H

http://dx.doi.org/10.1016/j.ibmb.2014.08.0040965-1748/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

In insects, epoxide hydrolases (EHs) play critical roles in the metabolism of xenobiotic epoxides from thefood resources and in the regulation of endogenous chemical mediators, such as juvenile hormones.Using the baculovirus expression system, we expressed and characterized an epoxide hydrolase fromAnopheles gambiae (AgEH) that is distinct in evolutionary history from insect juvenile hormone epoxidehydrolases (JHEHs). We partially purified the enzyme by ion exchange chromatography and isoelectricfocusing. The experimentally determined molecular weight and pI were estimated to be 35 kD and 6.3respectively, different than the theoretical ones. The AgEH had the greatest activity on long chain epoxyfatty acids such as 14,15-epoxyeicosatrienoic acids (14,15-EET) and 9,10-epoxy-12Z-octadecenoic acids(9,10-EpOME or leukotoxin) among the substrates evaluated. Juvenile hormone III, a terpenoid insectgrowth regulator, was the next best substrate tested. The AgEH showed kinetics comparable to themammalian soluble epoxide hydrolases, and the activity could be inhibited by AUDA [12-(3-adamantan-1-yl-ureido) dodecanoic acid], a urea-based inhibitor designed to inhibit the mammalian soluble epoxidehydrolases. The rabbit serum generated against the soluble epoxide hydrolase of Mus musculus can bothcross-react with natural and denatured forms of the AgEH, suggesting immunologically they are similar.The study suggests there are mammalian sEH homologs in insects, and epoxy fatty acids may beimportant chemical mediators in insects.

© 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Anopheles gambiae mosquitoes are the most important vectorsof malaria, which is one of the most severe insect-borne diseases.Approximately 3.3 billion people worldwide are at risk from

nile hormone; sEH, solublease; JHEH, juvenile hormonee; HsEH, sEH from Homo sa-m Rattus norvegicus; SpEH1,EH2 from Strongylocentrotus, sEH from Glycine max; StEH,enorhabditis elegans; CeEH2,Homo sapiens; RmEH, mEHmelanogaster; MsJHEH, JHEHbyx mori; c-SO, cis-stilbeneiphenylpropene oxide; EET,enoic acids; AUDA, 12-(3-t-TUCB, trans-4-{4-[3-(4-zoic acid; TPPU, 1-) urea.: þ1 530 752 1537.ammock).

malaria, and it caused an estimated 627,000 deaths in 2012 (WHO,2012). In order to understand the blood feeding behavior and theunique interactions between mosquitoes and their hosts, recentstudies have found a variety of blood-derived factors that areingested by female mosquitoes, and are still biologically active inthe midgut. These blood components include some cytokines (TGF-b1), growth factors (insulin and insulin-like growth factors), path-ogen derived molecules (glycosylphosphatidylinositols and hemo-zoin of Plasmodium falciparum) and others (Akman-Anderson et al.,2007; Beier et al., 1994; Lim et al., 2005; Surachetpong et al., 2009).These blood-derived molecules can trigger the conserved signalingpathways in mosquitoes to affect mosquito physiology, like aging,reproduction, immune responses and disease transmission pat-terns (Pakpour et al., 2013), which can critically affect the capacityof mosquitoes as disease vectors. To fully comprehend the in-teractions between mosquitoes and their hosts, additional bloodfactors need to be identified and their functions studied.

Epoxy fatty acids and their corresponding diols are autocrineand paracrine signaling molecules. Epoxyeicosatrienoic acids(EETs) are epoxygenated metabolites of C-20 arachidonic acid, andEETs belong to a group of potent chemical mediators termed

Delta:1_given nameDelta:1_surnameDelta:1_given namemailto:bdhammock@ucdavis.eduhttp://crossmark.crossref.org/dialog/?doi=10.1016/j.ibmb.2014.08.004&domain=pdfwww.sciencedirect.com/science/journal/09651748http://www.elsevier.com/locate/ibmbhttp://dx.doi.org/10.1016/j.ibmb.2014.08.004http://dx.doi.org/10.1016/j.ibmb.2014.08.004http://dx.doi.org/10.1016/j.ibmb.2014.08.004

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e52 43

eicosanoids. Together with prostaglandins and leukotrienes, theseeicosanoids have been extensively studied in the mammalian sys-tems in the context of human health and drug development(Morisseau and Hammock, 2013; Tapiero et al., 2002). In insects it isknown that eicosanoids are also involved in insect physiology suchas ion transport, reproduction and immunity (Stanley, 2006;Stanley and Kim, 2014; Stanley and Miller, 2006).

Epoxy fatty acids are endogenous substrates in mosquitoes. Likemammals, mosquitoes may synthesize epoxides of unsaturatedfatty acids by a variety of cytochrome p450 enzymes. In addition,epoxy fatty acids are regular components of mammalian blood(Imig, 2012; Jiang et al., 2012, 2005), and may be xenobiotic sub-strates for the female mosquitoes during blood feeding.

In mammals, EETs are short-lived lipid signaling molecules, andare mainly hydrolyzed by the soluble epoxide hydrolase (sEH),which was discovered while studying the mammalian metabolismof insect juvenile hormone and its analogs (Gill et al., 1974, 1972).The sEH turned out to be a therapeutic target for a variety ofmammalian diseases (Imig, 2005; Imig and Hammock, 2009;Schmelzer et al., 2005; Zhang et al., 2007). In insects, epoxide hy-drolases with activities on juvenile hormones (JHEHs) are the bestcharacterized EHs (Anspaugh and Roe, 2005; Keiser et al., 2002;Khalil et al., 2006; Seino et al., 2010; Tsubota et al., 2010; Zhanget al., 2005). These EHs are believed to be involved in the meta-bolic degradation of juvenile hormones in vivo (Li et al., 2004;Prestwich et al., 1996), which are key developmental and repro-ductive hormones (Goodman and Cusson, 2011). So far, the insectmEHs and JHEHs characterized are homologous to mammalianmicrosomal epoxide hydrolases (Newman et al., 2005; Prestwichet al., 1996). The homologs of mammalian soluble epoxide hydro-lases in insects have not been studied to our knowledge, althoughthe sEH homologs had been reported in the Caenorhabditis elegans(Harris et al., 2008). The AgEH characterized here shows evolu-tionary, biochemical, and immunological similarities to mamma-lian sEHs, suggesting there are sEH homologs in insects, and epoxyfatty acids may be important chemical mediators for insects. Thebiochemical characterization from this study provides knowledgeand tools to pave the road for investigating whether epoxy fattyacids (such as EETs, known for biomedical studies from mammals)play a profound role in mosquito biology.

2. Materials and methods

2.1. Phylogeny analysis

Protein sequences of previously reported epoxide hydrolasesand putative mosquito EH sequences were obtained from thedatabase in the National Center for Biotechnology. Sequences werealigned and compared by ClustalWOmega. The phylogeny tree wasgenerated using MEGA Version 5.2.1 (Tamura et al., 2011) with theNeighbor-Joining method (Saitou and Nei, 1987). 26 EH sequenceswere employed to infer the bootstrap consensus tree from 1000replicates (Felsenstein, 1985). The percentage of replicate trees inwhich the associated taxa clustered together in the bootstrap test(1000 replicates) is shown next to the branches. The evolutionarydistances were computed using the Poisson correction method.

2.2. Generation of recombinant virus

Many epoxide hydrolases have been successfully expressed inthe baculovirus system by insect cells. We also chose to express theAgEH with this eukaryotic expression system. The sf-9 cell lines areof insect origin, and we did not detect significant backgroundepoxide hydrolase activities with the substrates used under theassay conditions. The open reading frame sequence (AGAP 011972)

was purchased from GenScript (Piscataway, NJ). Primers weredesigned to add Bgl II and EcoR I endonuclease-cutting sites at theN-terminal and C-terminal end, respectively. There were no tagsadded. The insert was cloned into the transfer vector pAcUW 21(Weyer et al., 1990) by T4 DNA ligase (New England Biolabs, MA).Recombinant baculoviruses were generated by co-transfection ofinsect Sf9 cells with Bsu 36 I-digested BacPak 6 viral DNA (Clontech,CA) and the transfer vector pAcUW 21. Recombinant viruses wereamplified and isolated by three consecutive plaque assays to ensureconsistency. The titer of final recombinant viruses was determinedby plaque assays, which was 5.4 � 108 pfu/ml.

2.3. Baculovirus expression and differential centrifugation

Control recombinant CpJHE baculoviruses and recombinantAgEH baculoviruses were used to infect insect Sf-9 cells, whichwere grown to a density of 1 � 106 cells/ml in Ex-cell 420 serumfree medium (SigmaeAldrich, MO) with 1% Pen/Step antibiotics(SigmaeAldrich, MO) in a 50 ml shaker. The two recombinant vi-ruses were generated in the same way, except that the insertedgenes were different. Cells infected by CpJHE will express anesterase (Kamita et al., 2011) instead of an epoxide hydrolase. Virus(10 M.O.I) was added, and cells were harvested two days postinfection.

All of the following operations were carried out at 4 �C or lower.Infected cells were pelleted at 100 � g for 10 min and resuspendedin pH 8, 50 mM Tris buffer with 1 mM EDTA and 1 mM PMSF. APolytron homogenizer (6000 rpm for 60 s) was used to break thecells. The crude homogenates were centrifuged at 800 � g for10 min to remove cell debris, and the supernatant was centrifugedat 17,000 � g for 20 min to spin down mitochondria and peroxi-some fractions. Then the supernatant was subjected to 100,000 � gfor 60 min. The resulting supernatant was collected as the cytosolicfraction, and the pellet resuspended in Tris buffer containing 0.02%CHAPS as the microsomal fraction. For each step, the pellets werewashed once by Tris buffer before any further processing. Proteinconcentrations were determined by the BCA protein assay (Pierce,IL) throughout this study with BSA as the standard.

2.4. Optimal pHs for enzyme activity and stability

In order to investigate the effects of pH on enzyme activity andstability, cells were disrupted in different buffers. Sodium acetate(pH 5 and 6), BiseTris (pH 6 and 7), phosphoric buffer (pH 7 and 8),Tris (pH 8 and 9), borate (pH 9 and 10), CAPS (pH 10 and 11) werechosen to cover the pH range between 5 and 11. All buffers were50 mM in concentration and sodium chloride was added accord-ingly to make constant ionic strength at 100 mM for each buffer.Enzyme activity was detected with t-DPPO as the substrate.

2.5. Effect of ionic strength and inhibitors on enzyme activity

Sodium chloride solutions (0 mMe3000 mM) were preparedand added into 50mM Tris buffers, pH 8 to adjust the ionic strengthbetween 50 mM and 2000 mM. The effects of ionic strength(50 mM �2000 mM) on enzyme activity were detected with t-DPPO, juvenile hormone III and 14,15-EET as the substrate(Morisseau, 2007).

Six small molecule inhibitors of different structural classes wereused to study the inhibition patterns of the recombinant AgEH. Thesynthesis, chemical and physical properties of these compoundsare described somewhere else (Morisseau et al., 1999, 2002;Severson et al., 2002). Inhibitors were prepared in DMSO. 1 ml ofinhibitors at the appropriate concentration was added into 100 mlenzyme solutions before addition of substrates (t-DPPO, JH III or

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e5244

14,15-EET). 1 ml of DMSO was added into enzyme solutions as acontrol, although inhibition by DMSO was not observed at 1% (v/v)concentration. Enzymes from the microsomal fractions were used,and the incubation time was 5 min.

2.6. Solubilization of AgEH activity from the membrane

Enzymes were obtained by disrupting insect Sf-9 cells two daysafter infection by baculoviruses at an M.O.I of 10. Microsomes wereprepared as described in Section 2.3. Multiple conditions wereevaluated to release the enzyme from the membrane, includinghigh salt buffer (sodium chloride, 0 Me3 M), urea (1 M), sonication(3 � 30 s) and detergents (Triton-X100, CHAPS at varied concen-trations). The microsomes were treated and incubated for 1 h at4 �C. The solution was centrifuged again at 100,000 � g for 1 h. Theenzyme activity in the supernatant and pellet wasmeasuredwith t-DPPO as the substrate.

2.7. Enzyme assays and determination of kinetics

c-SO, t-SO, t-DPPO and JH III were tritium-labeled epoxidehydrolase substrates. The enzyme activity was determined bypartition assays as previously described (Borhan et al., 1995; Gillet al., 1983a; Mumby and Hammock, 1979). Briefly 1 ml of 5 mMc-SO, t-SO, t-DPPO, 14,15-EET, 9,10-EpOME or 0.5 mM JH III sub-strates in DMSO were added into 100 ml of the appropriatelydiluted enzyme solutions with 0.1 mg/ml BSA. For 9,10-EpOMEand 14,15-EET, the enzyme incubation was similar to tritium-labeled compounds, but the products were analyzed by LC-MS/MS (Morisseau, 2007).

The enzyme kinetics was studied using t-DPPO, JH III and 14,15-EETas substrates. Awide range of substrate concentrations was firstemployed to determine the approximate range of the Km. Then fivemore specific substrate concentrations covering the range Km/5 to5 � Km were used. Enzymes were diluted accordingly, and incu-bated for 5 min, 10 min and 30 min at 30 �C in a water bath. Eachassay was run in triplicate, and all the data within the linear rangewere included in subsequent calculations (Morisseau, 2007). Thekinetics was determined by three independent experiments. As aresult, for each substrate concentration, at least 9 datum pointswere available for the software SigmaPlot (Systat Software, CA) tofit the MichaeliseMenton equation.

2.8. Partial purification of AgEH by ion exchange chromatographyand isoelectric focusing

Solubilized AgEH fractions following treatment with 0.3%CHAPS were used as the starting materials, and was assigned as100% activity. Prepacked Q-Sepharose columns (GE healthcare, CA)were washed by 10 column volumes of starting buffer, whichcontains 20 mM, pH 8 TriseHCl, 0.3% CHAPS and 10% glycerol.Solubilized AgEH fractions were loadedwith a syringe, and the flowthrough was collected. The column was then washed by 5 columnvolumes of starting buffer, and then NaCl gradients (0.2 Me1 M).The flow rate was controlled at 1 ml/min.

The NaCl eluate with the highest enzyme specific activity wasdesalted by ultrafiltration (Amicon Ultra, 10K NMWL), and recon-stituted with pure water to the final volume of 60 ml, which con-tained 2% (w/v) pH 3-10 ampholytes (Bio-Rad, CA), 0.3% CHAPS and10% glycerol. In a cold room with temperature set at 4 �C, sampleswere loaded on the Rotofor cell (Bio-Rad, CA), and focusing was runat 10 W constant power with a cooling circulator set at 4 �C for 4 h.The initial conditions were 500 V and 20 mA. At equilibrium thevalues were 2000 V and 5 mA. 20 Rotofor fractions were collectedby vacuum aspiration. The pH of each fractionwasmeasured at 4 �C

using a Corning 430 pH meter. The pH was adjusted to 8 by adding100 ml of fraction solutions to 900 ml of 50 mM, pH 8 Tris buffer. Thespecific activity of each fractionwas then measured with t-DPPO asthe substrate.

2.9. SDS-PAGE and western blot analysis of purification fractions

Solubilized enzymes (S), 0.2 M NaCl Q-Sepharose eluate and aselection of Rotofor fractions (#3-#13) were loaded on a 4e20%Triseglycine gel (Life Technologies, CA), and stained by Sypro®

Ruby Red stain (Life Technologies, CA). The proteins were alsotransferred to a nitrocellulose membrane by the Pierce G2 FastBlotter (Thermo Scientific, IL). The membrane was blocked by 1%milk in Tris-buffered saline with 0.1% tween 20 (TBST) at roomtemperature for one hour, and blotted against a 1/10,000 dilutedpolyclonal mouse sEH antibody (Imig et al., 2002) in TBST at 4 �Covernight. The antibody was screened and found to have cross-reactivity with the AgEH (Fig. S4). The membrane was thenwashed in TBST and incubated with the 1/10,000 diluted goatanti-rabbit secondary antibody conjugated to horseradish perox-idase (Abcam, UK). Detection was achieved by incubating themembrane with SuperSignal® West PicoChemiluminescent Sub-strate (Thermo Scientific, IL) and exposing blot to an X-ray film for1 min.

2.10. Immunoprecipitation of the AgEH activity

20 mL of Pierce Protein A/G Plus Agarose slurry (10 mL of settledresin) was added into a microcentrifuge tube, and washed by 1Xcoupling buffer (Pierce, IL). Absorption at 280 nm was used to es-timate the protein concentration of the rabbit anti-mouse sEHserum (Imig et al., 2002). The serum varying from 30 mg to 1200 mgtotal IgG was added into the tube. The agarose-antibody mixturewas incubated on a rotator at room temperature for 60 min. Thetubewas subject to centrifugation at 1000� g for 2 min at 4 �C, andthe supernatant was discarded. The resinwas thenwashed twice by1X coupling buffer. The solubilized AgEH solution was pre-clearedby incubating 500 mL of the solubilized AgEH with the controlagarose resin (Pierce, IL) at 4 �C for 60 min with gentle end-over-end mixing. The pre-cleared solution was then added to theagarose resin coupled with mouse sEH serum. The mixture wasincubated overnight at 4 �C. After the incubation, the tube wascentrifuged, and the supernatant was collect for measuring theAgEH activity with t-DPPO as the substrate.

3. Results

3.1. Phylogeny analysis of the epoxide hydrolase from A. gambiae(AgEH)

Most epoxide hydrolases studied belong to the a/b hydrolasefamily, which share similar three-dimensional structures andenzymatic mechanism (Morisseau and Hammock, 2005; Newmanet al., 2005). Based on such structural and enzymatic similarities,in silico studies of the genome of A. gambiae revealed one putativeinsect epoxide hydrolase (AGAP 011972) that was distinct frominsect mEHs and JHEHs in homology. The resulting sequence (AGAP011972, showed in Fig. S1) contained conserved catalytic triad (D-159, H-319, D-291), oxyanion hole motif (HGXP, residues 90e93)and two tyrosines (Y-206, Y-261), which are all signature elementsfor epoxide hydrolases to function.

In the phylogenic analysis (Fig. 1), the AgEH was clustered withputative EH sequences from the other two medically importantmosquitoes, Aedes aegypti (2 sequences, prefixed with ‘AAEL’) andCulex quinquefasciatus (5 sequences, prefixed with ‘CPIJ’). Except for

Fig. 1. Phylogeny tree of the AgEH and other epoxide hydrolases from plants, insects, nematodes, sea urchins, chickens and mammals. The tree was generated by MEGA 5.2.1(Tamura et al., 2011). The full names of abbreviations are detailed in the paper. The accession number of amino acid sequences is shown in the parenthesis. The percentage ofreplicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches.

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e52 45

the orthologs in mosquitoes, the AgEH was most close to solubleepoxide hydrolases from C. elegans (CeEH 1 and 2), EH 3 and EH 4from Homo sapiens. It was also homologous to soluble epoxidehydrolase from plants (AtEH, from cress Arabidopsis thaliana; StEH,from potato Solanum tuberosum and GsEH, from soybean Glycinemax) to a lesser extent. These epoxide hydrolases contained theconserved C-terminal epoxide hydrolase domain of sEHs frommammals (Arahira et al., 2000; Morisseau et al., 2000), but lackedthe N-terminal phosphatase domain. Among all the sequencesanalyzed, the AgEH was remotely related to the reported micro-somal EH homologs, including mammalian microsomal EHs(RmEH, from rat Rattus norvegicus; HmEH, from human H. sapiens),mainly known for their role in detoxification (Morisseau andHammock, 2008), a microsomal EH (DmEH, from fruit flyDrosophila melanogaster) that cannot hydrolyze juvenile hormones(Taniai et al., 2003), and also insect JHEHs (MsJHEH, from the to-bacco horn worm Manduca sexta; BmJHEH-r1, from silkwormBombyx mori) that have a high hydrolytic activity on juvenile hor-mones (Seino et al., 2010; Touhara et al., 1994). There are also threeputative JHEH sequences in the tree (prefixed with AGAP), and theyall clustered with previously reported insect mEHs and JHEHs.

3.2. Substrate selectivity of AgEH

We moved on to test the hypothesis that the sequence AGAP011972 did code for a catalytically active epoxide hydrolase. Theenzyme was expressed in insect Sf-9 cells infected by 10 M.O.I re-combinant AgEH viruses or recombinant CpJHE viruses as a control.The reported data were corrected for non-enzymatic hydration inthe assays (Fig. S2). Epoxide hydrolase activity detected in celllysate from the CpJHE virus infection was about 700e1000 timeslower than the cell lysate from the AgEH virus infection (Fig. S2).

The structures of epoxide substrates are shown (Fig. 2). Therewas no activity greater than the non-enzymatic hydrolysis of c-SOand t-SO in cells infected by the recombinant AgEH viruses(Table 1). Although a typical substrate for many mammalian andinsect microsomal EHs (Gill et al., 1983b; Kamita et al., 2013;Morisseau and Hammock, 2005; Taniai et al., 2003), c-SO was nota substrate for the AgEH. However, the AgEH was catalyticallyactive on JH III (98 nmol diol formed � min�1 � mg1 protein), t-DPPO (564 nmol diol formed � min�1 � mg�1 protein), 14,15-EET(550 nmol diol formed � min�1 � mg�1 protein) and 9,10-EpOME(360 nmol diol formed � min�1 � mg�1 protein). t-DPPO is a

Fig. 2. Epoxide containing substrates evaluated in the study. The full names of thesubstrates are detailed in the text.

Table 1Substrate selectivity of the AgEH.

Substrate Specific activity (nmol diolformed/(min � mg protein))

c-SO

Fig. 3. Effects of pH and buffer composition on enzyme activity. Enzyme activity wasmeasured with t-DPPO as the substrate with triplicate assays. Data representmean ± SD (n ¼ 3) except when SD is smaller than the datum point.

Fig. 4. Enzyme stability in different buffers and pHs. The enzyme was stored in a bucket of crwith triplicate assays. Data represent the percentage of activity remaining (activity at day 1

Fig. 5. Inhibitors of the sEH (1e3) and mEH (4e6) used in the study. AUDA, t-TUCB andElaidamide (#4) is a potent microsomal EH inhibitor (Morisseau et al., 2008). #5 and #6 ar

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e52 47

3.5 fold and 11 fold higher than those of 9,10-EpOME, JH III and t-DPPO respectively.

The kinetics of AgEH on 14,15-EET and 9,10-EpOME is compa-rable to the soluble epoxide hydrolase from H. sapiens, to whichepoxy fatty acids are considered the endogenous substrates (Yuet al., 2000; Zeldin et al., 1993). The Vmax/Km of AgEH on 14, 15-EET and 9,10-EpOME were slightly higher (2.3 and 1.6 timesrespectively) than that of sEH fromH. sapiens, even considering thata crude microsomal fraction was used to determine the kinetics.The AgEH and the sEH from H. sapiens can both hydrolyze juvenilehormone III, at a lower Vmax/Km ratio than on epoxy fatty acids. TheJHEH fromManduca sexta hydrolyzed JH III with a low Km (0.28 mM)and a low Vmax (0.095 mmol � min�1 � mg�1 proteins) while AgEHhydrolyzed JH III with a high Km (9.8 mM) and a high Vmax(1.3 mmol � min�1 � mg�1 proteins). For t-DPPO, the Vmax/Km ofAgEH was 8 times lower than that of human sEH, but 46 timeshigher than that of MsJHEH.

ushed ice at a 4 �C freezer. Enzyme activity was measured with t-DPPO as the substrateis assigned 100%).

TPPU (#1 to #3) are urea-based mammalian sEH inhibitors (Morisseau et al., 1999).e two potent inhibitors for the JHEH from Manduca sexta (Severson et al., 2002).

Table 3Inhibition of the AgEH by sEH, mEH or JHEH inhibitors.

Inhibitors t-DPPO JH III 14,15-EET

5 nM 50 nM 500 nM 5 nM 500 nM 50 nM 5 nM 50 nM 500 nM

1 44.9 9.5 N.D. 57.2 11.2 4.7 79.0 34.7 7.12 90.4 57.3 12.5 96.3 85.2 34.3 98.4 60.3 91.03 99.5 94.0 81.8 100 98.9 100 100 100 1004 98.6 79.2 60.6 100 98.8 96.4 100 100 95.45 20.4 8.7 N.D. 70.3 45.9 22.6 100 86.3 32.36 50.6 28.7 8.6 94.7 70.2 50.7 100 100 64.0

Values are % of activity remaining with the presence of inhibitors. Inhibitors in DMSO were added, and incubated for 5 min before substrates were added into enzyme so-lutions. Enzymes from the microsomal fraction were used. Inhibition assays were done with triplicate assays. The SDs (n ¼ 3) are all within 10% of the mean value, and are notshown in the table. The enzyme assays were performed in 50 mM TriseHCl, pH 8.0 containing 50 mM substrates (5 mM for JH III), inhibitors, 1% (v:v) DMSO and 0.1 mg/ml BSAat 30 �C.

Fig. 6. IC50 of AUDA (Compound 1 in Fig. 5) on the AgEH's activity on 14,15-EET. The 4parameter logistic model describes the sigmoid-shaped response was used to calculatethe IC50 (SigmaPlot, C.A).

Table 5Attempts to release the AgEH activity from the microsomal membrane by treat-ments of salts, urea and sonication.

Treatment % Of activity recoveredfrom treatment

% Of activity remaining inthe microsomes

Washed microsomes 100 86 ± 5þ1M NaCl 94 ± 2 92 ± 4þ1M Urea 88 ± 2 81 ± 2þ3 � 30s Sonication 90 ± 1 85 ± 6

Microsomes were prepared and subjected by the corresponding treatments above.They were then repelleted and washed once with Tris buffer before t-DPPO activitywas measured in the resulting pellets and supernatant. Values are means ± SD(n ¼ 3).

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e5248

3.7. Solubilization of AgEH activity from the membrane

In order to solubilize the AgEH from the membrane, high saltbuffers, urea, sonication were first evaluated to release the enzymefrom the membrane. High salt buffer (sodium chloride at 0e3 M),urea (1 M) and sonication (3 � 30 s) did not release a significantamount of enzyme activity from the membrane (Table 5), whichsuggested that the enzyme was not loosely bound with themembrane.

Table 4Enzyme kinetics of the AgEH on four epoxide hydrolase substrates.

Substrate Kinetic parameter

t-DPPO Km (mM)Vmax (mmol � min�1 � mg�1)Vmax/Km(L � min�1 � mg�1)

9,10-EpOME Km (mM)Vmax (mmol � min�1 � mg�1)Vmax/Km(L � min�1 � mg�1)

JH III Km (mM)Vmax (mmol � min�1 � mg�1)Vmax/Km(L � min�1 � mg�1)

14,15-EET Km (mM)Vmax (mmol � min�1 � mg�1)Vmax/Km(L � min�1 � mg�1)

Enzymes from the microsomal fractions were used for kinetics.a The kinetics of MsJHEH on t-DPPO and JH III are from Severson and Touhara respective

the substrate.b The kinetics of human sEH on t-DPPO, 9,10-EpOME and 14,15-EET are from Morisse

Then we tried to solubilize the enzyme with two detergents(Triton X-100 and CHAPS), and the result is shown (Table 6). Theaddition of 0.3% CHAPS was detrimental to the activity (49% re-covery from resuspended microsomes), but could solubilize 75% ofrecovered enzyme activity to the supernatant, while in lowerconcentrations (0.01%e0.1%), the majority of activity was still in thepellets. Triton X-100 was not as efficient as CHAPS in solubilizingAgEH activity in terms of recovery and solubilized activity (33%maximum).

3.8. Partial purification of the AgEH and analysis of purificationfractions by SDS-PAGE and western blot

The starting material was 40 ml solubilized enzyme fractionswith a total activity of 52 U (1 U ¼ 1 mmol/min) and a specific

AgEH MsJHEHa hsEH

30.5 ± 5.0 65.6 6.2 ± 0.6b1.2 ± 0.1 0.059 2.1 ± 0.10.041 0.0009 0.34

7.0 ± 0.6 2.6 ± 0.4b

1.5 ± 0.4 N.A. 0.35 ± 0.030.21 0.13

9.8 ± 2.0 0.28 1.5 ± 0.61.3 ± 0.1 0.095 0.067 ± 0.0070.13 0.34 0.04

3.0 ± 0.3 7.0 ± 0.3b

1.4 ± 0.03 N.A 1.4 ± 0.050.46 0.20

ly (Severson et al., 2002; Touhara et al., 1994). N.A. indicates data are not available for

au (Morisseau et al., 2000, 2010).

Fig. 7. pH gradient and specific activity of Rotofor fractions. pH of fractions weremeasured, and 100 ml of each fraction was diluted with 900 ml 50 mM TriseHCl, pH 8buffer before activity was measured. Specific activity (mmol diols/(min � mg protein))was measured with t-DPPO as the substrate. The pI determined was 6.3.

Table 6Solubilization of the AgEH activity by CHAPS and Triton X-100.

Activity(mmol diol/min)in the pellet

Activity(mmol diol/min)in the supernatant

Recovery ofactivity aftertreatment (%)

% Of activityin thesupernatant

CHAPS percentage0.01% 0.08 ± 0.003 0.002 ± 0.0001 100 20.02% 0.07 ± 0.001 0.006 ± 0.0003 93 80.07% 0.06 ± 0.007 0.009 ± 0.0008 84 130.1% 0.06 ± 0.002 0.01 ± 0.003 85 140.2% 0.04 ± 0.001 0.015 ± 0.002 67 270.3% 0.01 ± 0.004 0.03 ± 0.002 49 750.4% 0.007 ± 0.001 0.015 ± 0.004 27 680.5% N.D. N.D. 0 0

Triton X-100 percentage0.01% 0.08 ± 0.003 0.003 ± 0.0001 100 40.02% 0.06 ± 0.002 0.015 ± 0.0004 90 200.07% 0.05 ± 0.004 0.018 ± 0.0005 82 260.1% 0.04 ± 0.001 0.02 ± 0.003 72 330.2% 0.03 ± 0.003 0.009 ± 0.0001 47 230.3% 0.009 ± 0.0008 0.001 ± 0.0001 12 10

The activity in microsomes with 0.01% detergent was assigned 100% activity. Thepellets were incubated with detergent at 4 �C for 1 h and re-pelleted. The criticalmicelle concentration (CMC) of CHAPS and Triton X-100 is 8e10 mM(0.4920e0.6150%, w/v) and 0.22e0.24 mM (0.013%e0.015%, w/v) respectively.

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e52 49

activity of 0.18 U/mg protein (Table 7). The 0.2 M NaCl Q-Sepharoseeluate contained 67% of total activity but only achieved 1.7 fold ofpurification, and lower specific activities were also detected inother fractions (Fig. S3). Ionic strength from 0.05 M to 2 M did nothave a significant effect on enzyme activity when t-DPPO was usedas the substrate (Table S1). The #7 Rotofor fraction had a total ac-tivity of 5 U and a specific activity of 3.13 U/mg proteins. Thus, thepurification factor was 17 fold with 10% recovery (Table 7).

The cDNA of the AgEH (AGAP 011972) is 1492 bp long with adeduced 340 amino acid sequence (Fig. S1). The predicted molec-ular mass and pI are 40.9 kD and 9.2 respectively (Artimo et al.,2012). The Rotofor determined pI of the AgEH was 6.3. High spe-cific activities were detected in fraction #4, 5, 6, 7, 8, and the highestactivity was found in fraction #7, which had a pH of 6.3 (Fig. 7).When proteins were loaded on a 4e20% gradient Triseglycine SDS-PAGE gel (Life Technologies, CA), and the PageRuler UnstainedProtein ladder (Thermo Scientific, MA) was used as the marker, aband approximate 35 kD (Fig. 8a) was found to correlate well withthe enzyme activity detected in different fractions. The band wasalso recognized by a rabbit serum against mouse soluble epoxidehydrolase (Fig. 8b). The rabbit serum also recognized a band ap-proximates 35 kD in the crude lysate of insect cells (Fig. S4) infectedby the recombinant AgEH baculoviruses, but not lysate of the CpJHEinfected cells (Fig. S4), which expresses a recombinant juvenilehormone esterase from C. quinquefasciatus. The CpJHE viruses weregenerated in the sameway as the AgEH, except for that the insertedgene was different (Kamita et al., 2011). The band was also cut forprotein sequencing (UC Davis Proteomics Core), which was diges-ted by trypsin. The data were analyzed by Scaffold version 4.3.2(Proteome Software Inc., OR) based on peptide and protein iden-tifications. The protein sequence of the AgEH was identified with

Table 7Partial purification of the recombinant AgEH.

Volume (mL) Total protein (mg) Total activity (mmo

Solubilized fraction 40 282 52Q-Sepharose 20 114 35Rotofor fraction#7 3 1.6 5

t-DPPO was used as the substrate. 1 U is 1 mmol/min 20 fractions were collected from R

100% probability to a false discover rate less than 0.1% and 1.0% forpeptide and protein identifications (Nesvizhskii et al., 2003)respectively.

3.9. Immunoprecipitation of the AgEH activity

The result of immunoprecipitation study is shown (Fig. 9).Whena constant amount of the solubilized AgEH was incubated with avarying amount of rabbit anti-mouse sEH serum, the AgEH activitywas precipitated in a dose-dependent manner, indicating the nat-ural form of the AgEH also cross-reacted with the rabbit serum.Elution of the AgEH by low pH and high salt buffer had not beensuccessful, and elution by SDS loading buffer resulted in a largecontamination of antibodies and other proteins. Therefore, we havenot obtained a homogenous and catalytically active AgEH.

4. Discussion

The AgEH has a different evolutionary history from insect mEHsand JHEHs. They share the same subcellular location, but havecomplementary and overlapping substrate selectivities. As a result,EH activities detected from a specific subcellular location cannot besimply assigned to one enzyme.

The AgEH orthologs are also found in the genome of A. aegyptiand C. quinquefasciatus, two medically important mosquitoes aswell as A. gambiae. Interestingly, wewere not able to find orthologsand activities on EETs in D. melanogaster. The orthologs all share anevolution different than the previously characterized insect JHEHsand mEHs. The catalytic triad (Asp-Asp-His) present in the ortho-logs is more commonly seen in sEHs. It is tempting to characterizethe orthologs in A. aegypti and C. quinquefasciatus, and determinewhether the orthologs are EHs, whether they can hydrolyze epoxyfatty acids or juvenile hormones, and whether the inhibitor andantibody described in this study can be useful tools.

l/min) Specific activity (U/mg protein) Yield (%) Purification factor

0.18 100 10.31 67 1.73.13 10 17

otofor cell and fraction #7 is shown because it has the highest specific activity.

Fig. 8. SDS-PAGE (a) and western blot analysis (b) of Rotorfor fractions.1 mg of solubilized enzymes (S), Q-Sepharose eluate (Q) and Rotofor fractions #3 e #13 were loaded on a4e20% Triseglycine gel (a). The proteins were also transferred to a nitrocellulose membrane and blotted against the rabbit serum against mouse sEH (b). The membrane wasexposed to an X-ray film in a dark room for 1 min.

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e5250

The substrate selectivity (structures showed in Fig. 2) suggeststhe AgEH hydrolyze 1,2-disubstituted epoxides (t-DPPO, 14,15-EET,9,10-EpOME) better than tri-substituted epoxides (JH III), and theAgEH does not hydrolyze epoxides that are sterically hindered onboth sides by bulky groups (c-SO and t-SO). The kinetics and inhi-bition patterns both show that epoxy fatty acids are preferredsubstrates among those that tested, and sEH inhibitor AUDA is themost potent inhibitors among the inhibitors evaluated. However,we can not exclude the possibility that the AgEHmay involve in themetabolism of juvenile hormone in certain conditions. While ju-venile hormone esterases are secreted to the hemolymph (Kamitaand Hammock, 2010), membrane-associated epoxide hydrolasesmay have a significant kinetic advantage regulating juvenile hor-mone titer within cells. Comparing the AgEH to the well-studiedJHEH from Manduca sexta, there are enormous differences in theKm and Vmax, while their catalytic efficiencies are within the samerange (Table 4). When the titer of juvenile hormones increases, the

Fig. 9. Immunoprecipitation of the AgEH activity. 100% activity refers to the amount ofactivity in the solution from non-immune IgG coupled agarose. Solubilized AgEH wassubjected to immunoprecipitation with rabbit serum against mouse soluble epoxidehydrolase. Different amount of IgG were bound to Pierce protein A/G resin plusagarose. Enzyme solutions were added, and incubated with gentle end-over-endmixing overnight at 4 �C before activity in the solution was measured with t-DPPOas the substrate.

capacity of the JHEH to regulate juvenile hormone metabolismmaybe strongly limited as the titer surpasses the low Km of the JHEH.Meanwhile, the contribution of the AgEH to juvenile hormonemetabolism may be significant because it has a high Vmax, and ahigh Km that lies at a point that juvenile hormone titer is probablynot able to reach. As a result, the AgEHmay play a role in regulatingjuvenile hormone titer under conditions that a high juvenile hor-mone titer is present locally and need to be dramatically down-regulated.

In our case, the experimentally determined molecular weight(around 35 kD) and pI (6.3) were different from the theoretical ones(41kD, 9.2). It is not uncommon that amino acid sequences are usedto predict the molecular weight and pI in biochemical studies, butamino acid sequences cannot be used to predict the three-dimensional structure and the post-translational modifications(cleavage of signal peptide, glycosylation, attachment of lipid),which can lead to miscalculation of physical properties, such asmolecular weight and pI. As a membrane-associated enzyme, theAgEH is expected to contain a signal peptide that is cleaved duringprotein folding and processing, which may be the reason a smallermolecular weight was detected than the predicted molecularweight.

The rabbit serum for the mouse sEH can both detect the dena-tured and natural form of the AgEH, indicating immunologically theAgEH is similar to the mouse sEH. Although the overall homologybetween the AgEH andmammalian sEHs is relatively low (20e30%)(Table S2), the AgEH may also share similar three-dimensionalstructure with the mammalian enzymes. Proteins with lowsequence homology but similar structures have been reportedbefore (Dickerson and Geis, 1983; Olsen et al., 1975). Epoxide hy-drolases belong to the a/b hydrolase fold, the members of whichshares no or low sequence homology, but have rather similarstructures (Ollis et al., 1992). The similarities between the AgEH andmammalian sEHs in overall sequence homology, conserved cata-lytic triad, biochemistry and immunology clearly suggest that theyhave diverged from a common ancestor, and they have evolved topreserve similar epoxide hydrolase activities.

In mosquitoes, the epoxy fatty acids may also be endogenouslipid signaling molecules or xenobiotic blood factors. In mammals,epoxy fatty acids are lipid signaling molecules and players in

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e52 51

immune responses. The EpOMEs (leukotoxin) and its correspond-ing diols have been reported to be a strong mediator of acute res-piratory distress syndrome (ARDS) (Moghaddam et al., 1997), andEETs are anti-inflammatory molecules that exert its effect byreducing the activity of NF-kB (Inceoglu et al., 2011; Liu et al., 2005;Morin et al., 2010; Node et al., 1999). In mosquitoes, the Toll andImd pathways are the major immune signaling pathways that arestudied in the context of immunity and disease transmission. Bothpathways are highly conserved and depend on the NF-kB tran-scription factor to play crucial roles in anti-pathogen defense(Silverman and Maniatis, 2001). Many immune genes were re-ported to be regulated by NF-kB, such as diptericin, cecropin,attacin, defensing as well as nitric oxide synthase (Dong et al.,2006; Hillyer and Estevez-Lao, 2010; Luna et al., 2006; Richmanet al., 1997; Vizioli et al., 2000). As prostaglandins and metabolitesfrom the LOX pathway have been reported to mediate insect im-munity, the inhibitor and the antibody described in the study canbe used to investigate whether epoxy fatty acids are players in in-sect immunity, how the immunity is regulated and how the diseasetransmission patterns will be impacted.

Acknowledgment

This work is supported in part by National Institute of Envi-ronmental Health Sciences (NIEHS) Grant ES002710, NIEHSSuperfund Grant P42 ES004699, the UC Davis Jastro-Shields Grad-uate Research Award and the China Scholarship Council. Wegracefully thank Dr. Shizuo Kamita for reading the manuscript andproviding tips on baculovirus expression system. We also thank Dr.Ahmet Inceoglu for detailed discussions and helpful suggestions.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.ibmb.2014.08.004.

References

Akman-Anderson, L., Olivier, M., Luckhart, S., 2007. Induction of nitric oxide syn-thase and activation of signaling proteins in Anopheles mosquitoes by the ma-laria pigment, hemozoin. Infect. Immun. 75, 4012e4019.

Anspaugh, D.D., Roe, R.M., 2005. Regulation of JH epoxide hydrolase versus JHesterase activity in the cabbage looper, Trichoplusia ni, by juvenile hormone andxenobiotics. J. Ins. Physiol. 51, 523e535.

Arahira, M., Nong, V.H., Udaka, K., Fukazawa, C., 2000. Purification, molecularcloning and ethylene-inducible expression of a soluble-type epoxide hydrolasefrom soybean (Glycine max L. Merr.). Eur. J. Biochem. 267, 2649e2657.

Artimo, P., Jonnalagedda, M., Arnold, K., Baratin, D., Csardi, G., de Castro, E.,Duvaud, S., Flegel, V., Fortier, A., Gasteiger, E., Grosdidier, A., Hernandez, C.,Ioannidis, V., Kuznetsov, D., Liechti, R., Moretti, S., Mostaguir, K., Redaschi, N.,Rossier, G., Xenarios, I., Stockinger, H., 2012. ExPASy: SIB bioinformaticsresource portal. Nucleic Acids Res. 40, W597eW603.

Beier, M.S., Pumpuni, C.B., Beier, J.C., Davis, J.R., 1994. Effects of para-aminobenzoicacid, insulin, and gentamicin on Plasmodium falciparum development inAnopheline mosquitos (Diptera, Culicidae). J. Med. Entomol. 31, 561e565.

Borhan, B., Mebrahtu, T., Nazarian, S., Kurth, M.J., Hammock, B.D., 1995. Improvedradiolabeled substrates for soluble epoxide hydrolase. Anal. Biochem. 231,188e200.

Dickerson, R.E., Geis, I., 1983. Hemoglobin: structure function evolution and pa-thology. Am. J. Hum. Genet. 35 (4), 781e782.

Dong, Y., Aguilar, R., Xi, Z., Warr, E., Mongin, E., Dimopoulos, G., 2006. Anophelesgambiae immune responses to human and rodent Plasmodium parasite species.PLoS Pathog. 2, e52.

Felsenstein, J., 1985. Confidence-limits on phylogenies - an approach using thebootstrap. Evolution 39, 783e791.

Gill, S.S., Hammock, B.D., Casida, J.E., 1974. Mammalian metabolism and environ-mental degradation of juvenoid 1-(40-ethylphenoxy)-3,7-dimethyl-6,7-epoxy-trans-2-octene and related compounds. J. Agric. Food Chem. 22, 386e395.

Gill, S.S., Hammock, B.D., Yamamoto, I., Casida, J.E., 1972. Preliminary chromato-graphic studies on the metabolites and photodecomposition products of thejuvenoid 1-(40 ethylphenoxy)-6, 7-epoxy-3, 7-dimethyl-2-octene. Insect Juve-nile Hormones: Chemistry and Action, 177e189.

Gill, S.S., Ota, K., Hammock, B.D., 1983a. Radiometric assays for mammalian epoxidehydrolases and glutathione s-transferase. Anal. Biochem. 131, 273e282.

Gill, S.S., Ota, K., Ruebner, B., Hammock, B.D., 1983b. Microsomal and cytosolicepoxide hydrolases in rhesus monkey liver, and in normal and neoplastic hu-man liver. Life Sci. 32, 2693e2700.

Goodman, W., Cusson, M., 2011. The juvenile hormones. In: Gilbert, L.I. (Ed.), InsectEndocrinology, pp. 311e347.

Harris, T.R., Aronov, P.A., Jones, P.D., Tanaka, H., Arand, M., Hammock, B.D., 2008.Identification of two epoxide hydrolases in Caenorhabditis elegans thatmetabolize mammalian lipid signaling molecules. Arch. Biochem. Biophys. 472,139e149.

Hillyer, J.F., Estevez-Lao, T.Y., 2010. Nitric oxide is an essential component of thehemocyte-mediated mosquito immune response against bacteria. Dev. Comp.Immunol. 34, 141e149.

Imig, J.D., 2005. Epoxide hydrolase and epoxygenase metabolites as therapeutictargets for renal diseases. Am. J. Physiol. Ren. Physiol. 289, F496eF503.

Imig, J.D., 2012. Epoxides and soluble epoxide hydrolase in cardiovascular physi-ology. Physiol. Rev. 92, 101e130.

Imig, J.D., Hammock, B.D., 2009. Soluble epoxide hydrolase as a therapeutic targetfor cardiovascular diseases. Nat. Rev. Drug Discov. 8, 794e805.

Imig, J.D., Zhao, X., Capdevila, J.H., Morisseau, C., Hammock, B.D., 2002. Solubleepoxide hydrolase inhibition lowers arterial blood pressure in angiotensin IIhypertension. Hypertension 39, 690e694.

Inceoglu, B., Wagner, K., Schebb, N.H., Morisseau, C., Jinks, S.L., Ulu, A., Hegedus, C.,Rose, T., Brosnan, R., Hammock, B.D., 2011. Analgesia mediated by solubleepoxide hydrolase inhibitors is dependent on cAMP. Proc. Natl. Acad. Sci. U.S.A.108, 5093e5097.

Jiang, H., Anderson, G.D., McGiff, J.C., 2012. The red blood cell participates inregulation of the circulation by producing and releasing epoxyeicosatrienoicacids. Prostagl. Other Lipid Mediat. 98, 91e93.

Jiang, H.L., Quilley, J., Reddy, L.M., Falck, J.R., Wong, P.Y.K., McGiff, J.C., 2005. Redblood cells: reservoirs of cis- and trans-epoxyeicosatrienoic acids. Prostagl.Other Lipid Mediat. 75, 65e78.

Kamita, S.G., Hammock, B.D., 2010. Juvenile hormone esterase: biochemistry andstructure. J. Pestic. Sci. 35, 265e274.

Kamita, S.G., Samra, A.I., Liu, J.Y., Cornel, A.J., Hammock, B.D., 2011. Juvenile hor-mone (JH) esterase of the mosquito Culex quinquefasciatus is not a target of theJH analog insecticide methoprene. PLoS One 6 (12), e28392.

Kamita, S.G., Yamamoto, K., Dadala, M.M., Pha, K., Morisseau, C., Escaich, A.,Hammock, B.D., 2013. Cloning and characterization of a microsomal epoxidehydrolase from Heliothis virescens. Ins. Biochem. Mol. Biol. 43, 219e228.

Keiser, K.C.L., Brandt, K.S., Silver, G.M.,Wisnewski,N., 2002. Cloning, partial purificationand in vivo developmental profile of expression of the juvenile hormone epoxidehydrolase of Ctenocephalides felis. Arch. Ins. Biochem. Physiol. 50, 191e206.

Khalil, S.M.S., Anspaugh, D.D., Roe, R.M., 2006. Role of juvenile hormone esteraseand epoxide hydrolase in reproduction of the cotton bollworm, Helicoverpa zea.J. Ins. Physiol. 52, 669e678.

Li, S., Jiang, R., Cao, M., 2004. Metabolism of juvenile hormone. Acta Entomol. Sin.47, 389e393.

Lim, J.H., Gowda, D.C., Krishnegowda, G., Luckhart, S., 2005. Induction of nitric oxidesynthase in Anopheles stephensi by Plasmodium falciparum: mechanism ofsignaling and the role of parasite glycosylphosphatidylinositols. Infect. Immun.73, 2778e2789.

Liu, Y., Zhang, Y., Schmelzer, K., Lee, T.-S., Fang, X., Zhu, Y., Spector, A.A., Gill, S.,Morisseau, C., Hammock, B.D., Shyy, J.Y.-J., 2005. The antiinflammatory effect oflaminar flow: the role of PPARg, epoxyeicosatrienoic acids, and soluble epoxidehydrolase. Proc. Natl. Acad. Sci. U.S.A. 102, 16747e16752.

Luna, C., Hoa, N.T., Lin, H., Zhang, L., Nguyen, H.L., Kanzok, S.M., Zheng, L., 2006.Expression of immune responsive genes in cell lines from two differentAnopheline species. Ins. Mol. Biol. 15, 721e729.

Moghaddam, M.F., Grant, D.F., Cheek, J.M., Greene, J.F., Williamson, K.C.,Hammock, B.D., 1997. Bioactivation of leukotoxins to their toxic diols by epoxidehydrolase. Nat. Med. 3, 562e566.

Morin, C., Sirois, M., Echave, V., Albadine, R., Rousseau, E., 2010. 17,18-epoxyeicosatetraenoic acid targets PPAR-gamma and p38 mitogen-activatedprotein kinase to mediate its anti-inflammatory effects in the lung: role ofsoluble epoxide hydrolase. Am. J. Respir. Cell Mol. Biol. 43, 564e575.

Morisseau, C., 2007. Measurement of soluble epoxide hydrolase (sEH) activity. Curr.Protoc. Toxicol. 33, 34.23:34.23.31e34.23.18.

Morisseau, C., Beetham, J.K., Pinot, F., Debernard, S., Newman, J.W., Hammock, B.D.,2000. Cress and potato soluble epoxide hydrolases: purification, biochemicalcharacterization, and comparison to mammalian enzymes. Arch. Biochem.Biophys. 378, 321e332.

Morisseau, C., Goodrow, M.H., Dowdy, D., Zheng, J., Greene, J.F., Sanborn, J.R.,Hammock, B.D., 1999. Potent urea and carbamate inhibitors of soluble epoxidehydrolases. Proc. Natl. Acad. Sci. U.S.A. 96, 8849e8854.

Morisseau, C., Goodrow, M.H., Newman, J.W., Wheelock, C.E., Dowdy, D.L.,Hammock, B.D., 2002. Structural refinement of inhibitors of urea-based solubleepoxide hydrolases. Biochem. Pharmacol. 63, 1599e1608.

Morisseau, C., Hammock, B.D., 2005. Epoxide hydrolases: mechanisms, inhibitordesigns, and biological roles. Annu. Rev. Pharmacol. Toxicol. 45, 311e333.

Morisseau, C., Hammock, B.D., 2008. Gerry Brooks and epoxide hydrolases: fourdecades to a pharmaceutical. Pest Manag. Sci. 64, 594e609.

Morisseau, C., Hammock, B.D., 2013. Impact of soluble epoxide hydrolase andepoxyeicosanoids on human health. Annu. Rev. Pharmacol. Toxicol. 53, 37e58.

http://dx.doi.org/10.1016/j.ibmb.2014.08.004http://dx.doi.org/10.1016/j.ibmb.2014.08.004http://refhub.elsevier.com/S0965-1748(14)00136-2/sref1http://refhub.elsevier.com/S0965-1748(14)00136-2/sref1http://refhub.elsevier.com/S0965-1748(14)00136-2/sref1http://refhub.elsevier.com/S0965-1748(14)00136-2/sref1http://refhub.elsevier.com/S0965-1748(14)00136-2/sref2http://refhub.elsevier.com/S0965-1748(14)00136-2/sref2http://refhub.elsevier.com/S0965-1748(14)00136-2/sref2http://refhub.elsevier.com/S0965-1748(14)00136-2/sref2http://refhub.elsevier.com/S0965-1748(14)00136-2/sref3http://refhub.elsevier.com/S0965-1748(14)00136-2/sref3http://refhub.elsevier.com/S0965-1748(14)00136-2/sref3http://refhub.elsevier.com/S0965-1748(14)00136-2/sref3http://refhub.elsevier.com/S0965-1748(14)00136-2/sref4http://refhub.elsevier.com/S0965-1748(14)00136-2/sref4http://refhub.elsevier.com/S0965-1748(14)00136-2/sref4http://refhub.elsevier.com/S0965-1748(14)00136-2/sref4http://refhub.elsevier.com/S0965-1748(14)00136-2/sref4http://refhub.elsevier.com/S0965-1748(14)00136-2/sref4http://refhub.elsevier.com/S0965-1748(14)00136-2/sref5http://refhub.elsevier.com/S0965-1748(14)00136-2/sref5http://refhub.elsevier.com/S0965-1748(14)00136-2/sref5http://refhub.elsevier.com/S0965-1748(14)00136-2/sref5http://refhub.elsevier.com/S0965-1748(14)00136-2/sref6http://refhub.elsevier.com/S0965-1748(14)00136-2/sref6http://refhub.elsevier.com/S0965-1748(14)00136-2/sref6http://refhub.elsevier.com/S0965-1748(14)00136-2/sref6http://refhub.elsevier.com/S0965-1748(14)00136-2/sref7http://refhub.elsevier.com/S0965-1748(14)00136-2/sref7http://refhub.elsevier.com/S0965-1748(14)00136-2/sref7http://refhub.elsevier.com/S0965-1748(14)00136-2/sref8http://refhub.elsevier.com/S0965-1748(14)00136-2/sref8http://refhub.elsevier.com/S0965-1748(14)00136-2/sref8http://refhub.elsevier.com/S0965-1748(14)00136-2/sref9http://refhub.elsevier.com/S0965-1748(14)00136-2/sref9http://refhub.elsevier.com/S0965-1748(14)00136-2/sref9http://refhub.elsevier.com/S0965-1748(14)00136-2/sref10http://refhub.elsevier.com/S0965-1748(14)00136-2/sref10http://refhub.elsevier.com/S0965-1748(14)00136-2/sref10http://refhub.elsevier.com/S0965-1748(14)00136-2/sref10http://refhub.elsevier.com/S0965-1748(14)00136-2/sref10http://refhub.elsevier.com/S0965-1748(14)00136-2/sref11http://refhub.elsevier.com/S0965-1748(14)00136-2/sref11http://refhub.elsevier.com/S0965-1748(14)00136-2/sref11http://refhub.elsevier.com/S0965-1748(14)00136-2/sref12http://refhub.elsevier.com/S0965-1748(14)00136-2/sref12http://refhub.elsevier.com/S0965-1748(14)00136-2/sref12http://refhub.elsevier.com/S0965-1748(14)00136-2/sref12http://refhub.elsevier.com/S0965-1748(14)00136-2/sref13http://refhub.elsevier.com/S0965-1748(14)00136-2/sref13http://refhub.elsevier.com/S0965-1748(14)00136-2/sref13http://refhub.elsevier.com/S0965-1748(14)00136-2/sref14http://refhub.elsevier.com/S0965-1748(14)00136-2/sref14http://refhub.elsevier.com/S0965-1748(14)00136-2/sref14http://refhub.elsevier.com/S0965-1748(14)00136-2/sref14http://refhub.elsevier.com/S0965-1748(14)00136-2/sref14http://refhub.elsevier.com/S0965-1748(14)00136-2/sref15http://refhub.elsevier.com/S0965-1748(14)00136-2/sref15http://refhub.elsevier.com/S0965-1748(14)00136-2/sref15http://refhub.elsevier.com/S0965-1748(14)00136-2/sref15http://refhub.elsevier.com/S0965-1748(14)00136-2/sref16http://refhub.elsevier.com/S0965-1748(14)00136-2/sref16http://refhub.elsevier.com/S0965-1748(14)00136-2/sref16http://refhub.elsevier.com/S0965-1748(14)00136-2/sref17http://refhub.elsevier.com/S0965-1748(14)00136-2/sref17http://refhub.elsevier.com/S0965-1748(14)00136-2/sref17http://refhub.elsevier.com/S0965-1748(14)00136-2/sref18http://refhub.elsevier.com/S0965-1748(14)00136-2/sref18http://refhub.elsevier.com/S0965-1748(14)00136-2/sref18http://refhub.elsevier.com/S0965-1748(14)00136-2/sref19http://refhub.elsevier.com/S0965-1748(14)00136-2/sref19http://refhub.elsevier.com/S0965-1748(14)00136-2/sref19http://refhub.elsevier.com/S0965-1748(14)00136-2/sref19http://refhub.elsevier.com/S0965-1748(14)00136-2/sref20http://refhub.elsevier.com/S0965-1748(14)00136-2/sref20http://refhub.elsevier.com/S0965-1748(14)00136-2/sref20http://refhub.elsevier.com/S0965-1748(14)00136-2/sref20http://refhub.elsevier.com/S0965-1748(14)00136-2/sref20http://refhub.elsevier.com/S0965-1748(14)00136-2/sref21http://refhub.elsevier.com/S0965-1748(14)00136-2/sref21http://refhub.elsevier.com/S0965-1748(14)00136-2/sref21http://refhub.elsevier.com/S0965-1748(14)00136-2/sref21http://refhub.elsevier.com/S0965-1748(14)00136-2/sref22http://refhub.elsevier.com/S0965-1748(14)00136-2/sref22http://refhub.elsevier.com/S0965-1748(14)00136-2/sref22http://refhub.elsevier.com/S0965-1748(14)00136-2/sref22http://refhub.elsevier.com/S0965-1748(14)00136-2/sref23http://refhub.elsevier.com/S0965-1748(14)00136-2/sref23http://refhub.elsevier.com/S0965-1748(14)00136-2/sref23http://refhub.elsevier.com/S0965-1748(14)00136-2/sref24http://refhub.elsevier.com/S0965-1748(14)00136-2/sref24http://refhub.elsevier.com/S0965-1748(14)00136-2/sref24http://refhub.elsevier.com/S0965-1748(14)00136-2/sref25http://refhub.elsevier.com/S0965-1748(14)00136-2/sref25http://refhub.elsevier.com/S0965-1748(14)00136-2/sref25http://refhub.elsevier.com/S0965-1748(14)00136-2/sref25http://refhub.elsevier.com/S0965-1748(14)00136-2/sref26http://refhub.elsevier.com/S0965-1748(14)00136-2/sref26http://refhub.elsevier.com/S0965-1748(14)00136-2/sref26http://refhub.elsevier.com/S0965-1748(14)00136-2/sref26http://refhub.elsevier.com/S0965-1748(14)00136-2/sref27http://refhub.elsevier.com/S0965-1748(14)00136-2/sref27http://refhub.elsevier.com/S0965-1748(14)00136-2/sref27http://refhub.elsevier.com/S0965-1748(14)00136-2/sref27http://refhub.elsevier.com/S0965-1748(14)00136-2/sref28http://refhub.elsevier.com/S0965-1748(14)00136-2/sref28http://refhub.elsevier.com/S0965-1748(14)00136-2/sref28http://refhub.elsevier.com/S0965-1748(14)00136-2/sref29http://refhub.elsevier.com/S0965-1748(14)00136-2/sref29http://refhub.elsevier.com/S0965-1748(14)00136-2/sref29http://refhub.elsevier.com/S0965-1748(14)00136-2/sref29http://refhub.elsevier.com/S0965-1748(14)00136-2/sref29http://refhub.elsevier.com/S0965-1748(14)00136-2/sref30http://refhub.elsevier.com/S0965-1748(14)00136-2/sref30http://refhub.elsevier.com/S0965-1748(14)00136-2/sref30http://refhub.elsevier.com/S0965-1748(14)00136-2/sref30http://refhub.elsevier.com/S0965-1748(14)00136-2/sref30http://refhub.elsevier.com/S0965-1748(14)00136-2/sref31http://refhub.elsevier.com/S0965-1748(14)00136-2/sref31http://refhub.elsevier.com/S0965-1748(14)00136-2/sref31http://refhub.elsevier.com/S0965-1748(14)00136-2/sref31http://refhub.elsevier.com/S0965-1748(14)00136-2/sref32http://refhub.elsevier.com/S0965-1748(14)00136-2/sref32http://refhub.elsevier.com/S0965-1748(14)00136-2/sref32http://refhub.elsevier.com/S0965-1748(14)00136-2/sref32http://refhub.elsevier.com/S0965-1748(14)00136-2/sref33http://refhub.elsevier.com/S0965-1748(14)00136-2/sref33http://refhub.elsevier.com/S0965-1748(14)00136-2/sref33http://refhub.elsevier.com/S0965-1748(14)00136-2/sref33http://refhub.elsevier.com/S0965-1748(14)00136-2/sref33http://refhub.elsevier.com/S0965-1748(14)00136-2/sref34http://refhub.elsevier.com/S0965-1748(14)00136-2/sref34http://refhub.elsevier.com/S0965-1748(14)00136-2/sref34http://refhub.elsevier.com/S0965-1748(14)00136-2/sref35http://refhub.elsevier.com/S0965-1748(14)00136-2/sref35http://refhub.elsevier.com/S0965-1748(14)00136-2/sref35http://refhub.elsevier.com/S0965-1748(14)00136-2/sref35http://refhub.elsevier.com/S0965-1748(14)00136-2/sref35http://refhub.elsevier.com/S0965-1748(14)00136-2/sref36http://refhub.elsevier.com/S0965-1748(14)00136-2/sref36http://refhub.elsevier.com/S0965-1748(14)00136-2/sref36http://refhub.elsevier.com/S0965-1748(14)00136-2/sref36http://refhub.elsevier.com/S0965-1748(14)00136-2/sref37http://refhub.elsevier.com/S0965-1748(14)00136-2/sref37http://refhub.elsevier.com/S0965-1748(14)00136-2/sref37http://refhub.elsevier.com/S0965-1748(14)00136-2/sref37http://refhub.elsevier.com/S0965-1748(14)00136-2/sref38http://refhub.elsevier.com/S0965-1748(14)00136-2/sref38http://refhub.elsevier.com/S0965-1748(14)00136-2/sref38http://refhub.elsevier.com/S0965-1748(14)00136-2/sref39http://refhub.elsevier.com/S0965-1748(14)00136-2/sref39http://refhub.elsevier.com/S0965-1748(14)00136-2/sref39http://refhub.elsevier.com/S0965-1748(14)00136-2/sref40http://refhub.elsevier.com/S0965-1748(14)00136-2/sref40http://refhub.elsevier.com/S0965-1748(14)00136-2/sref40

J. Xu et al. / Insect Biochemistry and Molecular Biology 54 (2014) 42e5252

Morisseau, C., Inceoglu, B., Schmelzer, K., Tsai, H.J., Jinks, S.L., Hegedus, C.M.,Hammock, B.D., 2010. Naturally occurring monoepoxides of eicosapentaenoicacid and docosahexaenoic acid are bioactive antihyperalgesic lipids. J. Lipid Res.51, 3481e3490.

Morisseau, C., Newman, J.W., Wheelock, C.E., Hill, T., Morin, D., Buckpitt, A.R.,Hammock, B.D., 2008. Development of metabolically stable inhibitors ofmammalian microsomal epoxide hydrolase. Chem. Res. Toxicol. 21, 951e957.

Mumby, S.M., Hammock, B.D., 1979. Partition assay for epoxide hydrases acting oninsect juvenile hormone and an epoxide-containing juvenoid. Anal. Biochem.92, 16e21.

Nesvizhskii, A.I., Keller, A., Kolker, E., Aebersold, R., 2003. A statistical model foridentifying proteins by tandem mass spectrometry. Anal. Chem. 75,4646e4658.

Newman, J.W., Morisseau, C., Hammock, B.D., 2005. Epoxide hydrolases: their rolesand interactions with lipid metabolism. Prog. Lipid Res. 44, 1e51.

Node, K., Huo, Y., Ruan, X., Yang, B., Spiecker, M., Ley, K., Zeldin, D.C., Liao, J.K., 1999.Anti-inflammatory properties of cytochrome P450 epoxygenase-derived ei-cosanoids. Science 285, 1276e1279.

Ollis, D.L., Cheah, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S.M., Harel, M.,Remington, S.J., Silman, I., Schrag, J., Sussman, J.L., Verschueren, K.H.G.,Goldman, A., 1992. The a/b hydrolase fold. Protein Eng. 5, 197e211.

Olsen, K.W., Moras, D., Rossmann, M.G., 1975. Sequence variability and structure ofD-glyceraldehyde-3-phosphate dehydrogenase. J. Biol. Chem. 250, 9313e9321.

Pakpour, N., Akman-Anderson, L., Vodovotz, Y., Luckhart, S., 2013. The effects ofingested mammalian blood factors on vector arthropod immunity and physi-ology. Microb. Infect. 15, 243e254.

Prestwich, G.D., Wojtasek, H., Lentz, A.J., Rabinovich, J.M., 1996. Biochemistry ofproteins that bind and metabolize juvenile hormones. Arch. Ins. Biochem.Physiol. 32, 407e419.

Richman, A.M., Dimopoulos, G., Seeley, D., Kafatos, F.C., 1997. Plasmodium activatesthe innate immune response of Anopheles gambiae mosquitoes. EMBO J. 16,6114e6119.

Saitou, N., Nei, M., 1987. The neighbor-joining method - a new method for recon-structing phylogenetic trees. Mol. Biol. Evol. 4, 406e425.

Schmelzer, K.R., Kubala, L., Newman, J.W., Kim, I.-H., Eiserich, J.P., Hammock, B.D.,2005. Soluble epoxide hydrolase is a therapeutic target for acute inflammation.Proc. Natl. Acad. Sci. U.S.A. 102, 9772e9777.

Seino, A., Ogura, T., Tsubota, T., Shimomura, M., Nakakura, T., Tan, A., Mita, K.,Shinoda, T., Nakagawa, Y., Shiotsuki, T., 2010. Characterization of juvenile hor-mone epoxide hydrolase and related genes in the larval development of thesilkworm Bombyx mori. Biosci. Biotechnol. Biochem. 74, 1421e1429.

Severson, T.F., Goodrow, M.H., Morisseau, C., Dowdy, D.L., Hammock, B.D., 2002.Urea and amide-based inhibitors of the juvenile hormone epoxide hydrolase ofthe tobacco hornworm (Manduca sexta : Sphingidae). Ins. Biochem. Mol. Biol.32, 1741e1756.

Silverman, N., Maniatis, T., 2001. NF-kB signaling pathways in mammalian and in-sect innate immunity. Genes Dev. 15, 2321e2342.

Stanley, D., 2006. Prostaglandins and other eicosanoids in insects: biological sig-nificance. Annu. Rev. Entomol., 25e44.

Stanley, D., Kim, Y., 2014. Eicosanoid signaling in insects: from discovery to plantprotection. Crit. Rev. Plant Sci. 33, 20e63.

Stanley, D.W., Miller, J.S., 2006. Eicosanoid actions in insect cellular immune func-tions. Entomol. Exp. Appl. 119, 1e13.

Surachetpong, W., Singh, N., Cheung, K.W., Luckhart, S., 2009. MAPK ERK signalingregulates the TGF-beta 1-dependent mosquito response to Plasmodium falcip-arum. Plos Pathog. 5 (4).

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood, evolu-tionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,2731e2739.

Taniai, K., Inceoglu, A.B., Yukuhiro, K., Hammock, B.D., 2003. Characterization andcDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase inDrosophila melanogaster. Eur. J. Biochem. 270, 4696e4705.

Tapiero, H., Nguyen Ba, G., Couvreur, P., Tew, K.D., 2002. Polyunsaturated fatty acids(PUFA) and eicosanoids in human health and pathologies. Biomed. Pharmac-other. 56, 215e222.

Touhara, K., Soroker, V., Prestwich, G.D., 1994. Photoaffinity-labeling of juvenilehormone epoxide hydrolase and JH-binding proteins during ovarian and eggdevelopment in Manduca sexta. Ins. Biochem. Mol. Biol. 24, 633e640.

Tsubota, T., Nakakura, T., Shiotsuki, T., 2010. Molecular characterization and enzy-matic analysis of juvenile hormone epoxide hydrolase genes in the red flourbeetle Tribolium castaneum. Ins. Mol. Biol. 19, 399e408.

Vizioli, J., Bulet, P., Charlet, M., Lowenberger, C., Blass, C., Muller, H.M.,Dimopoulos, G., Hoffmann, J., Kafatos, F.C., Richman, A., 2000. Cloning andanalysis of a cecropin gene from the malaria vector mosquito, Anopheles gam-biae. Ins. Mol. Biol. 9, 75e84.

Weyer, U., Knight, S., Possee, R.D., 1990. Analysis of very late gene expression byAutographa californica nuclear polyhedrosis virus and the further developmentof multiple expression vectors. J. Gen. Virol. 71, 1525e1534.

WHO, 2012. World Malaria Report 2012. World Health Organization.Yu, Z.G., Xu, F.Y., Huse, L.M., Morisseau, C., Draper, A.J., Newman, J.W., Parker, C.,

Graham, L., Engler, M.M., Hammock, B.D., Zeldin, D.C., Kroetz, D.L., 2000. Solubleepoxide hydrolase regulates hydrolysis of vasoactive epoxyeicosatrienoic acids.Circulat. Res. 87, 992e998.

Zeldin, D.C., Kobayashi, J., Falck, J.R., Winder, B.S., Hammock, B.D., Snapper, J.R.,Capdevila, J.H., 1993. Regiofacial and enantiofacial selectivity of epoxyeicosa-trienoic acid hydration by cytosolic epoxide hydrolase. J. Biol. Chem. 268,6402e6407.

Zhang, Q.R., Xu, W.H., Chen, F.S., Li, S., 2005. Molecular and biochemical charac-terization of juvenile hormone epoxide hydrolase from the silkworm, Bombyxmori. Ins. Biochem. Mol. Biol. 35, 153e164.

Zhang, W.R., Koerner, I.P., Noppens, R., Grafe, M., Tsai, H.J., Morisseau, C., Luria, A.,Hammock, B.D., Falck, J.R., Alkayed, N.J., 2007. Soluble epoxide hydrolase: anovel therapeutic target in stroke. J. Cereb. Blood Flow Metabol. 27, 1931e1940.

http://refhub.elsevier.com/S0965-1748(14)00136-2/sref41http://refhub.elsevier.com/S0965-1748(14)00136-2/sref41http://refhub.elsevier.com/S0965-1748(14)00136-2/sref41http://refhub.elsevier.com/S0965-1748(14)00136-2/sref41http://refhub.elsevier.com/S0965-1748(14)00136-2/sref41http://refhub.elsevier.com/S0965-1748(14)00136-2/sref42http://refhub.elsevier.com/S0965-1748(14)00136-2/sref42http://refhub.elsevier.com/S0965-1748(14)00136-2/sref42http://refhub.elsevier.com/S0965-1748(14)00136-2/sref42http://refhub.elsevier.com/S0965-1748(14)00136-2/sref43http://refhub.elsevier.com/S0965-1748(14)00136-2/sref43http://refhub.elsevier.com/S0965-1748(14)00136-2/sref43http://refhub.elsevier.com/S0965-1748(14)00136-2/sref43http://refhub.elsevier.com/S0965-1748(14)00136-2/sref44http://refhub.elsevier.com/S0965-1748(14)00136-2/sref44http://refhub.elsevier.com/S0965-1748(14)00136-2/sref44http://refhub.elsevier.com/S0965-1748(14)00136-2/sref44http://refhub.elsevier.com/S0965-1748(14)00136-2/sref45http://refhub.elsevier.com/S0965-1748(14)00136-2/sref45http://refhub.elsevier.com/S0965-1748(14)00136-2/sref45http://refhub.elsevier.com/S0965-1748(14)00136-2/sref46http://refhub.elsevier.com/S0965-1748(14)00136-2/sref46http://refhub.elsevier.com/S0965-1748(14)00136-2/sref46http://refhub.elsevier.com/S0965-1748(14)00136-2/sref46http://refhub.elsevier.com/S0965-1748(14)00136-2/sref47http://refhub.elsevier.com/S0965-1748(14)00136-2/sref47http://refhub.elsevier.com/S0965-1748(14)00136-2/sref47http://refhub.elsevier.com/S0965-1748(14)00136-2/sref47http://refhub.elsevier.com/S0965-1748(14)00136-2/sref48http://refhub.elsevier.com/S0965-1748(14)00136-2/sref48http://refhub.elsevier.com/S0965-1748(14)00136-2/sref48http://refhub.elsevier.com/S0965-1748(14)00136-2/sref49http://refhub.elsevier.com/S0965-1748(14)00136-2/sref49http://refhub.elsevier.com/S0965-1748(14)00136-2/sref49http://refhub.elsevier.com/S0965-1748(14)00136-2/sref49http://refhub.elsevier.com/S0965-1748(14)00136-2/sref50http://refhub.elsevier.com/S0965-1748(14)00136-2/sref50http://refhub.elsevier.com/S0965-1748(14)00136-2/sref50http://refhub.elsevier.com/S0965-1748(14)00136-2/sref50http://refhub.elsevier.com/S0965-1748(14)00136-2/sref51http://refhub.elsevier.com/S0965-1748(14)00136-2/sref51http://refhub.elsevier.com/S0965-1748(14)00136-2/sref51http://refhub.elsevier.com/S0965-1748(14)00136-2/sref51http://refhub.elsevier.com/S0965-1748(14)00136-2/sref52http://refhub.elsevier.com/S0965-1748(14)00136-2/sref52http://refhub.elsevier.com/S0965-1748(14)00136-2/sref52http://refhub.elsevier.com/S0965-1748(14)00136-2/sref53http://refhub.elsevier.com/S0965-1748(14)00136-2/sref53http://refhub.elsevier.com/S0965-1748(14)00136-2/sref53http://refhub.elsevier.com/S0965-1748(14)00136-2/sref53http://refhub.elsevier.com/S0965-1748(14)00136-2/sref54http://refhub.elsevier.com/S0965-1748(14)00136-2/sref54http://refhub.elsevier.com/S0965-1748(14)00136-2/sref54http://refhub.elsevier.com/S0965-1748(14)00136-2/sref54http://refhub.elsevier.com/S0965-1748(14)00136-2/sref54http://refhub.elsevier.com/S0965-1748(14)00136-2/sref55http://refhub.elsevier.com/S0965-1748(14)00136-2/sref55http://refhub.elsevier.com/S0965-1748(14)00136-2/sref55http://refhub.elsevier.com/S0965-1748(14)00136-2/sref55http://refhub.elsevier.com/S0965-1748(14)00136-2/sref55http://refhub.elsevier.com/S0965-1748(14)00136-2/sref56http://refhub.elsevier.com/S0965-1748(14)00136-2/sref56http://refhub.elsevier.com/S0965-1748(14)00136-2/sref56http://refhub.elsevier.com/S0965-1748(14)00136-2/sref57http://refhub.elsevier.com/S0965-1748(14)00136-2/sref57http://refhub.elsevier.com/S0965-1748(14)00136-2/sref57http://refhub.elsevier.com/S0965-1748(14)00136-2/sref58http://refhub.elsevier.com/S0965-1748(14)00136-2/sref58http://refhub.elsevier.com/S0965-1748(14)00136-2/sref58http://refhub.elsevier.com/S0965-1748(14)00136-2/sref59http://refhub.elsevier.com/S0965-1748(14)00136-2/sref59http://refhub.elsevier.com/S0965-1748(14)00136-2/sref59http://refhub.elsevier.com/S0965-1748(14)00136-2/sref60http://refhub.elsevier.com/S0965-1748(14)00136-2/sref60http://refhub.elsevier.com/S0965-1748(14)00136-2/sref60http://refhub.elsevier.com/S0965-1748(14)00136-2/sref61http://refhub.elsevier.com/S0965-1748(14)00136-2/sref61http://refhub.elsevier.com/S0965-1748(14)00136-2/sref61http://refhub.elsevier.com/S0965-1748(14)00136-2/sref61http://refhub.elsevier.com/S0965-1748(14)00136-2/sref61http://refhub.elsevier.com/S0965-1748(14)00136-2/sref62http://refhub.elsevier.com/S0965-1748(14)00136-2/sref62http://refhub.elsevier.com/S0965-1748(14)00136-2/sref62http://refhub.elsevier.com/S0965-1748(14)00136-2/sref62http://refhub.elsevier.com/S0965-1748(14)00136-2/sref63http://refhub.elsevier.com/S0965-1748(14)00136-2/sref63http://refhub.elsevier.com/S0965-1748(14)00136-2/sref63http://refhub.elsevier.com/S0965-1748(14)00136-2/sref63http://refhub.elsevier.com/S0965-1748(14)00136-2/sref64http://refhub.elsevier.com/S0965-1748(14)00136-2/sref64http://refhub.elsevier.com/S0965-1748(14)00136-2/sref64http://refhub.elsevier.com/S0965-1748(14)00136-2/sref64http://refhub.elsevier.com/S0965-1748(14)00136-2/sref65http://refhub.elsevier.com/S0965-1748(14)00136-2/sref65http://refhub.elsevier.com/S0965-1748(14)00136-2/sref65http://refhub.elsevier.com/S0965-1748(14)00136-2/sref65http://refhub.elsevier.com/S0965-1748(14)00136-2/sref66http://refhub.elsevier.com/S0965-1748(14)00136-2/sref66http://refhub.elsevier.com/S0965-1748(14)00136-2/sref66http://refhub.elsevier.com/S0965-1748(14)00136-2/sref66http://refhub.elsevier.com/S0965-1748(14)00136-2/sref66http://refhub.elsevier.com/S0965-1748(14)00136-2/sref67http://refhub.elsevier.com/S0965-1748(14)00136-2/sref67http://refhub.elsevier.com/S0965-1748(14)00136-2/sref67http://refhub.elsevier.com/S0965-1748(14)00136-2/sref67http://refhub.elsevier.com/S0965-1748(14)00136-2/sref68http://refhub.elsevier.com/S0965-1748(14)00136-2/sref69http://refhub.elsevier.com/S0965-1748(14)00136-2/sref69http://refhub.elsevier.com/S0965-1748(14)00136-2/sref69http://refhub.elsevier.com/S0965-1748(14)00136-2/sref69http://refhub.elsevier.com/S0965-1748(14)00136-2/sref69http://refhub.elsevier.com/S0965-1748(14)00136-2/sref70http://refhub.elsevier.com/S0965-1748(14)00136-2/sref70http://refhub.elsevier.com/S0965-1748(14)00136-2/sref70http://refhub.elsevier.com/S0965-1748(14)00136-2/sref70http://refhub.elsevier.com/S0965-1748(14)00136-2/sref70http://refhub.elsevier.com/S0965-1748(14)00136-2/sref71http://refhub.elsevier.com/S0965-1748(14)00136-2/sref71http://refhub.elsevier.com/S0965-1748(14)00136-2/sref71http://refhub.elsevier.com/S0965-1748(14)00136-2/sref71http://refhub.elsevier.com/S0965-1748(14)00136-2/sref72http://refhub.elsevier.com/S0965-1748(14)00136-2/sref72http://refhub.elsevier.com/S0965-1748(14)00136-2/sref72http://refhub.elsevier.com/S0965-1748(14)00136-2/sref72

ATGATCCAGTACTACGTCCGCGAGTCGATCCAGTTTGTGGTGTCGTACGCCCTGTGCCTG

-M--I--Q--Y--Y--V--R--E--S--I--Q--F--V--V--S--Y--A--L--C--L— 20

TTCTACAGCTGCCGGGTGCTGTTCGGTCTGCTGGTGCTGCTCGTCACCAAACCGCACACC

-F--Y--S--C--R--V--L--F--G--L--L--V--L--L--V--T--K--P--H--T- 40

AAATTTTGGGCCACAAAGGAGCGGCCCGTGCCGCCGGAATGTTTGCGCAATCACGAGTAC

-K--F--W--A--T--K--E--R--P--V--P--P--E--C--L--R--N--H--E--Y- 60

GGCACCGATAAGTACCAGAATGCGAACGGCATACGGATACATTTCGTGGAGAATGGAGAT

-G--T--D--K--Y--Q--N--A--N--G--I--R--I--H--F--V--E--N--G--D- 80

CGCAGCAAACCGCTCATGGTGCTCGTGCACGGCTTTCCCGAGTTTTGGTTCTCGTGGCGC

-R--S--K--P--L--M--V--L--V--H--G--F--P--E--F--W--F--S--W--R- 100 CATCAGCTGAAGGAGTTCGCCAAAGATTACTGGGTGGTGGCGTTGGATATGCGCGGGTAC

-H--Q--L--K--E--F--A--K--D--Y--W--V--V--A--L--D--M--R--G--Y- 120

GGTGACACCGAGAAGCCCCAGTACCAGTACGCCTATCGGATCGACAACATGACCGAGGAC

-G--D--T--E--K--P--Q--Y--Q--Y--A--Y--R--I--D--N--M--T--E--D- 140

ATCCGGTGCCTGGTGCGACAGTTAGGTCGTCAAAAGTTTACCCTCGTTGCGCACGACTGG

-I--R--C--L--V--R--Q--L--G--R--Q--K--F--T--L--V--A--H--D--W- 160 GGCGCAGTGATTGGATGGCACTTCATCACCAAACACATGGAGATGGTCGATCGGTACATC

-G--A--V--I--G--W--H--F--I--T--K--H--M--E--M--V--D--R--Y--I- 180

ATGATGGACGCACCCTCGCAGAAGATTGCCCGGAAGCTGTTCTCCACCAGCAAAACCCAG

-M--M--D--A--P--S--Q--K--I--A--R--K--L--F--S--T--S--K--T--Q- 200

TTCAAGATGTCCTGGTACATCTTCTTCTACCAAATGCCCTGGCTGCCGGAGTTCTTCGTG

-F--K--M--S--W--Y--I--F--F--Y--Q--M--P--W--L--P--E--F--F--V- 220 CGCCTGATGGACTTCCACCTGTTCGAGGTGGTGTTCCGCCACCACGGTGGGCCGGACGTG

-R--L--M--D--F--H--L--F--E--V--V--F--R--H--H--G--G--P--D--V- 240

ATCGAGGCGTTCAAGTACACGTTCTCCAAACCGCACGCCATGACGTACCCGATCAACTAC

-I--E--A--F--K--Y--T--F--S--K--P--H--A--M--T--Y--P--I--N--Y- 260

TATCGCCAGAATTTCCGCTTCTTCACGAGGCGGCAGATGCCACCGCGGCCGAAAACGTTC

-Y--R--Q--N--F--R--F--F--T--R--R--Q--M--P--P--R--P--K--T--F- 280

GCCCCCGGGCTGTACCTGATCGGCGAGAAGGATCTGTACATCTCGAAGGAGTCGGGACCG

-A--P--G--L--Y--L--I--G--E--K--D--L--Y--I--S--K--E--S--G--P- 300 CTGATGCAGCAGGAGTTTGAGAATCTGGAGTTCCGTGTCGTGCCCGGTGTCGATCACTTC

-L--M--Q--Q--E--F--E--N--L--E--F--R--V--V--P--G--V--D--H--F- 320 CTGCAGCAGCACAACCCGGAGCTGGTCAACCAGGTCATGCGAGAATTTCTGTCCAAGAGC

-L--Q--Q--H--N--P--E--L--V--N--Q--V--M--R--E--F--L--S--K--S- 340

00.050.10.150.20.250.30.35

Loaded flowthrough

Bufferwash

0.2MNaCl

0.4MNaCl

0.8MNaCl

1.0MNaCl

SpecificActivity

IonicStrength

(mM)t‐DPPOJHIII14,15‐EET

5010015030040050010002000

410±22122±7369±6384±50133±12310±32360±32131±18210±10400±22137±11233±22390±19129±7184±23393±3393±4175±18353±2082±7140±4380±3054±1123±2

Three substrates were tested with the addition of 0 mM to 3000 mM sodium chloride into 50 mM Tris-HCl buffer to adjust the ionic strength. Data represent mean specific activity ± SD (n=3).

Table S1 Effects of ionic strength on enzyme activity.

Accession numbers of sequences included can be found in Fig. 1. Protein sequences were used for the blast.

SequencesblastedagainstAGAP011972

aminoacid

sequencelength

Maxidentity

Scores

E‐value

sEHfromH.sapiensEH3fromH.sapiensEH4fromH.sapienssEHfromM.musculussEHfromC.eleganssEHfromA.thalianamEHfromH.sapiensmEHfromD.melanogasterJHEHfromM.sexta

555

360362488404321455463462

24%

37%

35%

28%

37%

29%

25%

26%

29%

95.5

211

208

101

203106

29.6

37.0

37.0

2e‐22

7e‐65

2e‐63

3e‐23

4e‐613e‐26

2.30.0100.013

Table S2 Protein BLAST results against the AgEH.

Expression and characterization of an epoxide hydrolase from Anopheles gambiae with high activity on epoxy fatty acids1 Introduction2 Materials and methods2.1 Phylogeny analysis2.2 Generation of recombinant virus2.3 Baculovirus expression and differential centrifugation2.4 Optimal pHs for enzyme activity and stability2.5 Effect of ionic strength and inhibitors on enzyme activity2.6 Solubilization of AgEH activity from the membrane2.7 Enzyme assays and determination of kinetics2.8 Partial purification of AgEH by ion exchange chromatography and isoelectric focusing2.9 SDS-PAGE and western blot analysis of purification fractions2.10 Immunoprecipitation of the AgEH activity

3 Results3.1 Phylogeny analysis of the epoxide hydrolase from A. gambiae (AgEH)3.2 Substrate selectivity of AgEH3.3 The subcellular locations of AgEH3.4 Effects of pH on enzyme activity and stability3.5 The inhibition patterns3.6 Enzyme kinetics3.7 Solubilization of AgEH activity from the membrane3.8 Partial purification of the AgEH and analysis of purification fractions by SDS-PAGE and western blot3.9 Immunoprecipitation of the AgEH activity

4 DiscussionAcknowledgmentAppendix A Supplementary dataReferences