02 insect biochemistry molecular

8/13/2019 02 Insect Biochemistry Molecular

1/137

Insect Biochemistry and Molecular BiologyVolume 35, Issue 10, Pages 1073-1208 (October 2005)

1. Identification and recombinant expression of a novel chymotrypsin from

Spodoptera exigua ARTICLE

Pages 1073-1082

Salvador Herrero, Eliette Combes, Monique M. Van Oers, Just M. Vlak, Ruud A.de Maagd and Jules Beekwilder

2. Acquisition, transformation and maintenance of plant pyrrolizidine alkaloids

by the polyphagous arctiid Grammia geneura ARTICLE

Pages 1083-1099

T. Hartmann, C. Theuring, T. Beuerle, E.A. Bernays and M.S. Singer

3.Molecular characterization and evolution of pheromone binding protein genes

inAgrotismoths ARTICLE

Pages 1100-1111

David Abraham, Christer Lfstedt and Jean-Franois Picimbon

4. TheBmChi-hgene, a bacterial-type chitinase gene ofBombyx mori, encodes a

functional exochitinase that plays a role in the chitin degradation during the

molting process ARTICLE

Pages 1112-1123

Takaaki Daimon, Susumu Katsuma, Masashi Iwanaga, WonKyung Kang and Toru

Shimada

5. Effect of chloroquine on the expression of genes involved in the mosquito

immune response toPlasmodiuminfection ARTICLE

Pages 1124-1132

P. Abrantes, L.F. Lopes, V.E. do Rosrio and H. Silveira

6. Accumulation of 23 kDa lipocalin during brain development and injury in

Hyphantria cunea ARTICLE

Pages 1133-1141Hong Ja Kim, Hyun Jeong Je, Hyang Mi Cheon, Sun Young Kong, JikHyun Han,

Chi Young Yun, Yeon Su Han, In Hee Lee, Young Jin Kang and Sook Jae Seo

7. The transcriptome of the salivary glands of the female western black-legged

tickIxodes pacificus(Acari: Ixodidae) ARTICLE

Pages 1142-1161

Ivo M.B. Francischetti, Van My Pham, Ben J. Mans, John F. Andersen, Thomas N.

Mather, Robert S. Lane and Jos M.C. Ribeiro


2/137

8. Development and characterization of a double subgenomic chikungunya virus

infectious clone to express heterologous genes inAedes aegyptimosqutioes ARTICLEPages 1162-1170

Dana L. Vanlandingham, Konstantin Tsetsarkin, Chao Hong, Kimberly Klingler,

Kate L. McElroy, Michael J. Lehane and Stephen Higgs

9. Molecular cloning and analysis of a novel teratocyte-specific carboxylesterase

from the parasitic wasp,Dinocampus coccinellae ARTICLE

Pages 1171-1180

Ravikumar Gopalapillai, Keiko Kadono-Okuda and Takashi Okuda

10. The extensible alloscutal cuticle of the tick,Ixodes ricinus ARTICLE

Pages 1181-1188

Svend Olav Andersen and Peter Roepstorff

11. Uptake and turn-over of glucosinolates sequestered in the sawflyAthalia

rosae ARTICLE

Pages 1189-1198

Caroline Mller and Ute Wittstock

12. MutantMos1 marinertransposons are hyperactive inAedes aegypti ARTICLE

Pages 1199-1207David W. Pledger and Craig J. Coates

Copyright 2006 Elsevier Ltd. All rights reserved


3/137

InsectBiochemistry

andMolecularBiology

Insect Biochemistry and Molecular Biology 35 (2005) 10731082

Identification and recombinant expression of a novel chymotrypsin

from Spodoptera exigua

Salvador Herreroa,b,, Eliette Combesb, Monique M. Van Oersb, Just M. Vlakb,Ruud A. de Maagda, Jules Beekwildera

aBusiness Unit Bioscience, Plant Research International B.V., Wageningen University and Research Centre, Wageningen, The NetherlandsbLaboratory of Virology, Wageningen University, Binnenhaven 11, 6709 PD Wageningen, The Netherlands

Received 2 March 2005; received in revised form 29 April 2005; accepted 2 May 2005

Abstract

A novel chymotrypsin which is expressed in the midgut of the lepidopteran insect Spodoptera exigua is described. This enzyme,

referred to as SeCT34, represents a novel class of chymotrypsins. Its amino-acid sequence shares common features of gut

chymotrpysins, but can be clearly distinguished from other serine proteinases that are expressed in the insect gut. Most notable,

SeCT34 contains a chymotrypsin activation site and the highly conserved motive DSGGP in the catalytic domain around the active-

site serine is changed to DSGSA. Recombinant expression of SeCT34 was achieved in Sf21 insect cells using a special baculovirus

vector, which has been engineered for optimized protein production. This is the first example of recombinant expression of an active

serine proteinase which functions in the lepidopteran digestive tract. Purified recombinant SeCT34 enzyme was characterized by its

ability to hydrolyze various synthetic substrates and its susceptibility to proteinase inhibitors. It appeared to be highly selective for

substrates carrying a phenylalanine residue at the cleavage site. SeCT34 showed a pH-dependence and sensitivity to inhibitors,

which is characteristic for semi-purified lepidopteran gut proteinases. Expression analysis revealed that SeCT34 was only expressed

in the midgut of larvae at the end of their last instar, just before the onset of pupation. This suggests a possible role of this protein inthe proteolytic remodelling that occurs in the gut during the larval to pupal molt.

r 2005 Elsevier Ltd. All rights reserved.

Keywords: Serine proteinase; Chymotrypsin; Trypsin; Baculovirus; Proteinase inhibitor; Lepidoptera

1. Introduction

Serine proteinases (SP) belong to one of the largest

gene families in the animal kingdom. Within the human

genome, for instance, around 500 proteinase-encoding

genes have been identified, of which around 30% are SP

or SP homologues (SPH) (Southan, 2001). A similar

complexity exists in the Drosophila melanogaster gen-

ome, where around 200 SP- and SPH-encoding genes

have been identified (Ross et al., 2003). SPs are involved

in a wide range of physiological functions, includingdigestion of dietary proteins, blood coagulation, im-

mune responses, signal transduction, hormone activa-

tion and development (Barrett et al., 2003). In insects,

the most abundant and best studied group of SPs

contains those expressed in the larval midgut, and these

are supposed to be involved in the digestion of dietary

protein.

Usually, the architecture of such proteinases is

comparatively simple. While most regulatory SPs, for

ARTICLE IN PRESS

www.elsevier.com/locate/ibmb

0965-1748/$- see front matter r 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.ibmb.2005.05.006

Abbreviations: SeCT34, Spodoptera exigua chymotrypsin 34; BAp-

NA,Na-benzoyl-L-arginine p-nitroanilide; SAAPFpNA, N-succinyl-alanine-alanine-proline-phenylalanine p-nitroanilide; SAAPLpNA, N-

succinyl-alanine-alanine-proline-leucine p-nitroanilide; SAAApNA,N-

succinyl-alanine-alanine-alanine p-nitroanilide; EFLpNA, pyrogluta-

myl-phenylalanine-leucine p-nitroanilide; BBI, BowmanBirk trypsin

inhibitor; PMSF, phenylmethylsulfonyl fluoride; TPCK, N-tosyl-L-

phenylalanine chloromethyl ketone; EDTA, ethylenediamine tetra-

acetic acid.Corresponding author. Present address: Department of Genetics,

University of Valencia, 46100 Burjassot, Spain. Tel.: +34 96 354 30 06;

fax: +3496 35430 29.

E-mail address: [email protected] (S. Herrero).
http://www.elsevier.com/locate/ibmbhttp://www.elsevier.com/locate/ibmb


4/137

instance those involved in polyphenol-oxidase activation

(Cerenius and Soderhall, 2004;Ji et al., 2004), or those

involved in dorsoventral patterning (Rose et al., 2003),

have a number of non-proteolytic protein modules

attached to their N-terminus, the SP genes isolated

from lepidopteran midgut do not contain such modules,

and have a relatively small size (i.e. less than 300 amino-acids) (Bown et al., 1997). Generally, the immature

protein (also called zymogen) contains a signal for its

secretion into the gut lumen and a pro-protein part

which keeps the protein in an inactive form until it is

cleaved off (Barrett et al., 2003).

The study of digestive proteinases in lepidoptera is

generally motivated by the fact that many lepidoptera

are severe agricultural pests and that their digestive

system is a suitable target for crop-protection strategies.

For instance, herbivory ofManduca sexta on tobacco

plants can be reduced by expressing a recombinant

potato proteinase inhibitor in the leaves (Johnson et al.,

1989). Proteinase inhibitors are also employed by the

natural defence of plants against insects (Zavala et al.,

2004). The inhibitors function by blocking the digestive

proteinases in the larval gut, thereby limiting the release

of amino acids from food protein. As a consequence, the

larvae are arrested in development and eventually die.

However, this strategy has not worked in all cases.

Polyphagous insects like Helicoverpa zea and Spodop-

tera exiguahave been shown to adapt to the presence of

proteinase inhibitors in their diet, by switching to the

production of proteinases that are resistant to plant

proteinase inhibitors (Jongsma et al., 1995;Mazumdar-

Leighton and Broadway, 2001b). Lepidopteran midgutSPs have also been studied in relation to their

interaction with the Cry toxins from the entomopatho-

genic bacterium Bacillus thuringiensis (Oppert, 1999).

Cry toxins accumulate in the bacteria in a protoxin form

which, upon ingestion by the insect, is converted into an

active form by action of the insects SP. In addition, SP

are also involved in the inactivation of such toxins by

degradation. Resistance to Cry toxins has been de-

scribed to be mediated both by down-regulation of

proteinase expression thereby decreasing the activation

of the protoxin (Oppert et al., 1997;Herrero et al., 2001)

as well as by up-regulation of SPs increasing toxininactivation (Forcada et al, 1996).

Despite their importance, not much is known about

the catalytic properties of individual midgut SPs from

lepidopteran insects. They have been studied following

two different approaches. In a biochemical approach,

the SPs have been purified from the midgut of the

insects, which allowed characterization of their activity

(Volpicella et al., 2003). By this approach, only the most

abundant proteins in the mixture have been identified

and characterized. In a genomic approach, sequences

from different proteinases have been obtained from

cDNA libraries (Bown et al., 1997) or by RT-PCR

techniques using conserved primers (Mazumdar-Leight-

on and Broadway, 2001a). This approach does consider

low abundant proteins, but no information on the

catalytic characteristics of these proteins has so far been

obtained due to the absence of a suitable expression

system.

In the current work, we studied a novel and lowabundant midgut proteinase from the beet armyworm,

S. exigua. The proteinase is characterized by sequence

comparison with related proteinases and detailed

analysis of recombinant expressed protein. A recombi-

nant baculovirus (Autographa californica multicapsid

nucleopolyhedrovirus, AcMNPV) containing a deletion

of the chitinase and cathepsin genes was employed for

the expression of a functional proteinase in insect cells.

Purified recombinant enzyme was characterized by its

ability to hydrolyze synthetic substrates, its kinetic

parameters and its susceptibility to different proteinase

inhibitors.

2. Material and methods

2.1. Proteinase substrates and inhibitors

Synthetic substratesNa-benzoyl-L-argininep-nitroanilide

(BApNA), N-succinyl-alanine-alanine-proline-phenylala-

nine p-nitroanilide (SAAPFpNA), N-succinyl-alanine-

alanine-proline-leucine p-nitroanilide (SAAPLrNA),

N-succinyl-alanine-alanine-alanine p-nitroanilide (SAA

ApNA) and pyroglutamyl-phenylalanine-leucine p-ni-

troanilide (EFLpNA) were purchased from Bachem AG(Bubendorf) and Sigma-Aldrich Chemie BV (Zwijn-

drecht). Proteinase inhibitors aprotinin, BowmanBirk

trypsin inhibitor (BBI), phenylmethylsulfonyl fluoride

(PMSF), N-tosyl-L-phenylalanine chloromethyl ketone

(TPCK), ethylenediamine tetra-acetic acid (EDTA) and

antipain were purchased from Sigma-Aldrich Chemie

BV (Zwijndrecht). Stock solutions were prepared

according the suppliers specifications.

2.2. Insect RNA isolation

S. exigualarvae were continuously reared on artificialdiet at 28 1C as described before (Smits and Vlak, 1988).

RNA was isolated at different instars from whole larvae,

from the larval midgut, the adult gut, hemocytes, and

eggs. Larval midguts were pulled from the larvae after

cutting off the hindbody between the last two pseudoleg

pairs. Next, midguts were cut longitudinally with

scissors and washed in phosphate-buffered physiological

saline to remove the gut contents. Adult guts were

obtained by longitudinally cutting of the abdomen.

Although attention was given to remove all non-gut

tissues during dissections, minor contamination could

not be ruled out. For hemocyte isolation hemolymph

ARTICLE IN PRESS

S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 107310821074


5/137

was obtained from last instar larvae by a small incision

in the last pseudoleg. Hemolymph was collected and

mixed (1:1) with anticlotting solution (1.5 mM K2HPO4,

8 mM NaH2PO4, 1 mM CaCl2, 3 mM KCl, 0.5 mM

MgCl2, 0.3 mM NaCl) and the hemocytes were collected

by centrifugation for 5 min at 12,000g. Samples were

stored at 801

C until further use or used directly forRNA isolation. Samples for RNA isolation were homo-

genized or incubated (for hemocytes) in TripureTM

reagent (Roche, Mannheim) and RNA was subse-

quently isolated according to the protocol described by

the manufacturer.

2.3. Cloning of the SeCT34 gene

An expressed sequence tag (EST) with homology to

chymotrypsins was obtained from a suppression sub-

tractive hybridization (SSH) library from 5th instar

midgut of S. exigua. Library construction will bedescribed elsewhere (manuscript in preparation). The

EST fragment has a size of 270 nucleotides and covers

nucleotides 131400 in the final ORF of the SeCT34

gene. Both the 30 and 50 cDNA fragments were amplified

using the SMART RACE-kit (Clontech, Palo Alto).

cDNAs produced from reverse transcribed mRNA

isolated from midguts of 5th instar larvae ofS. exigua

were used to amplify 50 and 30 ends of the SeCT34 by a

nested PCR procedure. Primers for amplification were

designed based on the cDNA fragment obtained from

the subtractive library. For the 50-end the primers were

50-CCCATTGTGGATGCATGTGGTAGCCC-3 0 for

primary PCR and 5-ACCATCATCAGCTATGAAA

GAC-30 for the nested PCR. For the 30-end the primers

were 50-GCAGGCGGCTTATGTTGACTGCAGCC-3 0

and 50-TGGAACTCAGGAGGCACCATGG-3 0 for the

primary and nested PCR, respectively. Amplified

cDNA-ends were purified using a QIAquick PCR

purification kit (Qiagen Benelux B.V., Venlo) and

ligated into pGEM-T Easy (Promega Benelux B.V.,

Leiden). Several clones were sequenced for each frag-

ment and assembled using the Seqman program

(DNAstar package, DNASTAR Inc., Madison).

2.4. Sequence analysis

Comparison of the deduced amino acid sequence of

the SeCT34 gene and phylogenetic reconstructions were

performed using the ClustalX program (Thompson

et al., 1997). Phylogenetic reconstruction was obtained

by the neighbor-joining method (Saitou and Nei, 1987)

together with bootstrap analysis using 100 replicates.

Kimura correction for multiple substitutions was

applied (Kimura, 1983). When specific residues in the

sequence are referred to, the bovine chymotrypsin

numbering is used (Brown and Hartley 1966). Presence

of a signal peptide was predicted using Signal P program

(Nielsen et al., 1997).

In order to simplify the phylogenetic reconstruction, a

total of 15 insect protease sequences was deployed in the

final analysis, representing the branches for lepidopteran

trypsin and chymotrypsins known to be expressed in the

gut and dipteran chymotrypsins identified by BLASTsearch. Other insect proteinases families appeared to be

more distantly related (not shown), and were left out for

clarity.

2.5. Expression analysis by reverse transcription-

polymerase chain reaction (RT-PCR)

The mRNA abundance of SeCT34 in different tissues

and larval instars was estimated by RT-PCR. Total

RNA from the different samples was isolated using

TriPureTM

reagent. A total of 0.5 mg RNA was reverse

transcribed into cDNA using an oligo-dT primer and

SuperScriptTM II reverse transcriptase (Invitrogen,

Breda). A total of 5 ml of a 1:5 dilution of cDNA were

used for PCR amplification. PCRs were carried out for

35 cycles of 20 s at 94 1C, 15 s at 541C and 60 s at 72 1C.

The primers employed were 50-AGTCTTTCATAGCT

GATGATGG-30 (forward) and 50-CTCCCTTGTCAC

CAATACTG-30 (reverse). Ribosomal RNA was used as

a control for the RNA concentration in the samples.

2.6. Generation of recombinant baculovirus

The full length open reading frame (ORF) of SeCT34

was amplified from cDNA from the midgut of last instarlarvae by PCR using a forward primer adding a BamHI

restriction site (50-GAGGATCCGATTAAGTTTCTA

AATTCGAAAATGG-3 0) and a reverse primer contain-

ing the coding sequence for a polyhistidine tag, a stop

codon and a HindIII restriction site (50-GGAA

GCCTTAATGGTGATGGTGATGGTGGTCCTCAT

AGAGTGCCATGGTAGAC-3 0). The resulting frag-

ment was cloned in pGemT-easy and sequenced. The

BamHI-HindIII fragment was recloned in plasmid

pFBD-GFP (Kaba et al., 2002) downstream of the

AcMNPV polyhedrin (ph) promoter to generate the

pFBD-GFP-SeCT34 vector. This plasmid, also containsthe GFP protein downstream of the AcMNPV p10

promoter to facilitate screening and tritation in insect

cells. Plasmid pFBD-GFP was employed subsequently

as a negative control.

To generate recombinant baculoviruses, Escherichia

coli DH10BAC cells containing the AcMNPV DCC

bacmid (a recombinant bacmid from which thechitinase

and v-cathepsin genes were deleted (Kaba et al.,

2004)) and the pMON7124 helper plasmid (Luckow

et al., 1993) were transformed with pFBD-GFP

and pFBD-GFP-SeCT34 plasmids. Putative recombi-

nant AcMNPV bacmids were selected by white/blue

ARTICLE IN PRESS

S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10731082 1075


6/137


7/137

Fig. 1. Multiple alignment of the predicted amino acid sequence for SeCT34 (AY820894) with bovine chymotrypsin (Bt:Bos taurus, P00766) and insec

Ae:Aedes aegypti,AF487334. Dm: Drosophila melanogaster,NP_732210. Si: Solenopsis invicta,1EQ9A. Ha:Helicoverpa armigera,CAA72950. BmCT:B

motives containing each of the catalytic triad residues are boxed. The black arrow on theN-terminal part indicates the predicted activation site, the gray

chymotrypsin.activity.


8/137

which are universally conserved among SPs and

constitute the catalytic triad. The presence of a glycin

residue at position 189 has been found in insect

chymotrypsins, such as the fire ant (Solenopsis invicta)

chymotrypsin (Botos et al., 2000). Therefore, the

SeCT34 was putatively classified as a chymotrypsin-like

protein.The SeCT34 protein was aligned and compared with

representative SPs from different species (Fig. 1). Blast-

X analysis (Altschul et al., 1997) of SeCT34 against the

NCBI database did not show high homology to any

known lepidopteran SP. The highest homology was

found with a chymotrypsin from the cat flea, Ctenoce-

phalides felis and dipteran chymotrypsin-like proteins. A

blast search against the Bombyx mori Silkworm EST

database (Mita et al., 2003) revealed homology to a

cDNA fragment (mg0778), encoding a putative

chymotrypsin (BmCT0778 in this work). SeCT34 has

two insertions of approximately six amino acids relative

to bovine chymotrypsin, and to the dipteran chymo-

trypsins (Fig. 1). Insertions are also present in

BmCT0778 at these locations, although their size is

different. The regions around the catalytic-triad resi-

dues, which are conserved in most SPs (TAAHC

around His59, DIAL around Asp102), have also been

conserved in SeCT34. However, both SeCT34 and

BmCT0778 show a remarkable change in the conserved

GDSGGP region (around the catalytic Ser195) to

GDSGSA.

SeCT34 clearly forms a distinct group among the

lepidopteran SPs. This becomes obvious when the

protein is included in a phylogenetic tree with lepidop-teran trypsins and chymotrypsins known to be expressed

in the midgut (Fig. 2). These proteinases, presumab-

ly involved in digestion of dietary protein, are

only distantly related to SeCT34, whereas the dipteran

chymotrypsins that came out of the homology

analysis appeared to be more closely related to it.

Only the B. mori protein BmCT0778 is located at the

same branch of the tree; this branch remains sepa-

rate when all known insect SP are included in the tree

(Fig. 2).

3.2. Expression analysis of SeCT34

Expression of SeCT34 was examined by RT-PCR on

RNA from S. exigua eggs, neonates, 2nd, 3rd and 4th

instar larvae, early and late 5th instar larvae, in midgut

tissue from 4th, early 5th and late 5th instar larvae and

from mature insects, and in hemocytes from larvae 1 day

into their 5th instar (Fig. 3). Expression was detected

exclusively in the midgut of late 5th instar larvae. Under

the conditions employed, we did not detect SeCT34

expression when RNA from the whole late 5th instar

larvae was used as a template, probably as a result of the

dilution of midgut RNA in the total body RNA.

3.3. Heterologous expression and purification of SeCT34

SeCT34 protein was expressed in Sf21 insect cells,

using the baculovirus-insect cells expression system. For

this purpose the SeCT34 gene was fused to the

polyhedrin promoter, and to a C-terminal 6xHis-tag

encoding DNA. The expression of the recombinantSeCT34 (rSeCT34) protein was monitored by Western

blot analysis, using an antibody against the 6xHis tag.

At 48 h.p.i, rSeCT34 was detected in the medium as well

as in the cells (Fig. 4A). The rSeCT34 was purified from

the medium by 6xHis affinity chromatography, to a level

where less than 10% contaminant protein was detected

by silver-staining (Fig. 4B). Purified rSeCT34 protein

showed an estimated mobility of around 30 KDa, which

is close to the predicted molecular weight (29 KDa) of

the mature rSeCT34 protein on the basis of the gene

sequence, including the 6xHis-tag. The estimated yield

of purified rSeCT34 was around 100mg/l of medium.

ARTICLE IN PRESS

0.1

100

100

94

100

SeCT34

BmCT0778

96

98

9483

100

100

10065

99

AiT (L)

PiT (L)

MsT (L)

HzT (L)

HaT (L)

HvCT (L) HaCT (L) SfCT (L)

AeCT (L)

MsCT (L)

DsCT (D)

DmCT (D)

AaeCT (D)

AdCT (D)

AaCT (D)

Fig. 2. Unrooted phylogenetic tree derived from a ClustalX alignment

of selected insect trypsin and chymotrypsin-like proteins. Numbers on

the branches report the level of confidence as determined by bootstrap

analysis (100 bootstrap replicates). T in the name indicates trypsin and

CT indicates chymotrypsin. Letter in parenthesis indicates the insect

order L for lepidopera, D for diptera. The proteins used in the tree are:

AdCT: Anopheles darlingi, AAD17494. AeCT: Anopheles aquasalis,

AAD17492. AaeCT: Aedes aegypti AAL93243. DmCT: Drosophila

melanogaster, NP_732210, Dp: Drosophila pseudoobscura, EAL27112.

HzT: Helicoverpa zea, AAF74742. PiT: Plodia interpunctella,

AAF24226. AiT: Agrotis ipsilon,, AAF74752. MsT: Manduca sexta,

T10109. HaT: Helicoverpa armigera, CAA72962. HaCT: Helicoverpa

armigera, CAA72966. SfCT: Spodoptera frugiperda, AAO75039.

HvCT: Heliothis virescens, AAF43709. MsCT: Manduca sexta,

AAA58743. AiCT: Agrotis ipsilon, AAF71516. BmCT0778: Bombyxmori,mg-0778. The scale bar indicates an evolutionary distance of 0.1

amino acid substitutions per position in the sequence.



9/137

3.4. Characterization of the recombinant SeCT34

(rSeCT34) activity

Chymotrypsins are known to cleave peptide bonds

behind Phe, Tyr, Trp and Leu residues (Barrett et al.,

2003). To determine the substrate preference of

rSeCT34, the enzyme was incubated with five different

synthetic substrates. Maximum activity was obtainedwith SAAPFpNA, while hydrolysis of SAAPLpNA was

low (5% of the activity obtained with SAAPFpNA).

Under the conditions employed, rSeCT34 was not able

to hydrolyze SAAApNA (an elastase substrate), BAp-

NA (a trypsin substrate) and EFLpNA (a thiol-

proteinase substrate).

The pH optimum of activity was analyzed by

measuring the hydrolysis of SAAPFpNA in a pH range

from 5 to 11 (Fig. 5). rSeCT34 was more active at basic

pH values, with a maximum activity at pH 11. We could

not test higher pH values, as the substrate appeared to

be unstable at pH411.

Kinetic parameters were obtained at two different pH

values. Under our assay conditions (i.e. in the presence

of BSA, which may compete as a substrate but stabilizes

the enzyme), the Km value for the hydrolysis of

SAAPFpNA was around 4-fold higher at pH 11

(Km 6.2 mM) than at pH 8 (Km 1.6 mM). Substrate

turnover at pH 11 (Kcat 1.8s1) was around 10-fold

higher than at pH 8 (Kcat 0.17 s1). Catalytic

efficiency values (Kcat/Km) were around 3-fold higher

at pH 11 than at pH 8. The observed 3-fold higher

catalytic efficiency at pH 11 is in agreement with the

differences previously found in the activity studies

performed at different pH range (Fig. 5).Since lepidopteran midgut proteinases are targets for

plant proteinase inhibitors, rSeCT34 was also charac-

terized with regard to its sensitivity to different

proteinase inhibitors. Proteinaceous inhibitors such as

aprotinin and BBI almost fully inhibited the activity of

the rSeCT34 proteinase at all the concentrations tested.

The most active inhibitor was aprotinin, which showed

values of 100% inhibition at the lowest concentration

tested. In contrast, synthetic inhibitors such as PMSF

and Antipain could only inhibit around 50% of the

activity at the highest concentrations tested. Inhibitors

as TPCK and EDTA hardly affected the activity ofrSeCT34 even at the highest concentrations tested

(Table 1).

4. Discussion

4.1. Recombinant expression of lepidopteran gut

proteinases

In this study, we describe the characterization and

funtional expression of SeCT34, a novel chymotrypsin

expressed in the midgut ofS. exigua.To our knowledge

ARTICLE IN PRESS

Fig. 3. RT-PCR of SeCT34 transcripts in different tissues and

development stages. rRNA refers to ribosomal RNA.

Fig. 4. Expression and purification of insect-cell expressed rSeCT34.

Panel A, detection of the 6xHis-tag from rSeCT34 by western analysis

in the medium and in the cell extract of Sf21 cells culture infected with

baculovirus expressing rSeCT34 (34) or infected with the control

baculovirus lacking rSeCT34 (C). Panel B, silver stained 12% SDS-

PAGE of rSeCT34 purified from the medium of cells infected with

baculovirus expressing rSeCT34 (34) or with a control baculovirus

lacking rSeCT34 (C). Crude, refers to crude protein extract loaded

onto the column and Pure, refers to the elution from the column of the

purified protein.

4 5 6 7 8 9 10 11 12

0

20

40

60

80

100

120

NaAc

Tris

Gly

pH

%r

elativeactivity

Fig. 5. Influence of pH on the activity of rSeCT34. Different buffers

were employed to cover the whole pH range as indicated by different

marks (see also Section 2).



10/137

this is the first report of the functional expression of a

recombinant midgut serine proteinase from insects,

despite the availability of many SP sequences from a

broad range of insect species. Sf21 cells, in which

rSeCT34 was expressed, are derived from S. frugiperda,

a lepidopteran species closely related to S. exigua Thus,

the applied recombinant protein expression system isclosely related to the insect species where SeCT34 was

isolated from. Another contribution to the successful

expression of rSeCT34 was possibly made by the use of

an improved baculovirus expression vector, from which

the viralcathepsinandchitinasegenes had been removed

(Kaba et al., 2004). V-cathepsin is a cysteine proteinase

involved, in conjunction with the chitinase, in liquefac-

tion of the insect host cell at the end of the baculovirus

infection (Hawtin et al., 1997). Production and stability

of recombinant proteins has been described to be

enhanced when both genes had been eliminated (Kaba

et al., 2004; Berger et al., 2004). Therefore the system

used here may well be applicable to other lepidopteran

midgut SPs, though still some may proof difficult to

express without damage to the expression system.

However, in the case of SeCT34 we have not observed

any indications of such damage.

4.2. Features of SeCT34

SeCT34 is a representative of a novel subgroup of

lepidopteran chymotrypsins, which map in a distinct

branch of the lepidoptera SP phylogenetic tree (Fig. 2).

Characteristic for this sub-group seems to be the

substitution of GP-SA in the highly conservedGDSGGP domain around the catalytic Ser195 residue.

These substitution occur in both SeCT34 and its

homologue in B. mori(BmCT0778). Some variation is

known to exist at these residues in the SP family fromD.

melanogaster(Ross et al., 2003). Out of 148 members of

the SP family, 11 are different in either of these two

residues. Out of 6 members where the Gly197 position is

different, 4 have the change Gly-Ser. Similarly,

sequence analysis of human SP (subfamily S1A)

revealed that only two out of 79 proteins had changed

the Gly197 residue, both of them Gly-Ser, and from

the four members where Pro198 is different, three ofthem have Pro-Ala (Yousef et al., 2004). These

observations suggest that the GP-SA substitution is

typical for the SeCT34 subgroup and is one of the very

rare variations allowed at this position that still yields a

functional protein. It is likely that phylogenetic compar-

ison of the SPs from other insect orders reveals the

presence of this sub-group in other orders. In the crystal

structure of bovine chymotrypsin and fire ant chymo-

trypsin (Hynes et al., 1990; Botos et al., 2000) the

Gly197 residue (Ser in SeCT34) localizes adjacent to the

catalytic triad His57, Asp102, and Ser195, though it is

not in direct contact with the substrate. This suggests

that Gly197 may have a possible role in positioning of

the catalytic triad relative to the substrate, rather than in

positioning the substrate relative to the enzyme.

The rSeCT34 is a true chymotrypsin, as can be

deduced from its ability to hydrolyze SAAPFpNA.

However, in contrast to most vertebrate chymotrypsins

(Barrett et al., 2003) and invertebrate chymotrypsins(Lee and Anstee, 1995;Valaitis, 1995), which hydrolyze

SAAPLpNA with similar efficiency, rSeCT34 does not

digest the substrate having Leu at the P1 position very

well. This suggests that SeCT34 may have a specific

function, rather than being involved in general digestion

of dietary protein.

The activation site of SeCT34 is atypical. Most

proteinases that are expressed in the gut, both in man

and in insects, are activated by a trypsin-like activity,

which acts on an Arg residue at position 15 (bovine

chymotrypsin numbering) (Brown and Hartley, 1966).

This holds true for trypsins, carboxypeptidases and

chymotrypsins. SeCT34 is an exception to this rule, as it

carries a Phe in this position, suggesting that it is

activated by chymotrypsin rather than by a trypsin. Our

activity assays showed chymotrypsin activity for

SeCT34 without the need of pre-incubation with trypsin,

and the migration of rSeCT34 as a single band. This

suggests that the proteinase activates itself.

4.3. Physiological role of SeCT34

The role of SeCT34 in the midgut ofS. exiguaremains

unclear. The pH optimum of the recombinant enzyme

(at pH411) is very similar to that of the total gutproteinase activity (Jongsma et al., 1996). This suggests

that it functions in a similar environment as the

proteinases involved in digestion of dietary protein, i.e.

the gut lumen. This is further supported by our

observation that both SeCT34 and the total gut

proteolytic activity of S. exigua are relatively sensitive

to proteinaceous inhibitors such as BBI and aprotinin

(Table 1;Jongsma et al., 1996).

The possible role of SeCT34 in insect gut physiology

can be inferred from the timing of its expression. The

SeCT34-encoding transcript could exclusively be de-

tected in the fifth instar insect, just prior to pupation. Togain further support for this apparent restricted expres-

sion of SeCT34, expression data for the B. mori

homologue, BmCT0778, available on the Internet were

searched (http://kaikocdna.dna.affrc.go.jp/page_pub.

html). BmCT0778 has only been identified in the

mg-B. mori cDNA library, which was obtained from

the midgut of larvae four days after molting to 5th

instar. No similar fragment has been found in 39 other

cDNA libraries obtained from different tissues and

developmental instars. Thus, both SeCT34 and

BmCT0778 seem to be exclusively expressed during the

transition from 5th instar larvae to pupae. Specific

ARTICLE IN PRESS

http://kaikocdna.dna.affrc.go.jp/page_pub.htmlhttp://kaikocdna.dna.affrc.go.jp/page_pub.htmlhttp://kaikocdna.dna.affrc.go.jp/page_pub.htmlhttp://kaikocdna.dna.affrc.go.jp/page_pub.html


11/137

proteolytic events occur during this period, when the

midgut epithelium is replaced completely and the

material is recycled by the action of digestive proteinases

(Uwo et al., 2002). Expression levels of SeCT34 were

low in comparison with levels of other midgut protei-

nase genes (data not shown). The precise tuning of its

expression, its auto-activation and its relatively narrowsubstrate specificity could mean that SeCT34 is involved

in the activation of other proteinases, which are

involved in midgut remodeling upon pupation. Knock-

out experiments should be carried out to confirm the

role of SeCT34 in this process. Although the specific role

of SeCT34 remains unclear, the functional expression of

SeCT34 in the baculovirus-insect cell system opens a

wide range of possibilities for the study of insect SPs.

Mutational studies could be applied to determine the

role of the different residues in the interaction with plant

proteinase inhibitors or in substrate specificity. Most

significantly, we have demonstrated that the baculovirus

system is capable of expressing a lepidopteran midgut

SP, and this system should be tested with other

lepidopteran SP genes relevant to digestion of dietary

protein.

Acknowledgments

S. Herrero was supported by a Marie Curie fellowship

contract No. HPMF-CT-2002-01994 from the EU. R.

de Maagd was supported by Program subsidy 347 of the

Dutch Ministry of Agriculture, Nature Management

and Fisheries.

References

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z.,

Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST:

a new generation of protein database search programs. Nucl. Acids

Res. 25, 33893402.

Barrett, A.J., Rawlings, N.D., Woessner, J.F., 2003. Handbook of

Proteolytic Enzymes. Academic Press, New York.

Berger, I., Fitzgerald, D.J., Richmond, T.J., 2004. Baculovirus

expression system for heterologous multiprotein complexes. Nat.

Biotechnol. 22, 15831587.

Botos, I., Meyer, E., Nguyen, M., Swanson, S.M., Koomen, J.M.,2000. The structure of an insect chymotrypsin. J. Mol. Biol. 298,

895901.

Bown, D.P., Wilkinson, H.S., Gatehouse, J.A., 1997. Differentially

regulated inhibitor-sensitive and insensitive protease genes from the

phytophagous insect pest, Helicoverpa armigera, are members of

complex multigene families. Insect Biochem. Mol. Biol. 27,

625638.

Brown, J.R., Hartley, B.S., 1966. Location of disulphide bridges by

diagonal paper electrophoresis. The disulphide bridges of bovine

chymotrypsinogen A. Biochem. J. 101, 214228.

Cerenius, L., Soderhall, K., 2004. The prophenoloxidase-activating

system in invertebrates. Immunol. Rev. 198, 116126.

Forcada, C., Alcacer, E., Garcera, M.D., Martinez, R., 1996.

Differences in the midgut proteolytic activity of two Heliothis

virescens strains, one susceptible and one resistant to Bacillus

thuringiensis toxins. Arch. Insect Biochem. Physiol. 31, 257272.

Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., Gooday,

G.W., King, L.A., Kuzio, J.A., Possee, R.D., 1997. Liquefaction of

Autographa californica nucleopolyhedrovirus-infected insects is

dependent on the integrity of virus-encoded chitinaseandcathepsin

genes. Virology 238, 243253.

Herrero, S., Oppert, B., Ferre, J., 2001. Different mechanisms ofresistance toBacillus thuringiensistoxins in the Indianmeal Moth.

Appl. Environ. Microbiol. 67, 10851089.

Hynes, T.R., Randal, M., Kennedy, L.A., Eigenbrot, C., Kossiakoff,

A.A., 1990. X-ray crystal structure of the protease inhibitor

domain of Alzheimers amyloid beta-protein precursor. Biochem-

istry 29, 1001810022.

Ji, C., Wang, Y., Guo, X., Hartson, S., Jiang, H., 2004. A pattern

recognition serine proteinase triggers the prophenoloxidase activa-

tion cascade in the tobacco hornworm, Manduca sexta. J. Biol.

Chem. 279, 3410134106.

Johnson, R., Narvaez, J., An, G., Ryan, C., 1989. Expression of

proteinase inhibitors I and II in transgenic tobacco plants: effects

on natural defense againstManduca sextalarvae. Proc. Natl. Acad.

Sci. USA 86, 98719875.

Jongsma, M.A., Bakker, P.L., Peters, J., Bosch, D., Stiekema, W.J.,1995. Adaptation ofSpodoptera exigua larvae to plant proteinase

inhibitors by induction of gut proteinase activity insensitive to

inhibition. Proc. Natl. Acad. Sci. USA 92, 80418045.

Jongsma, M.A., Peters, J., Stiekema, W.J., Bosch, D., 1996.

Characterization and partial purification of gut proteinases of

Spodoptera exigua Hubner (Lepidoptera: Noctuidae). Insect

Biochem. Mol. Biol. 26, 185193.

Kaba, S.A., Nene, V., Musoke, A.J., Vlak, J.M., van Oers, M.M.,

2002. Fusion to green fluorescent protein improves expression

levels ofTheileria parva sporozoite surface antigen p67 in insect

cells. Parasitology 125, 497505.

Kaba, S.A., Salcedo, A.M., Wafula, P.O., Vlak, J.M., van Oers, M.M.,

2004. Development of a chitinase and v-cathepsin negative bacmid

for improved integrity of secreted recombinant proteins. J. Virol.

Methods 122, 113118.

Kimura, M., 1983. The Neutral Theory of Molecular Evolution.

Cambridge, England.

King, L.A., Possee, R.D., 1992. The Baculovirus Expression System: A

Laboratory Guide. Chapman & Hall, London.

Lee, M.J., Anstee, J.H., 1995. Endoproteases from the midgut of larval

Spodoptera littoralis include a chymotrypsin-like enzyme with an

extended binding-site. Insect Biochem. Mol. Biol. 25, 4961.

Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Effi-

cient generation of infectious recombinant baculoviruses by site-

specific transposon-mediated insertion of foreign genes into a

baculovirus genome propagated in Escherichia coli. J. Virol. 67,

45664579.

Mazumdar-Leighton, S., Broadway, R.M., 2001a. Identification of six

chymotrypsin cDNAs from larval midguts ofHelicoverpa zea andAgrotis ipsilon feeding on the soybean (Kunitz) trypsin inhibitor.

Insect Biochem. Mol. Biol. 31, 633644.

Mazumdar-Leighton, S., Broadway, R.M., 2001b. Transcriptional

induction of diverse midgut trypsins in larval Agrotis ipsilon and

Helicoverpa zea feeding on the soybean trypsin inhibitor. Insect

Biochem. Mol. Biol. 31, 645657.

Mita, K., Morimyo, M., Okano, K., Koike, Y., Nohata, J., Kawasaki,

H., Kadono-Okuda, K., Yamamoto, K., Suzuki, M.G., Shimada,

T., Goldsmith, M.R., Maeda, S., 2003. The construction of an EST

database for Bombyx mori and its application. Proc. Natl. Acad.

Sci. USA 100, 1412114126.

Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997.

Identification of prokaryotic and eukaryotic signal peptides and

prediction of their cleavage sites. Protein Eng. 10, 16.

ARTICLE IN PRESS



12/137

Oppert, B., 1999. Protease interactions with Bacillus thuringiensis

insecticidal toxins. Arch. Insect Biochem. Physiol. 42, 112.

Oppert, B., Kramer, K.J., Beeman, R.W., Johnson, D., McGaughey,

W.H., 1997. Proteinase-mediated insect resistance to Bacillus

thuringiensis toxins. J. Biol. Chem. 272, 2347323476.

Rose, T., LeMosy, E.K., Cantwell, A.M., Banerjee-Roy, D., Skeath,

J.B., Di Cera, E., 2003. Three-dimensional models of proteases

involved in patterning of the Drosophila embryo. Crucial role ofpredicted cation binding sites. J. Biol. Chem. 278, 1132011330.

Ross, J., Jiang, H., Kanost, M.R., Wang, Y., 2003. Serine proteases

and their homologs in the Drosophila melanogaster genome: an

initial analysis of sequence conservation and phylogenetic relation-

ships. Gene 304, 117131.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method

for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406425.

Smits, P.H., Vlak, J.M., 1988. Quantitative and qualitative aspects in

the production of a nuclear Polyhedrosis-virus in Spodoptera

exigua larvae. Ann. Appl. Biol. 112, 249257.

Southan, C., 2001. A genomic perspective on human proteases as drug

targets. Drug Discov. Today 6, 681688.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,

D.G., 1997. The CLUSTAL_X windows interface: flexible

strategies for multiple sequence alignment aided by quality analysistools. Nucl. Acids Res. 25, 48764882.

Uwo, M.F., Ui-Tei, K., Park, P., Takeda, M., 2002. Replace-

ment of midgut epithelium in the greater wax moth, Galleria

mellonela, during larval-pupal moult. Cell Tissue Res. 308,

319331.

Valaitis, A.P., 1995. Gypsy moth midgut proteinases: purification and

characterization of luminal trypsin, elastase and the brush border

membrane leucine aminopeptidase. Insect Biochem. Mol. Biol. 25,

139149.Vaughn, J.L., Goodwin, R.H., Tompkins, G.J., McCawley, P.,

1977. The establishment of two cell lines from the insect

Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro 13,

213217.

Volpicella, M., Ceci, L.R., Cordewener, J., America, T., Gallerani, R.,

Bode, W., Jongsma, M.A., Beekwilder, J., 2003. Properties of

purified gut trypsin from Helicoverpa zea, adapted to proteinase

inhibitors. Eur. J. Biochem. 270, 1019.

Yousef, G.M., Elliott, M.B., Kopolovic, A.D., Serry, E., Diamandis,

E.P., 2004. Sequence and evolutionary analysis of the human

trypsin subfamily of serine peptidases. Biochim. Biophys. Acta

1698, 7786.

Zavala, J.A., Patankar, A.G., Gase, K., Hui, D., Baldwin, I.T., 2004.

Manipulation of endogenous trypsin proteinase inhibitor produc-

tion in Nicotiana attenuata demonstrates their function asantiherbivore defenses. Plant Physiol. 134, 11811190.

ARTICLE IN PRESS



13/137

InsectBiochemistry

andMolecularBiology

Insect Biochemistry and Molecular Biology 35 (2005) 10831099

Acquisition, transformation and maintenance of plant pyrrolizidine

alkaloids by the polyphagous arctiid Grammia geneura

T. Hartmanna,, C. Theuringa, T. Beuerlea, E.A. Bernaysb, M.S. Singerc

aInstitut fur Pharmazeutische Biologie der Technischen Universitat Braunschweig, Mendelssohnstrasse 1, D-38106 Braunschweig, GermanybDepartment of Entomology, University of Arizona, P.O. Box 210088, Tucson, AZ 85721-0088, USA

cDepartment of Biology, Wesleyan University, Hall-Atwater Labs, Rm. 259, Middletown, CT 06459, USA

Received 9 March 2005; accepted 6 May 2005

Abstract

The polyphagous arctiidGrammia geneuraappears well adapted to utilize for its protection plant pyrrolizidine alkaloids of almost

all known structural types. Plant-acquired alkaloids that are maintained through all life-stages include various classes of macrocyclic

diesters (typically occurring in the Asteraceae tribe Senecioneae and Fabaceae), macrocyclic triesters (Apocynaceae) and open-chain

esters of the lycopsamine type (Asteraceae tribe Eupatorieae, Boraginaceae and Apocynaceae). As in other arctiids, all sequestered

and processed pyrrolizidine alkaloids are maintained as non-toxic N-oxides. The only type of pyrrolizidine alkaloids that is neither

sequestered nor metabolized are the pro-toxic otonecine-derivatives, e.g. the senecionine analog senkirkine that cannot be detoxified

by N-oxidation. In its sequestration behavior, G. geneura resembles the previously studied highly polyphagous Estigmene acrea.

Both arctiids are adapted to exploit pyrrolizidine alkaloid-containing plants as drug sources. However, unlike E. acrea,G. geneura

is not known to synthesize the pyrrolizidine-derived male courtship pheromone, hydroxydanaidal, and differs distinctly in its

metabolic processing of the plant-acquired alkaloids. Necine bases obtained from plant acquired pyrrolizidine alkaloids are re-

esterified yielding two distinct classes of insect-specific ester alkaloids, the creatonotines, also present in E. acrea, and the

callimorphines, missing in E. acrea. The creatonotines are preferentially found in pupae; in adults they are largely replaced by thecallimorphines. Before eclosion the creatonotines are apparently converted into the callimorphines by trans-esterification. Open-

chain ester alkaloids such as the platynecine ester sarracine and the orchid alkaloid phalaenopsine, that do not possess the unique

necic acid moiety of the lycopsamine type, are sequestered by larvae but they need to be converted into the respective creatonotines

and callimorphines by trans-esterification in order to be transferred to the adult stage. In the case of the orchid alkaloids, evidence is

presented that during this processing the necine base (trachelanthamidine) is converted into its 7-(R)-hydroxy derivative

(turneforcidine), indicating the ability ofG. geneura to introduce a hydroxyl group at C-7 of a necine base. The creatonotines and

callimorphines display a striking similarity to plant necine monoesters of the lycopsamine type to which G. geneurais well adapted.

The possible function of insect-specific trans-esterification in the acquisition of necine bases derived from plant acquired alkaloids,

especially from those that cannot be maintained through all life-stages, is discussed.

r 2005 Elsevier Ltd. All rights reserved.

Keywords: Grammia geneura (Lepidoptera; Arctiidae); Alkaloid sequestration; Alkaloid processing; Pyrrolizidine alkaloids; Insect alkaloids;

Creatonotines; Callimorphines; Chemical defense

1. Introduction

Among insects that sequester plant pyrrolizidine

alkaloids and utilize them for their own chemical defense,

the tiger moths (Lepidotpera: Arctiidae) represent an

impressive example. The ability to sequester pyrrolizidine

alkaloids from the larval diet is most parsimoniously

ARTICLE IN PRESS

www.elsevier.com/locate/ibmb

0965-1748/$- see front matter r 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.ibmb.2005.05.011

Corresponding author. Tel.: +49 5313 915681;

fax: +49 5313 918104.

E-mail address: [email protected] (T. Hartmann).
http://www.elsevier.com/locate/ibmbhttp://www.elsevier.com/locate/ibmb


14/137

inferred to have arisen at the ancestral node of the

subfamily Arctiinae (Weller et al., 1999; Conner and

Weller, 2004). Subsequent loss of alkaloid-use within the

Arctiinae appears to have occurred multiple times as have

switches from larval to adult alkaloid feeding.

The success of pyrrolizidine alkaloids as plant-

acquired defense compounds in various insect speciesis attributed to a unique propertyan ability to exist in

two interchangeable forms: the pro-toxic free base

(tertiary amine) and its non-toxic N-oxide (Hartmann,

1999;Hartmann and Ober, 2000). All adapted insects so

far studied that recruit pyrrolizidine alkaloids from their

plant hosts have evolved strategies to avoid accumula-

tion of detrimental concentrations of the free bases in

metabolically active tissues. Pyrrolizidine alkaloid-

sequestering Arctiinae maintain the plant-acquired

alkaloids in the state of their N-oxides. They possess a

specific enzyme (senecionine N-oxygenase) localized in

the hemolymph that efficiently converts any pro-toxic

free base into its non-toxic N-oxide (Lindigkeit et al.,

1997; Naumann et al., 2002). The acquisition of this

enzyme in ancestral Arctiinae appears to be a mechan-

istic prerequisite for pyrrolizidine alkaloid sequestra-

tion. A second mechanistic requirement for pyrrolizidine

alkaloid sequestration is the ability to recognize the

alkaloids or alkaloid-sources. It has long been known

that pyrrolizidine alkaloids are larval feeding stimulants

(Boppre , 1986;Schneider, 1987) but only recently arctiid

caterpillars have been shown to possess single sensory

neurons in both the lateral and medial styloconic sensilla

of the galeae that respond specifically and sensitively

(threshold of response 1012

109

M) to a variety ofpyrrolizidine alkaloids (Bernays et al., 2002a, b).

Among Arctiinae that are adapted to recognize, recruit

and detoxify pyrrolizidine alkaloids from their larval diets

at least three distinctive strategies exist: (i) monophagous

species that as larvae utilize specific host-plants as both

nutrient and alkaloid source, e.g. Tyria jacobaeae, feeding

on Senecio jacobaea (Asteraceae) or Utetheisa ornatrix

feeding onCrotalaria(Fabaceae); (ii) polyphagous species,

e.g. Creatonotos transiens, Estigmene acrea, or Grammia

geneura, that as larvae feed on a variety of different plant

species including the local range of pyrrolizidine alkaloid-

containing species; (iii) Among both types there are somespecies like U. ornatrix, C. transiens or E. acrea that

possess androconial organs (coremata) in which they

produce and emit the pyrrolizidine alkaloid-derived male

courtship pheromone, hydroxydanaidal, while others like

T. jacobaeaeandG. geneurado not possess coremata and

are not known to produce hydroxydanidal. These

differences may greatly affect the individual strategies to

deal with pyrrolizidine alkaloids. The pyrrolizidine alka-

loid specialist just needs to be adapted to the type of

alkaloids present in its host plant while polyphagous

species are opportunistically able to utilize a variety of

plant pyrrolizidine alkaloids from different sources and to

maintain them in the non-toxic state. In fact, we previously

showed that E. acrea is able to sequester, detoxify and

process pyrrolizidine alkaloids of almost any known

structural type with one exception: otonecine derivatives

(e.g. senkirkine) that cannot be detoxified by N-oxidation

(Hartmann et al., 2005). Senkirkine is neither sequestered

nor metabolized but tolerated. Moreover, E. acrea is ableto convert all kinds of retronecine and heliotridine esters

into insect-specific retronecine esters, the creatonotines,

which appear to be the common precursor for the

formation of the male pyrrolizidine alkaloid-signal hydro-

xydanaidal (Hartmann et al., 2003a, 2004b). The role of

hydroxydanaidal as a male alkaloid signal emitted from

scent brushes (coremata) has been most completely

elucidated by Thomas Eisner and his colleagues with U.

ornatrix (Eisner et al., 2002). During close-range pre-

copulatory behavior, males use the pheromone to signal

the females the amount of their pyrrolizidine alkaloid

load. Females can differentiate between males that contain

different quantities of hydroxydanaidal and appear to

favor males having higher levels (Conner et al., 1990;

Dussourd et al., 1991). At mating the male transmits a

portion of his alkaloids to the female during insemination.

At oviposition these alkaloids together with the females

own load are transmitted to the eggs (Dussourd et al.,

1988; Iyengar et al., 2001). E. acrea shows a similar

pheromone-affected mating behavior (Davenport and

Conner, 2003; Jordan et al., 2005) and male-to-female-

to-eggs alkaloid transfer (Hartmann et al., 2004a).

Like E. acrea, G. geneura inhabits arid savanna and

grasslands of the southwestern USA. In this paper we

show that this arctiid, like E. acrea, is well adapted toexploit almost any naturally occurring pyrrolizidine

alkaloid containing plant as a drug source. To a great

extent the two arctiids show similar mechanisms of

alkaloid sequestration and processing but also display

distinct differences. Although G. geneura is not known

to synthesize pyrrolizidine-derived pheromones, insect-

specific pyrrolizidine alkaloids play an important role,

but the creatonotines, typical of E. acrea, are largely

replaced by the callimorphines. Our results show a

striking structural similarity of creatonotines and

callimorphines with plant monoesters of the lycopsa-

mine type that are maintained through all life-stages.We therefore hypothesize that a fundamental function

of the insect-specific necine esters is to sustain the

transfer of pro-toxic pyrrolizidine alkaloid across

different life-stages of the insect.

2. Materials and Methods

2.1. Insects

Caterpillars (penultimate or final instar larvae) ofG.

geneura(Strecker) were collected from a field population

ARTICLE IN PRESS

T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 108310991084


15/137

where Senecio longilobus Benth. and Plagiobothrys

arizonicus (A.Gray) Greene ex A. Gray were the only

abundant alkaloid containing host plants. Caterpillar

cultures were reared on a wheat-germ-based artificial

diet (Yamamoto, 1969). Larvae were raised individually

in 200-ml plastic cups containing a small cube of plain

diet (alkaloid-free) that was replaced daily. Fifth instarlarvae received a cube of diet (approximately

10mm 10 mm) containing approximately 1 mg of test

alkaloid(s) for 24 h in place of the plain diet. In most

cases the alkaloid meal was completely consumed within

24 h. Afterwards larvae were allowed to complete

development on the plain diet. Some larvae and pupae

(within 48 h after the start of pupation) were frozen for

alkaloid analysis. Pupae retained for obtaining adults

were sexed and individually kept in 200-ml cups. All

samples were preserved within 24 h of eclosion by

freezing. Samples allotted to alkaloid analysis were

lyophilized and kept in closed vials until analysis.

2.2. Exuviae from field collected caterpillars of G.

geneura

In spring 2002, caterpillars from several field sites

were opportunistically collected during one of the final

three larval stages (Table 8). In most cases, any G.

geneuracaterpillar found was collected. On one occasion

(Table 8, C), the collected individuals were chosen

haphazardly. These caterpillars were taken to the

laboratory and kept individually in 200-ml plastic cups

containing plain diet, as described above. The exuviae

molted from the stage of collection were saved inEppendorf tubes and stored at ambient laboratory

conditions. These exuviae were expected to contain

any pyrrolizidine alkaloids sequestered from host plants

eaten in nature.

2.3. Origin and preparation of pure pyrrolizidine

alkaloids and alkaloid mixtures

Pure pyrrolizidine alkaloids were prepared or ob-

tained as follows: retronecine by hydrolysis of mono-

crotaline (Carl Roth, Karlsruhe, Germany), heliotridine

by hydrolysis of heliotrine, sarracine (containing 5%sarracinine) was isolated from Senecio silvaticus (Witte

et al., 1990), senkirkine (containing 3% retronecine

esters) was isolated from flower heads ofSenecio vernalis

(Hartmann and Zimmer, 1986).

Purified alkaloid extracts were prepared from the

following plant sources: pyrrolizidine alkaloids of the

senecionine type: field-grownSenecio congestus(shoots),

field-grown S. jacobaea (flower heads), field-grown S.

vernalis (flower heads after removal of senkirkine);

pyrrolizidine alkaloids of the lycopsamine type: field-

grown Eupatorium cannabinum (inflorescences), green-

house-grown Heliotropium indicum (inflorescences);

pyrrolizidine alkaloids of the parsonsine type: in vitro-

grown plantlets ofParsonsia laevigata(Hartmann et al.,

2003b); pyrrolizidine alkaloids of the phalaenopsine

type (orchid alkaloids): commercially available Phalae-

nopsis hybrids (flowers). The alkaloid extracts were

purified as follows: methanolic or aqueous acidic plant

extracts were evaporated, the residue dissolved in1 M H2SO4 and incubated with an excess Zn dust for

5 h to reduce the pyrrolizidine alkaloidN-oxides. Then

the solution was extracted three times with ethyl ether,

the organic phase was discarded and the aqueous

solution made basic (pH 11) with ammonia and

extracted three times with ethyl ether. The solvent was

evaporated and the residue saved and directly applied in

the feeding experiments.

The identity and purity of the individual pyrrolizidine

alkaloids was confirmed by gas chromatography

(GC)MS basing on their retention indices (RI),

molecular ions and mass fragmentation patterns in

comparison to reference compounds and our compre-

hensive data base. The quantitative composition of

alkaloid mixtures and total alkaloid contents were

determined by quantitative GC (Witte et al., 1993).

2.4. Alkaloid analysis

Single freeze-dried insects (larvae, pupae, adults) were

weighed and then ground in 0.22 ml 1 M HCl in a mortar,

extracted for 23 h and then centrifuged. The pellet was

dissolved in a small volume of HCl and again extracted.

The combined supernatants were extracted with 2 ml

dichloromethane, the aqueous phase was recovered, mixedwith excess of Zn dust and stirred for 3 h at room

temperature for complete reduction of the pyrrolizidine

alkaloid N-oxides. Then the mixture was made basic with

25% ammonia and applied to an Extrelut (Merck) column

(size adapted to 1.4ml solution/g Extrelut). Pyrrolizidine

alkaloids (free bases) were eluted with dichloromethane

(6 ml/g Extrelut). The solvent was evaporated, and the

residue dissolved in 10100ml methanol prior to GC or

GCMS. Routine GC was performed as described

previously (Witte et al., 1993; Hartmann et al., 2004b).

Quantitative analyses were performed via the FID signals

with heliotrine or monocrotaline as internal standards.The GCMS data were obtained with a Hewlett

Packard 5890A gas chromatograph equipped with a

30 m 0:32 mm analytical column (ZB1, Phenomenex).

The capillary column was directly coupled to a triple

quadrupole mass spectrometer (TSQ 700, Finnigan).

The conditions applied were: Injector and transfer line

were set at 250 1C; the ion source temperature was

150 1C; the temperature program used was: 100 1C

(3 min)-310 1C at 6 1C/min. The injection volume was

1 ml. The split ratio was 1:20, the carrier gas flow was

1.6 mlmin1 He, and the mass spectra were recorded at

70 eV. CI mass spectra were recorded in the positive

ARTICLE IN PRESS

T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10831099 1085


16/137

mode with the same GCMS system using ammonia as a

reagent gas; Ion source temperature was 1301C.

2.5. Identification of insect alkaloids

The creatonotines and isocreatonotines A and B and

the three callimorphines, i.e. callimorphine, homocalli-morphine and deacetylcallimorphine were identified by

their characteristic RIs, molecular ions and mass

fragmentation patterns as described elsewhere (Hart-

mann et al., 2004b).

Callimorphine analogs like the 1,2-dihydrocallimor-

phines and 7-deoxy-1,2-dihydrocallimorphines were

tentatively identified by GCMS and the structures

subsequently confirmed by analysis of necine bases

obtained after hydrolysis. For hydrolysis of callimor-

phine analogs containing 1,2-unsaturated necine bases

purified extracts were kept in 15% ammonia for 2 days

at room temperature. Subsequently the samples were

dried, directly dissolved in N-Methyl-N-(trimethylsilyl)-

trifluoro-acetamid (MSTFA) (Fluka) and heated to

75 1C. After 30 min the necine bases (i.e. platynecine,

turneforcidine, trachelanthamidine, isoretronecanol)

were analyzed by GCMS and identified by their RI-

values and mass fragmentation patterns (see data below)

in comparison to reference compounds.

The identity of 7-(S)-callimorphines (heliotridine es-

ters) was deduced as follows: (i) they showed the same

molecular ions and mass fragmentation patterns as the

respective R-configurated callimorphines (retronecine

esters) but differed in their RIs (Table 7); (ii) they were

only detected in feeding experiments with heliotridine;(iii) hydrolysis of the respective alkaloid extracts (in 10%

NaOH at 100 1C for 2h) revealed a mixture of

heliotridine and retronecine that were identified by their

characteristic RI-values (Table 7) and identical fragmen-

tation pattern in comparison to reference compounds.

GCMS properties of the novel callimorphine analogs:

(1S)-1,2-Dihdrocallimorphine (necine base: platyneci-

ne)(Fig. 3B): RI 2016; GC-EIMS, m/z (rel. int.): 299

([M]+, 11), 255 (32), 140 (18), 138 (7), 96 (16), 95 (10 0),

82 (78), 73 (8), 55 (10), 43(17).

(1R)-1,2-Dihdrocallimorphine (necine base: turnefor-

cidine)(Fig. 3B): RI 1975; GC-EIMS, m/z (rel. int.): 299([M]+, 11), 255 (32), 140 (18), 138 (7), 96 (16), 95 (10 0),

82 (78), 73 (8), 55 (10), 43(17).

(1S)-1,2-Dihydrohomocallimorphine (necine base:

platynecine)(Fig. 3B): RI 2097; GC-EIMS, m/z (rel.

int.): 313 ([M]+, 9), 269 (33), 141 (8), 140 (20), 138 (7),

96 (27), 95 (1 0 0), 82 (78), 57 (26), 55 (11).

(1R)-1,2-Dihydrohomocallimorphine (necine base:

turneforcidine)(Fig. 3B): RI 2053; GC-EIMS, m/z (rel.

int.): 313 ([M]+, 9), 269 (33), 141 (8), 140 (20), 138 (7),

96 (27), 95 (1 0 0), 82 (78), 57 (26), 55 (11).

7-deoxy-(1R)-1,2-Dihdrocallimorphine (necine base:

trachelanthamidine)(Fig. 3C): RI 1833; GC-EIMS, m/z

(rel. int.): 283 ([M]+, 7), 125 (12), 124 (1 0 0), 122 (6), 95

(5), 83 (17), 82 (8), 73 (4), 55 (8),43 (9).

7-deoxy-(1R)-1,2-Dihydrohomocallimorphine (necine

base: trachelanthamidine)(Fig. 1C): RI 1913; GC-EIMS,

m/z(rel. int.): 297 ([M]+,4), 125 (13), 124 (1 0 0), 123 (3),

122 (4), 95 (4), 83 (17), 82 (7), 57 (10), 55 (7).

7-Chloromethoxy-(1S)-1,2-Dihydrohomocallimor-phine (necine base platynecine): RI 2207;

GC-EIMS,m/z(rel. int.): 284 (8), 255 (54), 196 (10),

188 (13), 96 (23), 95 (1 0 0), 82 (75), 73 (12), 55 (14), 43

(22). GC-CIMS, m/z (rel. int.): 348 (100;

[M( 35Cl)+H]+), 350 (32, [M( 37Cl)+H]+).

7-Chloromethoxy-(1S)-1,2-Dihydrohomocallimor-

phine (necine base platynecine): RI 2282;

GC-EIMS,m/z (rel. int.): 269 (66), 188 (9), 97 (5), 96

(39), 95 (1 0 0), 83 (11), 82 (83), 57 (40), 55 (13), 41 (7).

GC-CIMS, m/z (rel. int.): 362 (100; [M( 35Cl)+H]+),

364 (32, [M( 37Cl)+H]+).

GCMS properties of the trimethylsilyl derivatives of

necine bases obtained by hydrolysis of 1,2-saturated

plant and insect derived pyrrolizidine alkaloids:

Trimethylsilyl-(-)-trachelanthamidine (obtained from

phalaenopsine and 7-deoxy-1,2-dihydrohomocallimor-

phine): RI(ZB1) 1350; EIMS, m/z (rel. int.): 213 (27,

[M]+), 212 (14), 198 (24), 185 (27), 124 (12), 122 (13),

110 (23), 84 (19), 83 (1 0 0), 82 (36).

Trimethylsilyl-(-)-isoretronecanol (obtained from

phalaenopsine and 7-deoxy-1,2-dihydrohomocallimor-

phine): RI(ZB1) 1377; EIMS, m/z (rel. int.): 213 (25,

[M]+), 212 (14), 198 (21), 185 (27), 110 (23), 84 (19), 83

(1 0 0), 82 (38), 73 (14), 55(13).

Di-trimethylsilyl-(-)-turneforcidine (obtained from in-sects fed with phalaenopsine): RI(ZB1) 1569; EIMS,m/

z(rel. int.): 301 (7, [M]+), 286 (10), 212 (4), 211 (17), 187

(3), 186 (9), 185 (74), 83 (5), 82 (1 0 0), 73 (15).

Di-trimethylsilyl-(-)-platinecine (obtained from platy-

phylline and sarracine and callimorphine analogs of

insects fed with sarracine and platyphylline): EIMS, m/z

(rel. int.): RI(ZB1) 1611; EIMS, m/z (rel. int.): 301 (5,

[M]+), 286 (6), 211 (14), 186 (9), 185 (73), 147 (3), 122

(4), 83 (6), 82 (1 0 0), 73 (15).

3. Results

3.1. Sequestration and processing of macrocyclic

pyrrolizidine alkaloids

Extracts of pyrrolizidine alkaloids from three Senecio

species with structurally different alkaloid profiles were

fed to larvae. We were particularly interested to see how

larvae deal with macrocyclic pyrrolizidine alkaloids

which contain unusual necine bases like platynecine

and otonecine. The alkaloids of S. jacobaea and S.

vernalis are all sequestered and transmitted almost

unaltered to the adult stage (Table 1). A distinct change

ARTICLE IN PRESS



17/137

in the relative pyrrolizidine alkaloid composition was

only observed with the two 15,20-epoxides jacobine

(Fig. 1A) and jacozine, which in comparison to the plant

profile are less abundant in the insects alkaloid profile.

Since the relative proportions of jacoline and jaconine,the respective hydrolytic and chlorolytic derivatives of

jacobine, are clearly increased in comparison to their

dietary proportions, some degradation of the epoxide

during sequestration seems likely. Although an artificial

degradation cannot be excluded, this appears unlikely

since degradation was neither observed under identical

extraction conditions with the artificial diet nor in

analogous insect feeding experiments with E. acrea

(Hartmann et al., 2005).

Besides small amounts of the retronecine esters

senecionine/integerrimine, the dietary pyrrolizidine al-

kaloid mixture from S. congestus contains mainly their

platynecine analogs platyphylline/neoplatyphylline, and

senkirkine, the otonecine analog of senecionine.

Whereas the two macrocyclic platynecine esters are

sequestered and stored with almost the same efficiency

as their retronecine analogs, senkirkine is entirelyexcluded. Neither senkirkine itself nor insect-specific

otonecine esters are detectable in insect extracts.

Senkirkine (Fig. 1C) is as toxic as senecionine but

cannot be detoxified by N-oxidation (Lindigkeit et al.,

1997; Fu et al., 2004). To confirm the ability of G.

geneura to exclude senkirkine from being sequestered,

an additional feeding experiment with 97% pure

senkirkine was performed (Table 2). No traces of

senkirkine or potential metabolites were recovered from

the analyzed adults. However, the insects did contain

four retronecine esters that were present as impurities in

the senkirkine sample. One can calculate that larvae

ARTICLE IN PRESS

Fig. 1. Plant-acquired pyrrolizidine alkaloids sequestered and maintained by G. geneurathrough all life-stages comprise: (A) Various types of

macrocyclic retronecine esters, and (B) open-chain monoesters of the lycopsamine type. In the latter case adults preferentially contain alkaloids with

(7R)- and (3S)-configuration; alkaloids with opposite configuration are largely epimerized. (C) Macrocyclic otonecine esters that cannot form N-

oxides are neither sequestered nor metabolized.



18/137

Table 1

Profiles of the pyrrolizidine alkaloids established by GCMS for G. geneurathat as larvae (penultimate instar) had received about 1 mg per individual of t

added to the artificial diet

Alkaloids recovered m/z[M+] RI Relative abundance (%)

Alkaloid mixture from Senecio jacobaea Alkaloid mixture fromSenecio vernalis A

Diet Larvae

n 2

Males

n 3

Females

n 4

Diet Larvae

n 2

Males

n 4

Females

n 3

D

Plant acquired alkaloids

9-Angeloylplatynecine 5

Senecivernine 335 2283 73 74.570.5 5870.6 7173.8

Senecionine 335 2274 3 570 8.371.5 5.870.3 6 6.570.5 1170.5 7.370.3 3

Seneciphylline 333 2293 13 21.570.5 2870.8 2271.1 4 4.070 6.370.5 4.370.3

Spartioidine 333 2325 o1 170 1.370.3 170 3 3.070 3.570.3 2.071.0

Integerrimine 335 2335 3 670 7.770.3 7.070.7 10 1270 1570.3 1370.7 3

Unknown senecivernine derivative 349 2400 4 470 170 2.071.0

Platyphylline 337 2328 24

Neoplatyphylline 337 2354 2

Jacobine 351 2420 46 1570. 11.371.5 16.570.9

Jacozine 349 2440 9 2.570.5 1.270.4 1.770.3

Senkirkine 365 2450 59

Jacoline 369 2471 7 2072 2174.3 2371.4

Jaconine 387 2507 8 2372 1370.3 1570.7

Dehydrojaconine 385 2540 &lt 0.270.1

Eruciflorine 351 2591 2 2.570.5 2.070.6 1.570.3

Creatonotines

Creatonotine B 269 1978 Tr Tr

Callimorphines

Desacetylcallimorphine 255 1821 0.270.1 0.270.1

Callimorphine 269 1972 3.771.7 3.570.5 4.371.4 2.771.8

Homocallimorphine 311 2033 0.570.3 1.470.6 1.370.6 Tr

(1S)-1,2-Dihydrocallimorphine 299 2015 (1S)-1,2-Dihydrohomocallimorphine 313 2096

Total alkaloid (mg/individual) 189753 227766 2437106 390736 186724 81752

Total alkaloid (mg/g dry wt) 1.370.5 2.470.8 1.470.6 2.770.2 1.970.1 0.770.2


19/137

accumulate about 50% of the trace amounts of these

alkaloids present in their larval food. No toxic or

detrimental effects of senkirkine were observed in the

experiment during further larval development, indicat-

ing that the larvae are well adapted to tolerate otonecine

derivatives present in their alkaloid meals.

In all feeding experiments callimorphines (Fig. 2B)could be recovered as insect alkaloids from adults but

not larvae. Creatonotines (Fig. 2A) were only detected

in trace amounts in larvae and males fed on S. jacobaea

alkaloids. Insects fed on S. congestus alkaloids con-

tained 1,2-dihydrocallimorphines indicating insect-spe-

cific esterification of platynecine obtained from the

plant-acquired platyphyllines (Fig. 3B).

Pyrrolizidine alkaloid-containing species of the Apoc-

ynaceae often possess unique macrocyclic triesters.

Examples are 14-deoxyparsonsianidine and 14-deoxy-

parsonsianine (Fig. 1A) the major alkaloids ofParsonsia

laevigata. Larvae are able to sequester and store these

alkaloids (Table 3). It is interesting to note that 14-

deoxyparsonsianine, the less abundant pyrrolizidine

alkaloid in the larval diet, accumulates in adults as the

major component. The two pyrrolizidine alkaloids differ

in just one carbon atom (Fig. 1A). In adults the

callimorphines represent a considerable portion (15 to

38%) of total pyrrolizidine alkaloids.

3.2. Sequestration and processing of pyrrolizidine

alkaloids of the lycopsamine type

Alkaloids of the lycopsamine type are characterized by

their unique necic acid moiety, 2-isopropyl-2,3-dihydrox-ybutyric acid. At least three stereoisomers of this rare

acid are known to occur in alkaloids of the lycopsamine

type: (-)-trachelanthic acid with (2R)(3S)-configuration

in indicine; (-)-viridifloric acid, (20S)(3S), in lycopsamine

and echinatine and (+)-trachelanthic acid, (2S)(3R), in

intermedine and rinderine (Fig. 1B). Alkaloids of this

type are typical for pyrrolizidine alkaloid-containing

species of the Boraginaceae, Apocynaceae and the tribe

Eupatorieae of the Asteraceae. For example, indicine and

lycopsamine (from Heliotropium indicum) were seques-

tered and maintained without discrimination (Table 4). It

is notable that the concentration of 3acetylindicine, analkaloid that is only detectable in trace amounts in the

larval diet and larval extract, is considerably increased in

adults; it is accompanied by trace amounts of 3-

acetyllycopsamine which does not occur in the larval diet.

Feeding of a purified alkaloid extract from Eupator-

ium cannabinum gave more complex results (Table 4).

Rinderine as a major alkaloid in the larval diet was

found at already decreased levels in larvae and only in

traces in adults which instead contained lycopsamine

and echinatine as major alkaloids. Obviously, alkaloids

with a 3S-configuration (Fig. 1B) are preferentially

transferred to the adult life-stage. While for larvae the

changed alkaloid composition could be accomplished by

uptake discrimination, this explanation can be excluded

for adults. In particular, the strong increase in the

lycopsamine level indicates an insect-specific epimeriza-

tion of (3R)-configurated alkaloids, probably accom-

panied by the known (see Chapter 3.4) epimerization of

(7S)-configurated alkaloids (Fig. 1B).

In addition, like in the experiment with indicine small

amounts of acetyl derivatives are detectable, which were

not present in the larval diet and thus must have been

formed by the insect. Interestingly, besides 3-acetyl

derivatives, 7-acety esters are detected.

In both feeding experiments considerable amounts ofcallimorphines are detectable. In the experiment withH.

indicum alkaloids the insect-specific alkaloids account

for 1012%, while in the E. cannabinum experiment, the

callimorphines add up to 27% (males) and 50%

(females) of total alkaloids (Table 4).

ARTICLE IN PRESS

Table 2

Pyrrolizidine alkaloid profile established by GCMS for G. geneura that as larvae (penultimate instar) had received about 1 mg senkirkine per

individual added to the artificial diet

Pyrrolizidine alkaloids recovered from insects m/z[M+] RI Relative abundance (%)

Diet Larvae (n 2) Males (n 3) Females (n 4)


Senecivernine 335 2267 2 42.571.5 38.572.5 40.071.4

Senecionine 335 2275 1 28.071.0 33.571.5 32.070.9

Seneciphylline 333 2288 Tr 12.071.0 13.570.5 12.770.8

Integerrimine 335 2335 Tr 12.070 13.571.5 14.370.5

Senkirkine 365 2460 97 5.571.5a Nd Nd

Callimorphines

Homocallimorphine 311 2037 1.171.0 1.170.6

Total alkaloid (mg/individual 18.9710.8 14.371.3 12.872.8

Total alkaloid (mg/g dry wt) 0.0770.04 0.1670.02 0.0970.03

aMost likely due to the gut content



20/137

3.3. Sequestration and metabolism of open-chain

platynecine and trachelanthamidine esters

Feeding of a dietary alkaloid mixture that contained

the open-chain platynecine diester sarracine (containing

5% of its (E)(Z)-isomer sarracinine) (Fig. 3B) (Table 5).

In contrast, adults did not contain even traces of

the plant-derived pyrrolizidine alkaloids but instead

stored the respective platyphylline analogs of creatono-

tines and callimorphines, i.e. (1S)-1,2-dihydrocreatono-

tines and (1S)-1,2-dihdyrocallimorphines (Table 5).

Hydrolysis of the insects alkaloids recovered from

ARTICLE IN PRESS

Fig. 2. Retronecine and heliotridine are converted into insect-specific monoesters. (A) Creatonotines are found in pupae and probably synthesized atearly stages of pupation, (B) callimorphines are found in adults and probably are synthesized shortly before eclosion at the expense of creatonotines,

and (C) (7S)-Configurated heliotridine is partly epimerized yielding (7R)-configurated retronecine and partly converted into callimorphine derivatives

with (7S)-configuration.



21/137

adults and GC-MS analysis of the necine base fraction

revealed the presence of platynecine as exclusive necine

base. The two chlorinated alkaloids are most likely

artifacts generated during treatment with dichloro-

methane.

Insects given the dietary mixture of T-phalaenopsine

(trachelanthamidine ester, 80%) and Is-phalaenopsine(isoretronecanol ester, 20%) (Fig. 3C) did not, as

adults, contain even trace amounts of the dietary

pyrrolizidine alkaloids. Instead the respective 7-deso-

xy-1,2-dihydrocreatonotines and 7-desoxy-1,2-callimor-

phine were present (Table 6). Most interestingly

adults were found to contain as major alkaloids 1,2-

dihydrocallimorphine and 1,2-dihydrohomocallimor-

phine which account for more than 60% of total

pyrrolizidine alkaloids recovered from the insects.

The two compounds display mass fragmentation

patterns identical to those of the 1,2-dihydrocallimor-

phines identified after feeding of plant-acquired platy-

necine esters, i.e. S. congestus (Table 1) and sarracine

(Table 5) but show different RI values (Fig. 4).

Hydrolysis of the alkaloid mixtures recovered from

adults and analysis of the TMS-derivatives of the necine

base fraction revealed the presence a necine base with a

fragmentation pattern identical to that of platynecine

but with a different RI. It was identified as the

platynecine isomer turneforcidine with (1R)-configura-

tion like trachelanthamidine (Fig 3). Trachelanthami-

dine itself was identified in the same experiment

accompanied by only traces of its (1S)-configurated

isomer, i.e. isoretronecanol. This confirms, firstly, that

the alkaloids recovered from the insects have (1R)-configuration (Table 6) and, secondly, that, G. geneura

must be able to hydroxylate the trachelanthamidine

moiety at C-7 (Table 6;Fig. 3B, C).

ARTICLE IN PRESS

Fig. 3. Formation of insect-specific necine esters with insect-specific

necic acids, i.e. creatonotic acids and callimorphic acids (A). (B)

Formation of 1,2-dihydro derivatives from plant-acquired platynecine,

and (C) formation of 7-deoxy-1,2-dihdyro derivatives from plant

acquired trachelanthamidine and insect-specific 7-hydroxylation of

trachelanthamidine yielding turneforcidine.

Table 3

Pyrrolizidine alkaloid profiles established by GCMS for G. geneurathat as larvae (penultimate instar) had received about 2 mg per individual of an

alkaloid mixture derived from in vitro cultivated Parsonsia laevigata plantlets added to the artificial diet




14-Deoxyparsonsianine 425 2773 23 45.077.0 35.776.5 44.371.214-Deoxyparsonsianidine 439 2860 61 52.574.5 22.575.9 38.070.6

Heterophyllinea 453 2920 5 1.571.5

Parsonsianidine 455 2935 7

17-Methylparsonsianidine a 469 2993 3

Creatonotines

Creatonotine B 269 1973 Tr 2.371.3 0.470.3

Callimorphines

Deacetylcallimorphine 255 1821 1.070.99 1.070.6

Callimorphine 297 1955 14.574.8 8.771.3

Homocallimorphine 341 2033 23.376.7 6.770.9

Total alkaloids (mg/individual) 37.2736.8 14.374.0 33.078.2

Total alkaloids (mg/g dry wt) 0.370.3 0.1170.07 0.270.06

aTentatively identified



22/137

3.4. Metabolism of retronecine and heliotridine:

formation of creatonotines and callimorphines

To study the specificity and temporal sequence of the

formation of insect-specific necine esters, retronecine

and heliotridine were fed with larval diet to G. geneura.

The results are summarized in Table 7. Pupae of

individuals that as larvae received retronecine contain,

besides a small proportion of residual retronecine, the

full set of creatonotines (Fig. 2A) but not even traces of

ARTICLE IN PRESS

Table 4

Profiles of the pyrrolizidine alkaloids established by GCMS forG. geneurathat as larvae (penultimate instar) had received about 1 mg per individual

of the indicated plant derived alkaloid mixtures added to the artificial diet

Alkaloids recovered m/z[M+] RI Relative abundance (%)

Alkaloid mixture from Eupatorium cannabinum Alkaloid mixture from Heliotropium indicum

Diet Larvaen 4

Malesn 4

Femalesn 2

Diet Larvaen 2

Malesn 1

Femalesn 5


Supinine 283 1967 8 5.070.4

Amabiline 283 1972 Tr 5.872.2

Indicine 299 2120 88 83.572.5 64 50.873.6

Intermedine 299 2131 3 1.870.6

Lycopsamine 299 2145 1 1.871.2 32.5713.9 3575 12 15.071.0 9 8.270.7

Rinderine 299 2151 60 36.576.6 Tr

Echinatine 299 2164 19 42.874.4 30.5711.2 2.570.5

30-Acetylindicin 341 2182 Tr Tr 15 27.873.4

30-Acetylrinderine 341 2210 9

70-Acetyllycopsmaine 341 2210 5.071.8 0.670.2

70-Acetylechinatine 341 2228 6.571.7 2.570.7 0.370.2

30-Acetyllycopsamine 341 2239 Tr 2.370.5 7.570.5 Tr 1.570.4

30-Acetylechinatine 341 2269 1.470.7 0.470.2Creatonotines

Estigmine B 253 1830 Tr 0.870.3

Creatonotine A 255 1880 Tr

Creatonotine B 269 1973 Tr

Callimorphines

Isodeacetylcallimorphine 255 1814 0.370.1 1.071.0

Deacetylcallimorphine 255 1822 1.570.3 5.070

Callimorphine 297 1955 20.572.4 40.571.5 Tr 9 9.070.52

Homocallimorphine 5.372.4 5.573.5 3 1.670.4

Total alkaloid (mg/individual) 75.8716.5 47.378.5 58.5720.5 186759 105 165722

Total alkaloid (mg/g dry wt) 0.3370.09 0.3570.12 0.3570.15 1.1870.42 0.9 0.9870.09

Table 5

Pyrrolizidine alkaloid profiles established by GCMS for G. geneura that as larvae (penultimate instar) had received about 1 mg per individual ofsarracine/sarracinine added to the artificial diet




Sarracine 337 2390 95 56.072.0

Sarracinine 337 2401 5 10.1710.0

9-Angeloylplatynecine 239 1842 34.078.0

Creatonotines

(1S)-1,2-Dihydrocreatonotine A 257 1923 Tr Tr Tr

(1S)-1,2-Dihydrocreatonotine B 271 2032 Tr 11.974.2 Tr

Callimorphines

(1S)-1,2-Dihydrocallimorphine 299 2016 54.475.6 60

(1S)-1,2-Dihydrohomocallimorphine 313 2097 30.076.0 30

7-Chlormethoxy-(1S)-1,2-dihydrocallimorphinea 347 2207 2.571.9 8

7-Chlormethoxy-(1S)-1,2-dihydrohomocallimorphinea 361

02 insect biochemistry molecular

Documents