Molecular Identification of Pathogens in Nursery Crops

Download Molecular Identification of Pathogens in Nursery Crops

Post on 30-Dec-2015

17 views

Category:

Documents

0 download

Embed Size (px)

DESCRIPTION

Molecular Identification of Pathogens in Nursery Crops. Ainong Shi. Tennessee State University. Lilac Leaf Blight. What pathogen causes this disease? How to analyze and identify it by molecular approaches?. Powdery Mildew Diseases. Dogwood. Lilac. Crape myrtle. - PowerPoint PPT Presentation

TRANSCRIPT

  • Molecular Identification of Pathogens in Nursery CropsAinong ShiTennessee State University

  • Lilac Leaf BlightWhat pathogen causes this disease?How to analyze and identify it by molecular approaches?

  • Powdery Mildew DiseasesDogwoodLilacCrape myrtle Are they caused by same pathogen? How to analyze and identify them by molecular approaches?

  • How to identify a pathogen by molecular approach?Lilac leaf blight for example 1

  • Molecular Identification of PathogenITS universal primer analysisSpecific primer analysis

  • ITS (Internal Transcribed Spacer)18S rDNAITS15.8SrDNA28S rDNAITS2ITS1ITS4(primer)(primer) ITS region of rDNA has been widely used in identifying pathogens for fungal diseases in plants. Thousands of sequences of ITS regions from fungi have been published in GenBank. Universal primer pairs can amplify ITS region for all fungi.

  • A four-step procedurePCR Product SequencingITS Universal Primer AnalysisSimilarity AnalysisPCR AmplificationDNA Extraction

  • DNA ExtractionGenomic DNA was extracted by use of the DNeasy Plant Mini Kit from Alternaria medium (mycelia and conidia) or directly from the lilac leaves of Alternaria leaf blight.

  • ITS universal primers:PCR Amplification570 bpITS1: tccgtaggtgaacctgcgg *IST4: tcctccgcttattgatatgcThe primer pair ITS1/ITS4 produces a 570 bp fragment.ITS1/ITS4* White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications.

  • PCR Product SequenceTCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAPrimerSequence (5 3)reversal sequenceITS1TCCGTAGGTGAACCTGCGGIST4tcctccgcttattgatatgc GCATATCAATAAGCGGAGGAThe sequence above amplified from the primer pair ITS1/ITS4.

  • Query: 1 tccgtaggtgaacctgcggagggatcattacacaaatatgaaggcgggctggaacctctc 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 25 tccgtaggtgaacctgcggagggatcattacacaaatatgaaggcgggctggaacctctc 84Query: 61 ggggttacagccttgctgaattattcacccttgtcttttgcgtacttcttgtttccttgg 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 85 ggggttacagccttgctgaattattcacccttgtcttttgcgtacttcttgtttccttgg 144 Query: 541 ctgaacttaagcatatcaataagcggagga 570 ||||||||||||||||||||||||||||||Sbjct: 565 ctgaacttaagcatatcaataagcggagga 594BLAST SearchQuery from our dataSbject Alternaria in GenBankSimilarity Analysis570/570 (100%) identitiesAnalysis indicates the sequence from our data belongs to ITS region of Alternaria.

  • Specific Primer Analysis Develop specific primers for Alternaria genus. Develop specific primers for A. alternata.

  • TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAPrimer design for ITS region of Alternaria PrimerSequence (5 3) Reversal sequenceAl-f1cccaccactaggacaaacaAl-r1gcttaatggatgctagacct aggtctagcatccattaagc The sequence size from Al-f1 to Al-r1 is 370 bp.

  • Specific primer for Alternaria genus of ITS regionThe size of band is 370 bp.The band showed in all tested Alternaria samples.Sequence data from the PCR amplified from the specific primer pair Al-f1/Al-r1 is identical to that in ITS region of Alternaria.370 bpThe results indicated one kind of Alternaria was the pathogen.

  • Specific primers for Alternaria alternata (1)

    Primer pairGenBank AccessionGene nameSequence results Laneaboveaa-endo-f1aa-endo-r1AY629233A. alternata endopolygalacturonase gene100% (408/408)1 to 4aa-gp-f1aa-gp-r1AF282319A. alternata mixed-linked glucanase precursor 99% (659/664)5 to 8

  • Specific primers for Alternaria alternata (2)1500 bp1000 bp600 bp300 bp100 bp 1 2 3 4 M

    Primer pairGenBank AccessionGene nameSequence results Lanebelowaa-hsp-f1aa-hsp-r1AAU87808A. alternata hsp70 mRNA100% (237/237)1 & 2aa-his-f1aa-his-r1AF404640A. alternata histone gene100% (356/356)3 & 4

  • Alternaria alternata is one pathogen in lilac leaf blight disease.Specific primer pairs:aa-gp-f1/aa-gp-r1aa-hsp-f1/aa-hsp-r1aa-hsp-f1/aa-hsp-r2aa-his-f1/aa-his-r1A. alternataAl-f1/Al-r1 AlternariaConclusion for example 1

  • Powdery Mildew DiseasesDogwoodLilacCrape myrtle Are they caused by same pathogen? How to analyze and identify them by molecular approaches?Example two

  • Molecular Identification ApproachesITS universal primer analysisSequence analysisSpecific primer analysis

  • ITS universal primer analysis--------------------------------------------------------------Disease Band sizeLane ----------------------------------------------------Crape myrtle powdery mildew 666bp1Lilac powdery mildew 645bp2Dogwood powdery mildew 642bp3-----------------------------------------------------------------------------Primer pair: ITS1/ITS4M 1 2 3

  • Sequence Analysis

    DiseasePrimer pairSequence lengthCG%PathogenDogwood powdery mildewITS1/ITS4642 bp54.05Erysiphe pulchra Lilac powdery mildewITS1/ITS4645 bp54.42Microsphaera syringae-japonicae Crape myrtle powdery mildewITS1/ITS4666 bp51.05Uncinuliella australiana

  • Specific Primer AnalysisI. Erysiphe pulchra of dogwood powdery mildew M 1 2 3 4 5 6 7 8 9 MLane 1, 4, 7 are Microsphaera syringae-japonicae Lane 2, 5, 8 are Erysiphe pulchraLane 3, 6, 9 are Uncinuliella australianaLane M are 100 bp ladder

  • Specific Primer AnalysisII Uncinuliella australiana of powdery mildew in crape myrtleThe bands only for U. australiana (lane 2, 6, 10, and 14) in four DNA groups: Lagerstroemia indica, (2) Uncinuliella australiana, (3) Erysiphe Pulchra, and (4) Microsphaera syringae-japonicae.Lane M are 100 bp ladder.M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M

  • Specific Primer AnalysisIII. Microsphaera syringae-japonicae of lilac powdery mildew 1 2 3 MThe band showed only for Microsphaera syringae-japonicae (lane 2) in three materials: 1. Erysiphe pulchra, 2. Microsphaera syringae-japonicae , and 3. Uncinuliella australiana. Lane M are 100 bp ladder

  • A=EP-f6/EP-r3B=EP-f6/EP-r4C=EP-f6/EP-r5 Eight molecular markers (specific primer pairs)Summary for example 2D=ua-f1/ua-r3E=ua-f1/ua-r4 F=ua-f3/ua-r3G=ua-f3/ua-r4Primer pairs:H=msj-f2/msj-r1

    PathogenPrimer pairsABCDEFGHErysiphe pulchra11100000Uncinuliella australiana00011110Microsphaera syringae-japonicae00000001

  • Other diseases

  • Pseudocercospora bairamifera is one pathogen in lilac leaf spot.Lilac Leaf Spot

  • Identification of Botryosphaeria dothidea pathogen of leaf blight disease in dogwood (Cornus florida)

  • Oak Powdery Mildew

  • Maple Powdery Mildew

  • Similarity AnalysisMolecular Detection of PathogensPCR Product SequencingPCR AmplificationDNA ExtractionSequence to VerifyPrimer TestSpecific Primer DesignPathogen Detection

  • Face to plant diseasesHow can we solve them?This is our JOB!

  • ACKNOWLEDGEMENTSTennessee State University:Dr. Margaret Mmbaga, Dr. Sandra Reed, Dr. Nick Gawel, Dr. Roger Sauve,Dr. Suping Zhou, Dr. Emmanuel Nnodu,Dr. Frank Mrema, and Dr. Mario Keri.

  • Thank you!Thank all of you!

Recommended

View more >