DNA Barcoding From DNA to ID Inspiring Excellence.

Download DNA Barcoding From DNA to ID Inspiring Excellence.

Post on 02-Jan-2016

214 views

Category:

Documents

2 download

TRANSCRIPT

  • DNA BarcodingFrom DNA to IDInspiring Excellence

  • ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATGWhat is DNA Barcoding?=?Inspiring Excellence

  • What DNA Barcoding Works OnmatKrbcLCHLOROPLASTMITOCHONDRIONCO1

  • Fail: Sequence is completely conserved, good for PCR, but uninformative as barcode Fail: Sequence shows no conservation, impossible for PCR, but good as barcode Win: Sequence shows ~70% conservation, good for PCR, good as barcode Why DNA Barcoding Works

  • Why DNA Barcoding WorksmatKrbcLCHLOROPLASTMITOCHONDRIONCO1

  • ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG1. Sample Organism4. Sequence DNA2. Extract DNA3. Amplify Barcode DNA5. Compare sequence against databaseHow DNA Barcoding Works

  • ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATGWhy is DNA Barcoding Important?Inspiring Excellence

  • Issue #1: No one knows how many species there are.

  • How Many Species Can You Name?How many Animals did you name?How many mammals?How many plants?How many insects?CatFelis catusDogCanis lupus familiarisOak TreeQuercus albaSharkGinglymostoma cirratumBeetlePopillia japonica

  • Currently between 1.5 and 2 million species are described/known

    This number may represent as little as half of the true number of species

    Perhaps more than 1/3 of all species are threatened(IUCN Red list version 2010.1)

    VertebratesSpeciesMammals5,490Birds9,998Reptiles9,084Amphibians6,433Fishes31,300Total62,305

    InvertebratesSpeciesInsects1,000,000Mollusks85,00Crustaceans47,000Corals2,175Arachnids102,248Total (+others)1,305,250

    PlantsSpeciesAngiosperms281,821Gymnosperms1,021Ferns and Allies12,000Mosses16,236Algae10,134Total321,212

  • Issue #2: There is a lack of agreement of what species means.

  • Canis lupusCanis lupus (familiaris)Anas platyrhynchosDefining species is complex anddepends on many factors:

    Interbreeding capabilities

    Morphological variation

    Ecological context

    Genetic similarities

  • ?

  • Issue #3: Traditional taxonomic identification methods may be inadequateand too slow to capture vanishing biodiversity

  • Classical taxonomy is difficult for non-experts to understand Leaves alternate proximally, opposite and ultimately decussate distally, 616 413 cm; petiole ca. as long as blade, winged, base clasping, basal lobes stipulate, growing as extensions of wings, less than 1 mm wide; blade 57-veined, ovate, glabrous, base typically sagittate, margins entire, apex acute to acuminate. Staminate inflorescences axillary, 12 per axil, paniculate, fasciculate; panicles bearing flowers singly,bracteolate, in a zigzag pattern along rachis, internodes less than 2 mm; rachis to 25 cm, secondary axes 13(6), fasciculate, less than 3 cm, each subtended by deltate-ovate bracteole shorter than 1 mm. Pistillate inflorescences solitary, 48(20)-flowered, 635 cm, internodes ca. 1 cm.Adding to the complexity: immature, damaged or incomplete specimen may make identification impossible.

  • Issue #4: DNA Barcoding provides opportunities to investigate things

  • DNA Barcoding Engages and Transforms CuriosityInto Practical Inquiry

  • Kate StoeckleAugust 23, 2008

  • Research questions can be about any living thing or about non-living things (foods or other products) that have DNA. Are there invasive (non-native) plants in my local park?

    What are the most popular types of flowers in my city?

    Do the teas I buy at my supermarket really contain the ingredients on the package?

    How many different living organisms can I find in an office building?

    Whose droppings are these?What research questions could you ask?Examples:Inspiring Excellence

  • DNA extraction Kit

    PCR machine and reagents

    DNA sequencing (Genewiz, other)

    Bioinformatic tools (analysis of DNA sequence)Materials & Equipment for DNA BarcodingInspiring Excellence

  • Sequence

    Prepare

    Compare

    Identify

    ShareDNA Barcoding AnalysisInspiring Excellence

  • Contributing to big scienceInspiring ExcellenceGenBankBOLD

  • ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG1. Sample Organism4. Sequence DNA2. Extract DNA3. Amplify Barcode DNA5. Compare sequence against databaseHow DNA Barcoding Works

  • Find NCBIs MapViewer; identify difference between human and chimpanzee genome; check situation in all 4 other primate genomes provided

    Make sea shell phylogenetic tree, work through hhmi.org/biointeractive/activities/shells/online/index.html

    Review users.ugent.be/~avierstr/principles/phylogeny.html*

    Review http://www.hiv.lanl.gov/content/sequence/TUTORIALS/TREE_TUTORIAL/Tree-tutorial.html*

    Review Constructing an Evolutionary Tree (Binder)

    Review Stockle paper on DNA, Taxonomy & Barcode of Life (pre-Readings)

    * Links worked on 2012 05 31; if they fail, find the 2 sites through GoogleAssignments

  • Questions?Inspiring Excellence

    *Second, many species look alike or very nearly alike and many have a variety of life forms. It takes an expert to know this is Culex pipiens, which is the main vector for West Nile virus in the eastern US. And it takes an expert to know this is not Culex pipiens, this is Culicens incidens, which does not transmit disease to humans. Even if you know how to identify these adults, it is harder to recognize mosquitos when they are larvae, and probably impossible to identify the eggs. Here is a raft of eggs of Culex pipiens, and here you can see how small a raft is. These difficult-to-identify stages are the stages at which you want to apply control measures, such as spraying, before they hatch into adults. But an organisms DNA is the same in all life stages, and it only takes a tiny sample to make an identification and to tell these two species apart*I think Kate summarized their findings well: If youre paying for white tuna and youre eating tilapia, I think youd want to know that.