DNA Barcoding and Undergraduate Science

A Case Study

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Organism is sampled DNA is extracted “Barcode” amplified

Sequenced DNA is compared with a barcode database

How DNA barcoding works

7/31/2014 3

Major database for DNA Barcode data is BOLD

DNA Barcoding-Why Do it?

•Species are vanishing quickly-barcoding allows non-expertsto identify species without needing to be a trained taxonomist and in a short period of time

•Allows us to document all species in an ecosystem relatively quickly, helps with conservation efforts

•Is now being used to test the labelling on food products and to aid quarantine efforts to stop the trade in endangered species

31/07/2014 4

DNA barcoding is engaging in the classroom, and directs curiosity to opportunities for practical inquiry…

7/31/2014 6

Education and DNA Barcode projects in the USA

2 MAJOR PROJECTS, 2 Different approaches

1. Urban Barcode Project: small groups of high students matched with a mentor, devise project, compete for a prize. Projects derive data from species and food products in NYC urban area

7/31/2014 7

2. Coastal Marine Biolabs are leading a student-centeredcampaign, Barcoding Life’s Matrix, to generate reference barcodes for fish and invertebrate species that provide vital signs of marine ecosystem health. Student groups attend a residential camp, and assist scientists in collection, DNA extraction, PCR and data analysis of species in an area of Southern California

Education and DNA Barcode projects in the USA

31 July 2014 8

Outline of Holmesglen Projects

Students doing Diploma of Laboratory Technology (2 years).

leads to jobs as lab techs or research assistants, or students go on to higher degrees.

Ages ~19-45.

Carried out over 8 weeks. Printed project booklet given out to each student.

Assessed by presentation at departmental seminar and printed report in scientific report format

Outline of Holmesglen Projects .

Holmesglen has incorporated elements of both the USA projects

2012 our projects similar to the NYC Urban Barcode Project.

2013 students spent an extended period in a remote area making collections, project more similar to CMB

2014………….??

31/07/2014 9

Week 1. Brainstorming Session

Decide on a question they would like to answer and draw

up a plan for how to do this. (eg what chillie species are

grown and sold in Melbourne, what species can be found

in a rainforest area in the Rubicon state forest?)

They should also develop a hypothesis (eg that you will

find a variety of species labeled as “flake”. flake is a

generic name for shark in Australia.)

31/07/2014 10

Weeks 2-4 Sample Collection, Genomic DNA Extraction, PCR

Students visiting

markets or out in field

Take pics of samples

and record other data

with DNA Barcode

app for iPad and

iPhone (Android app

in pipeline)

11

7/31/2014 12

RLC and Rubicon State Forest

7/31/2014 13

RLC and Rubicon State Forest

Week 5. Analysis of Sequencing Data

Then put forward and reverse

trace sequences into DNA

subway (part of the Urban

Barcode Project

Or

Student Data Portal of BOLD

(SDP) The SDP has a very

intuitive interface, and has extra

features which from an educator’s

point of view are very useful,

such as the ability to monitor

student groups easily, to accept

or reject data, and to record

which students did which work31/07/2014 14

Week 6. Input Data to Atlas of Living Australia and BOLD

Our students inputted

plant species data into the

Atlas, which has links with

the international site,

Barcode of Life Database (

BOLD).

Fish sample data was

inputted directly to BOLD

through the SPD

This data is real

scientific data

31/07/2014 15

7/31/2014 16

Week 8. Seminar Presentations

Final seminar: Invite other staff and students, people

from outside school

My students complained that the audience wasn’t big

enough!

31/07/2014 17

Holmesglen Barcoding

Website

31/07/2014 18

Educational Benefits!

•Student engagement, motivation

•Learning to do real science

•Resume building

•Using a range of skills (PBL) (chemistry, maths)

•Independence, problem solving31/07/2014 19