ORIGINAL PAPER

Curcumin Prevents Cerebral Ischemia Reperfusion InjuryVia Increase of Mitochondrial Biogenesis

Li Liu • Wenchao Zhang • Li Wang • Yu Li • Botao Tan •

Xi Lu • Yushuang Deng • Yuping Zhang • Xiuming Guo •

Jun Mu • Gang Yu

Received: 6 January 2014 / Revised: 7 April 2014 / Accepted: 18 April 2014

� Springer Science+Business Media New York 2014

Abstract Curcumin is known to have neuroprotective

properties in cerebral ischemia reperfusion (I/R) injury.

However, the underlying molecular mechanisms remain lar-

gely unknown. Recently, emerging evidences suggested that

increased mitochondrial biogenesis enabled preventing I/R

injury. Here, we sought to determinate whether curcumin

alleviates I/R damage through regulation of mitochondrial

biogenesis. Sprague-Dawley rats were subjected to a 2-h

period of right middle cerebral artery occlusion followed by

24 h of reperfusion. Prior to onset of occlusion, rats had been

pretreated with either low (50 mg/kg, intraperitoneal

injection) or high (100 mg/kg, intraperitoneal injection) dose

of curcumin for 5 days. Consequently, we found that curcu-

min pretreatment enabled improving neurological deficit,

diminishing infarct volume and increasing the number of

NeuN-labeled neurons in the I/R rats. Accordingly, the index

of mitochondrial biogenesis including nuclear respiratory

factor-1, mitochondrial transcription factor A and mitochon-

drial number significantly down-regulated in I/R rats were

reversed by curcumin pretreatment in a dose-dependent

manner, and the mitochondrial uncoupling protein 2 presented

the similar change. Taken together, our findings provided

novel evidence that curcumin may exert neuroprotective

effects by increasing mitochondrial biogenesis.

Keywords Cerebral ischemia reperfusion � Curcumin �Mitochondrial biogenesis

Abbreviations

I/R Ischemia reperfusion

IHC Immunohistochemistry

MCAO Middle cerebral artery occlusion

NRF-1 Nuclear respiratory factors 1

OGD Oxygen glucose deprivation

PGC-1a Peroxisome proliferators-activated receptor ccoactivator-1a

ROS Reactive oxygen species

RT Reverse transcription

TFAM Mitochondrial transcription factor A

TTC Triphenyltetrazolium chloride

UCP2 Uncoupling protein 2

Introduction

Ischemic stroke is a leading cause of death and disability

worldwide. Nowadays, increasing treatments of acute

L. Liu � W. Zhang � X. Lu � Y. Deng � Y. Zhang � X. Guo �J. Mu � G. Yu (&)

Department of Neurology, The First Affiliated Hospital of

Chongqing Medical University, 1 Youyi Road, Yuzhong

District, Chongqing 400016, People’s Republic of China

e-mail: gangyuw2013@126.com

L. Liu

Department of Brain, The Chongqing Hospital of Traditional

Chinese Medicine, Chongqing 400021,

People’s Republic of China

L. Wang

Chongqing Cancer Institute, Chongqing 400010,

People’s Republic of China

Y. Li

Department of Pathology, Chongqing Medical University,

Chongqing 400016, People’s Republic of China

Y. Li

Institute of Neuroscience, Chongqing Medical University,

Chongqing 400016, People’s Republic of China

B. Tan

Department of Rehabilitation, The Second Affiliated Hospital of

Chongqing Medical University, Chongqing 400010,

People’s Republic of China

123

Neurochem Res

DOI 10.1007/s11064-014-1315-1

ischemic stroke with intravascular techniques and throm-

bolytic agents have significantly decreased functional def-

icits. However, reperfusion itself yielding excess

endogenous reactive oxygen species (ROS) results in

reperfusion injury [1–5]. Thus, effective prevention of

reperfusion injury is of great clinical value.

Curcumin, a polyphenols derived from powdered rhi-

zome of C. longa Linn, is widely used as a dietary spice in

food in several Asian countries [6]. Previous studies

demonstrated that curcumin have neuroprotective proper-

ties in cerebral ischemia reperfusion (I/R) injury [7].

Mechanisms underlying these neuroprotective properties of

curcumin remain poorly understood, although the molec-

ular effects of its anti-oxidant and anti-inflammatory were

intensively reported [8–10].

Recently, accumulating evidences have shown that

mitochondria is a key target for cerebral I/R injury [11–14].

Correspondingly, some studies revealed that increased

mitochondrial biogenesis may exert neuroprotection [15,

16]. For example, adaptive mitochondrial biogenesis was

reported to contribute to the improvement of overall oxi-

dative function and energy state of hypoxic-ischemic brain

[17]. In addition, Valerio et al. [18]. found that increased

mitochondrial biogenesis could help alleviating oxygen

glucose deprivation (OGD)-mediated neuronal impairment

and ischemic cerebral injury.

This research was designed to study whether curcumin

was capable of preventing I/R damage through regulation

of mitochondrial biogenesis. Mitochondrial transcription

factor A (TFAM) is a nucleus-encoded protein in charge of

maintaining mitochondrial DNA copy number [1]. The

expression of TFAM is controlled by nuclear respiratory

factors-1 (NRF-1), the transcriptional partner of peroxi-

some proliferator-activated receptor c coactivator-1a that

regulates the entire mitochondrial biogenesis program [15].

Uncoupling protein 2(UCP2), an inner mitochondrial

membrane anion-carrier protein, is available to protect

neurons from cerebral ischemia injury through inhibition of

ROS generation and limitation of mitochondrial Ca2? [3].

Using measurements of mitochondrial transcription and

replication factors (NRF-1 and TFAM), mitochondrial

number and mitochondrial protein UCP2, we demonstrated

that mitochondrial biogenesis was increased in the middle

cerebral artery occlusion (MCAO) reperfusion model of

rats with curcumin in a dose-dependent manner.

Materials and Methods

Animal Experiment

All experiments were approved by the Institutional Animal

Care and Use Committee of Chongqing Medical University.

One hundred of twenty-four male Sprague-Dawley rats

weighing between 220 and 300 g were randomly divided

into four groups: sham-operated (n = 28), ischemia reper-

fusion (I/R) (n = 32), curcumin 50 mg/kg ? I/R (n = 32)

and curcumin 100 mg/kg ? I/R (n = 32). Rats were anes-

thetized initially with chloralic hydras (400 mg/kg, ip) to

perform preparative surgery. The MCAO model was per-

formed according to the previous study [19]. Briefly, a

fishing thread with 0.234 mm in diameter was introduced

into the right external carotid artery and advanced into the

internal carotid artery for a length of 18 mm from the

bifurcation, where the origin of the middle cerebral arteryall

was blocked [8]. During anesthesia body temperature was

maintained at 37 ± 0.5 �C with a thermostatic table. The

fishing thread was left in place for 2 h. After recovering of

consciousness, the rats were returned to the animal room for

postoperative recovery in individual cages,and sacrificed at

24 h after the fishing thread was withdrawn. For sham-

operated animals, common carotid artery, external carotid

artery and internal carotid artery were just dissected from

connective tissue with no fishing thread inserted in.

Drug Treatment

100 mg curcumin (Sigma,USA) was dissolved in 1 ml of

dimethylsulfoxide (Sigma, USA). In drug groups, the rats

have been pretreated with either low (50 mg/kg, ip) or high

(100 mg/kg, ip) dose of curcumin for 5 days prior to the onset

of occlusion [7]. The other two groups were injected intra-

peritoneally with the same volume of dimethylsulfoxide.

Neurological Score

Neurological assessment was carried out after 30 min to

confirm successful MCAO and immediately before rats

were sacrificed after 24 h [7]. Neurological deficit was

scored on a 5-point scale [19]. No neurological deficit = 0,

failure to extend left paw fully = 1, circling to left = 2,

falling to left = 3, did not walk spontaneously and has

depressed levels of consciousness = 4.

Measurement of Infarct Volume

The brain tissues (n = 6) were immediately collected

while the rats were deeply anesthetized. The obtained brain

samples were frozen for 20 min at -20 �C, then sliced into

2-mm-thick coronal sections. The sections were stained

with 2 % 2,3,5-triphenyltetrazolium chloride (TTC, Sigma,

USA) for 30 min at 37 �C [20]. The white zone of sections

were considered as infarct areas. Sections were photo-

graphed using a digital camera (DSC-W320, Sony, Japan).

The infarct area in each coronal brain slice was measured

using Imagepro plus 6.0 analysis software (Media

Neurochem Res

123

Cybernetics, USA). The infarct volume was calculated as

follows: 100 9 (contralateral hemisphere volume - non-

lesioned ipsilateral hemisphere volume)/contralateral

hemisphere volume [21].

Detecting of Immunoreaction

General Tissue Treatment

All groups of rats were deeply anesthetized and intracar-

dially perfused with 0.9 % saline followed by 4 % para-

formaldehyde. The brain tissue samples were removed and

fixed in 4 % paraformaldehyde overnight. The samples cut

from 3 to 7 mm backward of the antinion were embedded

in paraffin [22, 23], and coronally cut into 5 lm thick

sections.

Immunohistochemistry (IHC)

The immunostaining was performed as reported previously

[24]. Paraffin sections were dewaxed with dimethylben-

zene and graded ethanol series. After heat induced epitope

retrieval, sections were processed through 0.3 % H2O2 for

15 min, and then 5 % bovine serum albumin for blocking

for 1 h. Sections were incubated with primary NeuN anti-

body (1:100, Millipore, USA) overnight at 4 �C, followed

by incubation with anti-rabbit secondary antibody

(Zhongshan Golden Bridge, Beijing, China) for 30 min at

37 �C. The immunoreactivity was visualized by treatment

with Dako Envision kit HRP. Finally, counterstaining was

carried out with hematoxylin. NeuN-positive immunore-

activity in the cortex was definite in the deeply brown-

stained cells, especially located at the nucleus. 15 random

visual field images for every sample were automatically

and semiquantitatively analyzed using the Imagepro plus

6.0 image analysis system (Media Cybernetics, America).

Immunofluorescence

The procedure of immunofluorescence was the same as

IHC on the first day while in the absence of incubation in

0.3 % H2O2. The primary antibody used was goat anti-

UCP2 N-terminus (1:25, Santa Cruz, USA). On the second

day, sections were incubated in dark place with fluorescein-

conjugated affinipure rabbit anti-goat IgG (Zhongshan

Golden Bridge, Beijing, China) for 30 min at 37 �C. After

several washes, sections were coverslipped in 50 %

glycerol. Immunoreactivity was detected under laser

scanning confocal microscopy (Leica Microsystems Hei-

delberg GmbH, Germany) on an Olympus IX 70 inverted

microscope (Olympus, Japan).

Electron Microscopy Evaluation of Mitochondrial

Number

At 24 h after reperfusion, the animals were deeply anes-

thetized and intracardially perfused with 0.9 % saline fol-

lowed by solution of 4 % paraformaldehyde mixed with

2.5 % glutaraldehyde in PBS. Peripheral penumbra of

infarct areas were cut into pieces about 1 mm3 and pro-

cessed as described previously (Fig. 1) [23, 25]. Briefly, a

coronal section was cut from 3 to 7 mm backward of the

antinion, then a longitudinal cut (from top to bottom)

approximately 2 mm from the midline through the right

hemisphere. We then made a transverse diagonal cut at

about the ‘‘2 o’clock’’ position to separate the core from the

penumbra. To measure the mitochondrial number, 15 ran-

domly selected penumbra areas per animal, which included

large neuronal-like nuclei covering about one-third of the

visible image, were photographed at 95,000 magnification

and counted according to the method described previously

with minor modifications (3 animals per group) [17].

Fig. 1 Pictorial view of sample in the peri-infarct subfield of the

cortex of rats for electron microscopy. The yellow square shows the

collected part. The drawing presented a slice of coronal brain tissue

stained with TTC solution. The white colored region indicates the

infarcted core, whereas the red colored area shows the surviving

tissue. The brain slice was cut from 3 to 7 mm backward of the

antinion, then a longitudinal cut (from top to bottom) approximately

2 mm from the midline through the right hemisphere. The penumbra

was separated from the core by a transverse diagonal cut at the ‘‘2

o’clock’’ position (about 30�) (Color figure online)

Table 1 Primer sequences used

for PCRGene Forward primer Reverse primer

TFAM ACGCCTAAAGAAGAAAGCACA ACACTGCGACGGATGAGAT

NRF-1 ACACACAGCATAGCCCATCTC ATTTTGTTCCACCTCTCCATCA

GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA

Neurochem Res

123

Collection of Tissue Samples from the cortex

Animals were sacrificed at 24 h after reperfusion, and the

brain tissues were placed on a piece of gauze moistened

with ice-cold 0.9 % saline for the removal of the ipsilateral

cortex [22]. The collected samples were rapidly frozen in

liquid nitrogen and stored at -80 �C before use.

RNA Isolation and Reverse Transcription (RT): PCR

Total RNA was isolated from the specific cortex using

RNAiso Plus reagent (Takara Bio Inc., Shiga, Japan). A

2–3 ll template RNA was adopted to synthesize the first

strand of cDNA using a reverse transcription kit (Takara

Bio Inc., Shiga, Japan). PCR of cDNA was performed

(S1000TM Thermal Cycler, Bio-Rad, USA) using the

forward and reverse primer sequences provided in Table 1.

GAPDH served as an internal control, to the level of which

the amount of target mRNA was normalized.

Western Blotting Analysis

Total proteins of cortex were extracted and quantified by the

method of BCA with a protein assay kit (Beyotime, Jiangsu,

China). Western blot analysis was performed as previously

described [25]. Protein samples were subjected to 8 or 10 %

polyacrylamide gel electrophoresis followed by electroblot-

ting onto PVDF membranes. The primary antisera used

included: goat polyclonal antibody against UCP2 (1:100,

Santa Cruz, USA), rabbit polyclonal antibody against NRF-1

(1:100, Anbo Biotechnology,USA) or TFAM (1:100, Biovi-

sion, USA), or b-actin (1:3,000, 4A Biotech, Beijing, China).

Fig. 2 Neuroprotection of

curcumin pretreatment after 2 h

of MCAO and 24 h of

reperfusion. a Bar graph of the

neurological scores from groups

of sham-operated (n = 6), I/R

(n = 7), curcumin 50 mg/

kg ? I/R (n = 9) and curcumin

100 mg/kg ? I/R (n = 9).

b–c Representative TTC

staining of the coronal sections

of rat brains. The white colored

region indicates the infarcted

zone, whereas the dark colored

area shows the surviving tissue,

n = 6 for each group. Data

represents the mean ± SD.

*p \ 0.05 by ANOVA plus

LSD test

Neurochem Res

123

Specific antibody-antigen complex was detected by an

enhanced chemiluminescence western blot detection system

(KeyGEN Biotech, Nanjing, China). The intensity of immu-

noblot bands was quantified using Quantity One image ana-

lysis (Bio-Rad, USA), and values were normalized to b-actin

in each sample.

Results

Assessing Neuroprotective Properties of Curcumin

Neurological deficit was initially evaluated at 30 min after

MCAO. Consequently, obvious neurological deficit was

observed in the MCAO rats, suggesting that the MCAO model

was successfully constructed. Due to severe cerebral infarction,

five rats were died within 24 h after MCAO. And then, the

neurological deficit was examined again at 24 h after MCAO.

Compared to the I/R group, high but not low dose of curcumin

could significantly lower the neurological scores (Fig. 2a). To

confirm the neuroprotective characteristic of curcumin, TTC

staining was used to visualize and quantify the infarct volume.

Therefore, we found that both low and high dose of curcumin

were capable of decreasing the infarct volume (Fig. 2b, c).

In addition, to further assess the effect of curcumin on

preventing neuronal death, the level of Neu-N in neurons of

cerebral cortex were tested by IHC. Compared to the sham-

operated group, the number of Neu-N-positive neurons was

significantly decreased in the I/R group. The decrease of

Neu-N-positive neurons was partly reversed by either low

or high dose of curcumin (Fig. 3).

Effect of Curcumin on the Number of Mitochondria

The number of mitochondria in the peri-infarct region of

the cortex was quantified by electron microscopy. A

Fig. 3 The changes of neuronal

survival with curcumin

pretreatment in the cortex after

ischemic reperfusion. a NeuN

(neuronal marker)

immunohistochemical staining

in groups of sham-operated (A),

I/R (B), curcumin 50 mg/

kg ? I/R (C) and curcumin

100 mg/kg ? I/R (D). Scale bar

50 lm. b Quantitative analysis

of the mean OD values

(mean ± SD) of NeuN. n = 3

for each group, and 10

photomicrographs were counted

per animal. *p \ 0.05 by

ANOVA plus LSD test

Neurochem Res

123

significant decrease of mitochondrial number was observed

at 24 h after ischemia reperfusion. Pretreatment with cur-

cumin at the dose of 50 or 100 mg/kg could inhibit the loss

of mitochondria (Fig. 4).

To further validate this finding, the expression level of

mitochondrial protein was investigated. UCP2, which is one

of the members of mitochondrial transporter proteins [27],

is predominantly present in the cell cytoplasm [28].

Fig. 4 Effects of curcumin

pretreatment on mitochondrial

number in the peri-infarct

subfield of the cortex after

ischemic reperfusion.

a Ultrastructure of neuron

including the nucleus (Nu) and

mitochondria (blue arrows) in

the peri-infarct subfield of the

cortex from the rats in groups of

sham-operated (A), I/R (B),

curcumin 50 mg/kg ? I/R

(C) and curcumin 100 mg/

kg ? I/R (D). b Quantification

of the mitochondrial number per

photomicrograph. Nu shows

nucleus; blue arrows

mitochondria. The values are

the mean ± SD. n = 3 for each

group, and 15 photomicrographs

were counted per animal.

*p \ 0.05 by ANOVA plus

LSD test (Color figure online)

Neurochem Res

123

Immunofluorescence and western blot analysis for UCP2

were detected in the cortex of the middle cerebral artery

distribution. Compared to sham-operated group, the UCP2

level was greatly decreased in the I/R group. The decrease

of UCP2 immunoreactivity was reversed by high but not

low dose of curcumin (Fig. 5a), yet in western blotting

analyses we found both low and high dose of curcumin

could inhibit the reducion of UCP2 protein. The amount of

UCP2 expressions in the two groups displayed statistically

significant difference (Fig. 5b).

Effect of Curcumin on the Mitochondrial Biogenesis

Regulators

We then investigated the changes in mitochondrial bio-

genesis so as to assess their possible contribution to the

curcumin-mediated neuroprotection. Both the mRNA and

protein levels of NRF-1 and TFAM were decreased in the

I/R group relative to the sham-operated group, which were

completely reversed by pretreatment with both low and

high dose of curcumin. The changes observed were in a

Fig. 5 Curcumin pretreatment

prevented ischemia reperfusion-

induced reduction of UCP2

expression in the cortex

ipsilateral to MCAO. a UCP2

immunofluorescence staining in

groups of sham-operated (A),

I/R (B), curcumin 50 mg/

kg ? I/R (C) and curcumin

100 mg/kg ? I/R (D). Scale bar

75 lm. b Western blot analyses

of UCP2 in the cortex of from

groups. Data show the

mean ± SD (n = 5 for each

group) and are normalized to

b-actin. *p \ 0.05 by ANOVA

plus LSD test

Neurochem Res

123

dose-dependent manner (Fig. 6a, b, d), but the protein level

of NRF-1 did not show significant difference between low

and high dose groups (Fig. 6c). Regulation of NRF-1

mRNA has not, in some ways, been followed by the change

in protein expressions, suggesting possible posttranscrip-

tional regulation of NRF-1 expressions.

Discussion

The present study showed that the curcumin had neuro-

protective effects againt I/R injury. Correspondingly, we

observed that the indexs of mitochondrial biogenesis

(NRF-1, TFAM), mitochondrial number, and the

Fig. 6 Curcumin pretreatment

rescued ischemia reperfusion-

induced impairment of

mitochondrial biogenesis in the

cortex ipsilateral to MCAO.

Mitochondrial biogenesis

markers TFAM and NRF-1

were measured by RT-PCR

analyses (a, b) and western blot

analyses (c, d) in groups: 1,

sham-operated; 2, I/R; 3,

curcumin 50 mg/kg ? I/R; 4,

curcumin 100 mg/kg ? I/R.

The values represent the

mean ± SD (n = 5 for each

group respectively for RT-PCR

and western blot analyses),

which are normalized to

GAPDH and b-actin,

respectively. *p \ 0.05 by

ANOVA plus LSD test

Neurochem Res

123

mitochondrial protein UCP2, which were significantly

down-regulated in rats with I/R injury, were reversed by

curcumin pretreatment. Our findings provided the evidence

for the first time that increased mitochondrial biogenesis by

curcumin may be a pathway to preventing cerebral I/R

injury.

The neuroprotective mechanisms of curcumin in cere-

bral I/R injury remain in dispute. Yang et al. [29]. pointed

out that activition of the Nrf2/HO-1 signaling pathway by

curcumin was a key contributor to the cellular response to

neuronal ischemia injury, and that HO-1, along with other

phase II enzymes, served as a defense system against

oxidative stress. Curcumin could aslo decrease expressions

of NF-jB and ICAM-1 to alleviate inflammatory response

in cerebral I/R injury [9, 30]. Moreover, antiapoptotic

mechanisms of curcumin has been described in the inhi-

bition of cerebral I/R injury. Zhao et al. [8]. claimed that

curcumin attenuated the downstream caspase activation of

apoptosis through increasing the mitochondrial levels of

antiapoptotic Bcl-2 protein and decreasing the subsequent

cytosolic translocation of cytochrome c. In another word, it

suggested that the mitochondrial pathway was an important

target for curcumin. Here, we found that curcumin was

capable of increasing mitochondrial biogenesis, thereby

providing neuroprotective effects against cerebral I/R

injury. This is not surprising since disruption of mito-

chondrial function plays a critical role in the pathophysi-

ology of I/R injury [31], and mitochondrial biogenesis was

recognized as one kind of neuroprotective mechanisms [18,

32].

We found that the level of NRF-1 was increased by

curcumin in I/R injury, and NRF-1 has been taken for the

transcriptional partner of peroxisome proliferators-acti-

vated receptor c coactivator-1a (PGC-1a) [33]. PGC-1ahas been usually described the initiate factor of mito-

chondrial biogenesis and could induce the gene expressions

of NRF-1 [18, 34], which was located at unique consensus-

binding site of the TFAM gene [33]. The cooperative

actions of TFAM and NRF-1 integrate the transcription of

mtDNA with the expression of nuclear DNA-encoded

proteins related to oxidative phosphorylation, such as

mitochondrial UCP2 [33, 35–37]. These findings imply that

curcumin may stimulate mitochondrial biogenesis program

by activition of PGC-1a, and curcumin induced upregula-

tion of PGC-1a was previously proved [38, 39]. Although

it has been verified that protective effects of curcumin on

cerebral ischemic injury were markedly attenuated by

GW9662, an inhibitor of peroxisome proliferators-acti-

vated receptor c [39], the relationship between neuropro-

tection of curcumin and PGC-1a activated mitochondrial

recovery requires further study. Besides, we found that

curcumin enabled preventing the loss of mitochondria and

reversing the decrease of UCP2. Previously, Andrews et al.

[40]. have reported that it is in wild-type but not UCP2-/-

mice that ghrelin increased mitochondrial number in neu-

ropeptide Y neuronal perikarya, suggesting that mito-

chondrial proliferation may be controlled by UCP2. Thus,

we propose UCP2 may be the direct cause of curcumin on

mitochondrial biogenesis.

In conclusion, the present research provided novel evi-

dence that curcumin played neuroprotective effects on I/R

injury possibly by increasing mitochondria biogenesis. This

finding paves a way for development of a new therapeutic

target to treat cerebral ischemic stroke. Further studies

should be performed to explore the molecular pathway of

curcumin to promoting mitochondria biogenesis.

Acknowledgments Our sincere gratitude is extended to Professor

Yu Li for technical assistance. This work was supported by the

National Science Foundation of China (30500170).

References

1. Chen SD, Yang DI, Lin TK et al (2011) Chuang, roles of oxi-

dative stress, apoptosis, PGC-1a and mitochondrial biogenesis in

cerebral ischemia. Int J Mol Sci 12:7199–7215

2. Chen SD, Lin TK, Yang DI et al (2010) Protective effects of

peroxisome proliferator-activated receptors gamma coactivator-

1alpha against neuronal cell death in the hippocampal CA1

subfield after transient global ischemia. J Neurosci Res

88:605–613

3. Mattiasson G, Shamloo M, Gido G et al (2003) Uncoupling

protein-2 prevents neuronal death and diminishes brain dys-

function after stroke and brain trauma. Nat Med 9:1062–1068

4. Niizuma K, Yoshioka H, Chen H et al (2010) Mitochondrial and

apoptotic neuronal death signaling pathways in cerebral ischemia.

Biochim Biophys Acta 1802:92–99

5. Franklin JL (2011) Redox regulation of the intrinsic pathway in

neuronal apoptosis. Antioxid Redox Signal 14:1437–1448

6. Rathore P, Dohare P, Varma S et al (2007) Curcuma oil: reduces

early accumulation of oxidative product and is anti-apoptogenic

in transient focal ischemia in rat brain. Neurochem Res

33:1672–1682

7. Shukla PK, Khanna VK, Ali MM et al (2008) Anti-ischemic

effect of curcumin in rat brain. Neurochem Res 33:1036–1043

8. Zhao J, Yu S, Zheng W et al (2009) Curcumin improves out-

comes and attenuates focal cerebral ischemic injury via antiap-

optotic mechanisms in rats. Neurochem Res 35:374–379

9. Zhuang R, Lin MX, Song QY, Li J (2009) Effects of curcumin on

the expression of nuclear factor-kappa B and intercellular adhe-

sion molecular 1 in rats with cerebral ischemia-reperfusion

injury. Nan Fang Yi Ke Da Xue Xue Bao 29:1153–1155

10. Liu ZJ, Liu W, Liu L et al (2013) Curcumin protects neuron

against cerebral ischemia-induced inflammation through

improving PPAR-gamma function. Evid Based Complement

Altern Med 2013:470975

11. McLeod CJ, Pagel I, Sack MN (2005) The mitochondrial bio-

genesis regulatory program in cardiac adaptation to ischemia: a

putative target for therapeutic intervention. Trends Cardiovasc

Med 15:118–123

12. Zhang Q, Wu Y, Sha H et al (2012) Early exercise affects

mitochondrial transcription factors expression after cerebral

ischemia in rats. Int J Mol Sci 13:1670–1679

Neurochem Res

123

13. Zhang X, Yan H, Yuan Y et al (2013) Cerebral ischemia-reper-

fusion-induced autophagy protects against neuronal injury by

mitochondrial clearance. Autophagy 9:1321–1333

14. Kumari S, Anderson L, Farmer S et al (2012) Hyperglycemia

alters mitochondrial fission and fusion proteins in mice subjected

to cerebral ischemia and reperfusion. Transl Stroke Res

3:296–304

15. Zhang Q, Wu Y, Zhang P et al (2012) Exercise induces mito-

chondrial biogenesis after brain ischemia in rats. Neuroscience

205:10–17

16. Mehta SL, Kumari S, Mendelev N, Li PA (2012) Selenium

preserves mitochondrial function, stimulates mitochondrial bio-

genesis, and reduces infarct volume after focal cerebral ischemia.

BMC Neurosci 13:79

17. Yin W, Signore AP, Iwai M et al (2008) Rapidly increased

neuronal mitochondrial biogenesis after hypoxic-ischemic brain

injury. Stroke 39:3057–3063

18. Valerio A, Bertolotti P, Delbarba A et al (2011) Glycogen syn-

thase kinase-3 inhibition reduces ischemic cerebral damage,

restores impaired mitochondrial biogenesis and prevents ROS

production. J Neurochem 116:1148–1159

19. Longa EZ, Weinstein PR, Carlson S, Cummins R (1989)

Reversible middle cerebral artery occlusion without craniectomy

in rats. Stroke 20:84–91

20. Thiyagarajan M, Sharma SS (2004) Neuroprotective effect of

curcumin in middle cerebral artery occlusion induced focal

cerebral ischemia in rats. Life Sci 74:969–985

21. Song W, Huo T, Guo F et al (2013) Globular adiponectin elicits

neuroprotection by inhibiting NADPH oxidase-mediated oxida-

tive damage in ischemic stroke. Neuroscience 248C:136–144

22. Ma M, Uekawa K, Hasegawa Y et al (2013) Pretreatment with

rosuvastatin protects against focal cerebral ischemia/reperfusion

injury in rats through attenuation of oxidative stress and inflam-

mation. Brain Res 1519:87–94

23. Ashwal S, Tone B, Tian HR et al (1998) Core and penumbral

nitric oxide synthase activity during cerebral ischemia and

reperfusion editorial comment. Stroke 29:1037–1047

24. Fang M, Shen L, Yin H et al (2011) Downregulation of gephyrin

in temporal lobe epilepsy neurons in humans and a rat model.

Synapse 65:1006–1014

25. Nisoli E, Falcone S, Tonello C et al (2004) Mitochondrial bio-

genesis by NO yields functionally active mitochondria in mam-

mals. Proc Natl Acad Sci USA 101:16507–16512

26. Zhu L, Liu Z, Feng Z et al (2010) Hydroxytyrosol protects

against oxidative damage by simultaneous activation of mito-

chondrial biogenesis and phase II detoxifying enzyme systems in

retinal pigment epithelial cells. J Nutr Biochem 21:1089–1098

27. Mehta SL, Li PA (2009) Neuroprotective role of mitochondrial

uncoupling protein 2 in cerebral stroke. J Cereb Blood Flow

Metab 29:1069–1078

28. Liu Y, Chen L, Xu X et al (2009) Both ischemic preconditioning

and ghrelin administration protect hippocampus from ischemia/

reperfusion and upregulate uncoupling protein-2. BMC Physiol

9:17

29. Yang C, Zhang X, Fan H, Liu Y (2009) Curcumin upregulates

transcription factor Nrf2, HO-1 expression and protects rat brains

against focal ischemia. Brain Res 1282:133–141

30. Jurenka JS (2009) Anti-inflammatory properties of curcumin, a

major constituent of curcuma longa: a review of preclinical and

clinical research. Altern Med Rev 14:141–153

31. Izem-Meziane M, Djerdjouri B, Rimbaud S et al (2011) Cate-

cholamine-induced cardiac mitochondrial dysfunction and mPTP

opening: protective effect of curcumin. Am J Physiol Heart Circ

Physiol 302:H665–H674

32. Chen SD, Lin TK, Lin JW et al (2010) Activation of calcium/

calmodulin-dependent protein kinase IV and peroxisome prolif-

erator-activated receptor gamma coactivator-1alpha signaling

pathway protects against neuronal injury and promotes mito-

chondrial biogenesis in the hippocampal CA1 subfield after

transient global ischemia. J Neurosci Res 88:3144–3154

33. Scarpulla RC (2008) Transcriptional paradigms in mammalian

mitochondrial biogenesis and function. Physiol Rev 88:611–638

34. Puigserver P, Spiegelman BM (2003) Peroxisome proliferator-

activated receptor-gamma coactivator 1 alpha (pgc-1 alpha):

transcriptional coactivator and metabolic regulator. Endocr Rev

24:78–90

35. Lee HC, Wei YH (2005) Mitochondrial biogenesis and mito-

chondrial DNA maintenance of mammalian cells under oxidative

stress. Int J Biochem Cell Biol 37:822–834

36. Ekstrand MI, Falkenberg M, Rantanen A et al (2004) Mito-

chondrial transcription factor A regulates mtDNA copy number

in mammals. Hum Mol Genet 13:935–944

37. St-Pierre J, Lin J, Krauss S et al (2003) Bioenergetic analysis of

peroxisome proliferator-activated receptor c coactivators 1a and

1b (PGC-1a and PGC-1b) in muscle cells. J Biol Chem

278:26597–26603

38. Hann SS, Chen J, Wang Z et al (2013) Targeting EP4 by cur-

cumin through cross talks of AMP-dependent kinase alpha and

p38 mitogen-activated protein kinase signaling: the role of PGC-

1alpha and Sp1. Cell Signal 25:2566–2574

39. Liu ZJ, Liu W, Liu L et al (2013) Curcumin protects neuron

against cerebral ischemia-induced inflammation through

improving PPAR-gamma function. Evid Based Complement

Altern Med. doi:10.1155/2013/470975

40. Andrews ZB, Liu ZW, Walllingford N et al (2008) UCP2

mediates ghrelin’s action on NPY/AgRP neurons by lowering

free radicals. Nature 454:846–851

Neurochem Res

123