Characterization of new Muscodor padawan and Muscodor sarawak, isolated from Sarawak, Malaysia: evaluation of their

potential as a biological control agent for Ganoderma boninense, a pathogenic fungus

of Elaeis guineensis

By

Noreha Mahidi

A thesis

presented in fulfilment of the requirements for the degree of

Doctor of Philosophy

at Swinburne University of Technology

2015

i

Abstract

The aim of this thesis is to isolate endophytic Muscodor-like fungi that produces anti-Ganoderma

volatile chemicals, from the rich biodiversity resources of Sarawak. These fungi were then

examined for their potential to be developed as biological control agents to control Ganoderma

boninense, a pathogenic fungus that causes basal stem rot disease in oil palm, Elaeis guineensis.

Ten new isolates of endophytic Muscodor-like fungi were successfully obtained from leaves of

different plants of Cinnamomum javanicum collected from the Padawan forest in Kuching,

Sarawak, Malaysia, using a co-culture technique with Muscodor albus as the selection organism.

Two isolates, Muscodor padawan and Muscodor sarawak were selected for further investigation.

Muscodor padawan, when grown on potato dextrose agar, exhibits poor production of aerial

mycelia, a yellowish colour, with 20 to 28mm colony diameter after 10 days of incubation at

250C. Muscodor sarawak forms whitish colony with a diameter of 23 to 30mm after 10 days of

incubation at 250C and produces moderate aerial mycelia on potato dextrose agar. Scanning

electron micrograph of the aerial mycelia of M. padawan showed hyphal formed coiled-like

structures, spider mat-like attachments on the surface of hyphae and occasionally the presence

of chlamydospores and clumps of hyphae. Formation of new hyphae at lateral main hyphae,

chlamydospores at intermediate hyphae, half coiled hyphae at the tip and a strip of hyphae

attached by lateral hyphae that formed short bridge-like structure were found in M. sarawak.

Analysis on volatiles chemicals produced by both strains using Micro Extraction Gas

Chromatography/ Mass Spectrograph showed Bicyclo [3.3.1] nona-2, 6-diene as a major

compound in M. padawan. M. sarawak produces a musty odour and a major compound

identified as (-) delta- Panasinsine. The ITS-5.8S rDNA sequence of both strains showed 96 to 99%

similarities to Muscodor equiseti, indicating that both strains are representative members of

Muscodor group. Phylogenetic analysis based on ITS-5.8S sequence showed that M. sarawak is

clustered with M. vitigenus, M. sutura and M. equiseti but M. padawan clustered as an

independent cluster. The anti-Ganoderma volatile chemicals produced by M. padawan and M.

sarawak were affected by physicochemical conditions. Ganoderma boninense was completely

killed by volatile chemicals produced by 5-day-old M. padawan and 7-day-old M. sarawak.

Volatile chemicals produced by M. sarawak grown on all tested media were capable of killing G.

boninense, but only volatile chemicals produced by M. padawan grown on oat extract agar and

potato dextrose agar were able to kill G. boninense. At 250C and 300C, M. sarawak produced

ii

volatile chemicals that kill G. boninense but M. padawan was only effective at 250C. At pH 5 and

9, M. padawan effectively killed G. boninense but M. sarawak showed the capability to kill G.

boninense at all range of tested pH. In a pot assay system, volatile and non-volatile chemicals

produced by M. sarawak did not show destructive impact to the growth rate (height, leaflet

production, disease symptom and viability) of oil palm seedlings, although M. padawan showed

suppressive impact towards the growth rate of the seedlings. M. padawan and M. sarawak

showed success in killing G. boninense and also indirectly suppressed the growth rate of the air

borne fungus, Trichoderma spp. This thesis discusses the isolation, characteristics and

bioactivities of M. padawan and M. sarawak. The findings from this study suggest potential for

the new endophytic fungi, M. sarawak, to be used as an alternative remedy to control the

infection of G. boninense at the nursery stage, as well as to control the spread of basal stem rot

disease in new or replanted area of oil palm plantations. The application of this newly discovered

biofumigant agent could be expanded to other pre and post plant disease problems in the

horticultural and agricultural industry. The isolated Muscodor strains described in this thesis may

hold a lot of potential in the field of fungal biocontrol and this thesis can serve as a useful

reference to the oil palm industries, researchers, and marketers.

iii

Acknowledgements

I would like to thank the following departments and individuals that directly or indirectly

contributed to my PhD project:

• Dr. Rita Manurung, Ex-Chief Executive Officer (CEO) of Sarawak Biodiversity Centre

who have always motivated me to achieve the goals in my study,

• Dr. Yeo Tiong Chia, Chief Executive Officer (CEO) of Sarawak Biodiversity Centre

and also as my co-supervisor in this project. He has always supported me to drive

this project till completion,

• Jabatan Ketua Menteri (Chief Minister’s Office) Sarawak, for funding the

operational cost of this project,

• Swinburne University of Technology Sarawak , for the fee waiver to support my

study,

• Sarawak Forest Corporation (SFC) and Sarawak Forest Department (SFD) for the

information of targeted plants in Sarawak,

• My supervisor Assoc. Prof. Dr. Peter Morin Nissom and ex-supervisor Prof. Clem

Kuek for their guidance and support throughout my studies,

• My Co-supervisor Dr. Moritz Mueller, who always supported and his trust in me on

the direction that I selected,

• My beloved family for their trust, support and encouragement to me to do the

best in my life,

• Prof. Dr. Gary Strobel from Montana University, US, and Dr. Hj. Idris Abu Seman,

Head of Ganoderma and Diseases Research for Oil Palm Unit of Malaysian Palm Oil

Board for their valuable and constructive comments,

• My colleague at Sarawak Biodiversity Centre and Swinburne University of

Technology Sarawak for their support and encouragements,

• Norhayati Ahmed Sajali and Prof. Dr. Sepiah Muid, who assisted me in

identification and encouraged me to persevere until completion of this project

iv

• Luming Chen and Onn May Ling , who assisted me in proof-read my thesis

Thank you very much………..

v

Declaration

I hereby declare that this thesis contains no material which has been accepted for the award to

the candidate of any other degree or diploma, except where due reference is made in the text

of this thesis. To the best of the candidate’s knowledge contains no material previously

published or written by another person except where due reference is made in the text of this

thesis. Where the work is based on joint research or publications, I have disclosed the relative

contribution of the respective workers or authors.

Noreha Mahidi

4 September 2015

vi

Table of Contents

Content Page Abstract i

Acknowledgements iii

Declaration v

Table of Contents vi

List of Abbreviations x

List of Figure xi

List of Table xiii

List of Appendix xv

Chapter 1 Introduction and Literature Reviews

1.1 Soil Borne Fungus: Enemies in Agricultural Sector 1

1.2 Infection Court of Basal Stem Disease (BSR) 3

1.3 Biological Control Agent for BSR 6

1.4 Endophytic Fungi: New Candidates for Biological Control Agent 9

1.5 Discovery of Muscodor and Its Roles 10

1.6 Borneo: Sarawak an Ideal Location for Potential Untapped Resources 13

1.7 Aim of the Thesis 15

Chapter 2 Isolation and Characterization of Endophytic Muscodor-like Isolates Obtained from Cinnamomum javanicum in Sarawak

2.1 Introduction 16

2.2 Materials and Methods 19

2.2.1 Collection of Plant Samples 19

2.2.2 Isolation of Putative Endophytic Fungi Producing 21 Volatile Chemicals

2.2.3 Preparation of Standard Strains 22

2.2.3.1 Muscodor albus, cz-620 22

vii

2.2.3.2 Plant Pathogenic Fungi: Rhizoctonia solani, 23

Phytophthora capsici, Ganoderma boninense and

Fusarium oxysporum

2.2.3.3 Preparation of Isolation Plate 23 2.2.4 In vitro Screening of Putative Endophytic Fungi Producing 23

Volatiles Chemicals

2.2.5 In vitro Screening of Endophytic Fungi Producing 24

Volatile Compounds

2.2.6 Preliminary Identification 25

2.2.6.1 Morphology of Colony 25

2.2.6.2 Molecular Identification 26

2.2.7 Storage 28

2.2.8 Viability and Productivity Test 29

2.3 Result and Discussion 30

2.3.1 Plant Collection 30

2.3.2 Isolation of Endophytic Fungi 31

2.3.3 In-vitro Screening of Endophytic Fungi Producing Volatile Chemicals 33

2.3.4 Preliminary Identification 34

2.3.5 Maintenance and Preservation 43

2.4 Conclusion 45

Chapter 3 Novel Endophytic Fungus from Borneo, Sarawak, Malaysia

3.1 Introduction 46

3.2 Materials and Methods 48

3.2.1 Morphological Identification 48

3.2.2 Analyses of the Chemical Composition in Volatile Chemicals 50

Produced by L3R3a and L5R1c

3.3 Results and Discussion 51

3.4 Conclusion 63

viii

Chapter 4 Effect of Physicochemical Conditions on the Efficiency of

Muscodor sarawak and Muscodor padawan as Biological Control Agent of

Ganoderma boninense

4.1 Introduction 65

4.2 Materials and Methods 66

4.2.1 Effect of Inoculum Age 66

4.2.2 Effect of Culture Media 67

4.2.3 Effect of Temperature 67

4.2.4 Effect of pH 67

4.3 Results and Discussion 68

4.3.1 Anti-Ganoderma Volatile Chemicals Produced in All Stages 68

of Growth of the Test Strains

4.3.2 Media Composition Affects Efficiency of Muscodor padawan, 70

but not Muscodor sarawak, in producing Anti-Ganoderma

Volatile Chemicals

4.3.3 250C and 300C are the Best Temperature for Muscodor sarawak 72

to Produce anti-Ganoderma Volatile Chemicals

4.3.4 pH affects the capability of Muscodor padawan in Producing 74

Anti-Ganoderma Volatile Chemicals

4.4 Conclusion 75

Chapter 5 Efficiency of Muscodor sarawak and Muscodor padawan in Preventing

Ganoderma boninense From Infecting Oil Palm Seedlings

5.1 Introduction 77

5.2 Materials and Methods 78

5.2.1 In vitro Screening on the Capability of Barley Infected with 78

Muscodor padawan and Muscodor sarawak to Produce Volatiles

Anti-Ganoderma Chemicals, Using a Double Plate Assay System

5.2.2 In vitro Screening on the Capability of Muscodor padawan and 79

Muscodor sarawak to Produce Non-volatiles Anti-Ganoderma

Chemicals, Using a Dual Cultures Assay System.

ix

5.2.3 Establishment of Muscodor padawan and Muscodor sarawak 80

Inside the Tissue of Oil Palm to Evaluate Their Effects on Oil Palm

Seedlings as well as Controlling Ganoderma boninense Infection.

5.2.4 Statistical analysis 83

5.3 Results and Discussions 83

5.3.1 In vitro Screening on the Capability of Barley infected with 84

Muscodor padawan and Muscodor sarawak in Producing

Volatiles Anti-Ganoderma Chemicals, Using a Double

Plate Assay System

5.3.2 In vitro Screening on the Capability of Muscodor padawan and 86

Muscodor sarawak in Producing Non-volatiles Anti-Ganoderma

Chemicals, Using a Dual Culture Assay System

5.3.3 Establishment of M. sarawak and M. padawan inside the Tissue of 88

Oil Palm Seedlings

5.4 Conclusion 97

Chapter 6 General Summary and Recommendations

6.1 Aim of the thesis 98

6.2 Enrichment and Isolation 98

6.3 Taxonomy and Characterization 99

6.4 Volatile Chemicals Composition 99

6.5 Key Factors that Affect Volatile Chemicals Production 99

6.6 Development of a Biocontrol Agent 100

6.7 Future Directions and Recommendations 100

Appendix 1 102

References 105

x

List of Abbreviations

Basal Stem Rot BSR

Dead Seedlings DS

Diameter Base Height DBH

Disease Incidence DI

Electron Impact EI

Fresh Fruit Bunches FFB

HeadSpace Solid Phase Micro Extraction Gas Chromatography HS-SPME-GC-MS

Internal Transcribed Spacer ITS

Malaysia Palm Oil Board MPOB

National Institute of Standards and Technology NIST

Polymerase Chain Reaction PCR

Potato Dextrose Agar PDA

Pressure Injection Apparatus PIA

Sarawak Biodiversity Centre SBC

Sarawak Forestry Corporation SFC

Sarawak Forestry Department SFD

Sarawak Oil Palm Plantation Owner’s Association SOPPOA

Scanning Electron Microscope SEM

Severity of Foliar Symptoms SFS

University Putra Malaysia UPM

Upper Stem Rot USR

Volatile Organic Compound VOC

xi

List of Figures

Figure Page

Figure 1: Location of National Parks, Wildlife Sanctuaries and 14 Nature Reserves in Sarawak. Figure 2a: Map of Sarawak and the Kuching area, circled in red. 19 Figure 2b: Map of enlarged Padawan area Figure 3: Isolation plate showing 10-day-old M. albus on one side of the 22 agar and the other side inoculated with three sterilized plants segments of L02. Figure 4a: A specimen of Cinnamomum javanicum. 32 Figure 4b: Split plates assay with M. albus. 32 Figure 5 to 7: Colony descriptions of Muscodor-like isolates. Refer to Table 6 35 for description. Figure 8 to 10: Colony descriptions of Muscodor-like isolates. Refer to Table 6 36 for description. Figure 11 to 13: Colony descriptions of Muscodor-like isolates. Refer to Table 6 37 for description. Figure 14: Colony descriptions of Muscodor-like isolates. Refer to Table 6 38 for description. Figure 15: Hyphae structure of isolate L3R3a (A) and L5R1c (B) using light 38 microscopy with 40x magnification (Bar = 5µm). Figure 16: Gel electrophoresis of PCR products obtained from the 10 isolates. 40 Figure 17: Phylogenetic analyses of the Muscodor spp and the isolated strains 43 from this study. Figure 18: Host of L3R3a, Cinnamomum javanicum (L05). This plant was 57 sourced at Padawan. Figure 19: Mycelial characteristics of L3R3a. 58 Figure 20: Micro-morphological structures of L3R3a visualised using 59 scanning electron microsope (SEM)

xii

Figure 21: Mycelial characteristics of L5R1c. 61 Figure 22: Micro-morphological structures of L5R1c visualised using 63 scanning electron microscope (SEM) Figure 23: Percentage inhibition of radial growth on G. boninense after exposed 70 to volatile chemical produced by various age of Muscodor padawan (MP) and Muscodor Sarawak (MS). Figure 24: The effect of media composition on the efficiency of M. padawan (L3R3a) 71 and M. sarawak (L5R1c) in producing volatile anti-Ganoderma compounds. Figure 25: The effect of temperature on the production of volatile anti-Ganoderma 73 chemical by M. padawan (L3R3a) and M. sarawak (L5R1c). Figure 26: Effect of pH on the efficiency of M. padawan (L3R3a) and 74 M. sarawak (L5R1c) in controlling the growth of G. boninense. Figure 27: Evaluation of capability of M. padawan on barley grains to produce 85 anti-Ganoderma VOC. Figure 28: Evaluation of capability of M. sarawak to produce non-volatile 87 anti-Ganoderma chemicals. Figure 29: M. padawan showed selective pressure against G. boninense 88 in dual culture assay. Figure 30: Pot trails of seedlings exposed to Muscodor. 91 Figure 31: Pot trails of seedlings unexposed to Muscodor. 92 Figure 32: Abundance of greenish fungus (Trichoderma sp.) growing from 94 the roots of untreated seedlings. Figure 33: Survivability of treated seedlings upon exposure to G. boninense. 96

xiii

List of Table

Table Page

Table 1: Effects of commercial biofertilisers towards reduction of 8 Basal Stem Rot (BSR) disease Table 2: Bioactivity of volatile chemicals produced by members of Muscodor 12 Table 3: Members of Muscodor isolated from plant hosts worldwide 17 Table 4: List of plant species collected from Padawan dan Bako National Park 30 Table 5: Percentage of radial inhibition growth of plant pathogenic fungi 34 after exposure to endophytic isolates. Table 6: Colony description of Muscodor-like isolates 35 Table 7: Percentage of similarity between isolates and top three 41 sequences in the Genbank database Table 8: Isolates were grouped using Multiple Sequence Alignment (MSA) 42 Table 9: GC/MS analysis of the volatile compounds produced by 53 a 10-day-old culture L3R3a Table 10: GC/MS analysis of the volatile compounds produced by 53 a 10-day-old culture L5R1c Table 11: Effect of 5 days exposure to volatile chemicals produced 86 by M. padawan and M. sarawak on barley grains, towards the growth of G. boninense Table 12: The inhibition of radial growth of G. boninense by 88 M. padawan and M. sarawak observed in a dual culture assay Table 13: Effect of M. padawan and M. sarawak treatment on 91 physical appearance of one-month-old oil palm seedling Table 14: Effect of G. boninense on the physical appearance 93 of one-month-old treated and untreated oil palm seedlings Table 15: Effect of M. sarawak and M. padawan on the 95 physical appearance of six-month-old oil palm seedlings

xiv

Table 16: Effect of G. boninense on the physical appearance 96 of six-month-old treated and untreated oil palm seedlings

xv

List of Appendix

Appendix Page

Appendix 1: List of collected plants from Padawan and Bako National Park 102

1

Chapter 1

Introduction and Literature Reviews

1.1 Soil Borne Fungus: Enemies of the Agricultural Sector

In agriculture, soil-borne diseases can cause major economic losses in crop products by

reducing 50-70% of potential yields (Stewart et al., 2009). The world economic crop losses due

to diseases caused by soil-borne plant pathogens are estimated to be billions of dollars per year

(Drenth & Sendall, 2004 and Stewart et al., 2009). In Malaysia alone, with regards to the major

crop oil palm, the economic losses per year caused by the soil borne fungus called Ganoderma

boninense is estimated between USD 70 to 464 million (Arif et al., 2011; Idris et al., 2011;

Khairil & Hasmadi, 2010 and Ommelna et al., 2012). The total revenue collected from this

industry in Malaysia is USD 226 million, thus any threat to this industry will also influence

revenue to Malaysia.

Soil borne diseases are difficult to control because of the ability of pathogens to produce

persistent survival structures that allow their populations to build up over time. Most fungi

from the Oomycete group and certain species of Basidiomycete are the main causal pathogens

for soil-borne diseases (Lee & Lum, 2004). Phytophthora capsici is one of the most common soil

borne species from Oomycete, causing foot rot disease in pepper crop worldwide (Drenth &

Guest, 2004). In the mid-1950s Phytophthora capsici was reported to cause an outbreak of root

rot disease in Sarawak black pepper, with crop losses estimated at 100% (Holliday & Mowat,

1963). However, by adopting disease integrated management control, the incidence declined to

10-15 % (Kueh, 1979).

In the oil palm industries, the soil borne fungus, G. boninense from the Basidiomycete group is

the most significant pathogen. The disease caused by this fungi, BSR, is also considered to be

the most serious and deadly oil palm disease in Southeast Asian countries, especially in

Malaysia and Indonesia, which are the major producers and exporters of palm oil in the world

(Idris et al., 2000, Susanto et al., 2005 and Wong et al., 2012). Basal Stem Rot (BSR) and Upper

Stem Rot (USR) diseases affect the production of Fresh Fruit Bunches (FFB), lower oil extracted

2

from mesocarp and also kill the trees (Singh, 1991; Khairuddin, 1993; Rao et al., 2003 and

Pilotti, 2005). BSR disease occurs at different ages in the oil palm lifecycle (Thompson, 1931;

Turner, 1981; Khairuddin, 1990; 1995; Singh, 1991; Ariffin et al., 1996; 2000; Hasan & Turner,

1998; Flood et al., 2000; Idris et al., 2004; 2005 and Lim & Udin, 2010). This disease has the

potential to collapse the oil palm industries such as in Malaysia (Singh 1990 and Ariffin et al.,

1996). The total production of crude palm oil (CPO) will be decreased and reposition the rank

of Malaysia as the major producers and exporters of palm oil and palm oil by products in the

world with 39% and 44%, respectively (PORIM, 2011). Consequently, it also reflects the total

revenue received from those products whereby in 2011, Malaysia received total revenue from

oil palm products of about USD 226 million (Khairil & Hasmadi, 2010).

The total revenue of Sarawak might also be affected as oil palm is among the major crops that

contribute to the economy of Sarawak. Sarawak Oil Palm Plantation Owner’s Association

(SOPPOA) claimed that 59,000 hectares of oil palm planted areas in Sarawak are already

infected by G. boninense. Meanwhile more than 60% of plantation area in Peninsula Malaysia

has been affected by G. boninense (Borneo Post, 2012). The disease incidence in Sarawak is

lower compared to Peninsula Malaysia due to high percentage of mature oil palm and

replanting programme in the same location with mature oil palm (Wahid & Simeh, 2008). Up to

2011, Malaysia has 5 million hectares of land that are planted with oil palm (PORIM, 2011).

Sabah became the largest oil palm planted state with 1.43 million hectares (PORIM, 2011).

Sarawak is the second highest oil palm producer in Malaysia with expanding areas for planting

oil palm whereby in 2011, 102,169 hectares of land have been deforested for new plantation

area (Wahid & Simeh, 2008 and PORIM, 2011;). This number is expected to increase in the near

future. The increase in the area of plantations will inevitably become vulnerable to the threat

of BSR disease. Thus, early actions to manage the threat must be taken into consideration in

the attempt to optimize the growth performance of the trees. Even though, the best planting

material or best variety of oil palm like tenera that could produce high yield of oil is used (Yusof

& Chan, 2004). It will be meaningless if the oil palm did not prolong to their economic lifespan

of 20 to 25 years because of infection by BSR disease (Loh, 1999). Due to that, proper and

urgent solutions for controlling the current disease incidence from expanding to new areas are

required. It is important, due to potential economic impact and deforested lands has been

invested and sacrificed to plant the oil palms.

3

1.2. Infection Court of Basal Stem Disease (BSR)

Infection court is defined as a site on or in a plant where an infection can take place (Zitter et

al., 1996). Understanding the infection court of the Basal Stem Rot disease (BSR) and Upper

Stem Rot (USR) diseases is very important in order to establish a method to control the

infection. In this aspect, G. boninense is the main target as this species has been identified as

the main cause of BSR and USR, and is known as the most aggressive species as compared to G.

zonatum and G. miniatocinctum (Turner, 1981; Ho & Nawawi, 1985; Khairuddin, 1990; Idris &

Ariffin, 2004 and Wong et al., 2012).

Ganoderma boninense is a whitish fungus from the family Polyporaceae and is also known as

white wood rot fungus as they are able to degrade lignin (Gilberston & Adarkaveg, 1993; Roy

and De, 1996; Ostrofsky et al., 1997; Jones & Ostry, 1998; Lee, 2003; Farid et al., 2005 and

Bernicchia, 2007). This fungus forms fruiting bodies through sexual reproduction as a response

to the low supply of food (Pegler, 1997 and Ingold, 2002). The fruiting body structure can last

up to 100 years as long as new hymenium is formed. Between 2 to 110,000 spores’ m-3

basidiospores can be released from the fruiting body (Corner, 1932; Pegler, 1997 and Rees et al.,

2011). This fungus possesses trimitic hyphal system that supports their viability in unfavourable

conditions which means they can withstand all weather conditions and survive for years with

very minimal metabolic activity (Corner, 1983 and Roy & De, 1996).

Fragments of mycelium and basidiospores have been identified as two main sources of primary

infection (Miller, 1995 and Ariffin et al., 1996). Rhizomorph mycelium was reported as the

major propagul that spread the incidence of BSR infection to the new host instead of

basidiospores (Turner, 1965; Ramasamy, 1972; PORIM, 1988 and Jennings & Lysek, 1996). This

is due to the mycelium developmental pattern of rhizomorphs that allow this fungus to

withstand dry conditions. Additional to that, closely packed hyphae and thick melanized walls

on the outer region of the rhizomorph mycelia assists in minimizing water loss to the external

environment (Jennings & Lysek, 1996). Indirectly these structures also prolong their life span

and contribute to their success as pathogens to spread the disease onto new areas. This could

explain why the rhizomorph mycelium of G. boninense is highly successful as a source of

propagules to spread BSR disease incidence in replanted areas.

4

In USR scenario, the primary disease inoculum develops from basidispore that were dispersed

from the basidiocarp which was carried by the insect vector, Episcapha 4-maculata, air

movement and strong winds to infect healthy palms (Turner, 1981; Ho & Nawawi, 1986;

Sanderson et al., 2000 and Idris & Ariffin, 2004).

The BSR and USR diseases were dispersed and spread by initiating primary infection through

two methods:

a) Root to root contact - the mycelium of root rot pathogens from infected stumps or other

woody debris that remained in soil could infect adjacent healthy palm through root

colonization, whereby roots of healthy palm contact with infected stumps or woody debris.

b) Wounded tree - Wounded trees are commonly caused by insects or breaking off of fronds.

The infection on the wounded area is caused by G. boninense basidiospores. Basidiospores

were released from the pathogen fruiting bodies called basidiocarp. The basidiospores initiate

infection on the wounded surface by germinating appresorium structure that then penetrates

and infects the epidermis of plant tissues.

Oil palm replanted after 20 to 35 years when yield of fresh fruit bunches, (FFB) becomes

increasingly low and difficulty in harvesting the tall palm (> 10 m) (Loh, 1999). Rapid incidence

of BSR disease was highly recorded in replanting area with the age of oil palm above 10 years

(Idris et al., 2004; 2005). Mature oil palm tree is favourable for G. boninense to form

basidiocarp due to higher cellulose content. The cellulose is the main component to support

the formation of oil palm. Besides that, planting density was also recorded as a factor that

influences the outbreak of Ganoderma disease (Idris et al., 2013). This situation might be

contributed by root to root contact from the close distance of planted palms. It has been

recorded that plantation with 200 palms/ha had the highest BSR disease incidence (Idris et al.,

2013). Integrated management, mechanical, synthetic chemicals and bio-control agents are

current methods that have been used to control BSR disease (Bong & Ibrahim, 1985; Jelani et

al., 2004; Idris et al., 2004; 2005 and Idris & Arifurrahman, 2008).

Several mechanical methods have been practiced to overcome the spread of BSR disease to

healthy palms. The most effective mechanical approach was removing the diseased palms by

digging a pit of 2 m width x 2 m length x 5 m depth and refilling with the nearby and inter- row

soil (Idris et al., 2004; 2005). Then, the diseased palm were destroyed by shredding the trunk,

5

stump and root masses into small fragment and stacking them in the frond piles to decompose

(Zulkifli et al., 2010). This method was able to significantly reduce the incidence of disease in

seedlings that were planted in the same area as the diseased palm that was removed. The rate

of disease incidence was influenced by the size of pit (Idris et al., 2005). Pits with sizes less than

2 x 2 x 2 m were found to cause approximately half of the root of diseased palm to still remain

in the soil as length of roots spread in the soil is estimated to be similar to the length of the

fronds of the palm (Idris et al., 2005). The remaining diseased roots will act as suitable

inoculum which can attack the oil palm soon after planting (Singh, 1991 and Flood et al., 2000).

Due to that, in clearing new replanting area, ploughing and harrowing the soil up to a depth of

60cm was suggested (Idris et al., 2005). This procedure fragments the buried roots into small

pieces, preventing the diseased root from spreading the disease to healthy palms (Flood et al.,

2000 and Hoong & Idris, 2010). Ploughing, harrowing and soil moulding approaches also have

shown reductions in disease incidence in oil palm seedlings as well as preventing the spread of

BSR disease (Idris et al., 2004). However, soil moulding only prevented the palm from being

felled by heavy wind and was not effective in controlling BSR disease but helped in prolonging

the productive life span of oil palms (Lim et al., 1993; Ho & Khairuddin, 1997; Tuck &

Khairuddin, 1997 and George et al., 2000). These mechanical solutions showed significant

reductions in disease incidence at seedlings stages. However, high cost was involved because

specialised machinery and manual labour are required.

In the chemical approach, Idris et al. (2010) suggested that hexaconazole has the potential of

reducing the risk of Ganoderma infection in healthy mature oil palms. In this approach, the soil

surrounding the healthy mature palm was injected with a solution contained 9g of the active

ingredient hexaconazole (Idris et al., 2010). This approach achieved 43% reduction in disease

incidence as compared to non-treated palms (Idris et al., 2010). Similarly in Ganoderma-

infected palms, hexaconazole (0.00045g/ml), and also bromoconazole (0.00045g/ml) were

effective at slowing down the Ganoderma spread (Idris et al., 2002 and Jelani et al., 2004). This

fungicide was injected into the infected palm (area with the presence of basidiocarp) using

pressure injection apparatus (PIA) to deliver the fungicides to the target area (Idris et al., 2002

and Jelani et al., 2004). These approaches showed effectiveness in delaying the death of the

infected palms whereby lower mortality rate and higher number of palm producing fruit

bunches were also observed (Idris et al., 2004; 2010 and Jelani et al., 2004). Besides

hexaconazole, dazomet was also shown to be effective in controlling the growth of G.

6

boninense. Ganoderma-infected palms that were treated with dazomet showed a longer

productive life of the oil palm as well as an increase of 36.6 % to 53.3% in the production of

fruit bunches (Idris & Maizatul, 2012). Dazomet could also act as a fumigant for treating

infected stump as well as to kill the Ganoderma inoculum colonizing the inside of the stump

(Idris & Maizatul, 2012). However, chemical residue drenching in the soils might also reduce

the population of micro-flora and might also create pathogens that are resistant to the

chemical (Idris et al., 2005) included might harmful to planter that handling the chemicals. Due

to such negative impacts, new solutions are required to control BSR that can work effectively

and with minimal harm to our health and the environment. Alternative treatment such as bio-

control is highly required to produce effective and eco-friendly methods to control the

pathogen and the disease.

1.3 Biological Control Agent for BSR

Natural mechanisms of controlling pests and plant diseases using other living organisms are

known as biological control. It is based on the strategy that organisms in the natural

environment compete for food and space. The natural enemies are used as biological control

agent via antagonism, predatory and parasitism interactions (Sankaran & Syed, 1972; Susanto

et al., 2005 and Shahid et al., 2012).

Trichoderma harzianum is an example of biological control agents that have been

commercialized by mimicking the antagonism interactions. Trichoderma harzianum is capable

of controlling agricultural pests, soil borne fungi as well as to induce plant growth (Chang et al.,

1989; Grondona et al., 1997 and Shamala & Idris, 2010). In the oil palm industry, T. harzianum

is used against G. boninense (Shamala & Idris, 2010). It has been shown to successfully supress

the growth of G. boninense and promotes the growth of oil palm (Shamala & Idris, 2010).

Besides all the benefits using T. harzianum as a biological control agent, the main obstacle is in

applying and adapting T. harzianum (Chang et al., 1989). The fertilizer that is mixed with the

spores of T. harzianum gets flushed away during heavy rain and is worst in the flooded oil palm

plantation area. Therefore success rate of this approach is affected by environmental

conditions. New approaches are required to overcome BSR and to inhibit the dispersal/spread

to other new planted areas which hasten potential collapse of the oil palm industry in Sarawak

as well as Malaysia.

7

Other endophytic fungi, arbuscular mycorrhiza and bacteria also show similar significant

activities as T. harzianum, i.e., ability to suppress the growth of G. boninense and promote the

growth of oil palm (Susanto et al., 2005; Sapak et al., 2008; Sharmala & Idris, 2009 and Idris et

al., 2010). From 2011 to 2012, the Malaysia Palm Oil Board (MPOB) had been commercializing

numerous biofertilizers, in granules and powder form, that comprised endophytic fungi

(Hendersonia, GanoEF1 GanoEF), bacteria (Burkholderia, GanoEB2; Pseudomonas, GanoEB3)

and Streptomyces (Streptomyces, GanoSA1) for controlling Ganoderma-infected palms (Ramle

et al., 2009; Nasyaruddin & Idris, 2011; Nurrashyeda et al., 2011; Idris et al., 2012; Shariffah

Muzaimah et al., 2012 and Maizatul et al., 2012). Microorganisms mixed with fertilizers have

been shown to be effective at supressing the growth of G. boninense on in vitro and nursery

trials (Zaiton et al., 2008; Idris et al., 2008; 2010 and Nurrashyeda et al., 2011). The

performance of biofertilizer, GanoEF1, GanoEF, GanoEB1, GanoEB2 and GanoSA1 towards

disease incidence (DI), severity of foliar symptoms (SFS) and dead seedlings (DS) of oil palm

seedling is described in Table 2 (Nasyaruddin & Idris, 2011; Nurrashyeda et al., 2011; Idris et al.,

2012; Shariffah Muzaimah et al., 2012 and Maizatul et al., 2012). The comparison of

performance of biofertilizer towards disease reduction showed that biofertilizers managed to

reduce the disease of BSR by more than 50%, with Hendersonia fertilizer in powder form being

the most effective treatment compared to GanoEF1, GanoEB, GanoEB3 and GanoSA

(Nurrashyeda et al., 2011; Maizatul & Idris, 2009; Nasyaruddin & Idris, 2011 and Sharifah et al.,

2012).

Muscodor, which produce volatile chemicals, is another group of endophytic fungi that may

show potential as biological control agent against Ganoderma boninense as in the previous

studies showed this group of fungi shown capability to control a wide range of soil borne

fungus included Basidiomycete (Strobel et al., 2002 and Ezra et al., 2002). Ganoderma

boninense that caused BSR and USR disease in oil palm is classified under class of

Basidiomycete (Khairudin, 1990 and Idris & Ariffin, 2004).

To date, no publications on Muscodor have been recorded in Sarawak. In this study, the

isolation of Muscodor-like from selected plant in Sarawak was performed to screen their

potential as effective biological control agents against Ganoderma boninense as discussed in

Chapter 2. Two of the Muscodor-like isolates have been examined as potential Biological

Control Agent (BCA) against G. boninense and suggested as novel species as described in

8

Chapter 3. The physicochemical effect towards their efficiency to control G. boninense will be

revealed in Chapter 4, while in Chapter 5, the efficiency of two novel strains in preventing G.

boninense from infecting oil palm seedling was discussed. The overall conclusions and

recommendations are discussed in Chapter 6.

Table 1: Effects of commercial biofertilisers towards reduction of Basal Stem Rot (BSR) disease

Treatment (Biofertilizer)

Disease Assessment (%)

Reference Disease Incidence

(DI)

Severity of foliar

symptoms (SFS)

Dead seedlings

(DS)

Disease reduction

(DR)

Treated with GanoEF

Untreated with GanoEF

46.7

93.3

48.4

83.8

26.7

86.7

69.5

Idris et al., 2012

Treated with GanoEF1

Untreated with GanoEF1

39.2

95.0

54.5

90.5

34.2

80.8

54.2

Nurrashyeda et al., 2011

Treated with GanoEB2

Untreated with GanoEB2

57.4

93.3

48.2

86.4

26.7

80.0

57.4

Maizatul & Idris, 2009

Treated with GanoEB3

Untreated with GanoEB3

53.3

93.3

40.6

84.7

33.3

73.3

51.8

Nasyaruddin & Idris, 2011

Treated with GanoSA

Untreated with GanoSA

53.3

93.3

49.7

83.8

40.0

86.7

59.8

Sharifah et al., 2012

9

1.4 Endophytic Fungi: New Candidates for Biological Control Agent

An estimated 300,000 number of plant species exist on the earth and each plant hosts at least

one or more endophytic microorganisms (Strobel et al., 2001). Endophyte is derived from the

latin word, endon meaning within and phyton, which means plant and is most commonly

defined as those organisms whose “infections are inconspicuous, the infected host tissues are

at least transiently symptomless, and the microbial colonisation can be demonstrated to be

internal” (Saikkonen et al., 1998, 2004; Bacon & White, 2000 and Stone et al., 2000).

Endophyte is also defined as host-organism interaction or adaptation of host and endophyte to

one another without causing apparent harm to each other via asymptomatic colonisation

(Petrini 1991; Petrini et al., 1992; Hallmann et al., 1997; Boyle et al., 2001; Sieber, 2001;

Lumyong et al., 2002 and Schulz & Boyle, 2005).

Fungus is the largest group of endophytic microorganisms that live inside plants and it is

estimated that there are about 1.3 million fungi species on earth (Dreyfuss & Chappela, 1994).

The total estimated number of fungi on the earth might greatly change to 2.8 million as a result

of the huge population of endophytic fungi that have been recently discovered (Hawksworth &

Rossman, 1997 and Hawksworth, 2001). For example, in Panama, 418 species of endophytic

fungi were obtained from the leaves of Heisteria concinna (Arnold et al., 2001). It is expected

that tropical endophytic fungi are hyperdiverse just as tropical forests are inhabited by a

diverse species of plants.

Endophytic fungi are potential candidates for new sources of biological active compounds and

biological control agents that could be applied in pharmaceutical and agricultural sectors. For

example, endophytic fungi that have been isolated from Wollemia pine, Justicia gendarusa and

Taxus spp. trees have been discovered to produce potential active compounds as a new source

of antibiotics as well as anticancer drugs (Strobel et al., 1997; Guo et al., 2006; Gangadevi &

Muthumary, 2008 and Somjaipeng et al., 2012). The fungi extracted from those trees showed

chemotherapeutic activity. Taxol, an anticancer drug obtained from Taxus brevifolia, could also

be obtained from endophytic fungi such as Pestalotiopsis spp. without only depending on the

Taxus plant which took longer time to grow before harvesting the taxol from their bark (Strobel

et al., 2012 and Somjaipeng et al., 2012).

10

In addition, endophytic fungi also display similar activities to biological control agents. They

may exhibit a mutualistic relationship within the host plant, protecting the host plant from

being invaded and destroyed by pathogen or herbivores via producing toxin or triggering the

defence system of the host (Kobayashi & Palumbo, 2000 and Tudzynski & Sharon, 2002). In

return, endophytic fungi use secreted exudates from the host as a food source. For example,

the presence of endophytic fungi in tropical trees has been reported to be able to limit the

damage of tropical trees by pathogens through reducing the leaf necrosis and mortality of the

tree (Arnold et al., 2003). In some cases, endophytic fungi possess different life histories, such

as grow as saprophytic or virulent pathogens in early stage following an endophytic growth

stage in latent stage due to reliable supply of nutrients and environmental stress (Stone et al.,

2000).

An endophytic fungus, Muscodor albus (cz-620) isolated from Cinnamomum zeylanicum

(Worapong et al., 2001) was shown to have potential as a biological control agent (Strobel et al.,

2001). A mixture of volatile chemicals produced by M. albus (Strobel et al., 2001) was able to

inhibit and kill certain pathogenic fungi and bacteria. A broad spectrum effectiveness of M.

albus towards various type of pathogens led to extensive investigation in other species of

untapped endophytic Muscodor all over the world (Worapong et al., 2002; Daisy et al., 2002;

Gonzalez et al., 2009; Suwannarach et al., 2010; 2013; Mitchell et al., 2010; Zhang et al., 2010;

Kudalkar et al., 2011; Mehram et al., 2012; 2013 and Saxena et al., 2014).

1.5 Discovery of Muscodor and Its Roles

Muscodor is a group of endophytic fungi from the family Xylariaceae that was first discovered

in 2001 (Worapong et al., 2001). This group of fungi have been widely studied in America by

the group of Prof. Dr. Gary Strobel from Montana University. Up to December 2014, 15 species

of Muscodor have been discovered all over the world. Namely; M. albus (Worapong et al.,

2001), M. sutura (Kudalkar et al., 2011), M. strobelli, M. kasyahum (Meshram et al., 2012;

2013), M. roseus (Worapong et al., 2002), M. fengyangensis (Zhang et al., 2010), M.

yucatanensis (Gonzalez et al., 2009), M. vitigenus (Daisy et al., 2002), M. crispans (Mitchell et

al.,2010), M. cinnanoni, M. musae, M. oryzae, M. suthepensis, M. equiseti (Suwannarach et al.,

2013) and M. tigerii (Saxena et al., 2014). Most of the species in this group have been found to

live inside woody trees except for M. vitigenus (Daisy et al., 2002) and 3 new species from

11

Thailand (Suwannarach et al., 2013) that were recently described. Muscodor vitigenus (Daisy et

al., 2002) has been found in vines while M. musae, M. oryzae and M. equiseti (Suwannarach et

al., 2013) have been isolated from vascular plants, Musa acuminate, Oryza rufipogon and

Equisetum debile, respectively. They also shared common characteristics including the

production of volatile chemicals, non-sporulation they are mostly white and slow growing.

Volatile chemicals produced by this group showed different capabilities of inhibiting and killing

microorganisms; gram negative and positive bacteria, filamentous fungi, yeast and certain

insects as showed in Table 1. The fungus, M. albus was the most studied for various

applications especially as a potential biofumigant agent. It was also being used to control

important pathogenic fungi especially from the class of Oomycete which is commonly found to

cause rot disease in postharvest fruits and vegetables. Biofumigant agents like Muscodor could

be considered to replace the function of the synthetic fumigant, methyl bromide that is

commonly used on fruits for export. As an endophytic biofumigant, Muscodor could naturally

minimise rotting problems by producing volatile chemicals which are able to inhibit pathogens

causing rot diseases.

In Sarawak, oil palm, pepper and local fruit industries face prevailing pest and disease problems.

Therefore, tapping new Muscodor species from Sarawak resources that have the potential to

be used to overcome pest and disease problems in Sarawak is crucial. Discovering new

Muscodor species is greatly possible, as Sarawak comprises large swathes of dense tropical

forests with a diversity of potential host plants.

12

Table 2: Bioactivity of volatile chemicals produced by members of Muscodor No Member of

Muscodor Major compound in

Volatile Bioactivity Reference

1. M. albus 1-Butanol, 3-methyl, C5H12O

Anti-fungal Anti- yeast

Anti-bacteria Anti-insect

Ezra & Strobel, 2003; Stinson et al., 2003; Jimenez, 2004; Atmosukarto et al., 2005; Jimenez & Mercier, 2005; Mercier & Manker, 2005; Gabler et al., 2006; Schnabel & Mercier, 2006; Lacey et al., 2007; 2009

2. M. roseus 2- butenoic acid, C4H6O2

Anti-fungal Worapong et al., 2002

3. M. vitigenus Naphthalene, C10H8 Anti-insect Daisy et al., 2002 4. M. cinnanomi Azulene, C10H8 Anti-fungal

Anti-bacteria Anti-insect

Mitchell et al., 2010

5. M. yucatanensis Octane, C8H18 Anti-fungal Anti-bacteria

Gonzalez et al., 2009

6. M. crispans Propanoic acid, 2-methyl-, methyl ester,

C5H10O3

Anti-fungal Anti-bacteria Anti-insect

Mitchell et al., 2010

7. M. fengyangensis a-phellandrene, C10H16 Anti-fungal Anti-bacteria

Zhang et al., 2010

8. M. sutura Propanoic acid, 2-methyl, C4H8O2

Anti-fungal Anti- yeast

Anti-bacteria Anti-insect

Kudalkar et al., 2012

9. M. strobelli

Octadecylmorpholine, C22H45NO

Anti-fungal Anti-bacteria

Meshram et al., 2012

10. M. oryzae Isoamyl alcohol, C5H12O Anti-fungal Suwannarach et al., 2013 11. M. musae Isobutyric acid, C4H8O2 Anti-fungal Suwannarach et al., 2013 12. M. equiseti Isobutyric acid, C4H8O2 Anti-fungal Suwannarach et al., 2013 13. M. suthepensis Isobutyric acid, C4H8O2 Anti-fungal Suwannarach et al., 2014 14. M. kasyahum 3-Cyclohexen-1-ol-(1,5-

dimethyl-4-hexenyl)-4-methyl (β-Bisabolol),

C15H26O

Anti-fungal Anti- yeast

Anti-bacteria Anti-insect

Meshram et al., 2013

15. M. tigerii 4-Octadecylmorpholine, C22H45NO

Anti-fungal Anti- yeast

Anti-bacteria Anti-insect

Saxena et al., 2014

13

1.6 Borneo: An Ideal Location for Potential Untapped Resources

Borneo is one of the twelve mega biodiversity regions and the third largest island in the world

with a total area of 743,330 square kilometres. Human population in Borneo is approximately

about 17.7 million but it is still covered with dense tropical forests. Besides that, diverse

habitats such as mangrove swamps, peat swamps, and heath (kerangas) and dipterocarp

forests are also found in Borneo (Forest Department Sarawak, 2013). An estimated 15,000

plants species (5,000 trees, 17,000 species orchids and more than 50 carnivorous pitcher plants)

inhabit Borneo (Forest Department Sarawak, 2013). These plants host a great diversity of

endophytic microorganisms. The diversity of flora and fauna in Borneo might be supported by

an ideal climate. Temperature ranges between 25-350C and received 2000-4000 mm rainfall

yearly so it is ideal for the development and growth of a diversity of flora and fauna. This makes

Borneo an ideal region to offer new discoveries, especially in Sarawak as the total land area

that is still covered with forest is about 80% or almost 10 million hectares (Sarawak

Government, 2013).

Sarawak is the largest state and the largest peat land area (1.5 million hectares) in Malaysia

with total land area 124,449.51 square kilometres (37.5% of the Malaysia total land). Additional

to that, Sarawak has 512,387.47 hectares of protected area which comprises 18 National Parks,

4 wildlife sanctuaries and 5 nature reserves (Sarawak Forest Corporation, 2013). Gunung Mulu

National Park which is located at south of Sarawak was acknowledged as the most studied

tropical karst area and the largest cave chamber in the world (World Heritage, 2000). It is also a

UNESCO world heritage site due to the high diversity and karst features (World Heritage, 2000

and Sarawak Government, 2013).

14

Figure 1: Location of National Parks, Wildlife Sanctuaries and Nature Reserves in Sarawak. (Source: http://www.forestry.sarawak.gov.my)

Numerous plants grow in various types of land in Sarawak. Out of 490 trees species, 102 of

these which are endemic to Borneo are located in Sarawak (Ng, 2004). The local people in

Sarawak, which comprises 14 ethnic groups, use native plants as medicine, timber, food, and

for ritual purposes (Sarawak Biodiversity Centre, 2013). This information has been studied by

researchers in order to search for potential plants that might have active compounds and thus

could be exploited for medical (Kogure et al., 2013), agricultural (Jeffrey et al., 2008) and

industrial sectors (Ahmad & Holdsworth, 1994). Those plants were inhabited by various

unknown types of endophytic fungi that could have potential value to be used as biological

agents. The high diversity of plants increases the likehood of the discovery of new species that

might have potential to be exploited in agricultural and industrial sectors (Strobel et al., 2002).

15

1.7 Aim of the Thesis

In this thesis, the aim is to develop local endophytic fungi isolates with capability to produce

volatile anti-Ganoderma compound as biological control agents for Ganoderma boninense. In

achieving the main aim, the specific objectives of the chapters of this thesis are:

a). Chapter 1: To isolate and test the effectiveness of volatile chemicals produced from new

endophytic Muscodor-like fungi from plants obtained from Sarawak,

b). Chapter 2 and 3: To describe new species of Muscodor fungi that have been isolated,

c). Chapter 4: To examine the physicochemical effects and chemical composition of volatile

chemicals of Muscodor isolates, including temperature, pH and culture media,

d). Chapter 5: To evaluate the potential for use of the Muscodor-like isolates within oil palm

seedlings as BCAs against G. boninense.

16

Chapter 2

Isolation and characterization of endophytic Muscodor-like isolates obtained from

Cinnamomum javanicum in Sarawak

2.1 Introduction

Muscodor species have been discovered all over the world and show potential as candidates in

the oil palm industry, for the biological control of Basal Stem Rot (BSR) disease caused by the

fungi, Ganoderma boninense. These group of endophytic fungi produce anti-microbial volatile

organic chemicals (VOC) that can inhibit the growth of plant and human pathogens like

Rhizoctonia solani, Bacillus subtilis and Aspergillus niger (Strobel et al., 2001). It was first

discovered in 2001 by Worapong et al., (2001) and described as a new genus. The DNA

sequence has a 96 to 98 % similarity to its closest relative in the order of Xylariales. Most

species in this group were isolated from woody plants (Table 3) except for Muscodor vitigenus

which was found in vines (Daisy et al., 2002; Worapong et al., 2001, 2002; Mitchell et al., 2008;

Gonzalez et. al., 2009; Suwannarach et al., 2010; Zhang et al., 2010; Kudalkar et al., 2011 and

Meshram et al., 2012). The capacity to produce anti-microbial volatile compound coupled with

the endophytic (living inside the tissues of healthy plants) nature of these fungi present

excellent potential for the Muscodor group to be candidates for the biological control of pest

and plant diseases. The host plants are symptomless, which indicates that the toxic chemicals

that are produced by the fungi do not harm the host. AgraQuest, a well-known company that

produces the bio-fungicides SERENADE SOIL®, SONATA® and RHAPSODY, has used the

endophytic fungus Muscodor albus, as a replacement or alternative to methyl bromide in

controlling the soil borne fungi, Rhizoctonia solani.

To date, there are no publications elucidating the occurrence and bio-activity of Muscodor in

Sarawak. The discovery of Muscodor isolates from Sarawak is novel and any usage derived from

these isolates can lead to new approaches for biological control of plant pathogens. The use of

a local isolate is preferred because it is well adapted to the local environment and is less likely

to become a pathogen when stressed.

17

Table 3: Members of Muscodor isolated from plant hosts worldwide

The search for host plants that harbour Muscodor in a mega-biodiversity region such as

Sarawak requires strategic collection plans. Strobel & Daisy, (2003) highlighted several

reasonable hypotheses for selecting such plants. These included selecting the plants from

unique environments, plants that have an ethno-botanical history, endemic plant and plants

growing in areas of great biodiversity. Based on previous records, Muscodor species were

mostly obtained from aromatic woody plants such as Lauraceae, Sapindaceae and Myristiceae

families. These groups of plants are commonly found in Sarawak (Adema et al., 1996 and

Wilde, 2000). In this study, Lauraceae, Sapindaceae and Myristiceae families were selected as

targeted plants with the hypothesis that at least one isolate of Muscodor-like will be isolated

from them.

Member of Muscodor Plant Host Isolated from Reference

M. albus Cinnamomum zeynalicum Bark Worapong et al., 2001

M. roseus Grevillea pteridifolia Limb Worapong et al., 2002

M. vitigenus Paullinia paullinioides Vines Daisy et al., 2002

M. cinnanomi Cinnamomum bejolghota Leaf Suwannarach et al., 2010

M. yucatanensis Bursera simaruba Leaf Gonzalez et. al., 2009

M. crispans Ananas ananassoides Bark Mitchell et al., 2010

M. fengyangensis Actinidia chinensis Leaf Zhang et al., 2010

M. sutura Prestonia trifida Twig Kudalkar et al., 2011

M. strobelli Cinnamomum zeylanicum stem Meshram et al., 2012

M. oryzae Oryza rufipogon leaf Suwannarach et al., 2013

M. musae Musa acuminate leaf Suwannarach et al., 2013

M. equiseti Equisetum debile stem Suwannarach et al., 2013

M. suthepensis Cinnamomum bejolghota stem Suwannarach et al., 2013

M. kashayum Aegle marmelos leaf Meshram et al., 2013

M. tigerii Cinnamomum camphora stem Saxena et al., 2014

18

Isolation techniques are also important to optimise the success rate in isolating Muscodor-like

as well as reduce the cost and time spent. The method described by Strobel et al., (2001) and

Wheatley et al., (1997) was adapted in this study as it had been shown that with the combined

treatment (surface sterilization plus volatile chemicals produced by M. albus), a large number

of endophytic fungi that were suspected to be non-volatile chemical producers were

successfully eliminated, thus enriching for Muscodor spp. fungi that produce volatile chemicals

(Table 3).

The endophytic fungus that survived repeated exposure to Muscodor albus could either be

resistant towards the volatile chemicals or is a producer of volatile chemicals. To test this

hypothesis, the isolated endophytic fungus was tested with plant pathogenic fungi in a dual

plate assay system, whereby the pathogenic fungi are exposed to the environment in which the

test endophyte grows. Retardation in growth of the pathogenic fungi would indicate that the

test endophyte produced volatile antifungal chemicals.

In this chapter, the details on new Muscodor spp. which were isolated from Cinnamomum

javanicum in Sarawak are described. The aim in this chapter is to isolate and test the

effectiveness of volatile chemicals produced from new endophytic Muscodor-like fungi from

target plants from Sarawak.

19

2.2 Materials and Methods

2.2.1 Collection of Plant Samples

In this study, plants from the family of Lauraceae, Sapindaceae and Myristicaceae were

targeted. The list of species and location of the plants from the corresponding families were

obtained from Sarawak Forestry Corporation (SFC) and Tree Flora Vol. 6. Based on SFC records,

target plants were located in the areas around Padawan and Bako National Park (Figure 2a).

Figure 2a: Map of Sarawak and the Kuching area, circled in red. (A). Enlarged map area show the plant samples collection areas, which are enclosed within black circles (Padawan Forest and Bako National Park (BNP). (Source: Department of Land and Survey Kuching Division)

(A)

Bako National Park (BNP)

Padawan Forest

20

Figure 2b: Map of enlarged Padawan area (B: Padawan area – dark blue circle) where five samples of Cinnamomum javanicum were collected at Padawan Forest area as shown in black circle. (Source: Department of Land and Survey Kuching Division)

Five plants from the Lauraceae family were collected from the Padawan area (Figure 2b) and

forty-five plants from Lauraceae, Sapindaceae and Myristicaceae families were collected from

Bako National Park. These plants were identified and recorded during the collection activity.

Other ancillary data such as the plant height, diameter base height (DBH), geographical

location, weather and photos of individual plants were also collected. Twigs (10cm long) and

leaves (2 leaflets) from plants were collected using secateurs and placed into zipper bags. List

of target plants collected from Padawan and Bako National Park are listed in Appendix 1.

B

21

2.2.2 Isolation of Putative Endophytic Fungi Producing Volatile Chemicals

Twigs and leaves from each plant were processed within 24 hours of collection. Each sample

was washed in running tap water to remove debris and other organisms on the plant surfaces.

Washed samples were cut into 1cm X 1cm segments with a sterilized scalpel. Plant segments

were then surface sterilized by sequential washes in 0.8% sodium hypochlorite (3 mins) and

70% ethanol (3 mins), rinsed thrice with sterile distilled water and then surface dried on sterile

tissue paper (Arnold et al., 2001 and Evans et al., 2003). Three sterilized plant segments from

each plant were plated per half plate containing Potato Dextrose Agar (PDA), Difco (39g/ L),

thereby exposing them to the VOCs of M. albus plated in the other half in the plate (Figure 3)

as prepared in section 2.2.3. For control, three sterilized plant segments from the same plant

were plated in half plate containing PDA without M. albus on the other half in the plate. The

plates were double sealed with parafilm and incubated at 250C for 5 to 10 days. Double sealing

was performed to minimize the release of volatile chemicals produced by M. albus. Endophytic

fungi growing from the plated plant tissue were picked and transferred onto new PDA plates.

The purity of endophytic fungi was determined based on their morphological appearances.

In order to confirm that M. albus used in this isolation process produces volatile chemicals,

agar plugs of plant pathogenic fungi as prepared in section 2.2.3.2 were inoculated on the

other side of agar in the isolation plate inoculated with M. albus. For the control plate, the

isolation plate was similarly prepared but without M. albus inoculation. The plates were double

sealed with parafilm and incubated at 250C for 5 days. Reduction on the radial growth of plant

pathogenic fungi after exposure to M. albus was compared with the control plate to determine

if the M. albus produced volatiles chemicals.

22

Figure 3: Isolation plate showing 10-day-old M. albus on one side of the agar and the other side inoculated with three sterilized plants segments of L02. A strip of agar of 2cm width was removed from the middle of the plate

2.2.3 Preparation of Standard Strains

2.2.3.1 Muscodor albus, cz-620

Muscodor albus is a well-known strain producing antimicrobial volatile chemicals and widely

used as selection strain for isolating new endophytic fungus from environmental samples

(Strobel et al., 2001; Worapong et al., 2001 and Ezra et al., 2002). The strain of M. albus used in

this study was obtained from Prof. Dr. Gary Strobel from Montana University. Prior to testing,

this strain was grown on PDA medium and incubated at 250C for 10 days. Active mycelia on the

edge of colony were used as the inoculum source. In order to confirm that M. albus used in this

isolation process produces volatile chemicals similar testing as section 2.2.2 paragraph 2 was

conducted.

23

2.2.3.2 Plant Pathogenic Fungi: Rhizoctonia solani, Phytophthora capsici, Ganoderma

boninense and Fusarium oxysporum

Plant pathogenic fungi were used to confirm the production of antifungal volatile chemicals by

M. albus in the control plates and to screen for endophytic fungi that produce antifungal

volatile chemicals. The growth rates of plant pathogenic fungi on the PDA media were

measured prior to preparing the inoculum for testing. The plant pathogenic fungi; R. solani and

P. capsici covered the whole surface of the PDA media in a 90mm diameter plate within 2 days.

Meanwhile, G. boninense and F. oxysporum required 7 days to cover the same surface area.

The preparation of the standard strains is based on these observations and samples were

grown on PDA plate and incubated at 250C for a day (R. solani and P. capsici) and 5 days (G.

boninense and F. oxysporum) prior to testing. The incubation period was shortened to prevent

the hyphae extension from reaching the edge of the plate and to facilitate detection of

contamination by other filamentous fungi, which normally occurs on the edge of the plate.

2.2.3.3 Preparation of Isolation Plate

Potato Dextrose Agar (PDA), Difco (39g per L) was used as isolation media. The isolation plates

were prepared 10 days prior to the isolation by removing a strip of agar (2cm width) from the

middle of the plate as described by Strobel et al., 2001. Agar strips were removed to prevent

compound diffusion from one side of the agar to the other. On one side of the agar was

inoculated with an agar plug of M. albus (that was removed from a 10 days M. albus in the

same media as prepared in section 2.2.3.2.). The plates were single sealed with parafilm and

incubated at 250C for 10 days. After 10 days incubation, only fungus that grows out from plant

segment that exposed with M. albus will be picked and transferred onto new PDA media.

2.2.4 In-vitro Screening on Putative Endophytic Fungi Producing Volatile Chemicals

In each isolation plate, false positives isolate producing volatile chemicals might also occur. Two

types of plate assay system were prepared to evaluate and reconfirm the capacity of individual

endophytic fungi in producing volatile chemicals which are:

24

(a) Double Plate

This method was modified from Wheatley et al., 1997. The PDA plates were inoculated with 9

points of agar plugs of M. albus and incubated at 250C for 10 days prior to testing. In a separate

PDA plate, 9 agar plugs from different isolates of endophytic fungi were inoculated. The lids

were removed and the plate containing the endophytic fungi was inverted over the plate with

M. albus. As the control, plates inoculated with endophytic fungi were inverted over an un-

inoculated PDA plate.

(b) Split Plate

This assay was to confirm that the isolates that failed to grow after exposure to M. albus in the

double plate assay was not caused by the diffusion of chemicals produced by neighbouring

isolates. The split plate assay was prepared as described by Strobel et al., (2001). PDA was used

as a growth media, and a 2 cm width of agar strip was removed from the middle of PDA media

in a 90mm Petri dish, to create an empty trench. One side of the trench was inoculated an agar

plug of 10 days’ old M. albus, grown on the same growth medium. The plate was single sealed

with parafilm and incubated at 250C for 10 days prior to testing. In the same plate, the other

side of the trench was inoculated with a 10 days old agar plug of endophytic fungi. As control,

an endophytic fungus was inoculated on one side of the agar in a control plate without M.

albus.

Three set of plates were prepared for each isolate (with and without M. albus). The plates were

then double sealed with two strips of parafilm and incubated at 250C for 5 days. The capacity of

the endophytic fungi to withstand the presence of volatile chemicals produced by M. albus was

evaluated based on reduction in radial colony growth of endophytic fungi compared with

control plate.

2.2.5 In-vitro Screening of Endophytic Fungi Producing Volatile Chemicals

An endophytic fungus that survived repeated exposure to M. albus could either be resistant

towards the volatile chemicals or is a producer of volatile chemicals. Exposure to plant

pathogenic fungi was used to confirm that an endophytic fungus is producing volatile

chemicals. The ability of the endophytic fungus to control the plant pathogenic fungi is an

25

indication of its VOC production capability. This was evaluated in split and double plate assay as

adapted from Section 2.2.4. The endophytic fungi was prepared in split plate and incubated for

10 days before being inoculated with plant pathogenic fungi on the other side on the agar

trench. For control, plant pathogenic fungi were inoculated on one of the agar, in a plate

without endophytic fungi. In double plate assay, 4 points of agar plugs of endophytic fungi

were inoculated onto PDA plate for 10 days prior to testing, and on the separate plate 4 points

of different species of plant pathogenic fungi were inoculated. The lid of the plates was

removed and plate containing the plant pathogenic fungi was inverted over the plate

containing the endophytic fungi. For control, a plate containing plant pathogenic fungi was

inverted over an un-inoculated PDA plate. The plates were sealed with double layers of

parafilm and incubated at 250C for 5 days. The radial growth of plant pathogenic fungi after

exposure to the endophytic fungi was measured and the percentage inhibition of radial

growth, PIRG, was calculated according to Skidmore & Dickenson, (1976):

Percentage Inhibition of Radial Growth (PIRG) = [C – T]/C x 100

Where;

C - Growth of plant pathogenic fungi eg. G. boninense in control plate

T - Growth of plant pathogenic fungi eg. G. boninense in test plate

All tests were conducted in triplicates. Values are given as Mean ± SE (n= 3), where SE refers to

Standard Error. Statistical analyses were conducted with Statistical Package for the Social

Sciences (SPSS) version 17.0 (SPSS Science Inc., IL) and Excel software (Microsoft, Redmond,

WA). Oneway ANOVA and a post hoc analysis [Tukey’s honestly significant difference (HSD)]

were applied to the data. The level of significance was P<0.05.

2.2.6 Preliminary Identification

2.2.6.1 Morphology of Colony

(a) Macroscopic Study

Agar plugs of each isolate were inoculated onto PDA media and incubated at 250C for a further

10 days. The colony appearance was recorded; the presence of aerial mycelium, pigment

26

production, colony pattern, and colour and exudate production were noted. The radial growth

of the isolate and changes in colour (during the 10 days of incubation) was also recorded.

(b) Microscopic Study

The microscopic features were examined under a light microscope. Two main features of the

isolates were examined carefully

i) Hyphal structure - size, colour, surface and mitic system

ii) Fruiting body structure - spore, rest spore, structure, pattern, size, colour and shape

2.2.6.2 Molecular Identification

(a) DNA Extraction, Amplification, Purification and Sequencing

i. DNA Extraction

Mycelia from a colony of 10 day old Muscodor-like isolates were picked using a sterilized

toothpick. Each sample was then placed into individual wells of a 96 wells plate containing 50µl

Tris-EDTA solution and then deep frozen at -800C freezer for 24 hours as described by

Muramatsu et al., 2003. The plate was then thawed by shaking at 250rpm at room temperature

for 15 minutes. The lysate obtained was used as crude DNA template for PCR.

ii. DNA Amplification

The mixture for DNA amplification was prepared as follows, per sample: Pfu Polymerase

(Fermentas), 0.2µl; 10x dNTP, 0.2µl; Polymerase buffer, 2µl; 20µm ITS 4 (5’

TCCTCCGCTTATTGATATGC 3’), 0.4µl; 20µm ITS 5 (5’GGAAGTAAAAGTCGTAACAAGG 3’) (White et

al., 1990), 0.4µl; sterilized water, 16.8µl; Crude DNA, 1µl. Amplification was carried out with the

following settings: Initial denaturation at 960C for 1 minute, denaturation at 960C for 5 minutes,

annealing at 530C for 1 minute, elongation at 720C for 5 minutes, final elongation at 720C for 2

minutes. The process was repeated for 30 cycles.

iii. Visualization of PCR Product

Amplified DNA (PCR product) was visualized on a 1% agarose gel incorporated with ethidium

bromide. The PCR product (5µl) was mixed with 1µl of 6x Mass Ruler loading dye #R0621 and

loaded into the well of the 1% agarose gel. Mass ruler DNA ladder mix # SM 0403 was used as

standard to determine the size of the target DNA. The DNA was separated according to size by

27

gel electrophoresis at 50 volts for five minutes, followed by 75 volts for another 35 minutes.

The DNA bands were visualized with a UV transilluminator the image was captured using an

Alphaimager.

iv. DNA Purification

Amplified DNA was purified using GE Healthcare PCR purification kit. The procedure for the

purification followed manufacturer’s instructions. The eluted solution (pure DNA) was stored at

-200C until needed.

v. Cycle Sequencing of PCR Products

Sequencing was performed on an Applied Biosystems 3130xl Genetic Analyser, using BigDye®

Terminator V3.1 Cycle Sequencing Kit according to the protocol in the user manual. Two PCR

primers were used. ITS 5 (5’ TCCTCCGCTTATTGATATGC 3’) was used as forward primer and ITS 4

(5’ TCCTCCGCTTATTGATATGC 3’) as reverse primer.

vi. Comparison of Sequences with Existing Sequences in GenBank Database

The raw sequences were edited using BioEdit programme in FASTA format. The forward and

reverse primer sequence was removed before the sequence was blasted with existing

sequences in GenBank database (www.ncbi.nlm.nih.gov/BLAST/). Sequence was compared

using BlastN to search for the closest best match sequence. The top three similarities to the

query sequence were used as estimated reference species for further investigation of the

identity of the isolate with 94% similarities for genus and 99% similarities for species

confirmation (Keswani et al., 2001 and Muramatsu et al., 2003)

(b) Phylogenetic analysis

DNA sequences were aligned using BioEdit (Hall, 2005) with other sequences obtained from

GenBank. A BLAST search was performed to find the possible sister group of the newly

sequenced isolate. Phylogenetic analyses were performed using Molecular Evolutionary

Genetics Analysis (MEGA) Version 6 (Tamura et al., 2013). Prior to phylogenetic analysis,

ambiguous sequences at the start and the end were deleted and gaps were manually adjusted

to optimize alignment. The evolutionary distances were inferred by using the Neighbour-

Joining method (Saitou & Nei, 1987). Bootstrap replicates (1000) were taken into account to

infer the bootstrap consensus tree for the representation of evolutionary history. The

28

evolutionary distances were computed using the Maximum Composite Likelihood method

(Tamura et al., 2004).

2.2.7 Storage

Four methods of long-term storage were evaluated in this study for maintenance and

preservation of the active vegetative mycelium condition of the Muscodor-like isolates. These

methods were:

(a) Infected Grains with Mycelium of Muscodor-like Isolate

Barley and rice grain were evaluated as substrates that could retain the viability of Muscodor-

like isolates for long term storage. In preparation of the substrate, 100g of grains were

prepared and washed twice with deionized water. The grains were soaked in PDA broth for 15

minutes. Grains (10-15) were placed into universal (McCartney) bottles and autoclaved thrice

at 1210C for 15 minutes. An agar plug containing the mycelia of the isolate was transferred onto

the grains aseptically and incubated at 250C for 2 weeks or until the barley grains were fully

colonized by mycelia. The grains were stored at 250C in an incubator and at 40C in the cold

room.

(b) PDA Agar Slant

The slant was prepared by pouring 7ml autoclaved PDA solution into each universal

(McCartney) bottle. The bottle was slanted at a 45 degree angle and left to solidify at room

temperature. An agar plug of a 10-day-old Muscodor-like isolate was inoculated onto the slant

and incubated at 250C incubator for 10 days prior before storage in a 40C cold room.

(c) Sterilized Water

Three 10-day-old agar plugs with mycelia of Muscodor-like isolates were placed aseptically in

universal (McCartney) bottles containing 7 ml sterilized water. The bottles were kept at 40C cold

room.

29

(d) Encapsulated Hypha in Alginate Beads

A 2% alginate solution was prepared and mixed with 1% blended mycelium of Muscodor- like

isolates. The broth culture of Muscodor-like isolates were prepared by placing 6 agar plugs with

mycelia of isolate into 250ml conical flask containing 50ml PDA broth and shaken at 200rpm at

250C for 10 days. Then the broth culture with mycelia was fragmented using a blender for

approximately 2 minutes. Hypha that were mixed with alginate solution were pipetted into 0.1

M CaCl2.H2O solution to form beads and washed with 0.025 M CaCl2.H2O thrice. These beads

were stored in: (i) universal (McCartney) bottles containing sterilized water (10-15 beads per

bottle) and kept at 40C in the cold room (ii) vacuum ampoules, whereby the beads were dried

in vacuum using L-Drying machine and kept at room temperature.

2.2.8 Viability and Productivity Test

All Muscodor-like isolates that were kept in different substrates and conditions were tested for

viability. After 2 weeks, 1, 3, 6, 10 and 12 months incubation, the stored isolates were

transferred onto new PDA plates. The plates were incubated at 250C for 10 days. Viable isolates

would produce new hyphal and from that the shelf life of that isolate in the different conditions

can be estimated. Viable isolates that recovered after different period of incubation were also

tested on their productivity. This was evaluated by incubating them with plant pathogenic fungi

following the assay system as described at section 2.2.5.

30

2.3 Results and Discussion

2.3.1 Plant Collection

The collection of twigs and leaves from target plants: Lauraceae, Myristicaceae and

Sapindaceae in Padawan and Bako National Parks were performed randomly. A total of 45

target plant samples were collected from both locations. The samples consisted of 33, 10 and 7

plants species from the families of Lauraceae, Myristicaceae and Sapindaceae, respectively. The

collected plants were categorized as small to moderate based on the size of the woody plants

with plant height that ranges in between 1 to 50cm in diameter base height (DBH) and 30 to

1200cm in height, respectively. Plant samples were collected from Cinnamomum javanicum (23

samples) under the Lauraceae family followed by Myristica fragrans (6 samples) from the

Myristicaceae family, Nephelium lappaceum (5 samples) from the Sapindaceae family, and

other species as shown in Table 4.

Table 4: List of plant species collected from Padawan dan Bako National Park

No Plant Species Total Collected

1 Actinodaphne sesquipedalis 3

2 Cinnamomum javanicum 23

3 Cinnamomum cassia 4

4 Cinnamomum zeylanicum 3

5 Dimocarpus longan 1

6 Horsfieldia paucinervis 1

7 Knema viridis 3

8 Myristica cinnamomea 1

9 Myristica fragrans 6

10 Nephelium lappaceum 5

31

2.3.2 Isolation of Endophytic Fungi

In this study, at least 3 morphospecies of fungi including Trichoderma spp. and Botrydiplodia

spp. grew from each plant segment that had undergone surface sterilization treatment without

exposure to volatile chemicals produced by M. albus. An additional treatment by exposure to

M. albus in the isolation process resulted in a threefold decline in the total number of fungal

morphospecies isolated from the plant segments (Figure 4b). In the samples collected from

Bako National Park, exposure to M. albus inhibited all fungal growth while lack of M. albus

exposure resulted in outgrowth of at least 3 morphospecies from the plant segments. Volatile

chemicals released by M. albus in the plate environment exhibited a killing effect towards

certain endophytic fungus like Trichoderma spp. and Botrydiplodia spp. inside the plant tissues,

which was also demonstrated by Strobel et al., (2001), Ezra et al. (2004), Worapong et al.,

(2002) and Zhang et al., (2010).

Using an adaption of the aforementioned technique in the isolation process, a total of 75

putative VOC producing endophytic fungal isolates were successfully obtained from the plated

plant samples. All were isolated from five plant samples of Cinnamomum javanicum (Figure 4a)

collected from Padawan. Unfortunately, no endophytic fungus grew from C. javanicum and

other plant samples that were collected from Bako National Park. This result suggests that the

occurrence of Muscodor spp. may be environmentally specific as opposed to species specific.

32

Figure 4a: A specimen of Cinnamomum javanicum. Endophytic fungi producing volatile chemicals were isolated from the leaves of this plant which was collected from Padawan.

Figure 4b: Split plates assay with M. albus. The pictures show that only two colonies of fungi grew from the plants segments of L05 (Left) compared to the control plate which has more than five colonies of fungi (Right). Picture was taken after the samples have been exposed to M. albus for 3 days.

Leaf and Stem of C. javanicum

33

2.3.3 In-vitro Screening of Endophytic Fungi Producing Volatile Chemicals

The observation that an endophytic fungus that survives after repeatedly being exposed to the

volatile chemicals (VOCs) produced by M. albus, is also capable of producing volatile chemicals

(Strobel et al., 2001 and Ezra et al., 2002), was adapted in this study to eliminate false positive

among the 75 putative endophytic isolates that were obtained from the plant samples.

Each isolate was exposed to VOCs produced by M. albus in split and double plate assays. Of the

75 isolates evaluated, 33 showed consistent activity after repeated exposure to M. albus and

displayed normal growth characteristics when compared to the corresponding control plate in

both assay systems. The remaining isolates showed retarded or no growth. This also indicated

that the 33 isolates tested did not produced chemicals secrete any chemicals into the PDA agar

that had the capacity to kill or retard the growth of other isolates grown on the same plate. The

33 isolates that survived in the presence of volatile chemicals produced by M. albus were

considered to be volatile chemicals producing fungi as they could tolerance with that chemical.

Resistance towards the volatile chemicals produced by M. albus could be a factor that allows

the isolates to remain alive and grow normally. To confirm whether these isolates are

producing volatile chemicals or are just resistant to the volatile chemicals, the isolates were

then exposed to plant pathogenic fungi using a double plate assay. All tested isolates that were

grown on the same plate did not kill or inhibit each other.

Out of 33 isolates screened, 10 of them exhibited the capacity to control the growth of plant

pathogenic fungi (Table 5). The volatile chemicals produced by these isolates were capable of

killing plant pathogenic fungi G. boninense, P. capsici, and R. solani and inhibited the growth of

F. oxysporum. This result shows that the isolates produced volatile chemicals that contain

antifungal compounds. Freire et al., (2012), demonstrated that F. oxysporum also produces

antimicrobial volatile chemicals. This may the possible reason that F. oxysporum was able to

withstand the exposure to the volatile chemicals produced by the 10 isolates.

34

Table 5: Percentage of radial inhibition growth of plant pathogenic fungi after exposure to endophytic isolates.

No

Isolate

The Percentage of Radial Inhibition Growth (PIRG) of Plant Pathogenic Fungi After 5 days exposed with isolates

R. solani P. capsici F. oxysporum G. boninense 1 L1R1f 100 ± 0.00a 100 ± 0.00a 66.15 ± 1.76e 100 ± 0.00a 2 L2R2f 100 ± 0.00a 100 ± 0.00a 49.74 ± 2.24bcd 100 ± 0.00a 3 L2R3a 100 ± 0.00a 100 ± 0.00a 60.51 ± 2.24de 100 ± 0.00a 4 L3R2a 100 ± 0.00a 100 ± 0.00a 49.23 ± 2.66bcd 100 ± 0.00a 5 L3R3a 100 ± 0.00a 100 ± 0.00a 46.67 ± 2.23abc 100 ± 0.00a 6 L4R2a 100 ± 0.00a 100 ± 0.00a 38.46 ± 1.78ab 100 ± 0.00a 7 L4R2e 100 ± 0.00a 100 ± 0.00a 43.59 ± 4.89abc 100 ± 0.00a 8 L4R2f 100 ± 0.00a 100 ± 0.00a 36.92 ± 3.55a 100 ± 0.00a 9 L5R1c 100 ± 0.00a 100 ± 0.00a 35.38 ± 1.78a 100 ± 0.00a

10 L5R3e 100 ± 0.00a 100 ± 0.00a 50.77 ± 0.89cd 100 ± 0.00a 11 M. albus 100 ± 0.00a 100 ± 0.00a 67.69 ± 0.89e 100 ± 0.00a 12 Control 100 ± 0.00a 100 ± 0.00a 100 ± 0.00f 100 ± 0.00a

The Percentage of radial inhibition growth (mean ± standard error, N=3) after 5 days exposed with endophytic isolates producing antifungal volatile chemicals. Different letters in the same column indicate a significant difference (Tukey’s HSD after one-way ANOVA, P<0.05) between isolates.

2.3.4 Preliminary Identification

The ten isolates that produced volatile antifungal chemicals were identified using

morphological and molecular methods. This preliminary identification was conducted to assign

the genus and species level of each isolates as well as to eliminate redundancy in studies on the

same species.

(a) Morphological Characteristics

The colony morphology of the isolates on PDA media was observed in detail as described in

Table 6. Presence of septa and absence of clamp connection indicated that these isolates

grouped into Ascomycete even though no fruiting bodies or spores were produced. Moreover,

the macro and micro-morphological characteristics of the isolates are similar to Muscodor

group whereby most of the colonies were white to dark brick, round to irregular, slow growing

35

(≤ 30 mm diameters in 10 days); Hyphal: hyaline, septate, branched, 1-3um diameter, absent of

asexual stages and pigments (Figure 5 to 14).

Table 6: Colony description of Muscodor-like isolates

Isolate Photograph

(a) L1R1b

Description: Colonies white, reverse cream, rounded, growing slowly to 24-28 mm diameter in 10 days incubation at 25°C. Mycelium production moderate for aerial and poor production of vegetative. Hyphal hyaline, smooth to finely rough, spiral, branched, septate, 1-2um diameter, thick walled. Asexual stage (non-sporulation), pigment and exudate absent.

(b) L2R2f

Description: Colonies white, reverse white, rounded, formed concentrically lines, slowly growing to 24-28 mm diameter in 10 days incubation at 25°C. Aerial mycelium abundance, poor production of vegetative mycelium. Hyphal hyaline, branched, septate, 1-3 um diameter. Asexual stage (non-sporulation), pigment and exudate absent.

(c) L2R3a

Description: Colonies white, reverse white, rounded, growing slowly to 22-28 mm diameter in 10 days incubation at 25°C. Aerial mycelium abundance on mature area and slowly decreased towards edge of the colony. Poor production of vegetative mycelium. Hyphal hyaline, branched, septate, 1-3 um diameter. Asexual stage (non-sporulation), pigment and exudate absent.

36

(d) L3R2b

Description: Colonies were initially pale brick then became dark brick after 14 days, reverse dark brick, rounded and growing slowly to 16-26mm diameter in 10 days incubation at 25°C. Mycelium production was poor for aerial and moderate production of vegetative mycelium. Hyphal hyaline, septate, 1-2 um diameter, thick walled, branched. Asexual stage (non-sporulation) and pigment absent. Exudate produced after 20 days incubation on PDA media at 25°C.

(e) L3R3a

Description: Colonies were initially yellowish then became dark brick after 10 days, reverse was cream, rounded and concentrically lines, slowly growing to 20-28 mm diameter in 10 days incubation at 25°C. Mycelium production was poor for aerial and moderate production of vegetative mycelium. Hyphal hyaline, septate, 1-3 um diameter, thick walled, branched. Asexual stage (non-sporulation) and pigment absent. Exudate produced after 20 days incubation on PDA media at 25°C.

(f) L4R2a

Description: Colonies white, rounded, slowly growing to 18-24 mm diameter in 10 days incubation at 25°C. Reverse cream. Moderate production of aerial mycelium and poor production of vegetative mycelium. Hyphal hyaline, septate, 1-2 um diameter, thick walled, branched. Asexual stage (non-sporulation), pigment and exudate absent.

37

(g) L4R2e

Description: Colonies white, rounded, slowly growing to 22-26 mm diameter in 10 days incubation at 25°C. The reverse was white. Aerial mycelium abundance on mature area and moderate towards edge of colony. Poor production of vegetative mycelium. Hyphal hyaline, septate, 1-2 um diameter, thick walled, branched. Asexual stage (non-sporulation), pigment and exudate absent.

(h) L4R2f

Description: Colonies was initially white then became creamed coloured after 14 days incubation. The reverse was cream. Rounded shape of colony growing to 24-28 mm diameter in 10 days incubation at 25°C. Poor production of aerial mycelium on mature area and moderate towards edge of colony. Vegetative mycelium was poor production. Hyphal hyaline, branched, 1-3um diameter, thick-walled. Asexual stage (non-sporulation), pigment and exudate absent.

(i) L5R1c

Description: Colonies was initially white then become black after 20 days incubation at 25°C. The reverse was white. Rounded to irregular shape of colony formed concentric lines, slow growing to 23- 30 mm diameter in 10 days incubation at 25°C. Moderate production of aerial and reverse mycelium. Hyphal hyaline, branched, 1-2um diameter, thick-walled. Asexual stage (non-sporulation), pigment absent. Exudate produced after 20 days incubation at 25°C.

38

(j) L5R3e

Description: Colonies white, rounded, slowly growing to 24- 28 mm diameter in 10 days incubation at 25°C. The reverse was white. Moderate production of aerial and reverse mycelium. Hyphal hyaline, branched, 1-2um diameter, thick-walled. Asexual stage (non-sporulation), pigment, exudate absent.

Figure 15: Hyphae structure of isolate L3R3a (A) and L5R1c (B) using light microscopy with 40x magnification (Bar = 5µm). (A) A group of L3R3a hyphal assembled together to form a strip-like structure (B) Intermediate formation of chlamydospore in L5R1c was observed

(b) Molecular Identification

The crude DNAs from the 10 isolates and the M. albus strain were successfully extracted using

a deep freeze and thaw method modified from Muramatsu et al., (2003). PCR products

obtained ranged between 600 to 700bp (Figure 16). The products were sent for sequencing

using the Sanger method and the sequences obtained were compared to sequences in

GenBank using BLAST. The results showed that the isolates exhibited 97 to 100% similarities to

the genus of Muscodor equiseti as per Table 7. This also indicated that these isolates belong to

the Muscodor genus (Keswani et al., 2001). Out of the 10 isolates that were compared against

the GenBank database, eight of them were closely related to the species equiseti (99%

A B

39

similarity) except for L3R2a and L3R3a, which showed 97% and 96% similarities, respectively to

the same species. Muscodor was accepted for the genus of all tested isolates following the

criterion for genus determination as suggested by Keswani et al., 2001 which is a 94% homolog

value. Species level determination, set at 99% similarity showed isolate L1R1b, L2R3a, L2R2f,

L4R2a, L4R2e, L4R2f, L5R1c and L5R3a are closely correlated to M. equiseti with a 99% homolog

value which met the criterion for species level as suggested by Muramatsu et al., (2003).

Further investigation on the identity of all ten isolates was conducted to eliminate duplicate

species. Multiple sequence alignment (MSA) was used to search for duplicate species whereby

all isolates were aligned to search for dissimilar base and gap in the sequences. Alignment with

the L3R3a sequence as reference showed that no gap occurred and less than five bases were

dissimilar with the reference sequence for all tested sequences. The ten isolates were grouped

into five groups (Table 8).

The phylogenetic tree that was constructed using the neighbour-joining method (Saitou & Nei,

1987) showed that Muscodor member and the new isolates were grouped into 7 clusters

(Figure 17). Six of isolates, L4R2a, L4R2e, L4R2f, L2R2f, L5R1c and L5R3a shared similar cluster

with M. vitigenus, M. sutura and M. equiseti under Cluster 1. However, L1R1b and L2R3a was

grouped as independents in Cluster 2 but were derived from a common ancestor with L4R2a,

L4R2e, L4R2f, L2R2f, L5R1c and L5R3a, which suggests that they inherited similar physical traits

(Baldauf, 2003). Isolate L3R2a and L3R3a were also located at a different cluster with other

members of Muscodor and the new isolates under Cluster 3.

According to BLAST results, MSA (100% matched for every base that has been aligned) and

phylogenetic analysis showed L3R2b and L3R3a were 100% identical through molecular

identification and morphological characteristics. They showed similar characteristics especially

poor production of aerial mycelium. Both isolates were named as Muscodor sp. as the

percentage of similarity to GenBank database was below 99%.

The other 8 tested isolates, even though they showed 99% similarity to M. equiseti but MSA

showed there were gaps between the bases. The MSA showed that L4R2a, L4R2e, L2R2f, L5R1c

and L5R3a came under the same group and phylogenetic analysis also grouped them in Cluster

1, which is also shared by M. vitigenus, M. sutura, M. equiseti and L4R2f. However,

40

morphological characteristics showed that L4R2a, L4R2e, L2R2f, L5R1c and L5R3a were

different from the closest sequence match, M. equiseti, as the colony pattern of these isolates

did not formed cottony-like mycelium and coiling hyphae (Suwannarach et al., 2013).

The multiple sequence alignment showed that the bases of isolate L1R1b, L2R3a and L4R2f did

not have a 100% alignment with other tested isolates, which indicated that there are

differences in molecular identity. Phylogenetic analysis also supported that these isolates are

different from other tested isolates as well as other Muscodor’s member as they were grouped

in different clusters. However, blast sequence analysis showed that these isolates had 99%

similarity with M. equiseti but the colony characteristics did not support these isolates as

belonging to the species of M. equiseti. Further identification is required to determine their

species. The viability of cultures, after several period of time is also important to evaluate their

potential as biological control agent. A viability study was conducted to determine their shelf

life.

Figure 16: Gel electrophoresis of PCR products obtained from the 10 isolates. DNA bands with estimated sizes between 600-700bp were obtained (A to K) after PCR reaction. The samples were analysed on 1% agarose gel. M is DNA marker, Mass ruler (#SM0403) from Fermentas

41

Table 7: Percentage of similarity between the isolates and the top three sequences in the GenBank database. No Isolate Comparison with GenBank Database

Closest Species %

Similarity Query Cover

(%) E-

value 1 LIR1b Fungal sp. ARIZ B342 [FJ612989] 99 99 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 99 0

Muscodor sp. RTM5-IV2 [KF850711] 99 99 0 2 L2R2f Muscodor sp. RTM5-IV2 [KF850711] 99 100 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0

Fungal sp. ARIZ B342 [FJ612989] 99 100 0 3 L2R3a Muscodor sp. RTM5-IV2 [KF850711] 99 98 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 98 0

Fungal sp. ARIZ B342 [FJ612989] 99 98 0

4 L3R2b Muscodor yucatanensis strain B110 [FJ917287] 97 100 0

Muscodor sp. KF229762.1 96 100 0 Muscodor sp. KF229758.1 96 100 0

5 L3R3a Muscodor yucatanensis strain B110 [FJ917287] 96 100 0

Muscodor sp. KF229762.1 96 100 0 Muscodor sp. KF229758.1 96 100 0 6 L4R2a Fungal sp. ARIZ B342 [FJ612989] 99 99 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 99 0

Muscodor sp. RTM5-IV2 [KF850711] 99 98 0 7 L4R2e Muscodor sp. RTM5-IV2 [KF850711] 99 100 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0

Fungal sp. ARIZ B342 [FJ612989] 99 100 0

8 L4R2f Muscodor equiseti strain CMU-M2 [JX089322] 99 99 0

Fungal sp. ARIZ B342 [FJ612989] 99 99 0 Muscodor sp. RTM5-IV2 [KF850711] 99 97 0 9 L5R1c Muscodor sp. RTM5-IV2 [KF850711] 99 100 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0

Fungal sp. ARIZ B342 [FJ612989] 99 100 0 10 L5R3a Muscodor sp. RTM5-IV2 [KF850711] 99 100 0

Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0

Fungal sp. ARIZ B342 [FJ612989] 99 100 0

42

Table 8: Isolates were grouped using Multiple Sequence Alignment (MSA). Group Isolates Species Compared with GenBank

Database 1 L3R2b Muscodor yucatanensis, 97%

L3R3a Muscodor yucatanensis, 96%

2 L4R2f Muscodor equiseti, 99%

3 L1R1b Muscodor equiseti, 99%

4 L2R3a Muscodor equiseti, 99%

5 L2R2f Muscodor equiseti, 99%

L4R2a Muscodor equiseti, 99%

L4R2e Muscodor equiseti, 99%

L5R1c Muscodor equiseti, 99%

L5R3a Muscodor equiseti, 99%

43

L4R2a L4R2f

L4R2e Muscodor sp. E8514iHQ117854.1

L2R2f L5R1c L5R3a Muscodor vitigenus AY100022.1 Muscodor sutura JF938595.1 Muscodor equiseti JX089322.1

L1R1b L2R3a

L3R2b L3R3a

Muscodor strobelli FJ664551.1 Muscodor yucatanensisFJ917287.1

Muscodor suthepensis JN558830.1 Muscodor kashayum KC481680.3

Muscodor sp. RTM5-IV4KF850713.1 Muscodor crispansEU195297.1 Muscodor oryzae JX089321.1 Muscodor musae JX089323.1 Muscodor cinnanomi GQ848369.1 Muscodor albusAF324336.1

Muscodor fengyangensis HM034856.1

100

6815

7

9

18

97

100

99

64

94

86

99

87

0.01

Figure 17: Phylogenetic analyses of the Muscodor spp and the isolated strains from this study. This was constructed using Molecular Evolutionary Genetics Analysis (MEGA) Version 6 (Tamura et al., 2013), based on the ITS rDNA gene sequences.

2.3.5 Maintenance and Preservation

In this study, the 10 positive isolates were cultured on PDA agar slants for 7, 14, 21 and 30 days,

at 250C to evaluate their viability. The growth media PDA was selected as the reference media.

This is a commonly used medium that supports the growth of a wide range of fungi including

the Muscodor spp. Results from the time course study towards their viability show all the

isolates were viable except for isolate L4R2a which died on day 21. Due to the short shelf life of

isolate L4R2a and labour intensive sub-culturing necessary for maintenance, isolate L4R2a was

eliminated from further study.

Long term storage requires a suitable passage medium and storage condition to maintain and

preserve the active condition of the vegetative mycelium of the isolates. Barley is the main

target for long term passage medium, as it has been successfully used for long term storage of

Muscodor spp. Other passage medium and storage conditions including rice grain, PDA agar

slants, beads, and agar plugs containing fungi mycelia were also evaluated. The results showed

that barley and rice grains were suitable passage substrates for storage of up to 3 years. This

Cluster 1

Cluster 2

Cluster 5 Cluster 4

Cluster 3

Cluster 6

Cluster 7

44

was probably because of the long chains of carbon contained in cellulose and carbohydrates,

which are major components in barley and rice grains. The long chained carbon needs to be

degraded into glucose, slowing the growth of isolates due to the high energy requirement to

breakdown the carbon chains into a usable food source. A rich source of carbon in the grain

might act as long term food storage to support and prolong the active vegetative mycelium

condition. This factor may contribute to the reason why isolates retained viability after long

term storage on barley and rice grains (Strobel et al., 2001)

Isolates that were kept on PDA agar slant, agar plugs and beads, in sterilized water show

selective pressure on the replicates. Some of the replicates failed to grow after 10 months of

storage at 40C in the cold room. This shows that the active shelf life is 6 months for isolates

kept on PDA agar slant, agar plugs, beads and in sterilized water. Based on the results,

throughout this study, barley was selected as passage substrate for long term storage of the

isolates. PDA agar slant was selected as passage media for working storage which requires sub-

culturing every 6 months.

All the isolates were viable after being kept for six months on PDA agar, agar plug, beads, and

sterilized water, and after being kept for three years in barley and rice grains as passage media.

Bioactivity or consistent production of antifungal volatile chemicals is crucial and important to

measure the suitability of these isolates as potential candidate for biological control agent

towards plant pathogenic fungi such as G. boninense. The isolates that have been kept for three

months in various passage media showed unaltered bioactivity, and the volatile chemicals

produced by those isolates were capable of controlling G. boninense. However, after 6 months,

most of the tested isolate except isolate L3R3a and L5R1c showed selective pressure within the

replicates with at least one replicate only showing inhibition on the growth of G. boninense.

Similar result was obtained after 10 months, all infested isolates on barley and rice grain except

for L3R3a and L5R1c showed selective bioactivity among replicates and created “sector on

colony” pattern. After 12 months of incubation, isolate L2R2f, L2R3a and L4R2f grown on barley

grains lost their capacity to produce antifungal volatile chemicals. However, L3R3a and L5R1c

consistently show their ability to produce anti-Ganoderma volatile chemicals after storage for

6, 10 and 12 months.

45

2.4 Conclusion

Ten Muscodor-like isolates producing volatile chemicals were successfully isolated from the

leaves of Cinnamomum javanium, collected from Padawan area in Kuching, Sarawak. These

isolates produced volatile chemicals that effectively controlled the growth of the plant

pathogenic fungi: Rhizoctonia solani, Phytophthora capsici and Ganoderma boninense.

DNA sequence identification classified these isolates as belonging to the genus Muscodor and

most of them showed 99% similarity to Muscodor equiseti. However, the morphological

characteristics of the isolates did not match M. equiseti, and required detailed microscopic and

chemical analyses to elucidate the identity of the isolates.

While ten isolates exhibited the ability to inhibit pathogenic fungal growth, the viability test

showed only isolate L3R3a and L5R1c to have the potential to be developed further as

biological control agents. Both of them remained viable and were capable of controlling G.

boninense, after storage on barley and rice grain for more than 12 months. Further studies on

both isolates, especially on their microscopic and chemical characteristics are required to

reveal their identity before they can be optimized for field trials.

46

CHAPTER 3

Novel Endophytic Fungi from Borneo, Sarawak, Malaysia

3.1 Introduction

Studies on endophytic fungi have intensified, after the discovery of paclitaxel (taxol) produced

by Pestalotiopsis microspore, which was isolated from the yew tree in Himalaya (Strobel et al.,

1996). In addition, the discovery of their potential in producing antibacterial, antiviral,

anticancer, antioxidant, antidiabetic, immunosuppressive, and bioremediation compounds

have attracted many researchers to investigate these microorganisms (Othman et al., 2008;

Dompeipen et al., 2011; Hazalin et al., 2009; 2012; Liang et al., 2012 and Russell et al., 2011).

The relationship between endophytic fungi and plants is commonly described as

communalistic (Saikkonen et al., 1998 and Sturz & Nowak 2000) and mutualistic, especially for

the endophytes that colonize the root area (Bai et al., 2002). The production of secondary

metabolites that trigger the plant defences system is the symbiotic rewards of endophytic

fungi towards the host plant (Picard et al., 2000 and Benhamau & Garand, 2001). The host

plant provides the glucose as a carbon source to support the growth of endophytic fungi

(Schulz et al., 1999; Arnold & Herre, 2003 and Mucciarelli et al., 2003). Outcomes from this

relationship allow the plants to grow in stressed conditions as well as to protect the plant from

invasion by pathogens. Their occurrence in the world is estimated to be about 1.3 million and

most of them are from the class of Ascomycete and with fewer being Basidiomycetes (Dreyfuss

& Chappela, 1994).

Strobel et al., (2001); (2003) claimed that each individual plant may host at least one but often

many endophytes. This fact might change the estimated total number of fungi of 1.5 million

drastically (Hawksworth, 2001). The total estimated number of plant species present in the

world is approximately 300,000 (Strobel et al., 2002). In Panama, 418 morphospecies of

endophytic fungi were isolated from the leaf of just one plant (Arnold et al., 2001). Firakova et

al., (2007) and Arnold et al., (2000) found that plants in high density and diversity forests in

tropical and subtropical regions possess a higher number and variety of endophytic fungi and

bacteria. Borneo is ranked as the sixth megabiodiversity region in the world and is predicted to

47

harbour a hyperdiversity of endophytic fungi. This also means there is a high potential of

finding new natural bioactive products.

In Sarawak, very few studies on endophytic fungi have been conducted and were mostly

focused on their bioactivity such as antibacterial and anticancer compounds (Jeffrey et al.,

2008). Muscodor is among the group of endophytic fungi that is interesting to be investigated

as they have the ability to produce volatile chemicals capable of controlling a wide range of

fungi, bacteria and certain insects. This group of endophytic fungi was found to grow in

numerous types of plants worldwide and was first discovered in Honduras and allocated as a

new genus. In total, Muscodor comprises nine species; M. albus, M. roseus, M. vitigenus, M.

yucatanensis, M. crispans, M. sutura, M. cinnanoni, M. fengyangensis and M. strobelli which

were isolated from trees growing in Honduras, Australia, Peru, Mexico, America, China and

India, respectively (Worapong et al., 2001; 2002; Daisy et al., 2002; Gonzalez et al., 2009 and

Kudalkar et al., 2011). However, recent reports on the discovery of four new species of

Muscodor in Northern Thailand namely; M. musae, M. oryzae, M. suthepensis and M. equiseti

shows the trend of Muscodor’s host is diverting to non-woody trees (Suwannarach et al.,

2013). Three out of four new species found in Thailand were isolated from the vascular plants;

Musa acuminate (banana), Oryza rufipogon (paddy) and Equisetum debile (greges otot). All

members under this genus possess similar characteristics and are capable of producing volatile

chemicals, and also are lacking the teleomorph stage. These characteristics are widely used as

preliminary identification of a Muscodor. Prior to this study, there are no published reports on

Muscodor isolated from Sarawak.

As described in Chapter 2, two endophytic fungi, L3R3a and L5R1c, have the potential to be

developed as biological control agents against Ganoderma boninense. The endophytes were

successfully isolated from Cinnamomum javanicum, which was collected at Padawan Forest,

Kuching, Sarawak. In this chapter, the aim is to describe the species of L3R3a and L5R1c based

on their morphological structures, molecular characteristics, and the chemical composition of

the volatile products. Our hypothesis is that L3R3a and L5R1c possess characteristics distinct

from existing members in the Muscodor group.

48

In this chapter, the characteristics of L3R3a and L5R1c will be described in a taxonomical

format to support the establishment of both isolates as novel species with the proposed name

of Muscodor padawan and Muscodor sarawak, respectively.

3.2 Materials and Methods

3.2.1 Morphological Identification

The morphological characteristic of the isolates were examined in detail using the scanning

electron microscope (SEM). The study was performed at the Institute of Bioscience, University

Putra Malaysia (UPM), Serdang, Selangor, Malaysia. As the samples are living organism and

isolated from natural resources in Sarawak, four permits were required to bring the samples

from Sarawak to Selangor. The permits were obtained from Sarawak Biodiversity Centre (SBC),

Sarawak Forest Department (SFD), Agriculture Department Kuala Lumpur and Department of

Agriculture, Plant Protection and Quarantine Services Kuching, Sarawak. Preparation of the

fungi samples was adapted and modified from procedures used in Malone & Ashworth, (1991)

as follows:

1. Primary Fixation

In the fume hood, agar blocks containing the mycelia were cut into 1 cm2 squares using a

sterile blade. Agar blocks (3-5) were transferred into a vial that was labelled with the

corresponding sample number. Glutaraldehyde (4%) was pipetted into the vial using a

disposable pipette until the samples were fully covered. Vials were capped and stored at 40C

for 4 hours

2. Preliminary Washing

After 4 hours at 40C, the 4% glutaraldehyde solution was discarded. Using a new disposable

pipette, 0.1M sodium cacodylate was added into the vials until the samples were fully covered.

The vials were stored at room temperature inside the fume hood for 10 minutes. The 0.1M

sodium cacodylate solution was removed from the vials and pipetted into a waste bottle. The

washing steps were repeated twice.

49

3. Post Fixation

Osmium tetroxide (1%) was pipetted into the vials until the samples were fully covered. The

vials were kept for 2 hours at 40C.

4. Washing

After 4 hours at 40C, the 1% osmium tetroxide solution was discarded and 0.1M sodium

cacodylate was added into the vials until the samples were fully covered. The vials were stored

at room temperature inside the fume hood for 10 minutes. The 0.1M sodium cacodylate

solution was removed from the vials and pipetted into a waste bottle. The washing steps were

repeated twice.

5. Dehydration

Ethanol (20%) was added into the vials until the sample was fully covered, and the vial was left

to stand for 10 minutes inside a fume hood. The 20% ethanol solution was discarded and the

process was repeated in 10% increments of ethanol concentration, until 100%. After the last

step with 100% ethanol, acetone was added into the vials until the samples were fully covered.

This was left to stand for 15 minutes. The acetone solution was discarded from the vials and

the acetone wash step was then repeated.

6. Critical Point Drying

The specimen was transferred into a basket. Each basket with 1cm diameter was capable of

containing up to two blocks while a 3 cm diameter basket can contain up to 5 blocks. During

the transfer, the blocks were soaked in 70% ethanol to maintain the fixed structure of the

mycelia. The basket was capped tightly and placed into the critical point drying (Baltec-CPD-

030) machine for 45 mins. During this process, the samples were flushed with liquid carbon

dioxide thrice, to fix the mycelia structure.

7. Mounting

Each block was stuck onto the stub using double sided tapes. The mycelia area was arranged

upwards, for visualization under SEM.

50

8. Coating

The stubs with the dry mycelia block stuck on the top was loaded into the sputter coater,

baltec SCD 005 machine to coat the sample with gold.

9. SEM Viewing

The coated stubs were placed inside the SEM machine. The structures were visualized from

low magnification up to 15,000 magnifications. The JOEL-JSM 6400 Scanning Microscope was

used to visualize the overlapping hyphae.

3.2.2 Analyses of the Chemical Composition in Volatile Chemicals Produced by L3R3a and L5R1c

Prior to the analyses of volatile contents, isolate L3R3a and L5R1c were inoculated individually

on PDA agar slants in 15ml vial. The inoculated and un-inoculated vials (control) contained

similar amounts of PDA media and were incubated at 250C for 10 days prior to analyses.

The Volatile chemicals produced by 10-day-old tested isolates was analysed using HeadSpace

Solid Phase Micro Extraction Gas Chromatography/ Mass Spectrograph (HS-SPME-GC-MS) as

described by Griffin et al., (2010). Syringe (Supelco) consisting of 50/30

divinylbenzene/carburen on polydimethylsiloxane on a stable flex fiber was preconditioned at

2400C for 20 minutes under a flow of helium gas using CTC CombiPAL autosampler. In order to

trap the volatiles produced in the headspace above the sample or media, the syringe was

injected at 22mm into the vial and the fibre was exposed to the headspace above the sample

for 35 minutes without agitation. After exposure, the syringe was then inserted into the split-

/splitless injection port of the gas chromatograph (Hewlett Packard 6890) for 2 minutes and

the fibre was exposed to HP5-MS column, 30m x 0.25 mm I.D. ZB Wax capillary column with a

film thickness of 0.25 um (Agilent Inc., Santa Clara, US) to separate the volatiles.

The column was programmed at 400C for 2 minutes and followed with 1000C at 70C/min and

further held for 5 minutes with a constant flow rate of 1.0mL/min purified Helium gas, 99.99%

purity (Eastern Oxygen). Electron impact (IE) spectra were obtained from electron impact

ionization at 70eV (source temperature 2400C, quadrupole 1500C) and data were collected

over the mass range of 30-300 atomic mass unit (amu).

51

Data acquisition and data processing was performed on the MSD Chemstation E.02:01.1177

(Agilent Inc. Little, Falls, U.S) software system. The mass spectra of chromatographic peaks of

samples were compared with the NIST 08 and Wiley 8n database (Griffin et al., 2010).

Comparative analyses were conducted by subtracting the compound produced on

uninoculated vials (control) containing PDA media and the compounds produced by test

samples in vial containing isolates grown on the same media.

3.3 Results and Discussion

In this study, a 10-day-old isolate was used to evaluate morphological structures of each

species in PDA media. The comparison of morphological characteristic between isolate L3R3a

and L5R1c with existing members in Muscodor was performed.

The presences of septate hyphal indicate that these isolates came under the class of

Ascomycete or Basidiomycete (Corner, 1932; Pegler, 1973; Roy & De, 1996 and Watkinson et

al., 2005). However, the absence of clamp connection structures (structures that differentiate

between Ascomycete and Basidiomycete) and hyphal accessories classifies them under the

class of Ascomycete (Dix & Webster, 1995). The asexual stage is unknown owing to the

absence of fruiting bodies or spore structures, suggesting that these isolates can be classified

under Deuteromycetes (Dix & Webster, 1995). Based on a newly described genus by

Worapong et al., (2001), these isolates fulfil the basic criterion of the Muscodor group;

produces distinct smell (odour), slow grower <5 cm diameter in 10 days, light colony colour

(white to pinkish), hyphal ≤2.5um diameter and non-sporulation. Using morphological and

molecular data, these isolates can be classified as members of the Ascomycete, Muscodor

genus. Production of volatile chemicals that are capable of inhibiting or killing pathogenic fungi

is characteristic of Muscodor fungi and this characteristic is also present in these isolates

(Worapong et al., 2001; 2002; Daisy et al., 2002; Gonzalez et al., 2009; Mitchell et al., 2010 and

Kudalkar et al., 2011). The Internal Transcribed Spacer (ITS) sequences also supported the

conclusion that these isolates are members of Muscodor. Their homolog value when compared

to Muscodor was over 94% which met the standard parameter of genus determination as

suggested by Keswani et al., (2001).

52

Detailed observations on the morphological structure via scanning electron microscope (SEM),

DNA arrangement (phylogenetic tree and multiple sequence alignment) and major volatile

compounds produced by these isolates vary largely. Phylogenetic studies and multiple

sequence alignment also showed that the isolates did not group together in the same cluster

with the existing members in Muscodor as discussed at Chapter 2. The major compound

produced by 10-day-old isolates L3R3a and L5R1c also supports the recommendation that the

isolates are novel. In existing members in Muscodor, the major compound produced showed

high similarity (more than 90%) to chemical profiles in NIST database and the compound was

identified according to search results with NIST database. However, in this study, the major

compounds produced by test isolates showed low similarity to NIST database which was in the

range 74-78%. The major compound produced by isolate L3R3a, Bicyclo [3.3.1] nona-2,6-diene

chemical profile had a low similarity with existing chemical profiles in NIST database (Table 9).

It is suggested that the compound produced by this isolate L3R3a is new to the existing

chemical profile in NIST database and it should be noted that the compound is different from

the existing major compound produced by members of Muscodor. Similar to L5R1c, (-) delta-

panasinsine which is the major compound in the volatiles produced by this isolate only showed

78% similarity to the NIST database (Table 10). This also supports the recommendation that

the isolates are novel as no other members in Muscodor produced these compounds as the

major compound at the specific retention times. Detailed descriptions of the isolates are

presented below.

53

Table 9: GC/MS analysis of the volatile compounds produced by a 10-day-old culture L3R3a RT (min) Area (%) Possible Compound Quality

14.8644 18.415 Bicyclo[3.3.1]nona-2,6-diene 74

9.2155 11.1736 3-Octanone 96

3.7327 3.221 1-Butanol, 3-methyl- 90

22.4136 1.9122 1H-Cycloprop[e]azulene, 90

decahydro-1,1,7-trimethyl-4-methylene-,

[1aR-(1a.alpha.,4a.alpha.,7.alpha.,

7a.beta.,7b.alpha.)]-

15.1448 1.6443 Cyclopropanecarboxylic acid, 83

2-phenylethyl ester

12.1127 1.514 Phenylethyl Alcohol 93

RT, retention time in minutes

Table 10: GC/MS analysis of the volatile compounds produced by a 10-day-old culture L5R1c

RT (min) Area (%) Possible Compound Quality

17.7306 12.6611 (-)-delta.-Panasinsine 78

3.0371 3.9967 Propanoic acid, 2-methyl-, methyl ester 91

1.7599 3.0864 Cyclobutanol 39

22.4138 2.8512 1H-Cycloprop[e]azulene, 92

decahydro-1,1,7-trimethyl-4-methylene-,

[1aR-(1a.alpha.,4a.alpha.,7.alpha.,

7a.beta.,7b.alpha.)]-

1.573 2.5044 Ethyne, fluoro- 5

RT, retention time in minutes

54

(a) Isolate L3R3a

Muscodor padawan Mahidi, Mueller, Yeo, Kuek and Nissom sp. nov. (Fig. 18)

Fungal Taxonomy

Fungus in nature is associated with the plant from Lauraceae, Cinnamomum javanicum as

shown in Figure 18. Fungal colonies exhibit cream mycelia when exposed to direct light or

placed in the dark, are occasionally yellowish to brackish after repeated sub culturing on rich

media such as PDA, cream at reverse, mycelia growing in a circular shape and initially form

radial then rhizomorph lines, slowly growing to 20-28 mm diameter in 10 days incubation at

25°C with poor production of aerial mycelia, moderate production of vegetative mycelia,

produces a sweet fruit odour at 5 days. Hyphae hyaline, smooth, septate, 1-3 um diameter,

thick walled, branched, clump rope-like strands, overlapping hyphal form well shape, spider

mat attached on hyphal (Figure 20). Fruiting body or spore structures were absent,

chlamydospore present. Exudate produced after 20 days of incubation at 25°C on PDA media,

pigment colour absent.

Holotype

Endophytic on Cinnamomum javanicum. Collections were made at Padawan forest which is

located at 20 km from Kuching City, Sarawak, Malaysia. The holotype came from one of the

Cinnamomum species trees collected in February, 2010 by Noreha Mahidi. A living culture was

deposited as Muscodor padawan in the SBC Fungi Collection as acquisition-L3R3a. ITS

sequence of M. padawan have been submitted to GenBank with the assigned serial number

SBC102010

Telomorph

Unknown

Etymology

The genus name, Muscodor, is taken from the Latin word which means musty (Worapong et

al., 2001). This is consistent with the quality of the odour produced by the first twelve isolates

of the genus. The species epithet is- Padawan, named after the collection site of the

Cinnamomum javanicum host.

55

Molecular Biology of Muscodor padawan

Comparison with the existing sequences in the GenBank databasen, the sequencing of the ITS-

5.8S ribosomal gene, (563 bp) showed that M. padawan was 96% similar to Muscodor

yucatanensis, FJ917287.1, Muscodor sp., KF229762.1 and Muscodor sp., KF229758.

Phylogenetic analysis showed that this fungus shared a common ancestor with M. strobelli and

M. yucatanensis but grouped with a different cluster (Figure 17 at Chapter 2).

Fungal Biology

The fungus produced a cream mycelium on agar based media either exposed to direct light or

placed in the dark. Occasionally it exhibits yellow to brick mycelium after repeated sub-

culturing on rich media (e.g PDA, Difco), twigs and leaves of Cinnamomum javanicum. Cream

at reverse and produces moderate production of vegetative mycelium. This fungus was slow

growing with a size of 20-28 mm diameter in 10 days incubation at 25°C. In comparison, M.

albus takes 21-28 days to reach 90 mm colony diameter (Worapong et al., 2001). Production of

aerial mycelium was poor and produced a sweet odour at 5 days. Hyphal were hyaline, smooth

and occasionally rough, septate, 1-3 µm diameter, thick walled, generative to arboriform

branched, occasionally clump rope-like strands, overlap hyphal form a well shape, spider mat

attached on hyphal (Figure 20). No coiled hyphal were observed in this fungus as found in M.

vitigenus (Daisy et al., 2001). All attempts to obtain fruiting body of this fungus were

unsuccessful, including exposure with UV light, near to blue light, growth on poor substrate

such as water agar, corn meal agar (CMA, Oxoid), or natural media containing C. javanicum

twigs and leaves.

Non-sporulation fungus is one of the characteristics of the genus of Muscodor (Worapong et

al., 2001; 2002; Daisy et. al., 2002; Kudalkar et al., 2011 and Mitchell et. al., 2010). However

unusually in this fungus there were chlamydospore observed (Worapong et al., 2001; 2002;

Daisy et. al., 2002; Kudalkar et al., 2011 and Mitchell et. al., 2010). A hyaline exudate was

produced after 20 days incubation at 25°C on PDA media but there was no pigment produced

either by young or older cultures. This fungus retained viability for 6 months on PDA slant in a

universal bottle and distilled water under storage conditions between 250C and 40C. This

fungus has a prolonged shelf life of up to 3 years when cultured on barley, rice grain, twigs and

leaves of C. javanicum and stored at 40C. The morphology characteristics alone were unable to

distinguish and compare the fungus from existing members in the genus of Muscodor.

56

Therefore, studies on molecular characteristics and chemical compositions in the VOC

produced by this fungus were also performed to compare this fungus with other members in

Muscodor.

The sweet fruity odour of the cultures became apparent after 5 days of incubation at 250C and

became concentrated as the mycelia spread across the entire plate. After one month of

incubation, no growth was detected and the odour diminished. This may occur as a response

to depleted nutrients in the media. A study on the chemical composition in the VOC produced

by a 10-day-isolate of this fungus was performed. HeadSpace Solid Phase Micro Extraction Gas

Chromatography/ Mass Spectrograph (HS-SPME-GC-MS) was used to analyse the compound

and the mass spectrum and retention times of the compound were compared with the NIST

database. Bicyclo [3.3.1] nona-2,6-diene was detected as a major compound in the range of

18.42% at retention time 14.86 mins, followed by 3-Octanone and 1-Butanol, 3-methyl- with a

covering area of 11.17% and 3.22%, respectively. However, the peak quality of Bicyclo [3.3.1]

nona-2, 6-diene was less than 90% (Table 7). The VOC produced by this fungus was capable of

killing Ganoderma boninense, Phytophthora capsici and Rhizoctonia solani, which are soil

borne fungi that causes diseases in oil palm, pepper and vegetables, respectively

Strain Deposited at:

(i) Swinburne University of Technology Sarawak (SUTS) with reference number L3R3a

(ii) Sarawak Biodiversity Centre (SBC) with reference number L3R3a

57

Figure 18: Host of L3R3a, Cinnamomum javanicum (L05). This plant was sourced at Padawan.

58

Figure 19: Mycelial characteristics of L3R3a. (a) A 10-day-old L3R3a in 90cm Petri Dish contained PDA media (b) The reverse appearance of 10-day-old L3R3a (c) A 30-day-old L3R3a (d) Reverse appearance of 30-day-old L3R3a

59

Figure 20: Micro-morphological structures of L3R3a visualised using scanning electron microsope (SEM): (a) Formed coiled-like hyphal (b) Spider-mat-like attached on the surface of hyphal (c) Chlamydospores formed in the intermediate hyphal (d) A clump of hyphal occasionally present.

(b) Isolate L5R1c

Muscodor sarawak Mahidi, Mueller, Yeo, Kuek and Nissom sp. nov.

Fungal Taxonomy

Fungus in nature is associated with the plant from Lauraceae family, Cinnamomum javanicum.

Fungal colonies exhibit white mycelia in all media, reverse is white, concentric lines, rounded

to irregular shape, slow growing at 23-30 mm diameter in 10 days (Figure 21) incubation at

250C, moderate production of aerial and vegetative mycelium. After 20 days of incubation at

250C the mature mycelium began to turn black and was completely black after 60 days.

Hyphae hyaline, branched, 1-2um diameter, thick-walled, smooth to rough, coiled at tip, rope-

like strands, two hyphae connecting to form a bridge, which was similar to typical Zygomycete

structures (Figure 22). Fruiting body was absent. Exudate produced after 20 days of incubation

at 25°C on PDA, Difco media, and pigment colour absent.

60

Holotype

Endophytic on Cinnamomum javanicum. Collections were made at Padawan forest which is

located 20 km from Kuching City, Sarawak, Malaysia. The holotype came from one of

Cinnamomum javanicum trees collected in February, 2010 by Noreha Mahidi. A living culture

was deposited as Muscodor sarawak in the SBC Fungi Collection as acquisition-L5R1c. ITS

sequence of M. sarawak have been submitted to GenBank with the assigned serial number

SBC112010

Telomorph

Unknown

Etymology

The genus name, Muscodor, is taken from the Latin word which means musty (Worapong et

al., 2001). This is consistent with the quality of the odour produced by the first eight isolates of

the genus. The species epithet is- Sarawak, named after the state of Sarawak, where the plant

sample was collected.

Molecular Biology of Muscodor sarawak

Comparison with the existing sequences in the GenBank database, the sequence of the ITS-

5.8S ribosomal gene, (563 bp) showed that fungus was 99% maximum identity to Muscodor

equiseti, Muscodor sp. RTM5-IV2, KF850711 and Fungal ARIZ B342, FJ612989. Phylogenetic

analysis showed this fungus was grouped in the same cluster with M. vitigenus, M. sutura and

M. equiseti.

Fungal Biology

The fungus produced a white mycelium on all media included plant based which mimicked the

characteristics of M. albus (Worapong et al., 2001). This fungus became black completely after

60 days. The reverse was white and then became cream and lastly black after 60 days of

incubation. This fungus also displayed similar characteristics as members of Muscodor which is

slow growing with 23-30 mm colony diameter in 10 days incubation at 250C (Worapong et al.,

2001; 2002; Daisy et al., 2002; Kudalkar et al., 2011 and Mitchell et al., 2010). Production of

aerial and vegetative mycelia was moderate. Mycelium was circular and irregular in shape and

formed concentric lines mimicking colony characteristic of Phomopsis spp. Hyphal were

61

hyaline, smooth to rough, septate, 1-2 µm diameter, thick walled, generative to arboriform

branched. This fungus also formed coiled hyphal at the tip but not as complete as found in M.

vitigenus (Daisy et al., 2001). Fruiting body and spores stage was unknown. All attempts at

obtaining fruiting bodies failed, including growing this fungus on twigs and leaves of C.

javanicum. In traditional fungus classification, any fungus which lacks asexual stage was placed

under Deuteromycete. Therefore in the genus of Muscodor , the members were placed under

the family of Ascomycetes as their morphological and molecular characteristics was similar to

characteristic of Ascomycetes, even though this fungus did not produced spores but hyphae to

hyphae connection was similar with Zygomete group. The two different lateral hyphal were

growing toward one another and form aseptate hyphal as contact to diffuse any materials

from each other. This two hyphal did not form thick-walled septate progametangia as end

product from sexual stage in Zygomete. The rest spore structure, chlamydospore (one or two

sections) was also observed in this fungus but no report on occurrence of this structure in

other members of Muscodor (Worapong et al., 2001; 2002; Daisy et. al., 2002; Kudalkar et al.,

2011 and Mitchell et. al., 2010). A hyaline exudate was produced after 20 days incubation at

25°C on PDA, Difco media but there was no pigment even in older cultures. This fungus

retained viability for 6 months on PDA slant in universal (McCartney) bottle and distilled water

under storage conditions 250C and 40C. Their shelf life could be prolonged up to 3 years when

cultured on barley, rice grain, twigs and leaves of C. javanicum and stored at 40C. This isolate

was capable of withstanding the presence of VOC produced by M. albus and non-sporulation

was preliminary characteristic in classifying this fungus under the group of Muscodor.

Therefore detailed morphology characteristics were used to distinguish and compare the

fungus from existing members in genus of Muscodor. Studies on molecular characteristics and

chemical composition in the VOC produced by this fungus were also performed to compare

this fungus with other members in Muscodor.

The musty odour of the cultures became apparent after 3 days of incubation at 250C and

became concentrated as the mycelia spread across the entire plate. After a month of

incubation, almost no growth was detected and the odour diminished. This may occur as a

response to depleted nutrients in the media. The chemical composition in the VOC produced

by a 10-day-old isolate was analysed using Headspace Solid Phase Micro-extraction Gas

Chromatography/Mass Spectrograph (HS-SPME-GC/MS). The mass spectrum and the retention

times of each compound detected were compared with existing compounds in NIST database.

62

The major compound produced by this fungus was (-) delta-Panasinsine with a coverage area

of 12.66% at retention time 17.73 minutes. However, the similarity of the peak with existing

peak or chemical profile in NIST database was 78%, lower than 91%. The second major

compound produced with 91% similarity to the chemical profile in NIST database was

Propanoic acid, 2-methyl, methyl ester with coverage area of 4% at retention time 3.04

minutes. The third highest coverage area (3.09%) in volatiles produces by this fungus was

Cyclobutanol at retention time 1.76 minutes but the similarity towards the chemical profile in

NIST database was only 39%. In total, the volatile chemicals produces by a 10 days old isolate

of strain comprised 5 different compounds. The volatiles produces by this fungus showed

antifungal activities towards soil borne fungi, G. boninense, a pathogenic fungus that causes

basal stem rot disease in oil palm.

Strain Deposited at:

(i) Swinburne University of Technology Sarawak (SUTS) with reference number L5R1c

(ii) Sarawak Biodiversity Centre (SBC) with reference number L5R1c

Figure 21: Mycelial characteristics of L5R1c. (a) A 10-day-old L5R1c in 90cm Petri Dish contained PDA media (b) The reverse appearance of 10-day-old L5R1c (c) A 30-day-old L5R1c (d) The reverse appearance of 30-day-old L5R1c

a b

c d

63

Figure 22: Micro-morphological structures of L5R1c visualised using scanning electron microscope (SEM): (a) Formation of new hyphal at lateral main hyphae (b) Chlamydospores formed in the intermediate hyphal (c) Half-coiled hyphal at the tip (d) A strip of hyphal attached by lateral hyphal that formed short bridge-like structure

3.4 Conclusion

The ability of L3R3a and L5R1c isolates to withstand the presence of volatile chemicals

produced by the standard strain, Muscodor albus, suggests that both of the isolates are

members of the Muscodor genus. Further study on their colony morphology has shown that

these isolates almost mimicked the Muscodor group with the characteristics of; slow growth

(takes 4-6 weeks to cover the 90mm media surface) and low production of aerial mycelium.

Absence of intertwining hyphal, lacking of right-angle branching position from lateral hyphal

differentiate the two isolates from other members of Muscodor as those characteristics were

common in members of Muscodor. Occasionally the presence of chlamydospores was also

characteristic of these two strains which were not reported in any of the existing members of

Muscodor.

64

In the molecular study, comparative sequence analysis of ITS sequence with the GenBank

database also showed these fungi were identical to Muscodor spp. with similarities ranging

between 96-99% with Muscodor equiseti. Study on the chemical composition of volatiles

produced by 10-day-old isolates showed that the major compound produced by those two

isolates were new, as the similarity of the compounds to existing chemicals profile in the NIST

database was below 80%. The major compounds produced by the isolates were also different

from the major compound produced by existing members of Muscodor group. The distinct

taxonomy, molecular characteristic and volatile chemical profiles produced by both isolates

suggest that L3R3a and L5R1c are novel species with the proposed name of Muscodor

padawan and Muscodor sarawak, respectively. Further studies on the analysis and elucidation

of the chemical profile of the major compound in the volatiles produced by those isolates

needs to be further investigated. The possibility to obtain novel compound from these new

isolates is promising based on the results from NIST database and also the differences in their

morphology and DNA sequences as compared with other species in Muscodor.

Muscodor padawan and Muscodor sarawak are proposed to be novel species with the

potential to become biological control agents against Ganoderma boninense. Further studies

on their capacity to control G. boninense under different conditions are important to sustain

and optimize their capabilities and will be discussed in Chapter 4.

65

Chapter 4

Effect of Physicochemical Conditions on the Efficiency of Muscodor sarawak and

Muscodor padawan as Biological Control Agents of Ganoderma boninense

4.1 Introduction

Ganoderma boninense is a soil-borne fungus that causes the destructive Basal Stem Rot (BSR)

disease of oil palm, affecting plantation especially in Malaysia and Indonesia (Singh, 1991;

Flood et al., 2000; Idris et al., 2009; Susanto, 2009 and Susanto & Huan, 2010). The success of

this fungus as a pathogen to oil palm is due to its ability to survive and reproduce in stressful

conditions such as acidic soil, inconsistent weather, and nutritional imbalance, especially in

peat soil, which contains low potassium (Gourmit et al. 1987 and Hasnol et al., 2007). In order

to establish an effective biological control agent (BCA) to control the growth of G. boninense,

the BCA has to have similar capability as G. boninense, which is to survive and reproduce under

stress.

Reflecting on field situations, Nelson et al., (2011) and Ng et al., (2011) reported that the soil

pH in oil palm plantations especially in re-planted areas is acidic compared to new plantation

areas as fertilizers were repeatedly applied to the soil. An estimated 2.5 million hectares of

land bank in Malaysia is peat land and 33.9% of the peat land which is slightly acidic has been

devoted to planting oil palm (Miettinen et al., 2012). In order to develop an effective BCA

against G. boninense, the tested strains must be capable of growing in a wide range of pH,

especially the acidic soil of most of the land in Malaysia (Akbar et al., 2010).

On the basis of Muscodor features, different species show different optimum condition for the

growth and bio-activity against plant pathogens (Strobel et al., 2001; 2003). Studies done by

Gabler et al. (2006) and Lacey et al., (2008), showed that the efficacy of the biofumigant

fungus, Muscodor albus, to control pathogenic fungi and insects was affected by

physicochemical conditions such temperature. Muscodor albus was found to be an effective

BCA in controlling pathogenic fungi and insects at 200C and 240C, respectively. Nutrients are

also another physiochemical factor that affect the performance of BCA. Ezra and Strobel,

66

(2003) and Wheatley et al., (1996) have reported that the composition of the media greatly

influenced the number and type of chemicals in the volatile chemicals released by the fungi, as

well as their effectiveness in killing and inhibiting the pathogens. Muscodor albus performed

the best in media that was rich in sucrose.

Two VOC producing endophytic fungi, Muscodor padawan and Muscodor sarawak have been

isolated from Cinnamomum javanicum. The two isolates produced anti-Ganoderma volatile

chemicals and were revealed, in this study, to have the potential to act as biological control

agents (BCA) against G. boninense. Their capabilities to grow and produce anti-Ganoderma

volatile chemicals in different cultural media and environmental parameters have not been

studied as these two isolates were suggested as novel strains. One of the objectives of this

thesis is to develop the isolate M. padawan and M. sarawak as biological control agent against

G. boninense. The aim of this chapter is to determine the influences of media and

environmental parameters on the growth and VOC production, so as to enable optimization of

the growth and culture conditions for the two test isolates.

4.2 Materials and Methods

Four parameters that were examined in this study were temperature; pH, media, and the age

of inoculum. The experiments were performed as described below:

4.2.1 Effect of Inoculum Age

Muscodor padawan (L3R3a) and Muscodor Sarawak (L5R1c) are slow growing fungi and in

order to obtained sufficient inoculum for testing, both isolates were cultured on PDA at 250C

for up to 10 days prior. An agar plug (7mm diameter) was cut from each isolate and inoculated

on the middle of a 90mm petri dish containing PDA media. The inoculated plates were

incubated at 250C for 0 until 10 days in triplicates for each examined day (age of inoculum).

After incubation on the target days, the plate was exposed to G. boninense using a double

plate assay procedure as described in Chapter 2, Section 2.2.5b. As a control plate, a plate of G.

boninense was inverted over the plate with uncultured PDA media. The purpose of inverting G.

boninense over the test isolate was to confirm that only the volatile chemicals present in the

plate environment retarded the growth or killed the G. boninense. The plates were sealed with

67

double layers of parafilm to minimize the escape of volatile chemicals produced by tested

isolates. The plates were then incubated at 250C for 5 days. After 5 days exposure to the test

isolate, the Percentage Inhibition of Radial Growth (PIRG) of G. boninense was measured (see

Chapter 2 section 2.2.5). The inoculum age of the tested isolate that showed effectiveness in

controlling the growth of G. boninense was selected as the standard age for further studies.

4.2.2 Effect of Culture Media

The media: (a) Potato Dextrose Agar (PDA) (b) Corn Meal Agar (CMA) (c) Malt Extract Agar

(MEA) (d) Oat Extract Agar (OEA) were selected based on their composition and their effect

towards production of secondary metabolite (Wang & Zabel, 1990). The experiment was

performed similarly as an experiment of effect of inoculum age section (a) above. The best

media that supported the effectiveness of the test isolate against G. boninense was selected as

standard media.

4.2.3 Effect of Temperature

Three temperatures: 250C, 300C, 350C were selected for use in this study. An inoculum of the

test isolates was first grown on PDA at 250C for 10 days and this culture was used as an

inoculum source for this study. An agar plug was cut from the 10 days old culture and

inoculated on the middle of a new PDA plate. The inoculated plates with test isolates was

incubated at 250C, 300C and 350C for 5 days prior before being exposed with G. boninense as

described in section (a). Ganoderma boninense that was exposed to uncultured PDA media

was used as a control. The effective temperature for the test isolate to produce volatile

chemicals that can kill the G. boninense was used as a standard temperature for the test

isolates.

4.2.4 Effect of pH

In this study, a range of pH: 5, 5.6, 7 and 9 was selected. However, the main target in this study

was for acidic conditions as most soils in Malaysia are slightly acidic (Nelson et al., 2011 and Ng

et al., 2011). The lowest pH we could use was 5, because the agar would not set at higher

acidities. PDA media was used as standard media with an adjustment on the pH. The test

isolate was inoculated on the middle of the plate and incubated at 250C for 5 days prior to

being exposed together with G. boninense as described in section (a) above.

68

4.3 Results and Discussion

Four parameters (temperature, pH, media and age of inoculum) have been reported to affect

the efficiency of the Muscodor group in controlling test pathogens (Strobel et al., 2001; 2003;

Ezra & Strobel, 2003 and Lacey et al., 2008). Based on these reports, the efficiencies of test

strains Muscodor padawan and Muscodor sarawak might also be affected by age of inoculum,

media, temperature and pH. With reference to the data from studies conducted on other

members of Muscodor, this study examined the optimum condition for the test strains. The

experiments were designed according to protocols used by Gomori (1955), Xiao & Sitton

(2004), Ezra & Strobel, (2003) and Mathan et al., (2013) with the purpose of comparing the

optimized conditions with existing members in Muscodor. In addition, this study was also

performed to examine if the ability of the test fungi to produce anti-Ganoderma volatile

chemicals is dependent on, or associated with culturing conditions and/or environmental

parameters.

Since the target of the study was to develop effective biological control agents (BCA) against

pathogens that caused basal stem rot (BSR) disease, G. boninense was selected as the standard

pathogen. The efficiency of the test isolates was observed by measuring the growth rate of G.

boninense after exposure to volatile chemicals produced by test isolates under different

conditions using a dual plate assay system (Wheatley et al., 1997).

4.3.1 Anti-Ganoderma Volatile Chemicals Produced in All Stages of Growth of the Test

Strains

In this study, test isolates; M. padawan and M. sarawak with ages of 0 up to 10 days old were

used to evaluate their efficiency in controlling G. boninense. The age of test strains partially

influences their capacity to inhibit the growth of G. boninense (Figure 23). Muscodor padawan

and Muscodor sarawak, as early as 0 days old, have the capacity to inhibit the growth of G.

boninense with 73% and 79.75% inhibition, respectively (Figure 23). Muscodor padawan and

Muscodor sarawak show differences in their capacity to inhibit the growth of G. boninense

with increasing age. Ganoderma boninense was inhibited after exposure to 1, 3 and 4-day-old

cultures of M. sarawak. However, volatile chemicals produced by 2, 5, and up to 10-day-old

69

cultures of M. sarawak caused 100% inhibition in the growth rate of G. boninense as compared

with the growth rate of G. boninense in the control plate.

In contrast, M. padawan, at the earlier stages between the ages of 0 up to 6 days old, was only

able to inhibit the growth rate of G. boninense in the range of 79% to 96% inhibition, as

compared with the control plates (Figure 23). At 7 to 10 days old, M. padawan started to kill

the G. boninense with a PIRG value of 100%. This suggests that volatile chemicals produced by

M. sarawak at the early ages (day 0 to day 4) are different from the volatile chemicals

produced in day 5 up to day 10 as the PIRG value in these two stages differ. Similarly with M.

padawan, the age of inoculum used in this study showed differences in their capability to

inhibit the G. boninense at an early stage (day 0 up to day 6) and the late stages (day 7 to day

10). This suggests that the effective age of inoculum for controlling G. boninense for M.

padawan and M. sarawak was 5 to 10 days olds and 7 to 10 days, respectively. This result also

concluded that the types and chemicals composition in the volatiles produced by different age

of inoculum might vary with age.

70

Figure 23: Percentage inhibition of radial growth on G. boninense after exposed to volatile chemical produced by various age of Muscodor padawan (MP) and Muscodor Sarawak (MS). Each value is the mean PIRG ± Standard Error (N=3) from each tested age of each tested strain according to One-Way ANOVA with Tukey’s HSD test (P<0.05)

4.3.2 Media Composition Affects Efficiency of Muscodor padawan, but not Muscodor

sarawak, in Producing Anti-Ganoderma Volatile Chemicals

Previous reports showed that the volatile chemicals composition and bio-activity of the

member of Muscodor towards pathogens is greatly influenced by media composition (Ezra et

al., 2003). A similar approach was adapted in this study to evaluate the capability of volatile

chemicals produced by tested isolates. Four different media (PDA; MEA; OEA, and CMA) were

used in this study to evaluate the influence of media on the capacity of the test isolates (M.

padawan and M. sarawak) in controlling G. boninense. The results showed that M. padawan

and M. sarawak grew on all tested media and were able to produce volatile chemicals that

inhibited the growth of G. boninense at different percentage of inhibition (Figure 24).

However, the percentage of inhibition rate of G. boninense that was exposed to M. padawan

grown on MEA, and CMA, was 91.67% which was slightly lower compared to PDA and OEA

71

media. Volatile chemicals produced by M. padawan grown on PDA and OEA inhibited G.

boninense with the percentage of inhibition of 100%. Ezra and Strobel, (2003), and Wheatley et

al., (1996) also reported that the composition of the media greatly influences the number and

type of volatile chemical composition as well as their effectiveness in killing and inhibiting the

pathogens. This might explain why the activity of tested isolates towards G. boninense,

especially M. padawan showed partial difference in tested media.

The results obtained from M. sarawak showed that this fungus was not dependent on types of

media in producing effective anti-Ganoderma volatile chemicals. In all test media, M. sarawak

showed the capacity to produce volatile chemicals that caused 100% inhibition of G. boninense

as compared with control plates.

Figure 24: The effect of media composition on the efficiency of M. padawan (L3R3a) and M. sarawak (L5R1c) in producing volatile anti-Ganoderma compounds. The results presented in this figure showed the percentage inhibition of radial growth (PIRG) of G. boninense after 5 days of exposure to M. padawan (L3R3a) and M. sarawak (L5R1c) grown on different growth media. Each value is the mean PIRG ± Standard Error (N=3) from each media of each tested strain

72

4.3.3 250C and 300C are the Best Temperatures for Muscodor sarawak to Produce Anti-

Ganoderma Volatile Chemicals

Temperature is another environmental factor that was used as parameter to evaluate the

efficiency of the two test fungi in inhibiting the pathogen. South East Asia (SEA), especially

Indonesia and Malaysia are the main producers of oil palm products that face problems from

the BSR disease. In this study, three different sets of temperature were used to mimic the

normal temperature range in South East Asia especially Malaysia and Indonesia with an

average daily temperature range of 28-320C (Sarawak Government, 2013). The range of

temperature tested in this study was within 25-320C, the average daily range in Malaysia

(Cheong et al., 2013 and Sarawak Government, 2013).

The ability of M. padawan, M. sarawak and G. boninense to grow in the tested set of

temperature was evaluated. The growth of all test strains decreased as the set temperature

increased. Effect on efficiency of M. padawan and M. sarawak against G. boninense was

calculated based on the comparison with a control plate that was also incubated at the same

temperature. In Figure 25, the efficiency of M. padawan to control G. boninense was

influenced by temperature. Muscodor padawan (L3R3a) inhibited the growth of G. boninense

by 100% at 250C. The percentage of inhibition declined to 91.88% and 75% at 300C and 350C,

respectively.

In contrast, the PIRG of G. boninense after exposure to M. sarawak at 250C and 300C did not

show any difference. However, M. sarawak inhibitory activity towards the growth of G.

boninense declined to 75% as compared with the PIRG of G. boninense that was exposed to M.

padawan at 250C and 300C. This suggests that the capacity of M. padawan to produce volatile

chemicals that inhibited the growth of G. boninense was influenced by temperature. Muscodor

sarawak could be partially temperature-dependent as there was no difference on the effect of

two temperatures, 250C and 300C, but their inhibition activity declined at 350C as similarly

observed in the M. padawan experiments. In conclusion, the effective temperature for M.

padawan and M. sarawak to kill G. boninense completely was between 250C to 300C.

73

Figure 25: The effect of temperature on the production of volatile anti-Ganoderma chemical by M. padawan (L3R3a) and M. sarawak (L5R1c). The bars in this figure show the percentage of inhibition on radial growth (PIRG) of G. boninense after 5 days of exposure to M. padawan and M. sarawak at different temperatures. Each value is the mean PIRG ± Standard Error (N=3) from each temperature dataset of each tested strain

4.3.4 pH Affects the Capability of Muscodor padawan in Producing Anti-Ganoderma

Volatile Chemicals

To study the effects of pH, four different pH were selected, representing acidic, neutral and

alkaline conditions. In the earlier study pH 3 was included. However, as this assay was

conducted with solid agar in the double plate assay, the PDA media at pH 3 failed to solidify.

Thus, pH 3 was excluded from further study. The relationship between pH and the ability of

the test strains to produce volatile chemicals that have inhibitory effect on G. boninense is

shown in Figure 26.

The productivity of M. padawan was affected by pH even though it could suppress the growth

of G. boninense. Muscodor padawan showed the capability to inhibit the growth of G.

boninense with the percentage inhibition of radial growth (PIRG) of 71.43% at pH 5. This

increased to 100% at pH 5.6. However at neutral condition of pH 7, the bioactivity of M.

padawan against G. boninense declined with a PIRG of 60.71%. The bioactivity of M. padawan

74

against G. boninense increased at an alkaline condition of pH 9, with a PIRG value of 100%,

effectively killing the G. boninense. This suggests that the capacity of M. padawan to produce

volatile chemicals that were lethal to G. boninense was affected by pH. The favourable pH

condition for M. padawan to produce volatile chemicals that caused 100% inhibition to G.

boninense was at pH 5.6 and 9.

Muscodor sarawak did not show differences in the activity towards G. boninense at any pH

conditions tested. Muscodor sarawak showed the capability to produce volatile chemicals that

caused 100% inhibition to G. boninense when grown on various ranges of pH. This suggests

that M. sarawak is not pH-dependent in its capability to produce volatile chemicals.

Figure 26: Effect of pH on the efficiency of M. padawan (L3R3a) and M. sarawak (L5R1c) in controlling the growth of G. boninense. The bars in the figure show percentage of inhibition on radial growth (PIRG) of G. boninense after 5 days of exposure to M. padawan and M. sarawak that were grown on PDA media with different pH. Each value is the mean PIRG ± Standard Error (N=3) from each temperature dataset of each tested strain

The rationale for this study was to evaluate the survivability as well as productivity of test

isolates under stress, such as acidic and alkaline conditions. With the ability to withstand

stressful conditions, the potential of these test isolates to perform as biological control agents

(BCA) of G. boninense was high. In nurseries or plantations, application of chemical fertilizers

causes rapid growth and development of oil palm but at same time, reduces resistance

towards pathogenic organisms such as G. boninense. In addition, the fertilizers also cause the

soil to become more acidic as well as reduce the population of beneficial microorganisms that

75

sustain the growth of the oil palm. Besides that, 5 million hectares of land that is currently

planted with oil palm comprises areas with different pH conditions. Accordingly, the potential

BCA candidate for G. boninense in oil palm industry must have the characteristic to withstand

and show high productivity in various ranges of pH.

In this study, M. sarawak met one of the criterions as potential BCA for G. boninense in oil

palm industry as it was capable of producing anti-Ganoderma volatile chemicals in vitro

regardless of pH. Muscodor sarawak showed the ability to grow in acidic and alkaline condition

and was effective in controlling the growth of G. boninense with a PIRG of 100%.

4.4 Conclusion

The effect of physicochemical factors towards the viability and productivity of Muscodor

padawan and Muscodor sarawak are important aspects to evaluate their potential as

biological control agent (BCA) for G. boninense in the oil palm industry. Viability and high

productivity at stress condition are key factors that contribute to the success of the potential

BCA.

In this study, M. padawan and M. sarawak have shown their viability and capacity in

controlling G. boninense in various ranges of inoculum age, media, temperature and pH by

displaying different Percentage Inhibition of Radial Growth (PIRG). The PIRG value was a

parameter used to evaluate the effective physiochemical factors that contributed to the

productivity of M. padawan and M. sarawak as the suitability as a BCA for G. boninense.

In all ranges of inoculum age that were tested including at 0 day, M. padawan and M. sarawak

have the capacity to control G. boninense. However, the most productive inoculum age of M.

padawan to control G. boninense with a PIRG of 100% was at ages 5 to 10 days. The productive

inoculum age for M. sarawak was at ages 7 up to 10 days old.

Similarly, when evaluating the factor of media, M. padawan and M. sarawak has the capacity

to control G. boninense in all test media. However the productive media that supported M.

padawan in killing G. boninense was PDA and OEA, each with a PIRG value of 100% as

76

compared to MEA, and CMA. In contrast, media did not show distinct influence on the ability

of M. sarawak to control G. boninense. All test media supported M. sarawak in producing

volatile chemicals that has the capability of controlling the growth of G. boninense with a PIRG

of 100%.

It was found that the effectiveness of M. padawan and M. sarawak in controlling G. boninense

was affected by temperature. The effective temperature for M. padawan was at 250C with a

PIRG value of 100%. Meanwhile, for M. sarawak it was at 250C and 300C. In contrast with the

pH factor, M. sarawak did not show differences in controlling G. boninense at all tested pH.

The productive pH for M. sarawak was at all tested pH with a PIRG of 100% whereas for M.

padawan it was at pH 5.6 and 9. This study thus shows that physiochemical factors greatly and

partially influence the effectiveness of M. padawan and M. sarawak as biological control

agents of G. boninense.

77

Chapter 5

Efficiency of Muscodor sarawak and Muscodor padawan in Preventing Ganoderma

boninense From Infecting Oil Palm Seedlings

5.1 Introduction

In the agricultural sector, especially in Malaysia and Indonesia, G. boninense is a major threat

to the oil palm industry. Ganoderma boninense causes BSR disease in all growth stages of the

oil palm (Gurmit, 1990; Khairuddin, 1990; 1995; Singh, 1991 and Ariffin et al., 1996).

Ganoderma boninense-infected oil palm show reduced production of fruit fresh bunch (FFB),

reduction in number of palm stands, high mortality of mature palms from 10 to 25 years, and

reduced total oil extract per bunch due to high moisture in the mesocarp (Singh, 1991 and

Khairuddin, 1995). A survey on Ganoderma disease in Malaysia for the years 2009-2010

showed that 3.71% of palms had been infected with the total affected area of 59,148 hectares

and the losses derived from this destructive disease was estimated to be USD 176 to 557

million (Arif et al., 2011).

Ganoderma boninense infection occurs mostly through root to root contact (Turner, 1981;

Khairuddin, 1993; Hasan & Turner, 1998 and Rees et al. 2009). Healthy palms are infected

through contact of rhizomorph mycelium of G. boninense on the diseased root with the root of

replanted or healthy palms. Hasan and Turner (1998), reported that the tissue of the former

stand of oil palm were the primary source of infection at replanting area. Studies by Idris et al.

(2004; 2005), showed that 87.5% of seedlings planted around diseased palm in the field

became infected within two years. As the diseased palm was identified as the primary source

of infection, several solutions have been implemented in the oil palm industry, to combat the

BSR disease, as reviewed in Chapter 1. Manipulating the symbiotic interaction of endophytic

organisms and host plants for controlling pathogens and promoting the growth of plants is an

eco-friendly approach. The advantages of endophytes compared to saprophytes are that they

grow inside the tissues of the host plant, thus acting as internal guardians for the host plant

from invasion by plant pathogenic organism as well as helping the host plant to survive under

stressful conditions (Saikkonen et al., 1998, 2004).

78

This thesis describes the isolation of ten endophytic fungi from the host plant, Cinnamomum

javanicum obtained from Sarawak. They were found to be producing volatile chemicals and

are members of the group of Muscodor. These ten isolates displayed the capability in

producing anti-Ganoderma volatile chemicals by killing the G. boninense in in-vitro studies. Out

of the ten, two of them are novel endophytic fungi and named (tentatively) as Muscodor

padawan and Muscodor sarawak as described in Chapter 3. In this chapter, the efficiency of M.

padawan and M. sarawak to control G. boninense from infecting oil palm seedlings as well as

promoting the growth of oil palm seedlings is described.

5.2 Materials and Methods

5.2.1 In-vitro Screening on the Capability of Barley Infected with Muscodor padawan and

Muscodor sarawak to Produce Volatile Anti-Ganoderma Chemicals, Using a Double Plate

Assay System

A double plate assay system, adapted from Wheatley et al., (1997) with modification, was used

to examine the capacity of test fungi in controlling G. boninense. Infected barley grains used in

this study were prepared as follows: (i) 100g barley grain was washed with deionized water

three times and placed into 250ml bottles, (ii) these bottles containing the barley grains were

sterilized thrice using an autoclave, (iii) five agar plugs from 10-days old M. padawan or M.

sarawak culture were cut out and transferred into bottles containing the sterilized barley (iv)

these bottles were incubated at 250C until the barley grains were covered in mycelium, which

was approximately 30 days.

In preparing the double plate assay, a 90cm petri dish was filled with barley grains infected

with either M. padawan or M. sarawak to form a layer. On another 90cm petri dish containing

PDA media, an agar plug of G. boninense cut from 7-days old G. boninense culture was placed

on the centre of the PDA plate. At 7-days, the mycelium G. boninense is in its active stage and

exhibits hyphal growth of 2-4mm per day, making it a suitable age as an inoculum (Seo, 1987

and Adaskaveg & Gilberston, 1989). The covers of both petri dishes were discarded and the

dish with the G. boninense was inverted over the dish containing the infected barley grains.

The dishes were sealed with two layers of parafilm to minimize the volatile chemicals

79

produced by the infected barley from escaping. In control plates, the steps involved were

similar but the petri dish with the G. boninense was inverted over a dish containing sterilized

uninfected barley. In this study, 10 replicates were prepared for each tested strains inclusive of

control plates. After five days of incubation at 250C, the radial growth of G. boninense was

measured and the percentage inhibition of radial growth was calculated according to Skidmore

& Dickenson, 1976.

5.2.2 In-vitro Screening on the Capability of Muscodor padawan and Muscodor sarawak to

Produce Non-volatile Anti-Ganoderma Chemicals, Using a Dual Cultures Assay System

Muscodor padawan and Muscodor sarawak have been known to produce antifungal volatile

chemicals as discussed at Chapter 2. However, both isolates might also produce non-volatile

anti-Ganoderma chemicals that could dissolve in agar media. To test on their capability to

produce non-volatile anti-Ganoderma chemicals, the dual culture assay system were used in

this study adapted from Skidmore & Dickenson, (1976) and Huang et al., (2005).

In preparing the dual culture assay system, the test fungi M. padawan and M. sarawak was

cultured on PDA medium for 10 days. Concurrently, G. boninense was also cultured on PDA

medium for 7 days. Agar plugs of M. padawan or M. sarawak were then cut from the active

growing mycelium of the 10 day old cultures and inoculated at a point of 2cm distance from

the centre of a new PDA in a 90cm Petri dish. An agar plug of G. boninense was then cut from

an active growing mycelium of a 7-day-culture and inoculated on the same PDA plate, on the

opposite side with a 2cm distance from the centre of the dish. The distance between agar plug

of M. padawan or M. Sarawak, and G. boninense was 4cm. The plates were sealed with a layer

of parafilm and incubated for 15 days at 25OC. Similar procedures were applied to control

plates but no agar plugs of both test fungi were inoculated on the opposite side. In this study,

10 replicates were prepared for each test strains including the control plates. After 15 days of

incubation at 250C, the radial growth of G. boninense was measured and the percentage

inhibition of radial growth was calculated according to Skidmore & Dickenson, 1976.

80

5.2.3 Establishment of Muscodor padawan or Muscodor Sarawak Inside the Tissue of Oil

Palm to Evaluate Their Effects on Oil Palm Seedlings as well as Controlling Ganoderma

boninense Infection

(a) Preparation of Infected Barley (M. padawan, M. sarawak and G. boninense)

In this study, the root system of oil palm seedlings was selected as the target area for

introducing M. padawan and M. sarawak into the tissues of oil palm as root to root contact is

a major area where the BSR disease spreads (Turner, 1981; Khairuddin, 1993; Hasan & Turner,

1998 and Rees et al. 2009). Barley grain was selected as a carrier to introduce M. padawan or

M. sarawak to the root system of oil palms as their viability on the barley could be prolonged

to 3 years at 250C. Barley grains infected with M.albus has shown success in supporting the

growth of kale as well as controlling the pathogenic fungus, Phythium ultimum that caused

root rot in kale (Worapong & Strobel, 2009).

The infected barley grains used in this study were prepared as follows: (i) 250g barley grains

were washed thrice with deionized water and placed into a 500ml container (ii) The container

containing the barley was autoclaved thrice at 1210C for 15 minutes, (iii) 15 agar plugs from

10-day-old M. padawan or M. sarawak culture was cut and transferred into the container

containing the sterilized barley, (iv) The inoculated container was incubated at 250C, until the

grains were fully covered by mycelia. During the incubation period, the container was shaken

every 10 days to detach the barley grains that were attached together by the mycelia. Similar

procedures were applied in preparing infected barley of G. boninense except the agar plug was

cut from a 7-day-old G. boninense culture.

(b) Preparation of Oil Palm Seedlings

In oil palm plantations, it is common practice to plant oil palm seedlings that are 6 to 12

months old. In this experiment, we used 1-month and 6-month old seedlings with 20 replicates

per treatment. One month old seedlings were selected because at this stage, a low number of

endophytic fungi grow inside them. These were compared to 6-month old seedlings. One

month old seedlings were obtained by growing a germinated seed that was bought from

Sarawak Plantation Agriculture Development (SPAD), on sterilized soil for 30 days. The

sterilized soil was prepared by mixing topsoil, coco peat and sand in the ratio of 3:2:1 and

aliquot into 200g per bag before autoclaving thrice at 1210C for 15 minutes.

81

After 30 days, the seedling with 1-2 leaflets was uprooted and re-planted into a new pot

containing sterilized soil mixed with 2g of infected barley of M. padawan or M. sarawak. The

seedling was incubated at room temperature (28 ± 20C), and exposed alternately to light for 12

hours and watered daily until day 30. The pots with different treatments were placed on a

different rack that was at least 1m away from each other to prevent cross contamination.

Twenty pots of oil palm seedlings that have been exposed to barley grains infected with either

M. padawan or M. sarawak for 30 days were examined. After the oil palm seedlings were

uprooted, their height from tip to bole, number of leaflet production, disease symptoms and

their viability were measured before being replanted into the same pot and then exposed to G.

boninense.

The physical examination was adapted from Worapong & Strobel (2009). The height was

measured from the leaf tips to the base of the stem. The number of completely open leaflets

was also counted and browning on the leaves or whole part of the seedling recorded as an

indication of disease symptoms. The viability of the seedlings was noted by observing new root

formation and the occurrence of discoloration.

After physical examination, the seedling was re-planted back in the same pot and the same

soil. The control seedlings were incubated in the same conditions as seedlings treated with M.

padawan and M. sarawak. After 30 days of exposure to G. boninense, M. padawan or M.

sarawak-treated seedling was uprooted for physical examination using the similar

characteristics as described in the previous paragraph. The seedlings were also separated into

three parts which was the root, bole, and leaves to test for the presence of M. padawan, M.

sarawak and G. boninense inside the internal tissue of treated and untreated seedlings using

endophytic fungi isolation and molecular methods.

In endophytic fungi isolation, the seedling segments were surface sterilized using 0.8%

commercial Clorox and 70% ethanol. The sterilized segments from seedlings that were

exposed to M. padawan was placed onto PDA media and inverted over a Petri dish that

contained a 10-day-old M. padawan. The two plates was double sealed with two layers of

parafilm and incubated at 250C for 15 days. Triplicates were prepared per part of each treated

and untreated seedlings. The plates were examined for any fungi that grew out from the

sterilized segment after 7 days, up to 15 days of incubation as M. padawan was a slow growing

82

fungus with whitish mycelia. Fungi that grew out from the sterilized segments with whitish

mycelia after 7 days, was picked and transferred onto new PDA media. The identity of that

fungus was examined by comparing the growth pattern and hyphal structure with the original

M. padawan. Similar procedures were adapted to examine for the presence of M. sarawak in

the sterilized segments from seedling that were treated with M. sarawak.

The DNA molecular method was adapted to detect for the presence of the test strains in the

oil palm seedlings. The plant parts were washed with deionized water thrice and cut into

approximately 0.5mm of internal tissue from every parts. Crude DNA was extracted from the

internal tissues using the freeze-thaw method as described by Muramatsu et al., 2003. The

tissues were placed into 96 well plates containing 50ul Tris-EDTA solution. The plate containing

the plant a tissue was then deep frozen at -800C for 24 hours. The plate was thawed at room

temperature for 15 minutes and the solution in the 96 well plates was used as crude DNA.

Then crude DNA was amplified following the same procedures as stated in Chapter 2, section

2.2.7.2 with the following modifications. Bands within the size range of 600-700bp were cut

from the agarose and purified using GE Healthcare PCR purification kit according to the

manufacturer’s instructions. The purified DNA was stored at -200C until required. The purified

DNA was ethanol precipitated and sequenced using the same procedure as stated in Chapter

2, section 2.2.7.2. The sequences obtained were aligned together with sequences of M.

padawan and M. sarawak to determine the identity of the fungi DNA isolated. The sequences

were also searched against the GenBank database using BlastN.

This was repeated for the six month old oil palm seedlings obtained from Igan plantation in

Sarawak. The seedlings were planted in pots containing 500g of soil that had been mixed with

5g of barley grains infected with either M. padawan or M. sarawak. The seedlings were placed

in an open space environment to mimic nursery conditions and the seedlings were watered

daily. After 30 days of exposure to M. padawan and M. sarawak, the seedlings were uprooted

and their physical appearances were examined using similar procedures as for a month old oil

palm seedling. Then, the seedling was re-planted into the same pot contained the same soil.

The seedling was placed in the same position and incubated for 90 days with daily watering.

After 90 days of exposure to G. boninense the physical appearance of the oil palm seedlings

were examined as described for a month old oil palm seedlings.

83

The seedlings were separated into 3 parts which was root; bole and leaves to examine for the

presence of the test fungus; M. padawan, M. sarawak and G. boninense inside the internal

tissue of treated and untreated seedlings using the methods as described in the protocol for

endophytic isolation and molecular biology methods for a month old oil palm seedling.

5.2.4 Statistical analysis

The data were analyzed and plotted using Statistical Package for the Social Sciences (SPSS)

version 17.0 (SPSS Science Inc., IL) and Excel software (Microsoft, Redmond, WA). To test the

significance of the exposure studies, One way ANOVA with Tukey’s HSD test was performed

with the replicated data. The test determine if there are significant differences between two

datasets: the control and VOC exposed cultures. For each experiment, ten replicate plates,

with two independent experiments, for a total of 30 plates. For vegetative plant exposure, 20

plants were used. There were three independent experiments for each experiment, for a total

of 60 plants

5.3 Results and Discussions

In this chapter, the efficiency of Muscodor padawan and Muscodor sarawak as biological

control agents against G. boninense was evaluated. The main aim in this chapter was to

establish M. padawan and M. sarawak in the internal tissues of the host plant without causing

a negative impact on the host plants. This would permit potential utilization of M. padawan

and M. sarawak as biocontrol agents to prevent G. boninense from infecting the oil palm

seedling. Oil palm seedling was used as a model to demonstrate the effect of volatile and non-

volatile chemicals produced by M. padawan and M. sarawak towards their growth, as well as

to prevent G. boninense from infecting the oil palm seedling. The root system of oil palm

seedling was the main area to be protected by M. padawan and M. sarawak as that area was

the point to be infected by G. boninense in Basal Stem Rot (BSR).

Prior to that, the capability of barley grains infected with M. padawan and M. sarawak, in

producing volatile and non-volatile anti-Ganoderma chemicals was evaluated using a dual

plate assay system. Confirming this was important to increase the chances of M. padawan and

84

M. sarawak to perform similar to the in vitro result. M. padawan and M. sarawak that were

capable of producing anti-Ganoderma chemicals will be used as inoculum to introduce these

fungi into the internal tissue of oil palm seedling.

5.3.1 In-vitro Screening on the Capability of Barley infected with Muscodor padawan and

Muscodor sarawak in Producing Volatile Anti-Ganoderma Chemicals, Using a Double Plate

Assay System

The result described in Chapter 2 showed that barley infected with Muscodor padawan and

Muscodor sarawak had the capability to control G. boninense as well as prolonging their active

life. Due to that, barley was selected in this study as a carrier for introducing M. padawan and

M. sarawak into the root system of palm oil seedlings. Prior to that stage, an experiment to

confirm that the M. padawan and M. sarawak growing on the barley grains used in the in vivo

(greenhouse pot assay) was capable of producing volatile and non-volatile chemicals which

were able to kill G. boninense were conducted. The efficiency of the strains in producing

volatiles chemicals for controlling the G. boninense in plate assay system was performed by

exposing agar plugs of G. boninense inoculated in separate plates with a layer of infested

barley plated in 90 cm Petri dish similar to the double plate assay concept.

The capability of M. padawan and M. sarawak in producing anti-Ganoderma chemicals was

determined by comparing the growth rate of G. boninense that have been exposed to the

barley grains infected with M. padawan or M. sarawak and control plate without infected

barley. According to Pegler, (1931), in normal condition at 250C, the diameter of a colony of G.

boninense was in the range of 5 cm to 7 cm after 5 days, with new hyphal growth from the

agar plug on day three of incubation. However, in this study, G. boninense that has been

exposed to the infected barley grains did not show any occurrence of new hyphal growth out

of the agar plug after three days of incubation. According to the time course study described in

Chapter 4, the peak period for M. padawan and M. sarawak to completely kill G. boninense

was on day 5 and 7, respectively. Due to that, the evaluation on growth rate of G. boninense in

this study was prolonged to 7 days even though on day 3, there was no growth of new hyphae.

The final evaluation of the growth of G. boninense was measured and observed after 7 days of

being exposed to the infected barley grains carrying the Muscodor fungi. The results showed

similar condition as observed on day 3 which was no new hyphae growth from agar plug of G.

85

boninense, indicating that volatile chemicals produced by M. padawan and M. sarawak in plate

environment were able to kill the G. boninense (Figure 27).

In order to validate that the volatile chemicals produced by M. padawan or M. sarawak caused

death to G. boninense, a viability test of G. boninense that had been exposed to infected barley

grains (M. padawan or M. sarawak) was performed. An agar plug of G. boninense that had

been exposed to M. padawan or M. sarawak was transferred onto new Potato Dextrose Agar

(PDA) media to observe the ability of G. boninense to resume their growth upon removal from

exposure to the test fungi. No new hyphae grew out from the agar plug after 7 days of

incubation at 250C. The incubation period was prolonged up to 15 days as further confirmation

on the viability of G. boninense. There was no new growth observed even after this length of

incubation. This showed that the agar plug of G. boninense which contained the active mycelia

was killed by the volatile chemicals produced in plate environment by M. padawan and M.

sarawak that had colonized the barley (Table 11).

Figure 27: Evaluation of capability of M. padawan on barley grains to produce anti-ganoderma VOC. (a) A layer of infected barley of M. padawan (b) G. boninense was dead after 5 days of exposure to the infected barley of M. padawan (c) Control plate: A 5-day-old G. boninense incubated at 250C on PDA media.

86

Table 11: Effect of 5 days exposure to volatile chemicals produced by M. padawan and M. sarawak on barley grains, towards the growth of G. boninense.

Strain The percentage of inhibition on radial growth (PIRG) of G. boninense M. padawan 100.00 ± 0.00b M. sarawak 100.00 ± 0.00b Control 0.00 ± 0.00a Each value is the mean of PIRG ± standard error of ten replicates from each tested strain. Different letters indicate a significant difference according to One-Way ANOVA with Tukey’s HSD test (P<0.05)

5.3.2 In vitro Screening on the Capability of M. padawan and M. sarawak in Producing

Non-Volatile Anti-Ganoderma Chemicals, Using a Dual Culture Assay System

Non-volatile chemicals might also be produced by M. padawan and M. sarawak which would

diffuse into the media. The diffused chemicals might directly be in contact with G. boninense

thus contributing to the killing activity; in vivo study soil will be used as media. In order to

verify the presence of non-volatile chemicals produced by M. padawan and M. sarawak, a dual

culture assay was performed and G. boninense was inoculated on the same media with either

M. padawan or M. sarawak. Then, the growth of G. boninense was measured and compared

with the control plate which is G. boninense without the test fungi. In this study, G. boninense

incubated together M. sarawak at 250C for five days showed perfect score in which all 10

replicates of plate assay shown the consistent killing of G. boninense (Figure 28). In order to

verify that the G. boninense was indeed dead and not just inhibited by the non-volatile

chemicals produced by M. sarawak, a viability test was performed by transferring agar plugs of

G. boninense that have been grown together with M. sarawak onto new PDA plates. The result

indicated G. boninense was dead as no new hyphae were observed even though the incubation

periods at 250C was prolonged up to 15 days (Table 11). This dual culture assay showed M.

sarawak has the potential to become a curative agent for BSR as this fungus is capable of

killing G. boninense in vitro. In comparison with the current biological control agents; T.

harzianum, Hendersonia, Burkholderia, Pseudomonas and Streptomyces that have been

adapted for controlling infection of G. boninense in oil palm seedling, these were only effective

in supressing the growth of G. boninense (Shamala & Idris, 2009; Shariffah Muzaimah et al.,

2012; Maizatul et al., 2012; Nasyaruddin et al., 2011; Nurrashyeda et al., 2011 and Idris et al.,

2010; 2012).

87

A different result was obtained from M. padawan whereby selective pressure in the replicates

was observed. Of the 10 replicates studied, 60% or 6 plates showed the capacity to kill G.

boninense in dual culture assay (Figure 29). The remaining 40% showed that the growth of G.

boninense was retarded after a challenge with M. padawan. This experiment was repeated

twice and similar result was obtained. A viability test as described earlier for M. sarawak was

conducted. The original agar plug of G. boninense that was inoculated next to M. padawan was

transferred onto a new PDA media and the capacity of G. boninense to resume their growth

was observed. The result showed that the cultures in which G. boninense was observed to be

completely killed, also show similar activity in this viability assay, that is, there was no new

hyphal growth from the agar plug. This meant that chemicals produced by M. padawan had

diffused into the media and killed the G. boninense (Table 12). However, replicates in which G.

boninense was observed to be supressed, the agar plug started to show new hyphae growth on

day 5 and took 15 days to reach 9 cm radial growth inside of 7 days in normal condition at 250C

on PDA media. The growth rate of that replicates was reduced by approximate half of their

normal growth rate. This study showed volatile chemicals produces by M. padawan is strong

or consistence against G. boninense compared to non-volatiles chemicals. Even though in

certain replicates M. padawan did not fully kill the G. boninense but by inhibiting their growth

also showed M. padawan produces chemicals that are capable of inhibiting, or killing G.

boninense. Through this dual culture assay, M. padawan and M. sarawak was suggested to

also produce non-volatile anti-Ganoderma chemicals.

Figure 28: Evaluation of capability of M. sarawak to produce non-volatile anti-Ganoderma chemicals. (a) M. Sarawak (top) caused death of G. boninense on dual culture of PDA media at 15-day after incubation at 250C (b) A 15-day-old G. boninense incubated at 250C on PDA media.

a b

88

Figure 29: M. padawan showed selective pressure against G. boninense in dual culture assay. (a) M. padawan (ii) caused death of G. boninense (i) on dual culture of PDA media at 15-day after incubation at 250C (b) M. padawan (ii) inhibited the growth of G. boninense (i) on dual culture of PDA media at 15-day after incubation at 250C (c) A 15-day-old G. boninense incubated at 250C on PDA media

Table 12: The inhibition of radial growth of G. boninense by M. padawan and M. sarawak observed in a dual culture assay

Strain The percentage inhibition of radial growth (PIRG) of G. boninense M. padawan 28.42 ± 8.98b M. sarawak 100.00 ± 0.00c Control 0.00 ± 0.00a Each value is the mean of PIRG ± standard error of ten replicates from each tested strain. Different letters indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test

5.3.3 Establishment of M. sarawak and M. padawan Inside the Tissue of Oil Palm

Seedlings

In this study, M. padawan and M. sarawak were established inside the tissue of oil palm

seedlings and the endophytes conveyed the added benefit of protecting the host from

pathogens, like G. boninense. Section 5.3.1 showed that M. padawan and M. sarawak both

produced volatile and non-volatile chemicals. The effect of volatile and non-volatile chemicals

towards oil palm seedling was evaluated to ensure that there was no destructive effect

towards the oil palm seedling.

89

The in vitro plate assay system has shown that volatile and non-volatile chemicals produced by

M. padawan and M. sarawak have the capacity to inhibit and kill the G. boninense fungus.

Thus far, no study has been conducted on the effects of volatile and non-volatile chemicals

produced by any member of Muscodor towards the growth of oil palm seedling. This study is

the first such attempt to generate new knowledge on the Muscodor spp. and their effects on

oil palm seedlings. In this study, carrier (infected barley) was used to introduce the M.

padawan and M. sarawak into the internal tissue of oil palm seedlings. The effects of M.

padawan and M. sarawak that were delivered using the carrier method on the growth of oil

palm seedling was evaluated by observing and measuring the height, leaflet production,

disease symptoms (browning) and the viability of the seedlings.

Establishment of M. padawan and M. sarawak inside the tissues of oil palm is proposed here,

as an alternative method to controlling the incidence of basal stem rot (BSR) disease in early

stages such as seedlings (plant materials). The approach was to generate plant seedlings that

are resistant to G. boninense especially in the replanting area that having BSR disease record.

In this study, two outcomes were used to examine the effects of M. padawan and M. sarawak.

These were the physical appearance of one month and six month old oil palm seedlings as well

as successful prevention of G. boninense from infecting the seedlings.

(a) Effect of Infected Barleys of M. padawan and M. sarawak on the Physical Appearance

(Growth Rate, Disease Symptom & Viability) of a Month Old Oil Palm Seedlings

Out of twenty seedlings that were treated with M. sarawak, 3 (15%) of them showed

appearance of disease symptoms which was browning at the tip of the oldest leaves.

Meanwhile, seedlings that were treated with M. padawan showed 90% viability after

treatment with volatile and non-volatile chemicals produced by M. padawan (Table 12). Out of

20 seedlings that were treated with M. padawan, 13 (65%) of them showed appearance of

disease symptoms (browning) and two of these were completely dead. The first disease

symptoms on the oil palm seedlings was browning at the tip of oldest leaves after two weeks

of exposure to M. padawan. The browning symptom spread to the youngest leaves, then to

the stem and eventually, the entire seedling turned brownish before collapsing. A study

conducted by Idris et al., (2006) also showed that disease symptoms caused by G. boninense

on oil palm seedlings first developed from the oldest to the youngest leaves. In contrast, non-

treated seedlings showed that 1 out of 20 had developed disease symptoms.

90

This result showed that, the M. padawan had deleterious effects on oil palm seedlings as

compared with seedlings that were treated with M. sarawak and non-treated seedlings.

The effect of M. padawan or M. sarawak towards the height of oil palm seedlings was also

evaluated. The height from the tip to the bole represented the effect of the treatments

towards the growth rate of oil palm seedlings. In this study, the height from the tip to the bole,

was not significantly different between seedlings treated with M. sarawak and non-treated

seedling (Table 12). However, seedlings treated with M. padawan showed reduction in growth

rate. The average height from the tip to the bole of treated seedlings with M. padawan was

8.3 cm, which was reduced approximately 50% as compared with non-treated seedlings (Table

12). These results indicated that M. padawan had suppressive impact towards the growth rate

of oil palm seedling as compared to M. sarawak and non-treated seedlings.

In leaflet production, the result showed oil palm seedlings that were treated either with M.

padawan or M. sarawak did not showed significant reduction in their leaflet production. The

leaflet produced by seedlings treated with M. sarawak and non-treated seedlings were three

leaflets. Meanwhile, seedlings treated with M. padawan produced two leaflets. It was

concluded neither M. sarawak nor M. padawan had any significant impact towards the leaflet

production.

Based on the viability results, oil palm seedlings that were treated with M. sarawak and non-

treated one showed 100% viability (Table 13). However, out of 20 seedlings that were treated

with M. padawan, three of them were dead (the whole plant turned brown and there was no

new production of roots). This suggests that M. padawan might impact the viability of oil palm

seedlings.

Overall, M. sarawak treated seedlings did not affected the leaflet production, height, disease

symptoms and viability as compared with non-treated oil palm seedlings. However, M.

padawan showed slightly impact in reducing the number of leaflet production, height, viability

and increasing the presence of disease symptoms on oil palm seedlings compared to control

pots. The viable oil palm seedlings were then used to determine their efficacy in controlling G.

boninense from infecting the root systems.

91

Table 13: Effect of M. padawan and M. sarawak treatment on physical appearance of one-month-old oil palm seedling

Treatment Height of tip to bole (cm)

No. of leaflet Disease Symptom (%)

Viability (%)

1 (M. sarawak) 14.1 ± 0.44b 2.85 ± 0.08b

15.00 ± 8.19b

100.00 ± 0.00b

2 (M. padawan) 8.2 ± 0.54a 2.1 ± 0.10a

65.00 ± 10.94a

90.00 ± 6.88a

3 (Control) 13.5 ± 0.48b 2.75 ± 0.10b

5.00 ± 5.00b

100.00 ± 0.00b

Each value is the mean of PIRG ± standard error of twenty replicates from each treatment. Different letters in the same column indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test

Figure 30: Pot trails of seedlings exposed to Muscodor. Whitish mycelium grew from infected barley and colonized the soil surface

Oil palm seedlings that had been exposed to M. sarawak and M. padawan were re-planted in

the pot containing soil that has been mixed with barley grains infected with G. boninense. The

seedlings were exposed to the G. boninense for 30 days before the seedlings were uprooted

for examination on their physical appearance as well as for the presence of test fungus inside

the internal tissue of the seedling via DNA molecular and endophytic isolation.

In the first week of incubation, all pots containing untreated oil palm seedlings showed whitish

mycelia growing out from the barley grains infected with G. boninense and started to colonize

the soil (Figure 30). However, this situation was not observed on the pots containing the

92

treated seedlings. A small sample of soil with mycelia was taken out from the pot and placed

onto PDA with ampicillin. After 7-days, the growth of mycelium was observed and the identity

was determined by comparing the colony growth pattern with that of G. boninense. The

pattern was similar to G. boninense and the mycelium was suggested to be from the infected

barley. However, after 14 days incubation, the presence of whitish fungi declined and greenish

mycelia started to cover the soil. At 24 days, the soil surface in all pots containing untreated oil

palm seedlings were covered by a greenish fungus, suspected to be Trichoderma spp. (Figure

31). This situation was not observed on the pots containing oil palm seedlings treated with M.

sarawak. It was occasionally observed (small (10-30%) part of the soil surface) on some pots

containing oil palm seedlings treated with M. padawan. It was suggested that G. boninense

produced chemicals that supported the growth of Trichoderma, as no abundance of

Trichoderma was observed on the pots containing M. padawan and M. sarawak -treated

seedlings.

Figure 31: Pot trails of seedlings unexposed to Muscodor. Greenish mycelia covered the soil surface in the pots containing untreated oil palm seedlings The effect of G. boninense towards treated and untreated seedlings is described in Table 14.

Height and leaflet production by M. sarawak-treated seedlings did not show significant

difference from untreated seedlings after 30 days of exposure to G. boninense. However

disease symptoms occurrence on the M. sarawak-treated seedlings was significantly higher

than untreated seedlings. In M. padawan-treated seedlings, height and leaflet production was

significantly different from untreated seedlings. Occurrence of disease symptoms on M.

padawan-treated seedlings was not significantly different from M. sarawak-treated seedlings.

93

Out of 18 M. padawan-treated seedlings, one of the seedlings was dead after exposure to G.

boninense. In contrast with the viability result, there was no impact of G. boninense towards

treated and untreated seedlings.

Table 14: Effect of G. boninense on the physical appearance of one-month-old treated and untreated oil palm seedlings

Treatment Height of tip to bole (cm)

No. of leaflet Disease Symptom (%)

Viability (%)

M. padawan- treated seedling + G.

boninense

11.32 ± 0.99a 1.89 ± 0.18a 66.67 ± 11.43a 94.44 ± 5.56a

M. sarawak -treated seedling + G.

boninense

16.45 ± 0.83b 2.60 ± 0.11b 60.00 ± 11.24a 100.00 ± 0.00a

Untreated seedling + G. boninense

17.18 ± 0.80b 2.75 ± 0.10b 35.00 ± 10.94b 100.00 ± 0.00a

Each value is the mean of PIRG ± standard error of twenty replicates from each treatment. Different letters in the same column indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test.

In the endophytic fungi isolation method, the occurrence of whitish hyphae with slow growth

rate growing out from the sterilized parts of root, leaves and bole of seedlings treated with M.

sarawak and M. padawan was examined. However, there were no whitish hyphae observed

growing out from the sterilized tissue after 5 days of incubation at 250C. The incubation period

was extended to 15 days but the results were still negative. Bacteria were detected in all

replicates that contained root parts. In non-treated seedlings, the presence of G. boninense

was not detected but there was a high presence of Trichoderma spp. observed (Figure 32). The

occurrence of Trichoderma on the untreated pots might explain the observation that

untreated seedlings showed lower occurrence of disease symptoms and high viability rate.

According to Shamala et al., (2009), Trichoderma is a potential biological control agent that has

antagonistic activity towards G. boninense. It is interesting to note from this observation, the

question “Why Trichoderma, a fungus that is present ubiquitously in the environment, does

not prevent the spread of BSR disease or kill G. boninense?”.

94

Figure 32: Abundance of greenish fungus (Trichoderma sp.) growing from the roots of untreated seedlings.

In the molecular detection approach, genomic DNA was extracted from the tissues of treated

and non-treated seedlings using a deep freeze and thaw method. The crude DNA was used as

template to perform PCR. The PCR products with sizes of 600-700bp were selected, purified

and sequenced to obtain their identity. Three bands with the sizes stated above were obtained

from seedlings treated with M. sarawak, four were obtained from M. padawan samples, and

three were obtained from the non-treated seedlings. However, the sequences obtained after

sequencing, did not match with M. sarawak, M. padawan or G. boninense sequences in the

GenBank database.

The results and observations suggest that M. sarawak and M. padawan only grew externally in

the soil surrounding the root systems of oil palm seedlings. Chemicals produced by M.

padawan caused destructive impact to the oil palm seedlings by reducing the number of

leaflet, height of tip to the bole and caused browning on the oldest leaves of 65% of tested

seedlings. These chemicals were also effective in controlling G. boninense, as no occurrence of

G. boninense was observed in the soil samples. In contrast with M. sarawak, the chemical

produced showed no significant impact on treated oil palm seedlings as compared to

untreated seedlings. The occurrence of G. boninense was also not detected from the soil

collected from M. sarawak-treated seedling pots. This suggests that the chemicals released or

diffused into the soil were effective in controlling G. boninense. It also further suggests that M.

sarawak would be a better BCA candidate than M. padawan.

95

(a) Effect of Infected Barleys of M. padawan and M. sarawak on the Physical Appearance

(Growth Rate, Disease Symptom and Viability) of Six-Month-Old Oil Palm Seedlings

A six-month-old healthy oil palm seedling was used in this study and conducted in the lab to

mimic the situation at nursery stage. The infected barley of M. sarawak or M. padawan was

mixed with sterilized soil and a six-month-old healthy oil palm seedling was planted in the soil.

After 30 days of treatment, all seedlings with 3 replicates per treatment were up-rooted and

examined for their physical appearance of height, leaflet production, disease symptoms and

their viability (Table 15).

Table 15: Effect of M. sarawak and M. padawan on the physical appearance of six-month-old oil palm seedlings

Treatment Height

(Tip to bole) Leaflet

Production Disease

Symptoms (%) Viability (%) M. sarawak 27.9 ± 0.21a 3.67 ± 0.33a 33.33 ± 33.33b 100 ± 0.00a M. padawan 26.67 ± 1.42a 3.67 ± 0.33a 66.67 ± 33.33b 66.67 ± 33.33a Control 27.43 ± 1.03a 4 .00 ± 0.00a 0.00 ± 0.00a 100 ± 0.00a

Each value is the mean of PIRG ± standard error of twenty replicates from each treatment. Different letters in the same column indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test.

Based on the results, there were no significant difference on the height, leaflet production and

the viability of the treated and untreated seedlings. Disease symptoms were only detected on

oil palm seedling that were treated with M. padawan and M. sarawak. It was concluded that

oil palm seedlings treated with M. padawan and M. sarawak showed no statistical difference

with untreated seedlings.

The treated and untreated seedlings were subjected to G. boninense treatment to test for their

ability to resist infection. The treatment period was prolonged to three months as the earlier

study showed that the oil palm seedlings developed the disease symptoms after three months

of exposure to G. boninense (Figure 33). Based on the qualitative results, physical appearance

of M. sarawak and M. padawan treated seedlings showed differences from untreated

seedlings. However, statistical analysis (Table 16) described differently, which showed no

significant difference on the physical appearance between treated and untreated seedlings.

96

Table 16: Effect of G. boninense on the physical appearance of six-month-old treated and untreated oil palm seedlings

Treatment Height

(Tip to bole) Leaflet

Production Disease

Symptoms (%) Viability (%) M. padawan- treated seedling + G. boninense 22.53 + 11.60a 2.33 ± 1.20a 66.67 ± 33.33a 66.67 ± 33.33a

M. sarawak -treated seedling +

G. boninense 18.83 ± 9.24a 2.33 ± 1.20a 66.67 ± 33.33a 66.67 ± 33.33a Untreated seedling

+ G. boninense 9.83 ± 9.83a 1.33 ± 1.33a 66.67 ± 33.33a 33.33± 33.33a Each value is the mean of PIRG ± standard error of twenty replicates from each treatment. Different letters in the same column indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test.

Figure 33: Survivability of treated seedlings upon exposure to G. boninense. (a) Out of three untreated seedling, one replicate survived and two replicates were dead after exposure to G. boninense. Muscodor sarawak -treated seedlings (b) M. padawan-treated seedlings (c) showed two replicates survived after treatment with G. boninense and the other one was dead

After the physical appearances examination, the seedling was separated into 3 parts; root,

bole and leaves for endophytic isolation and DNA molecular. In endophytic fungi isolation, no

occurrence of white fungus with slow growth was observed from the root, bole and leaves

sample of treated and untreated seedlings. However, root parts were mostly colonized by

bacteria and the upper parts (bole and leaves) were colonized by bacteria and fast growing

fungus, suspected to be Pestalotiopsis spp. It was concluded that G. boninense failed to infect

the oil palm seedlings. This result suggests that M. sarawak and M. padawan act externally by

releasing anti-Ganoderma chemicals into the soil and the air, killing the G. boninense.

a b c

97

5.4 Conclusion

Muscodor padawan and Muscodor sarawak produced volatile and non-volatile anti-

Ganoderma chemicals in the plate assay system. They could be considered as strong

antagonistic fungi to G. boninense in vitro (double plate and dual culture assay) especially M.

sarawak. However, in greenhouse studies (pot assay system) using oil palm seedlings

especially one month old seedlings, M. padawan showed destructive impact towards the

height, leaflet production and disease symptoms even though the rate of viability did not show

significant differences as compared with M. sarawak and untreated seedlings. In contrast with

M. sarawak, the seedlings were not significantly different from the untreated seedlings. Thus,

M. sarawak is recommended over M. padawan, as a potential biological control agent in oil

palm industry especially in the nursery stage. However, the endophytic isolation and DNA

isolation results did not support M. padawan and M. sarawak as the endophytic fungi that

supported the oil palm seedlings from G. boninense infection due to (1) no slow growing white

mycelium was observed coming out from the sterilized tissue of seedlings that were treated

with M. padawan, or M. sarawak (2) DNA sequence obtained from samples suspected to be M.

padawan, or M. sarawak did not match or align with DNA sequences of M. padawan or M.

sarawak. Ganoderma boninense that was mixed with the soil that had been treated or

untreated with M. padawan or M. sarawak was also not detected in soil isolation. This

suggests that the chemicals produced by M. padawan or M. sarawak into the soil caused the

death of G. boninense and supressed the growth of Trichoderma sp. that was found to cover

the soil surface of untreated seedlings. The presence of Trichoderma sp. after two weeks in

control seedlings treated with G. boninense becomes questionable as this situation was not

observed in other treated seedlings. It was thus concluded that M. padawan or M. sarawak

was not successfully established inside the internal tissue of oil palm seedlings, but they acted

externally to kill off G. boninense by secreting chemicals into the soil.

98

Chapter 6

General Summary and Recommendations

6.1 Aim of the thesis

The thesis presents data from our work to explore the biodiversity of Sarawak to isolate

indigenous species of Muscodor, from the jungles of Sarawak, Malaysia. Studies by Prof. Dr.

Strobel and other researchers have found that endophytic fungi from the newly described

genus, Muscodor showed the ability to completely kill (100% inhibition) certain soil borne fungi

including those from the group of Basidiomycete (Worapong et al., 2001; 2002; Ezra & Strobel,

2003; Daisy et al., 2002; Gonzalez et. al., 2009; Suwannarach et al., 2010; 2013; Mitchell et al.,

2010; Zhang et al., 2010; Kudalkar et al., 2011; Meshram et al., 2012 and Saxena et al., 2014).

This gave the inspiration to search for local isolates of Muscodor spp., from the jungles of

Sarawak, Malaysia. Prior to this study, there were no records of Muscodor occurrence in

Sarawak, this thesis is thus, a first report on the strategy to isolate Muscodor from Sarawak

resources as well as the potential development of the isolates as BCA against G. boninense.

This chapter summarises the findings of this thesis and offers recommendation for future work

in this area.

6.2 Enrichment and Isolation

A screening and isolation method designed based on exposure to VOC produced by M. albus

resulted in successful isolation of 10 fungi. It was concluded that, these 10 fungi were also

producing volatile chemicals similar to M. albus. This also suggested that the method adapted

in this study was successful in the screening for endophytic fungi that produces volatile

chemicals. All 10 isolates were obtained from the host plant, Cinnamomum javanicum.

99

6.3 Taxonomy and Characterization

The identity of the Muscodor-like isolates was determined to belong to the Muscodor group

with 96-99% sequence similarity to existing sequences of Muscodor spp. in the GenBank

database. Two isolates, L3R3a and L5R1c, exhibited potential to be further developed as

biological control agents (BCAs). Since the results collected from morphological structures and

DNA sequence analysis suggested that these two isolates did not match with any member in

the Muscodor group, we determined that the isolates are new species and proposed the

names Muscodor padawan and Muscodor sarawak.

6.4 Volatile Chemicals Composition

Isolate M. padawan that was grown on barley grain produced a light sweet fruit odour.

GC/MS-SPME analysis showed 3-Octanone was detected in all range of incubation period (day

1 to 18), either as a major compound or in the top three range of major compounds. M.

sarawak produced a musty odour that was lighter than M. albus (Strobel et al., 2001). In the

analysis of volatile chemical produced by M. sarawak, azulene was found to be the major

compound at the early stage (incubation up to 6 days) and delta-Panasinsine at the late stages

of incubation (7 to 18 days).

6.5 Key Factors that Affect Volatile Chemicals Production

In this study M. padawan and M. sarawak produces secondary metabolite (VOC) at the same

time during the growth phase but the effect towards G. boninense was lesser or only inhibitory

to growth.

Nutrient and environment factors (temperature and pH) influenced the effectiveness of M.

padawan in producing anti-Ganoderma compound capable of killing G. boninense. The anti-

Ganoderma compound produced by isolate M. padawan that was grown on media containing

rich sucrose (OEA) and glucose (PDA) showed the capability to kill G. boninense. This was not

the case when MEA and CMA were used. However, the productivity and volatile chemicals

100

produced by M. sarawak was not influenced by nutrient factors as they showed consistent

bioactivity towards G. boninense when grown on different media.

Muscodor padawan produces volatile chemical that can kill G. boninense when grown at

temperature 250C and at pH condition of 5 and 9. However, in M. sarawak the bioactivity was

not influenced by pH condition but partially affected by temperature. Muscodor sarawak that

was grown at different pH did not show any significant difference in their ability to kill, but

were only able to inhibit the growth of G. boninense when grown at 350C.

Muscodor padawan was able to produce the VOC earlier, on day 5 as compared to M. Sarawak

(on day 7), however, nutritional and environment conditions; pH and temperature greatly

influenced the capability of M. padawan to produce these VOCs that could kill G. boninense.

6.6 Development of a Biocontrol Agent

This thesis proposes the use of biofumigant agent as a new approach in handling G. boninense

infection in the oil palm industry. Data obtained from in vivo studies conducted on young oil

palm seedlings concluded that the endophytes, M. padawan and M. sarawak were able to

produce both volatiles and non-volatile organic compounds that can kill or inhibit the growth

of G. boninense, thus preventing it from infecting the root systems of palms and causing BSR

disease.

6.7 Future Directions and Recommendations

The findings from this thesis suggest that M. padawan and M. sarawak have the potential to

be developed as biological control agent for G. boninense. Future work involving these two

isolates may involve the production of resistant materials using manipulation of interaction

between endophytic fungi and host plant. This is a promising alternative method to overcome

G. boninense infection. By establishing M. padawan and M. sarawak inside the tissue of oil

palm seedlings, these fungi will protect the oil palms from being invaded by G. boninense. The

idea was to inoculate the calluses of oil palm with mycelium suspension of M. padawan and M.

101

sarawak. However as the time needed to prepare calluses took more than 3 months, the

process to establish M. padawan and M. sarawak in the tissues was stopped due to time

limitation to finish this project. Through this idea, oil palm seedlings containing M. padawan

and M. sarawak might be able to resist G. boninense infection throughout their lifespan.

This approach has clear benefits to the oil palm industries as G. boninense is the major causal

agent of BSR. Generating a clone of an oil palm harbouring an endophyte which is able to

protect the palm from being infected by the fungi would substantially reduce cost and increase

yield to the plantations.

The application of this newly discovered biofumigant agent could be expanded to other pre

and post plant disease problems in the horticultural and agricultural industry. The isolated

Muscodor strains described in this thesis may hold a lot of potential in the field of fungal

biocontrol and this thesis can serve as a useful reference resource to the oil palm industries,

researchers, and marketers.

102

Appendix 1: List of plants collected from Padawan and Bako National Park (BNP)

Sample Plant Name Plant Family Location GPS DBH (cm)

Height (cm)

L01 Cinnamomum javanicum

Lauraceae Padawan N 01023.451 E 110019.273

9 420

L02 Cinnamomum javanicum

Lauraceae Padawan N01023.433 E 110019.321

10 510

L03 Cinnamomum javanicum

Lauraceae Padawan N 01023.466 E 110019.331

5 150

L04 Cinnamomum javanicum

Lauraceae Padawan N01023.459 E 110019.352

8 510

L05 Cinnamomum javanicum

Lauraceae Padawan N 01023.458 E 110019.362

5.5 340

L06 Actinodaphne sesquipedalis

Lauraceae BNP N 0143.258 E 110026.842

4.5 10

L07 Myristica fragrans

Myristicaceae BNP N 01043.283 E110026.852

8 160

L08 Cinnamomum zeylanicum.

Lauraceae BNP N 01043.333 E110026.903

2 150

L09 Cinnamomum zeylanicum

Lauraceae BNP N 01043.358 E110026.963

2 150

L10 Cinnamomum cassia

Lauraceae BNP N 01043.375 E 110027.224

1 93

L11 Cinnamomum javanicum

Lauraceae BNP N 01043.399 E 110027.233

4.5 320

L12 Horsfieldia paucinervis

Myristicaceae BNP N 01043.258 E 110026.842

50 240

L13 Nephelium lappaceum

Sapindaceae BNP N 01043.453 E 110027.409

13 300

L14 Cinnamomum javanicum

Lauraceae BNP N 01043.512 E110027.418

2 80

L15 Cinnamomum javanicum

Lauraceae BNP N 01043.651 E 110027.460

3 120

L16 Cinnamomum javanicum

Lauraceae BNP N 01043.816 E 110027.120

2.5 280

L17 Cinnamomum javanicum

Lauraceae BNP N 01042.895 E 110026.613

2 80

L18 Cinnamomum javanicum

Lauraceae BNP N 01042.896 E 110026.613

16 650

L19 Myristica fragrans

Myristicaceae BNP N 01042.850 E 110026.631

7 320

L20 Actinodaphne sesquipedalis

Lauraceae BNP N 01042.805 E110026.648

13 320

L21 Myristica cinnamomea

Myristicaceae BNP N 01042.691 E 110026.697

27 800

103

Sample Plant Name Plant Family Location GPS DBH (cm)

Height (cm)

L22 Knema viridis Sapindaceae BNP N 01042.638 E 110026.602

25 300

L23 Nephelium lappaceum

Sapindaceae BNP N 01042.571 E 110026.686

10.7 1200

L24 Myristica fragrans

Myristicaceae BNP N 01042.671 E 110026.678

3 80

L25 Nephelium lappaceum

Sapindaceae BNP N 01042.789 E 110026.662

4.5 320

L26 Cinnamomum javanicum

Lauraceae BNP N 01042.497 E 110026.777

2.5 200

L27 Cinnamomum cassia

Lauraceae BNP N 01042.461 E 110026.790

1 100

L28 Cinnamomum cassia

Lauraceae BNP N 01042.416 E 110026.797

1 120

L29 Cinnamomum javanicum

Lauraceae BNP N 01042.406 E 110026.801

1 150

L30 Cinnamomum javanicum

Lauraceae BNP N 01042.379 E 110026.812

1.5 120

L31 Cinnamomum javanicum

Lauraceae BNP N 01042.801 E 110026.812

3 75

L32 Actinodaphne sesquipedalis

Lauraceae BNP N 01042.347 E 110026.846

3.5 230

L33 Cinnamomum javanicum

Lauraceae BNP N 01042.358 E 110026.858

1 120

L34 Cinnamomum javanicum

Lauraceae BNP N 01042.347 E 110026.884

1 30

L35 Cinnamomum javanicum

Lauraceae BNP N 01042.338 E 110026.902

3.5 320

L36 Cinnamomum javanicum

Lauraceae BNP N 01042.331 E 110026.935

2.5 320

L37 Cinnamomum cassia

Lauraceae BNP N 01042.505 E 110027.237

1 245

L38 Cinnamomum javanicum

Lauraceae BNP N 01042.739 E 110027.576

3.5 100

L39 Cinnamomum javanicum

Lauraceae BNP N 01043.034 E 110027.270

2 300

L40 Myristica fragrans

Myristicaceae BNP N 01044.489 E 110030.092

34 1100

L41 Myristica fragrans

Myristicaceae BNP N 01044.489 E 110030.102

23 350

L42 Cinnamomum javanicum

Lauraceae BNP N 01044.470 E 110030.107

3.5 150

104

Sample Plant Name Plant Family Location GPS DBH (cm)

Height (cm)

L43 Nephelium lappaceum

Sapindaceae BNP N 01044.477 E 110030.077

1 150

L44 Cinnamomum javanicum.

Lauraceae BNP N 01044.477 E 110030.141

3 160

L45 Cinnamomum zeylanicum

Lauraceae BNP N 01044.438 E 110030.158

2 150

L46 Knema viridis Myristicaceae BNP N 01044.423 E 110030.048

15 100

L47 Dimocarpus longan

Sapindaceae BNP N 01044.438 E 110030.158

2 150

L48 Knema viridis Myristicaceae BNP N 01044.510 E 110030.078

18 120

L49 Nephelium lappaceum

Sapindaceae BNP N 01044.507 E 110030.073

3 200

L50 Myristica fragrans

Myristicaceae BNP N 01044.531 E 110030.043

10 600

105

References

Adaskaveg, J.E and Gilbertson, R.L. (1989). Cultural studies of four North American

species in the Ganoderma lucidum complex with comparisons to G. lucidum and G.

tsugae. Mycological Research, 92: 182-191.

Adema F, Leehouts P.W & Welzen P.C. V (1996). Sapindaceae. In Tree Flora of Sabah and

Sarawak Vol. Two (Eds: Soepadmo, E., Wong, K.M. & Saw, L.G.). Ampang Press Sdn. Bhd.

Kuala Lumpur, Malaysia.

Ahmad, F.B and Holdsworth, D.K. (1994). Medicinal plants of Sarawak, Malaysia, Part 1.

The Kedayans. Pharmaceutical Biology, 32 (4): 384-387.

Akbar, M.H., Ahmed, O.H., Jamaluddin, A.S., Majid, N.M. N.A., Abdul-Hamid, H., Jusop, S.,

Hassan, A., Yusof, K.H. and Abdu, A. (2010). Differences in soil physical and chemical properties

of rehabilitated and secondary forests. American Journal of Applied Sciences, 7 (9): 1200-1209.

Ariffin, D., Idris, A.S and Marzuki, A. (1996). Spread of Ganoderma boninense and vegetative

compatibility studies of a single field palm isolates. In: Ariffin, D. et al., (eds) Proceedings of the

1996 PORIM International Palm Oil Congress (Agriculture), September 1996. Palm Oil Research

Institute of Malaysia, Bangi, Selangor, Malaysia.pp:132-141.

Arnold, A.E., Maynard, Z., Gilbert, G.S., Coley, P.D. and Kursar, T.A. (2000). Are tropical

endophytic fungi hyper diverse. Ecology Letter, 3: 267-274.

Arnold, A.E., Maynard, Z and Gilbert, G.S. (2001). Fungal endophytes in dicotyledonous

neotropical trees: pattern of abundance and diversity. Mycological Research, 105: 1502-1507.

Arnold, A.E and Herre, E.A (2003). Canopy cover and leaf age affect colonization by tropical

fungal endophytes: ecological pattern and process in Theobroma cacao (Malvaceae).

Mycologia, 95: 388-398.

106

Arnold, A.E., Mejia, L.C., Kyllo, D., Rojas, E.I., Maynard, Z., Robbins, N and Herre, E.A (2003).

Fungal endophytes limit pathogen damage in a tropical tree. PNAS, Vol. 100.p. 15649-15654.

Ariffin, D., Idris, A.S. and Singh, G. (2000). Status of Ganoderma in oil palm. In: Ganoderma

Diseases of Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 49-68. United

Kingdom, CABI Publishing.

Arif, M.S., Roslan, A. and Idris, A.S. (2011). Economics of oil palm pests and Ganoderma disease

and yield losses. Proceedings of the third MPOB-IOPRI International Seminar: Integrated Oil

Palm Pests and Diseases Management. Kuala Lumpur Convention Centre: 14 November 2011.

Atmosukarto, I., Castillo, U., Hess, W.M., Sears, J and Strobel, G.A. (2005). Isolation and

characterization of Muscodor albus I-41.3s, a volatile antibiotic producing fungus. Plant

Science, 169: 854-861.

Bacon, C.W and White, J.F. (2000). Microbial endophytes. New York: Marcel Dekker

Bai, Y., Aoust, F., Smith, D., Driscoll, B. (2002). Isolation of plant growth promoting Bacillus

strains from soybean root nodules. Canadian Journal Microbiology, 48: 230-238.

Baldauf, S.L. (2003). Phylogeny for the paint of heart: a tutorial. TRENDS in Genetics, 19 (6):

345-351.

Bernicchia, A., Savino, E. and Gorjon, S.P. (2007). Aphyllophoraceous wood-inhibating

fungi on Pinus spp. in Italy. Mycotaxon, 101: 5-8.

Boyle, C., Gotz, M., Dammann-Tugend, U and Schulz, B. (2001). Endophyte-host interactions III.

Local vs. systemic colonization. Symbiosis, 31:259-281.

Cheong, Y.L., Burkart, K., Leitao, P.J. and Lakes, T. (2013). Assessing weather effects on dengue

disease in Malaysia. International Journal of Environmental Research and Public Health, 10:

6319-6334.

107

Corner, E.J.H. (1932). The fruitbody of Polystictuc xanthopus Fr. Annals of Botany, 46:71-111.

Corner, E.J.H. (1983). Ad Polyporaceae I. Amauroderma and Ganoderma. Nova Hedwigia, 75:

1-182.

Daisy, B., Strobel, G.A., Castillo, U., Ezra, D., Sear, J., Weaver, D.K and Runyon, J.B. (2002).

Naphtalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic

fungus. Microbiology, 148: 3737-3741.

Dix, N.J and Webster, J. (1995). Fungal Ecology. Chapman and Hall, London, pp. 1-60.

Dreyfuss, M.M and Chapela, I.H (1994). Potential of fungi in the discovery of novel, low-

molecular weight pharmaceuticals. p. 49-80. In V.P. Gullo (ed.), the discovery of natural

products with therapeutic potential. Butterworth- Heinemann. London.

Drenth, A and Sendall, B (2004). Economic Impact of Phytophthora Diseases in Southeast Asia.

In: Diversity and Management of Phytophthora in Southeast Asia (Eds. Drenth, A. & Guest, D.I.

(2004). ACIAR Monograph 114. BPA Print Group PTY Ltd, Melbourne, Australia.p.10-28.

Drenth, A and Guest, D.I. (2004). Phytophpthora in the Tropics. In: Diversity and Management

of Phytophthora in Southeast Asia (Eds. Drenth, A. & Guest, D.I. (2004). ACIAR Monograph 114.

BPA Print Group PTY Ltd, Melbourne, Australia.p.10-28.

Dompeipen, E. J., Srikandace, Y., Suharso, W. P., Cahyana, H. and Simanjuntak, P. (2011).

Potential Endophytic Microbes Selection for Antidiabetic Bioactive Compounds Production.

Asian Journal of Biochemistry, 6: 465-471.

Ezra, D and Strobel, G.A. (2003). Effect of substrate on the bioactivity of volatile antimicrobials

produced by Muscodor albus. Plant Science, 165: 1229 -1238.

Ezra, D., Hess, W.M and Strobel, G.A. (2004). New endophytic isolates of Muscodor albus, a

volatile-antibiotic-producing fungus. Microbiology, 150: 4023-4031.

108

Farid, M.A., Lee, S.S., Maziah, Z., Rosli, H and Norwati, M. (2005). Basal root rot, a new

disease of Teak (Tectona grandis) in Malaysia caused by Phellinus noxius. Malaysian Journal of

Microbiology, 1(2): 40-45.

Firakova, S., Sturdikova, M. and Muckova, M. (2007). Bioactive secondary metabolites

produced by microorganisms associated with plants. Biologia, 62: 251-257.

Flood, J., Hasan, Y., Turner, P.D. and O’Grady, E.B. (2000). The spread of Ganoderma from

infective sources in the field and its implications for management of the disease in oil palm. In:

Ganoderma Diseases of Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 104-

112. United Kingdom, CABI Publishing.

Gilberston, R.L. and Adaskaveg, J. E. (1993). Studies on wood-rotting basidiomycetes of

Hawaii. Mycotaxon, Vol XLIX: 369-397.

Hallman, J., Quadt-Hallmann, A., Mahaffee, W.F and Kloepper, J.W. (1997). Bacterial

endophytes in agricultural crops. Canadian Journal Microbiology, 43: 895-914.

Hasan, Y and Turner, P.D. (1998). The comparative importance of different oil palm tissues as

infection sources for basal stem rot in replantings. The Planter, 74: 119-135.

Hawksworth, D.L. and Rossman, A.Y (1997). Where are all the undescribed fungi?

Phytopathology. Vol. 89. No.9.p. 888-891.

Hawksworth, D.L (2001). The magnitude of fungal diversity: the 1.5 million species estimate

revisited. Mycological Research, 105: 1422-1432.

Ho, Y.W and Nawawi, A. (1985). Ganoderma boninense Pat. From basal stem rot of oil palm in

Peninsular Malaysia. Pertanika, 8: 425-428.

Ingold, C.T. (2002). A love affair with giant polypores. Mycologist, 16: 162-164.

109

Forest Department Sarawak, 2013. Fact and Figures. (www.

http://www.forestry.sarawak.gov.my/modules/web/pages.php.)

Freire, E.S., Pinho, R.S.C., Oliveira, D.F., Faria, M.R., Pohlit, A.M., Noberto, N.P., Rezende, E.L.,

Pfenning, L.H and Silva, J.V.C. (2012). Volatiles substances produced by Fusarium oxysporum

from coffee rhizosphere and other microbe affect Meloidogyne incognita and Arthrobotrys

conoides. The Journal of Nematology, 44 (4): 321-328.

Gabler, F.M., Fassel, R., Mercier, J and Smillanick, J.L. (2006). Influence of temperature,

inoculation interval, and dosage on biofumigation with Muscodor albus to control postharvest

Gray Mold on grapes. Plant disease, 90 (8): 1019-1025.

Griffin, M.A., Spakowicz, D.J., Gianoulis, T.A and Strobel, G.A. (2010). Volatile organic

compound production by organisms in the genus Ascocoryne and a re-evaluation of myco-

diesel production by NRRL 50072. Microbiology, 156: 3814-3829.

Gomori, G. (1955). Preparation of buffers for use in enzyme studies. In Methods of Enzymology

(S.P. Colowick & Caplan, N.O., eds): 138-146. Academic Press, New York.

González, M. C., Anaya, A. L., Glenn, A. E., Macías-Rubalcava, M. L., Hernández-Bautista, B. E.

and Hanlin, R. T (2009). Muscodor yucatanensis, a new endophytic ascomycete from Mexican

chakah, Bursera simaruba. Mycotaxon, 110 (10): 363-372.

Hazalin, N.A.M.N., Ramasamy, K., Lim, S.M., Wahab, I.A., Cole, A. L.J., Abdul Majeed, A. B.

(2009). Cytotoxic and antibacterial activities of endophytic fungi isolated from plants at the

National Park, Pahang, Malaysia. BMC Complementary and Alternative Medicine 2009, 9:46

Hazalin, N.A.M.N., Ramasamy, K., Lim, S.M., (2012). Induction of apoptosis against cancer cell

lines by four ascomycetes (endophytes) from Malaysian rainforest. Phytomedicine, 19 (7): 609-

617.

110

Idris, A.S., Ariffin, D., Swinburne, T.R and Watt, T.A. (2000). The identity of Ganoderma species

responsible for BSR disease of oil palm in Malaysia- Morphological characteristics. MPOB

Information series.

Idris, A.S., Ismail, S., Ariffin, D and Ahmad, H. (2002). Control of Ganoderma-infected palms-

development of pressure injection and field application. MPOB Information series.

Idris, A.S., Ismail, S., Ariffin, D and Ahmad, H. (2004). Prolonging the productive life of

Ganoderma-infected palms with hexaconazole. MPOB Information series.

Idris, A.S., Ismail, S and Ariffin, D. (2005). Reducing risk of Ganoderma in supply palms. MPOB

Information series.

Idris, A.S., Kushairi, D., Ariffin, D and Basri, M.W. (2006). Technique for inoculation of oil palm

geminated seeds with Ganoderma. MPOB Information series.

Idris, A.S and Arifurrahman, R. (2008). Determination of 50% effective concentration (EC50) of

fungicides against pathogenic Ganoderma. MPOB Information series.

Idris, A.S., Zaiton, S and Noorhaida, S. (2008). In vitro methods for evaluation of antagonistic

bacteria and actinomycetes against pathogenic Ganoderma. MPOB Information series.

Idris, A.S., Azahar, T., Wahid, O., Hasnol, O and Tarmizi, A.M. (2009). Spatial pattern and

hotspot analyses of Ganoderma disease in oil palm plantations using the geographical

information system. MPOB Information series.

Idris, A.S., Noor Haida, S and Nur Rashyeda, R. (2010). GanoEF1-A fungal biocontrol agent for

Ganoderma in oil palm. MPOB Information series.

Idris, A.S and Maizatul, S.M. (2012). Stump treatment with dazomet for controlling Ganoderma

disease in oil palm. MPOB Information series.

111

Idris, A.S., Nur Rashyeda, R., Maizatul, S.M., Madihah, A.Z., Tarmizi, A.M., Kushairi, D., Wan

Azha, W.M and Tong Peng, S.H. (2012). Biofertiliser Hendersonia GanoEF as biological control

of Ganoderma in oil palm. MPOB Information series.

Idris, A.S., Mior, M.H.A.Z., Rusli, M.H., Wahid, O and Zulkifli, H. (2013). Effects of Planting

Density on Outbreak of Ganoderma Disease. Proceedings of the 5th MPOB-IOPRI International

Seminar: Sustainable Management of Pests and Diseases in Oil Palm- The Way Forward. Kuala

Lumpur Convention Centre, 22 November 2013.

Jeffrey, L.S.H., Son, R. and Tosiah, S. (2008). Preliminary screening of endophytic fungi isolated

from medicinal plants at MARDI Sessang, Sarawak for their bioactivity. Journal Tropical

Agriculture and Fundamental Science, 36 (1):121-126.

Jelani, A.R., Hitam, A., Khalid, R., Idris, A.S., Shuib, A.R., Aminulrashid and Ismail, F. (2004).

Mechanical trunk injection for control of Ganoderma. MPOB Information series.

Jennings, D.H and Lysek, G. (1996). Fungal Biology: Understanding the fungal lifestyle. United

Kingdom: Bios Scientific Publishers.pp. 1-143

Jones, A.C and Ostry, M.E. (1998). Estimating white trunk rot in Aspen stands. Northern Journal

of Applied Forestry, 15: 33-36.

Khairil, M.M.R. and Hasmadi, M.I. (2010). Applying GIS for mapping agriculture roads network

in Felda Trolak Utara for Oil Palm Plantation Management. Information Management and

Business Review, 1 (1):11-15.

Khairuddin, H. (1993). Basal stem rot of oil palm caused by Ganoderma boninense. An update,

PORIM, International Palm Oil Congress, Update and vision. PORIM, Kuala Lumpur. pp: 739-

749.

Khairuddin, H. (1995). Basal stem rot of oil palm caused by Ganoderma boninense. In: 1993

PORIM, International Palm Oil Congress, Kuala Lumpur, Malaysia.

112

Kobayashi, D.Y and Palumbo, J.D. (2000). Bacterial endophytes and their effects on plants and

uses in agriculture. In: Bacon, C.W and White, J.F. (Eds) Microbial endophytes. Dekker, New

York, pp: 199-236.

Kogure, T., Douglas Kinghorn, A., Yan, I., Bolon, B., Lucas, D.M., Grever, M.R and Patel, T.

(2013). Therapeutic potential of the translation inhibitor silvestrol in Hepatocellular cancer.

PLoS One, 8 (9).

Kudalkar, P., Strobel, G.A., Hasan, S.R.U., Geary, G and Sears, J. (2012). Muscodor sutura, a

novel endophytic fungus with volatile antibiotic activities. Mycoscience, 53: 319-325.

Lacey, L.A., Horton, D.R., Jones, D.C., Headrick, H.L and Neven, L.G. (2009). Efficacy of the

biofumigant fungus Muscodor albus (Ascomycota: Xylariales) for control of codling moth

(Lepidoptera: Tortricidae) in simulated storage condition. Journal of Economic entomology,

102(1): 43-49.

Lee, S.S. (2003). Pathology of tropical hardwood plantations in South-Eastasia. New Zealand

Journal of Forestry Science, 33 (3): 321-335.

Lee, B.S and Lum, K.Y (2004). Phytophthora Diseases in Malaysia. In: Diversity and

Management of Phytophthora in Southeast Asia (Eds. Drenth, A. & Guest,

D.I. (2004). ACIAR Monograph, 114. BPA Print Group PTY Ltd, Melbourne, Australia.p.60-69.

Liang, H., Xing, Y., Chen, J., Zhang, D., Guo, S. and Wang, C. (2012). Antimicrobial activities of

endophytic fungi isolated from Ophiopogon japonicus (Liliaceae). BMC Complementary and

Alternative Medicine, 12:238

Lim, K.H and Udin, W. (2010). Management of Ganoderma in peat soil in Indonesia. Paper

presented in 2010 Second International Seminar Oil Palm Diseases: Advances in Ganoderma

research and management. 31 May 2010, Sheraton Hotel- Yogyakarta, Indonesia.p. 11.

Loh, H.P. (1999). The essentials of oil palm replanting: United Plantations' experience. Planter

(Malaysia), 75 (879), p. 289-303.

113

Lumyong, S., Lumyong, P., Mckenzie, E.H.C and Hyde, K. (2002). Enzymatic activity of

endophytic fungi of six native seedlings of Pinus resinosa on iron tailings. Canadian Journal

Botanical, 66:55-60.

Maizatul, S.M., Idris, A.S., Madihah, A.Z., Nasyaruddin, M.N.M and Kushairi, A. (2012).

Burkholderia GanoEB2 powder as biological control of Ganoderma in oil palm. MPOB

Information series.

Mathan, S., Vasuki, S and Nagamony, S (2013). Optimization and antimicrobial metabolite

production from endophytic fungi Aspergillus terreus KC582297. European Journal of

Experimental Biology, 3 (4): 138-144.

Mercier, J and Manker, D.C. (2005). Biocontrol of soil-borne diseases and plant growth

enhancement in greenhouse soilless mix by the volatile-producing fungus Muscodor albus.

Crop protect, 24: 355-362.

Malone, S.R and Ashworth, E.N. (1991). Freezing stress response in woody tissue observed

using low-temperature scanning electron microscopy and freeze substitution techniques. Plant

Physiology, 98: 871-881.

Meshram, V., Kapoor, N., and Saxena, S. (2012). Muscodor strobelli, new species from South

India. Mycoscience.

Meshram, V., Kapoor, N., and Saxena, S. (2013). Muscodor kashayum sp.nov. a new volatile

anti-microbial producing endophytic fungus. Mycology, 4 (4): 196 – 204.

Miller, R.N.G. (1995). The characterization of Ganoderma population in oil palm cropping

systems. PhD thesis, University of Reading, UK.

Mitchell, A.M., Strobel, G.A., Moore, E., Robinson, R and Sears, J. (2010). Volatile

antimicrobials from Muscodor crispans, a novel endophytic fungus. Microbiology, 156: 270-

277.

114

Mucciarelli, M., Scannerini, S., Bertea, C and Maffei, M. (2003). In vitro and in vivo peppermint

(Mentha piperita) growth promotion by nonmycorrhizal fungal colonization. New Phytologist,

158: 579-591.

Muhamad, I., Zainol, M., Sahid, I and Abu Seman, I. (2012). Determination of hexaconazole in

field samples of an oil palm plantation. Drug testing and analysis, 4 (1):112-117.

Muramatsu, H., Shahab, N., Tsurumi, Y., and Hino, M. (2003). A comparative Study of

Malaysian and Japanese Actinomycetes Using a Simple Identification Method Based on Partial

MPOB Information series.

Nurrashyeda, R., Idris, A.S., Madihah, A.Z., Ramle, M and Kushairi, A. (2011). Hendersonia

GanoEF1 granules for the control of Ganoderma boninense in oil palm. MPOB Information

series.

Nasyaruddin, M.N., Idris, A.S., Maizatul, S.M., Madihah, A.Z and Kushairi, A. (2011).

Pseudomonas GanoEB3 powder for the control of Ganoderma boninense in oil palm. MPOB

Information series.

Nelson, P.N., Rhebergen, T., Berthelsen, S., Webb, M.J., Banabas, M., Oberthur, T., Donough,

C.R., Rahmadsyah, Indrasuara, K and Lubis, A. (2011). Soil acidification under oil palm: rates

and effects on yield. Better Crops, 95 (4): 22-25.

Ommelna, B.G., Jennifer, A.N. and Chong, K.P. (2012). The potential of chitosan in suppressing

Ganoderma boninense infection in oil-palm seedlings. Journal of Sustainability Science and

Management, 7 (2).p: 186-192.

Ostrofsky, A., Jellison, J., Smith, K.T and Shortle, W.C. (1997). Changes in cation concentrations

in red sprude wood decayed by brown rot and white rot fungi. Canadian Journal of Forest

Research, 27: 567-571.

115

Othman, A.S., Samsiah, M.S., Ishak, Z. and Russman, N. (2008). Endophytic fungi in Theobroma

cacao L. leaves (clones PBC123 and KKM22). Malaysian Cocoa Journal, 4: 6-12.

Petrini, O. (1991). Fungal endophytes of tree leaves. In: Andrews, J., Hirano, S. (Eds) Microbial

ecology of leaves. Springer, New York Berlin Heidelberg, pp: 179-197.

Pegler, D.N. (1997). The Larger Fungi of Borneo. Natural History Publications, Kota Kinabalu,

Malaysia, pp. 2-20.

Petrini, O., Sieber, T., Toti, L and Viret, O (1992). Ecology, metabolite production, and substrate

utilization in endophytic fungi. Natural Toxins, 1: 185-196.

Roy, A. and De, A.B. (1996). Taxonomy of Daedalea roseola comb. Nov. Mycotaxon, LVIIII: 413-

417.

Ramasamy, S. (1972). Cross-infectivity and decay ability of Ganoderma species parasitic to

rubber, oil palm and tea. Bachelor Agriculture Science, Project Report, University Malaya.

Saikkonen, K., Faeth, S.H., Helander, M and Sullivan (1998). Fungal endophytes: A continuum

of interactions with host plants. Annual Review Ecology System, 29: 319-343

Saikkonen, K., Helander, M and Faeth, S.H (2004). Fungal endophytes: hitch-hikers of

the green world. Plant Microbiology.p. 81-100.

Saitou, N and Nei, M. (1987). The neighbor-joining method: A new method for reconstructing

phylogenetic trees. Molecular Biology and Evolution, 4: 406-425.

Sanderson, F.R., Pilotti, C.A. and Bridge, P.D. (2000). Basidiospores: Their influence on our

thinking regarding a control strategy for basal stem rot of oil palm. In: Ganoderma Diseases of

Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 113-128. United Kingdom,

CABI Publishing.

Sankaran, T and Syed, R.A. (1972). The natural enemies of bagworms on oil palms in Sabah,

East Malaysia. Pasific Insects, 14 (1): 57-71.

116

Sapak, Z., Meon, S and Ahmad, Z.A.M (2008). Effect of endophytic bacteria on growth and

suppression of Ganoderma Infection in oil palm. International Journal of Agriculture & Biology,

10: 127- 132.

Sarawak Planning Unit (2013). The Report Sarawak 2013. Oxford Business Group, Sarawak,

Malaysia.

Sariah, M. and Zakaria H. (2000). The use of soil amendments for the control of basal stem rot

of oil palm seedlings. In: Ganoderma Diseases of Perennial crops (Flood, J., Bridge, P.D. and

Holderness, M., ed.), p. 89-99. United Kingdom, CABI Publishing.

Saxena, S., Meshram, V and Kappor, N (2014). Muscodor tigerii sp. Nov. volatile antibiotic

producing endophytic fungus from the Northeastern Himalayas. Annual Microbiology.

Schnabel, G and Mercier, J. (2006). Use of Muscodor albus pad delivery system for the

management of brown rot of peach in shipping cartons. Postharvest Biology and Technology,

42: 121-123.

Schulz, B and Boyle, D. (2005). The endophytic continuum. Mycological Research, 109: 661-

687.

Schulz, B., Rommert, A.K., Dammann, U., Aust, H.J and Strack, D. (1999). The endophyte-host

interaction: a balanced antagonism. Mycological Research, 103: 1275-1283.

Schulz, B., Boyle, C., Draeger, S., Rommert, A.K and Krohn, K. (2002). Endophytic fungi: a source

of biologically active secondary metabolite. Mycological Research, 106: 996-1004.

Shahid, A.A., Rao, A.Q., Bakhsh, A and Husnain, T. (2012). Entomopathogenic fungi as biological

controllers: New insights into their virulence and pathogenicity. Arch. Biol. Sci., Belgrade, 64

(1): 21-24.

117

Shamala, S and Idris, A.S. (2009). Assessment of arbuscular mycorrhiza (AM) as a vegetative

growth enhancer for oil palm. MPOB Information series.

Shariffah Muzaimah, S.A., Idris, A.S., Madihah, A.Z and Kushairi, A. (2012). Streptomyces

GanoSA1 powder as biological control of Ganoderma in oil palm. MPOB Information series.

Sieber, T.N. (2002). Fungal root endophytes. In: Waisel, Y., Eshel, A and Kafkafi, U (Eds) The

hidden half. Dekker, New York.pp: 887-917.

Singh, G. (1990). Ganoderma-scourage of oil palm in the coastal area. In: Proceedings of the

Ganoderma workshop, 11 september , (Ariffin, D and Jalani, S. eds). Palm oil research Institute

of Malaysia, Kuala Lumpur.pp: 7-35.

Singh, G. (1991). Ganoderma-the scourage of oil palms in the coastal areas. The Planter, 67:

421-444.

Stewart A, Brownbridge M, Hill RA & Jackson TA (2009). Utilizing soil microbes for biocontrol.

In Dickson CR & Tilston E eds Soil microbiology and sustainable crop production. Springer,

Dordtrecht (in press)

Stinson, A.M., Zidack, N.K., Strobel, G.A. and Jacobsen, B.J. (2003). Mycofumigation with

Muscodor albus and Muscodor roseus for control of seedling of sugarbeet and Verticillium wilt

of eggplant. Plant Disease, 87 (11): 1349-1354.

Stone, J.K., Bacon, C.W and White, J.F. (2000). An overview of endophytic microbes:

endophytism defined. In: Bacon, C.W and White, J.F. (Eds) Microbial endophytes. Dekker, New

York.pp: 3-30.

Strobel, G.A., Yang, X.S., Sears, J., Kramer, R., Sidhu, R.S., Hess, W.M. (1996) Taxol from

Pestalotiopsis microspora, an endophytic fungus of Taxus wallachiana. Microbiology,142:435-

440.

118

Strobel, G.A., Hess, W.M., Li, J.Y., Ford, E., Sears, J., Sidhu, R.S and Summerell, B. (1997).

Pestalotiopsis guepinii, a taxol producing endophytic of the Wollemi pine, Wollemia nobilis.

Australian Botanical Journal, 45: 1073-1082.

Strobel, G.A., Dirkse, E., Sears, J and Markworth, C., (2001). Volatile antimicrobials from a novel

endophytic fungus. Microbiology, 147: 2943 – 2950

Strobel, G.A., Ford, E., Worapong, J., Harper, J.K., Arif, A.M., Grant, D.M., Fung, P.C.W and

Chan, K. (2002). Ispoestacin, an isobenzofuranone from Pestalotiopsis microspore, possessing

antifungal and antioxidant activities. Phytochemistry, 60: 179- 183.

Strobel G.A., Daisy B., Castillo U and Harper J. (2003). Natural Products from Endophytic

Microorganisms.

Strobel, G.A and Daisy, B. (2003). Bioprospecting for microbial endophytes and their natural

products. Microbiology and Molecular Biology Review, 67: 491-502.

Sturz, A.V and Nowak, J. (2000). Endophytic communities of rhizobacteria and the strategies required to create yield enhancing associations with crops. Applied Soil Ecology, 15:183–190.

Susanto, A., Sudharto, P.S and Purba, R.Y. (2005). Enhancing biological control of basal stem

rot disease (Ganoderma boninense) in oil palm plantations. Mycopathologia, 159 (1): 153-157.

Tamura, K., Nei, M and Kumar, S. (2004). Prospects for inferring very large phylogenies by

using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA),

101: 11030-11035.

Suwannarach, N., Bussaban, B., Hyde, K. D. and Lumyong, S. (2010). Muscodor cinnamomi, a

new endophytic species from Cinnamomum bejolghota. Mycotaxon, 114: 15–23.

Suwannarach, N., Kumla, J., Bussaban, B., Hyde, K. D., Matsui, K and Lumyong, S. (2013).

Molecular and morphological evidence support four new species in the genus Muscodor from

northern Thailand. Annual Microbiology. doi:10.1007/s13213-012-0593-6.

119

Tudzynski, B and Sharon, A. (2002). Biosynthesis, biological role and application of fungal

hormones. In: Osiewacz, H.D. (Ed) The mycota X industrial applications, Springer, Berlin

Heidelberg New York. Pp: 183-211.

Turner, P.D. (1965). Infection of oil palms by Ganoderma. Phytopathology, 55: 937.

Turner, P.D. (1981). Oil palm diseases and disorders. Oxford University Press, Oxford.pp: 88-

110.

Wang, C.J.K. and Zabel, R.A. (1990). Identification manual for fungi from utility poles in the

Eastern United Stated.

Wahid, M.B and Simeh, M.A. (2008). Issues related to production cost of palm oil in Malaysia.

Oil Palm Industry Economic Journal, 9 (2):1 -12.

Watkinson, S.C., Boddy, L., Burton, K., Darrah, P.R., Eastwood, D., Fricker, M.D and Tlalka, M.

(2005). New approaches to investigating the function of mycelial networks. Mycologist, 19 (1):

11-17.

Wheatley, R., Hackett, C and Bruce, A. K. (1997). Effect of substrate composition on the

production of volatile organic compounds from Trichoderma spp. inhibitory to wood decay

fungi. Internation Biodeterioration & Biodegradation, 39: 199-205.

White, T.J., Bruns, T and Taylor, J.W. (1990). Amplifications and direct sequencing of fungal

ribosomal RNA genes for phylogenetics. In PCR Protocols: A guide to methods and applications.

Edited by Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. Academic Press, Inc.,California:

315-324.

Wilde W.J.J.O.D (2000). Myristicaceae. In Tree Flora of Sabah and Sarawak Vol. Three (Eds:

Soepadmo, E. & Saw, L.G.). Ampang Press Sdn. Bhd. Kuala Lumpur, Malaysia.

Worapong, J, Strobel, G.A., Ford, E.J., Li, J.Y., Baird, G. and Hess, W.M (2001) Muscodor albus

anam. Nov. an endophyte from Cinnamomum zeylanicum. Mycotaxon 79: 67-79

120

Worapong, J., Strobel, G., Daisy, B., Castillo, U. F., Baird, G. and Hess, W.M. (2002). Muscodor

roseus anam. sp. nov., an endophyte from Grevillea pteridifolia. Mycotaxon, 81: 463-475.

Worapong, J. and Strobel, G.A (2009). Biocontrol of a root rot of kale by Muscodor albus strain

MFC2. Biocontrol, 54:p.301-306

World Heritage, 2000. Natural Heritage, Properties inscribed on the world heritage list

(Property: Gunung Mulu National Park) in Twenty-fourth session report, WHC-

2000/CONF.204/21. Convention concerning the protection of the world cultural and Natural

Heritage. Pp: 36-37.

Xiao, C.L. and Sitton, J.W. (2004). Effects of culture media and environmental factors on

mycelia growth and pycnidial production of Potebniamyces pyri. Mycological Research, 108

(8): 926-932.

Yates, I., Bacon, C.W and Hinton, D.M. (1997). Effects of endophytic infection by Fusarium

moniliforme on corn growth and cellular morphology. Plant Disease, 81: 723-728.

Yusof, B and Chan, K.W. (2004). The oil palm and its sustainability. Journal of Oil Palm

Research, 16 (1): 1-10.

Zhang, C. L., Wang, G. P., Mao, L. J., Komon-Zelazowska, M., Yuan, Z. L., Lin, F. C., Druzhinina, I.

S., Kubicek, C. P. (2010). Muscodor fengyangensis sp. nov. from southeast China: morphology,

physiology and production of volatile compounds. Fungal Biology, 114(10):797-808.

Zitter, T. A., D. L. Hopkins, and C. E. Thomas (Editors). (1996). Compendium of Cucurbit

Diseases. American Phytopathological Society.

Zulkifli, H., Halimah, M., Chan, K.W., Choo, Y.M and Mohd Basri, W. (2010). Life cycle

assessment for oil palm fresh fruit bunch production from continued land use for oil palm

planted on mineral soil (part 2). Journal of Oil Palm Research, (22): 887-894.