diet composition modulate expression of sirtuins and renin-angiotensin system components in adipose...
Post on 19-Dec-2016
218 Views
Preview:
TRANSCRIPT
Diet Composition Modulates Expressionof Sirtuins and Renin-Angiotensin SystemComponents in Adipose TissueLucin�eia de Pinho1, Joao Marcus Oliveira Andrade1, Alanna Paraıso1, Aristides Batista Maia Filho1, John D.Feltenberger1,2, Andr�e Luiz Sena Guimaraes1, Alfredo Mauricio. Batista de Paula1, Antonio Prates Caldeira1,Ana Cristina de Carvalho Botelho1, Maria Jos�e Campagnole-Santos3 and S�ergio Henrique Sousa Santos1,3
Objective: The aim of this study was to evaluate the expression of RAS components and SIRTs enzymes
in the adipose tissue of mice fed diets with different macronutrient composition.
Design and Methods: The body weight, food intake, and energy intake (kcal) were evaluated. Blood
parameters (insulin sensitivity, glucose tolerance, total cholesterol, HDL-C triglyceride, and glucose levels)
were also assessed. Real-time PCR was performed in epididymal adipose tissue samples to analyze the
expression of renin, angiotensinogen (AGT), angiotensin-converting enzyme 1 and 2 (ACE and ACE2),
and SIRTs 1-7. Male FVB/N mice were divided into 5 groups (N ¼ 10 each) that were fed with
experimental diets for 60 days. Test diets were divided into standard (ST), AIN-93M, high glucose (HG),
high protein (HP) and high lipid (HL).
Results: The main results showed that HL diet treatment induced reduction in HDL-C and triglyceride
plasma levels; increased ACE (Ang II marker) expression and decreased ACE2 (Ang-[1-7] catalyzer)
expression in adipose tissue; and also increased SIRT4 expression.
Conclusion: Diets with high lipid content induced a degenerative state associated with deregulation of
adipose tissue enzymes expression.
Obesity (2013) 21, 1830-1835. doi:10.1002/oby.20305
IntroductionSeveral studies pointed out an important role of diet composition in
metabolic regulation and energy balance (1). The ideal proportion of
dietary macronutrients and the molecular adaptations of the adipose
tissue in response to diets with different nutrient levels are matters
of discussion (2). Adipose tissue modulates several physiological
processes and is likely associated with metabolic regulation, working
as an essential endocrine organ (3).
Adipose tissue contains many components of the renin-angiotensin
system (RAS) (4), including angiotensin II (Ang II), a potent pro-
inflammatory, pro-oxidant, and pro-thrombotic agent that affects in-
tracellular insulin signaling (5). The levels of Ang II and of its cata-
lyzer enzyme, the angiotensin-converting enzyme (ACE), are related
to obesity and diabetes (6). ACE/AngII/AT1, RAS arm, is counter-
balanced by the angiotensin-converting enzyme 2 (ACE2)/Ang-(1-
7)/MAS axis, which improves glucose and fat metabolism thereby
decreasing body fat (6,7). Also, the seven classes of sirtuins
(SIRT1-7) have been included in studies of energy balance, meta-
bolic regulation, inflammation, and obesity (8).
Although RAS components and SIRTs are likely related to obesity,
and studies showed similarities when comparing the metabolic
effects induced by Angiotensin-(1–7) and Resveratrol (a SIRT acti-
vator), the effect of diet composition on the activation of these sys-
tems is yet to be studied. In this sense, the aim of this study was to
evaluate the relationships between diet composition balance and the
expression of RAS and sirtuins in the adipose tissue of mice treated
with diets presenting different macronutrient proportions. This study
is the first study to investigate the role of dietary macronutrients on
the expression of RAS and SIRT components in the adipose tissue.
Data on feeding and blood parameters were also assessed.
Methods and ProceduresFifty male mice, aged 8 weeks, were divided into 5 groups that
were fed with experimental diets for 60 days (N ¼ 10 per treat-
ment). The mice of FVB/N lineage were housed in individual cages,
under 12h:12h light-dark cycle (lights on from 7:00 to 19:00 h) and
at 25.0 6 2.0�C temperature. Food and water were offered adlibitum.
1 Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), MontesClaros, Brazil. Correspondence: S�ergio H. S. Santos (sergiosousas@hotmail.com) 2 Touro University Nevada School of Osteopathic Medicine, Las Vegas,Nevada, USA 3 Institute of Biological Sciences, Departments of Pharmacology and Physiology, Universidade Federal de Minas Gerais, Minas Gerais, Brazil
Disclosure: The authors have no competing interests.
Received: 1 August 2012 Accepted: 30 November 2012 Published online 14 February 2013. doi:10.1002/oby.20305
1830 Obesity | VOLUME 21 | NUMBER 9 | SEPTEMBER 2013 www.obesityjournal.org
Original ArticleOBESITY BIOLOGY AND INTEGRATED PHYSIOLOGY
Obesity
The experimental diets and their composition (carbohydrate/protein/
lipid ratio, calories in kcal/g) were standard diet (ST, 50/42/8, 2.86),
AIN-93M diet (76/14/10, 3.69) (9), high-glucose diet (HG, 90/14/10,
3.66), high-protein diet (HP, 76/28/10, 3.65), and high-lipid diet
(HL, 76/14/25, 3.84). Experimental diets were formulated as
described in previous studies (10). The ST diet was tested to include
a control with less carbohydrate content (2.86 versus 3.69 kcal/g in
AIN-93).
Body weight (BW), food intake, and energy intake (food intake in
kcal) were recorded every two weeks. At the end of the experiment,
insulin sensitivity was tested by determination of glucose levels in
tail blood at 0, 15, 30, and 60 min after intraperitoneal injection of
0.75 U insulin/kg BW (Sigma, St Louis, MO, USA). After two
days, the mice were subjected to glucose tolerance test by the mea-
surement of tail blood glucose at 0, 15, 30, 60, and 120 min after
12 h of fasting, using Accu-Check (Roche Diagnostics Corp India-
napolis, IN, USA). One week after the tests, when acute effects of
glucose and insulin administration had been completely eliminated,
the animals were sacrificed.
Blood samples were centrifuged (3,200 rpm for 10 min) and the
plasma was separated for the determination of total cholesterol,
HDL, and triglycerides, using enzymatic tests (Wiener Lab,
Argentina).
The mice were killed and samples of epididymal white adipose tis-
sue (WAT) were collected and stored in dry ice (–80�C) for further
evaluation. The WATs were prepared in Trizol reagent (Invitrogen
Corp.VR , San Diego, CA, USA) and treated with DNAse. Reverse
transcription was carried out with M-MLV (Invitrogen Corp.VR )
using random hexamer primers. Levels of the interested genes were
FIGURE 1 Feeding and adipose tissue formation in mice-fed standard (ST), AIN-93M, high-glucose (HG), high-protein (HP), and high-lipid (HL)diets (N ¼ 10 per treatment). (A) Weight gain; (B) food intake for g; (C) food intake for kcal; (D) epididymal adipose tissue; (E) retroperitonealadipose tissue. *P < 0.05; **P < 0.01 (one-way ANOVA).
Original Article ObesityOBESITY BIOLOGY AND INTEGRATED PHYSIOLOGY
www.obesityjournal.org Obesity | VOLUME 21 | NUMBER 9 | SEPTEMBER 2013 1831
determined by Real Time PCR (SYBR Green reagent) in Step One
Plus equipment (Applied Biosystems-EUA).
Gene expression was normalized to the endogenous GAPDH (FW:
5’AACGACCCCTTCATTGACCTC3’; RV: 5’CTTCCCATTCTCA
GCCTTGACT3’).
The genes of interest and respective primers were: Renin
(FW:5’GCTCTGGAGTCCTTGCACCTT3’; RV:5’TTGAGCGGGA
TGCGTTCAA3’); AGT (FW:5’GACGTGACCCTGAGCAGTCC3’;
RV:5’TGAGTCCCGCTCGTAGATGG3’); ACE (FW:5’CTCAGCC
TGGGACTTCTACAAC3’; RV:5’CTCCATGTTCACAGAGGTA-
CACT3’); ACE2 (FW:5’GGCTCCTTCTCAGCCTTG3’; RV:5’TTC
ATAAAAGGCAGACCATTTG3’); SIRT1 (FW:5’CCTTGGAG
ACTGCGATGTTA3’; RV:5’GTGTTGGTGGCAACTCTGAT3’);
SIRT2 (FW:5’GCAGTGTCAGAGCGTGGTAA3’; RV:5’CTAGT
GGTGCCTTGCTGATG3’); SIRT3 (FW:5’TACAGGCCCAATGT-
CACTCA3’; RV:5’ACAGACCGTGCATGTAGCTG3’); SIRT4
(FW:5’TCCCGGCAAAACCGGACTGT3’; RV:5’TCCCGGCAAA
ACCCGACTTT3’); SIRT5 (FW:5’GACTCAAGACGCCAGAA
TCC3’; RV:5’CAGAGGATGTTCCCACCACT3’); SIRT6 (FW:5’
CTGGTCTGGAACTCACTGCT3’; RV: 5’CGGGTGTGATTGGTA
GAGAG3’); and SIRT7 (FW:5’GGCACTTGGTTGTCTA CACG3’;
RV:5’GTGATGCTCATGTGGGTGAG3’).
Data on insulin sensitivity and glucose tolerance were eval-
uated by two-way ANOVA; the other parameters were ana-
lyzed by one-way ANOVA. Statistical differences, considered
FIGURE 2 Blood parameters of mice fed the experimental diets: standard (ST), AIN-93M, high glucose (HG), high protein (HP), and high lipid(HL) (N ¼ 10 per treatment). (A) HDL-C levels; (B) triglyceride levels; (C) cholesterol levels; (D) glucose levels; (E) insulin sensitivity curve; and(F) glucose tolerance curve. *P < 0.05; **P < 0.01 (one-way ANOVA).
Obesity Diet-Modulation of RAS and Sirtuins in Adipose de Pinho et al
1832 Obesity | VOLUME 21 | NUMBER 9 | SEPTEMBER 2013 www.obesityjournal.org
at an error probability of 0.01 and 0.05, were contrasted by
student’s t-test.
ResultsAverage weight gain was significantly lower in HG (22.15 6 1.65
g) than in AIN-93M (25.03 6 2.47), HP (24.29 6 2.93), and HL
(24.70 6 2.65) (Figure 1A). Mean food intake (per BW) was signifi-
cantly higher in ST (0.13 6 0.03) than in HL (0.09 6 0.02) (Figure
1B). Food intake per BW was higher in AIN-93M (0.37 6 0.09),
HP (0.40 6 0.14), and HG (0.38 6 0.07) than in the ST group (0.27
6 0.07, in kcal), with HL showing intermediary values (0.36 6
0.08) (Figure 1C). The mass of epididymal white adipose tissue was
significantly lower in ST (0.01 6 0.01) than in the AIN-93M (0.03
6 0.00) and HP (0.02 6 0.01) (Figure 1D). The mass retroperito-
neal white adipose tissue was not significantly affected by the treat-
ments as shown in Figure 1E.
Mice from HL had significantly lower HDL-C values (64.32 6
24.69, in mg/dL) compared with AIN-93M (118.25 6 45.13), and
the other treatments showed intermediary values (ST ¼ 90.98 6
23.90; HP ¼ 110.95 6 44.30; HG ¼ 110.27 6 25.22) (Figure 2A).
Also, triglyceride levels were lower in HL (73.20 6 32.61, in mg/
dL) than in HG (151.00 6 56.03), HP (152.50 6 47.97), and AIN-
93M (150.00 6 55.47) (Figure 2B), but all the groups were similar
to ST (106.02 6 47.58).
Total cholesterol (Figure 2C), glucose levels (Figure 2D), insulin
sensitivity (Figure 2E), and glucose tolerance (Figure 2F) were simi-
lar among the treatments.
The expression of mRNA for ACE was significantly higher in HL
(2.03 6 0.69, in arbitrary unit) than in ST (0.71 6 0.40) and AIN93-
M (0.61 6 0.56) (Figure 3A), and these groups were similar to HP
(1.40 6 0.97) and HG (1.11 6 0.71). For ACE2, the expression was
significantly higher for treatments AIN-93M (1.45 6 0.60) and HG
(1.46 6 0.33) than HL (0.70 6 0.45), and ST (1.09 6 0.45) and HP
(1.09 6 0.45) exhibited intermediary values (Figure 3B). The expres-
sion for renin (ST ¼ 103.63 6 38.96; AIN-93M ¼ 99.96 6 25.88;
HP ¼ 85.24 6 32.66; HG ¼ 100.74 6 39.69; HL ¼ 92.40 6 34.54)
(Figure 3C) and AGT was similar among the treatments (ST ¼103.63 6 38.96; AIN-93M ¼ 99.96 6 25.88; HP ¼ 85.24 6 32.66;
HG ¼ 100.74 6 39.69; HL ¼ 92.40 6 34.54) (Figure 3D).
The expression of SIRT4 was higher in HL (0.85 6 0.47) and HP
(0.29 6 0.32) than in HG treatment (0.29 6 0.85) (Figure 4A), and ST
(0.50 6 0.42) and AIN-93M (0.41 6 0.35) had intermediary values.
The expression of the other SIRTs did not differ among the treatments.
DiscussionThe main finding of this study shows that diet composition is
strongly related to adipose tissue modulation of RAS and SIRT4
expressions. High-fat diet increases the deleterious enzyme ACE and
FIGURE 3 Expression of components of the rennin-angiotensin system in epididymal adipose tissue of mice fed standard (ST), AIN-93M, high-glucose (HG), high-protein (HP) and high-lipid (HL) diets (N ¼ 10 per treatment). (A) Angiotensin-converting enzyme (ACE); (B) angiotensin-con-verting enzyme 2 (ACE2); (C) rennin; and (D) angiotensinogen (AGT). *P < 0.05; **P < 0.01 (one-way ANOVA).
Original Article ObesityOBESITY BIOLOGY AND INTEGRATED PHYSIOLOGY
www.obesityjournal.org Obesity | VOLUME 21 | NUMBER 9 | SEPTEMBER 2013 1833
decreases the benefits from enzyme ACE2. In addition, we demon-
strated that fat-rich diet affect the plasma lipid profile of mice,
reducing HDL-C. This diet also increases the expression of SIRT4.
The most caloric diet (HL) promoted satisfactory weight gain and
food intake for kcal, although food intake was lower. In contrast,
the ST diets, which had the lowest caloric density, were con-
sumed at high amounts. Mice from HG treatment had normal
food consumption and food intake per kcal but low weight gain.
It appears that mice balanced between energy intake and food
intake since the WAT formed in the different treatments were
similar.
FIGURE 4 Sirtuin expression in epididymal adipose tissue of mice-fed standard (ST), AIN-93M, high-glucose (HG), high-protein (HP), or high-lipid (HL)diet (N ¼ 10 per treatment). (A) SIRT1; (B) SIRT 2; (C) SIRT3; (D) SIRT4; (E) SIRT5; (F) SIRT6; and (G) SIRT7. *P< 0.05; **P< 0.01 (one-way ANOVA).
Obesity Diet-Modulation of RAS and Sirtuins in Adipose de Pinho et al
1834 Obesity | VOLUME 21 | NUMBER 9 | SEPTEMBER 2013 www.obesityjournal.org
The HL diet was based on soybean oil, which is rich in polyunsatu-
rated fatty acids (PUFA). PUFA decrease hepatic VLDL secretion
and also decrease triglyceride levels (11), as observed in HL-fed
mice. However, the consumption of diets with high PUFA content
increases fat oxidation and decreases HDL-C levels. Therefore, fat
sources and the profile of dietary fatty acids can be more significant
in the determination of the fat profile of the animal than the amount
to fat intake.
The HL diet increased ACE expression compared with ST and
AIN93-M, reinforcing the pro-inflammatory effects of this diet.
ACE converts Ang I into Ang II, which induces adipocyte hyper-
trophy (12,13), commonly observed in obese individuals. Ang II
produced in adipose tissues likely plays a modulatory role in fat
metabolism, mediating the relationship between obesity and
hypertension (7). A limitation of this study was that Ang II and
Ang-(1-7) levels were not determined directly because of restric-
tions to perform radioimmunoassay. However, the measurement of
ACE and ACE2 expressions is reliable to determine Ang II and
Ang-(1-7).
It was determined that changes in the adipose tissue can regulate
RAS. As shown in earlier studies, ACE can be considered an
environmental factor that modulates body response to the lipid-
rich diet (HL) (14). The level of ACE2, which counterbalances
RAS action, was higher in the WAT from mice of AIN-93M and
HG treatments than of HL treatment. Recent studies showed the
pivotal role of ACE2/Ang-(1-7)/Mas axis on the obesity
prevention and in the lipid/glucose metabolism improvement,
decreasing adipose proinflammatory markers (5–7). The present
findings reinforce the potential use of diet for regulating the RAS
system.
SIRT4 was the only sirtuin affected by the treatments. SIRT4 is
associated with the balance between fat and glucose metabolism
and participates in the inhibition of insulin production in pancreatic
b cells (15). We found higher SIRT4 expression in HL and HP
than in HG, indicating that excess fat and protein in the diet can
compromise insulin activity and complicate diabetes cases. We
have not detected effects of the dietary treatments on insulin sensi-
tivity, but this issue should be studied for a longer experimental
period.
In conclusion, the results obtained showed that high-fat diet can modu-
late the SIRT4 and RAS profile in adipose tissue pointing to a strong
participation of these systems on the obesity-related disorders.O
AcknowledgmentsThis work was supported by individual grants to SHS and MJC-S from
Conselho Nacional de Desenvolvimento Cientıfico e Tecnol�ogico
(CNPq), Coordenacao de Aperfeicoamento de Pessoal de Nıvel Superior
(CAPES) and Fundacao de Amparo a Pesquisa do Estado de Minas Ger-
ais (FAPEMIG) and by Pronex Project Grant/2010 (FAPEMIG/ CNPq).
VC 2013 The Obesity Society
References1. Abete I, Astrup A, Martınez JA, Thorsdottir I, Zulet MA. Obesity and the metabolic
syndrome: role of different dietary macronutrient distribution patterns andspecific nutritional components on weight loss and maintenance. Nutr Rev 2010;68:214–231.
2. Capel F, Viguerie N, Vega N, et al. Contribution of energy restriction and macronu-trient composition to changes in adipose tissue gene expression during dietaryweight-loss programs in obese women. J Clin Endocrinol Metab 2008;93:4315–4322.
3. Fantuzzi G. Adipose tissue, adipokines, and inflammation. J Allergy Clin Immunol2005;115:911–919.
4. Strazzullo P, Galletti F. Impact of the renin-angiotensin system on lipid and carbo-hydrate metabolism. Curr Opin Nephrol Hypertens 2004;13:325–332.
5. Santos SH, Fernandes LR, Pereira CS, er al. Increased circulating angiotensin-(1–7)protects white adipose tissue against development of a proinflammatory state stimu-lated by a high-fat diet. Regul Pept 2012;178(1-3):64–70.
6. Santos SH, Fernandes LR, Mario EG, et al. Mas deficiency in FVB/N mice pro-duces marked changes in lipid and glycemic metabolism. Diabetes 2008;57:340–347.
7. Santos SH, Braga JF, Mario EG, et al. Improved lipid and glucose metabolism intransgenic rats with increased circulating angiotensin-(1-7). Arterioscler ThrombVasc Biol 2010;30:953961.
8. Huang JY, Hirschey MD, Shimazu T, Ho L, Verdin E. Mitochondrial sirtuins. Bio-chim Biophys Acta 2010;1804:1645–1641.
9. Duffy PH, Lewis SM, Mayhugh MA, et al. Effect of the AIN-93M purified diet anddietary restriction on survival in Sprague-Dawley rats: implications for chronic stud-ies. J Nutr 2002;132:101–107.
10. Bianchetti ES, Costa dos Santos K, Perazzo FF, Carvalho JCT. Preclinical study ofthe interference of different nutritional diets on the anti-inflammatory and analgesicactions of etoricoxib. Lat Am J Pharm 2010;29;213–218.
11. Pan M, Cederbaum AI, Zhang YL, Ginsberg HN, Williams KJ, Fisher EA. Lipidperoxidation and oxidant stress regulate hepatic apolipoprotein B degradation andVLDL production. J Clin Invest 2004;113:1277–1287.
12. Mario EG, Santos SH, Ferreira AV, Bader M, Santos RA, Botion LM. Angiotensin-(1–7) Mas-receptor deficiency decreases peroxisome proliferator-activated receptorgamma expression in adipocytes. Peptides 2012;33:174–177.
13. Zorad S, Fickova M, Zelezna B, Macho L, Kral JG. The role of angiotensin II andits receptores in regulation of adipose tissue metabolism and cellularity. Gen Phys-iol Biophys 1995;15:383–391.
14. Heimann AS, Favarato MH, Gozzo FC, et al. ACE gene titration in mice uncoversa new mechanism for ACE on the control of body weight. Physiol Genomics 2005;20:173–182.
15. Haigis MC, Mostoslavsky R, Haigis KM, et al. SIRT4 inhibits glutamate dehydro-genase and opposes the effects of calorie restriction in pancreatic beta cells. Cell2006;126:941–954.
Original Article ObesityOBESITY BIOLOGY AND INTEGRATED PHYSIOLOGY
www.obesityjournal.org Obesity | VOLUME 21 | NUMBER 9 | SEPTEMBER 2013 1835
top related