Research Article Open Access

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

Open AccessResearch Article

Marine ScienceResearch & Development

Chatterjee and Haldar, J Marine Sci Res Dev 2012, S:1http://dx.doi.org/10.4172/2155-9910.S1-002

Keywords: Vibrios; Molecular techniques; PCR; 16S rRNA; FISH; AFLP; RAPD

Abbreviations: PCR: Polymer Chain Reaction; AFLP: Amplified Fragment Length Polymorphism; FISH: Fluorescence In Situ Hybridization; RAPD: Random Amplified Polymorphic DNA; rep-PCR: Repetitive Extragenic Palindrome–PCR; RFLP: Restriction Fragment Length Polymorphism; VBNC: Viable But Non-Culturable; FISHCH: FISH Following Cultivation

IntroductionAquaculture remains a growing, vibrant and important production

sector for high-protein animal food that is easily digestible and of high biological value. Globally, marine and inland capture fisheries provide two-thirds of the total food fish supply with the remaining one-third being derived from aquaculture [1]. The reported global production of food fish from aquaculture, including fin fishes, crustaceans, molluscs and other aquatic animals for human consumption, reached a staggering height of 52.5 million tons in 2008. The contribution of aquaculture to the total production of capture fisheries and aquaculture continued to grow, rising from 34.5% in 2006 to 36.9% in 2008. In the period 1970-2008, the production of food fish from aquaculture increased at an average annual rate of 8.3% according to The State of World Fisheries and Aquaculture 2010 [2].

However, a major setback in aquaculture is the sudden outbreak of diseases, especially those caused by Vibrio spp, which are considered a significant problem to the development of a sector with severe economic losses worldwide. Global estimation of disease losses by the World Bank in 1997, was approximately US $3 Billion per year [3]. Vibrio harveyi, and Vibrio anguillarum are most frequently isolated marine Vibrio species [4-7], having been associated with large-scale losses of larval and juvenile penaeids [8] and also causing several opportunistic diseases to fishes [9-13]. Due to the plasticity of Vibrio genomes, with frequent horizontal gene transfer events, species boundaries are very narrow in the marine environment [14]. Hence, the identification of Vibrio-related species isolated from the marine environment is

*Corresponding author: Shruti Chatterjee, Scientist Fellow (QHS), Biological Oceanography Division, National Institute of Oceanography, Regional Center, Lokhandwala Road, Four Bungalows, Andheri (West), Mumbai- 400053, India, Tel: 0832-2450-441; Fax: 0832-2450-660; E-mail: schatterjee@nio.org

Received September 21, 2011; Accepted April 21, 2012; Published April 23, 2012

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Copyright: © 2012 Chatterjee S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification MethodsShruti Chatterjee1* and Soumya Haldar2

1National Institute of Oceanography, Regional Centre, Lokhandwala Road, Four Bungalows, Andheri (West), Mumbai, India2Discipline of Marine Biotechnology and Ecology, Central Salt and Marine Chemicals Research Institute (CSIR), GB Marg, Bhavnagar, Gujarat, India

sometimes difficult. An array of phenotypic and genomic techniques has become available for the identification of vibrios in the last three decades [15-22]. Accurate identification is the basic step for developing appropriate prophylactic measures in any aquaculture setting. In the present study a detailed review was undertaken to study the diseases caused by vibrios in aquaculture settings and some of the important modern techniques used to accurately identify the disease-causing organisms.

Vibriosis in AquacultureVibrios are gram-negative, ubiquitous in marine and estuarine

ecosystems as well as aquaculture farms, and comprise one of the major microbiota of these ecosystems. Many vibrios are serious pathogens for animals reared in aquaculture [23-27]. Vibriosis, caused by infection by Vibrio spp, is one of the most prevalent disease in fishes and other aquaculture-reared organismsand is widely responsible for mortality in cultured aquaculture systems worldwide [28,29]. Major Vibrio spp. viz. V. harveyi, V. parahaemolyticus, V. alginolyticus, V. anguillarum, V. vulnificus, and V. splendidus are usually associated with shrimp diseases. V. harveyi is associated with luminescent vibriosis in shrimps e.g., Litopenaeus vannamei and Penaeus monodon, and it is the most important etiological agent for mass mortality in P. monodon [28,30-32]. It has been reported that V. anguillarum, V. salmonicida, and V.

AbstractVibrio spp. are the most common and serious pathogen in fish and shellfish marine aquaculture worldwide.

Vibriosis is a common disease caused by a number of Vibrio spp. viz. V. harveyi, V. parahaemolyticus, V. alginolyticus, V. anguillarum, V. vulnificus etc. The plastic nature of Vibrio genomes makes the species boundaries very narrow in a marine environment; therefore accurate species identification is complicated for any taxonomist. Traditional bacterial identification has been based on different phenotypic characteristics. However, with the advancement of molecular biology, arrays of genomic techniques have been developed for correct and rapid species identification in aquaculture. Among DNA-sequence-based identification, 16S rRNA and housekeeping genes are most popularly used. Other common methods for Vibrio identification include ribotyping and PCR-based techniques such as. Amplified Fragment Length Polymorphism (AFLP), Fluorescence In Situ Hybridization (FISH), Random Amplified Polymorphic DNA (RAPD), repetitive extragenic palindrome–PCR (rep-PCR), and Restriction Fragment Length Polymorphism (RFLP). Molecular methods have slowly established a place in the diagnosis of disease- causing pathogens in aquaculture. In the present study a detailed review was undertaken to highlight common aquaculture- related diseases caused by different Vibrio species and some of the common molecular techniques used to identify those pathogens.

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Page 2 of 7

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

vulnificus are among the main bacterial pathogens in several fish species [26]. The primary mode of infection in fish consists of penetration of bacterium to the host tissue mainly via chemotactic activity, followed by deployment of an iron-sequestering system, resulting in eventual damage to the fish by means of extracellular products i.e. haemolysin and proteases. In a recent study, mucus secretion blood clots were reported to be common symptoms for moribund seabream (Sparus aurata) isolated from a hatchery located in Malta [33]. A detailed investigation concluded the infection might be due to haemolysin activity of V. harveyi infection. Some of the common symptoms of disease in fish caused by strains of pathogenic vibrios include intestinal nacrosis, anemia, ascetic fluid, petechial haemorrhages in the muscle wall, liquid in the air bladder etc. It has been reported that shrimps are also infected by vibrios and the possible routes of infection are feed, gill, hepatopancreas etc. Vibrios colonized the host tissue of shrimps after crossing the epithelial cells [34]. Table 1 lists some of the important aquaculture diseases caused by different Vibrio spp. Although marine vibrios were reported to be the main cause for bacterial disease in aquaculture, an important challenge for understanding the virulence potential of marine Vibrio sp. and its mechanism for causing disease in a simple and reliable animal model is lacking. Recently, the brine shrimp Artemia nauplii has been used in many studies because of its simple culture method in gnotobiotic conditions [35]. Bacterial interaction or colonization with challenged organisms is a very complex process. To study colonization potentials, several techniques have been employed such as use of cell lines [36], direct observation with scanning electron microscopy, etc. [37]. These processes involve fixation and preparation of samples for microscopy, but do not permit observations in vivo or on recently killed organisms, nor do they guarantee that the observed bacteria are those inoculated or of interest. Thus, labeling a pathogenic Vibrio strain with fluorescent dye was considered to be an appropriate method to study the colonization potential in vivo. In a recent study, Haldar et al. [38] established pathogenic potentials of a small number of V. campbellii isolates, a marine bacterial species, which was previously considered to be a non-pathogenic Vibrio [38].

Problems in Modern AquacultureIn the past an intensive mode of culture with high stocking density

become popular in different southeast Asian countries like Thailand, Indonesia, Philippines etc. To maintain productivity of such intensive aquaculture, high inputs of fish protein originating from the sea have been employed for feeding, together with high levels of water exchange and massive use of antibiotics. The spread of antibiotic resistance from aquaculture settings to the natural environment is increasing. About 70% of the Vibrio isolated from aquaculture settings in Mexico are multi-drug resistant [39]. On the other hand some of the important negative environmental impacts include loss of wild fishes (5 kg of wild fish has to be caught to feed 1 kg of carnivorous reared fish), loss of natural habitat, effluent discharge and destruction of sensitive habitat [40,41]. Ben-Haim et al. [41] in 2003, advanced the hypothesis that aquaculture settings serve as foci or reservoirs for pathogenic Vibrio strains. During certain periods of the year, pathogenic Vibrio withstand unfavourable environmental conditions within aquaculture settings and when favourable environmental conditions are reestablished, Vibrio are once again able to cause disease in wild animals [42].

Due to an increasing trend of antibiotic resistance in aquaculture many alternative methods are in use by aquaculture scientists to reduce Vibrio-related diseases. Among many others, one of the popular methods is the use of probiotic immunostimulants.

Different Methods Used for Bacterial IdentificationAn array of molecular techniques is gaining popularity for the

identification of different aquaculture-related bacterial pathogens. Suitable genetic fingerprinting methods are essential for rapid and accurate tracking of different marine vibrios. Among DNA sequence-based identification, analysis of 16S rRNA and other housekeeping gene sequences are the most popular and precise methods currently used to identify closely related Vibrio. Among other methods, ribotyping and PCR-based techniques, e.g., Amplified Fragment Length Polymorphism (AFLP), Fluorescence In Situ Hybridization (FISH), Random Amplified Polymorphic DNA (RAPD), repetitive extragenic palindrome–PCR (rep-PCR), and Restriction Fragment Length Polymorphism (RFLP) have yielded the most valuable information and new insights into the identification of closely related marine bacteria. Below we discuss some of these methods commonly used for identification:

Table 1: Diseases caused by Vibrio spp. in aquaculture [Need to fill in question marks].

Vibrio spp. caused disease Host organism Disease PCR based diagnostic method ReferenceVibrio harveyi

V. alginolyticus

V. parahaemolyticus

V. anguillarum

V. vulnificus

V. ordalii

V. salmonicida

Moritella viscose (V. viscosus)

Peneause monodon (Tiger prawn)

Litopenaeus vannamei (White shrimp)

Epinephelus coioides (Grouper)

Sulculus diversicolor (Japanese abalone)

P. monodon (Tiger prawn)

P. monodon (Tiger prawn)

Salmo salar L. (Salmon),Oncorhynchus mykiss (Rainbow trout)

Oreochromis niloticus (Nile tilapia),Eels

Salmonids

Atlantic salmon, cod

Atlantic salmon, cod

Luminescent vibriosis resulting in mass mortality

Up to 85% mortality in nauplii

Gastroenteritis followed by mass mortalityMass mortality

Shell disease

Red disease, up to 80% mortality

Vibriosis

Vibriosis

Vibriosis

Vibriosis

Winter ulcer

Yes

?

?

?

Yes

Yes

Yes

Yes

No

No

No

[84], [36]

[85]

[86]

[87]

[88]

[88]

[89], [90]

[91], [90]

[90]

[90]

[90]

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Page 3 of 7

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

PCR-based identification

Although there are a handful of methods for the identification of marine Vibrio as described above, the majority require two or more step approaches like PCR and sequencing (16S rRNA and MLST), PCR and digestion with restriction enzymes (PCR-RFLP, AFLP), or the use of radioisotope labelled probes which are expensive, time-consuming and hazardous for health. A simple and rapid identification method of Vibrio-related disease to aquaculture settings is essential for taking preventive and curative measures in aquaculture. PCR-based identification is a suitable alternative because it is comparatively easy, less expensive and can be completed within several hours [43]. However, success of this method depends on the selection of target gene, which should be species-specific, widely distributed and also stable in the genome.

The majority of reported work has been to identify V. harveyi-related marine bacteria using PCR, because V. harveyi is the major causal organism of luminous vibriosis, causing potential devastation to diverse ranges of marine invertebrates over a wide geographical area. These microorganisms, however, are extremely difficult to identify because they are phenotypically diverse. In 2006, Bramhachari and Dubey [44] developed PCR-based identification methods for V. harveyi targeting a partial 16S rRNA gene [44]. Fukui and Sawabe [45] modified the method by developing a one step colony PCR targeting the same 16S rRNA gene to identify pathogenic V. harveyi from aquaculture settings [45]. Similarly, Conejero and Hydryda [46] in 2003 targeted the toxR gene for identification of V. harveyi from aquaculture systems [46]. However, the most precise method to identify V. harveyi along with V. campbellii and V. parahaemolyticus was developed by Haldar et al. [47] in 2010, using multiplex PCR. This method was so accurate that the individual detection limit of all three target species ranged from 10 to 100 cells per PCR tube, using primer concentrations of 0.25 to 0.5 µmol/l (Figure 2a and 2b) [47]. Table 2 presents details of PCR primers for identification of some important marine Vibrio spp.. Photobacterium damselae ssp. Damselae and Photobacterium damselae ssp. Piscicida are important aquaculture pathogens that are responsible for causing photobacteriosis, also known as pasteurellosis or pseudotuberculosis. High mortalities of

P. piscicida infection were first observed in natural populations of white perch (Morone americanus) and striped bass (Morone saxatalis) [48,49]. The Photobacterium damselae ssp., formerly classified as V. damsela, is a halophilic bacterium causing skin ulcers in warm and cold water fish [50-53]. In 2003, Rajan et al. [54] developed a common PCR-based method to identify both P. damselae ssp. Damselae and P. damselae ssp. Piscicida, targeting the capsular polysaccharide gene and further differentiating between the species by selective culturing in thiosulphate citrate bile salts–sucrose agar (TCBS-1) [54]. P. damselae ssp. damselae grew on TCBS-1 producing green colonies whereas P. damselae ssp. Piscicida did not grow.

16S rRNA and housekeeping gene based identification

16S rRNA gene sequencing is considered by many authors to be a very reliable method for identification of any bacteria including marine Vibrio [55-60]. The 16S rRNA gene (about 1,500 bp in length) consists of highly conserved regions and is present in almost all bacteria which may reveal deep-branching (e.g., classes, phyla) relationships, while variable regions may be demonstrated to be useful in discriminating species within the same genus. This feature has prompted researchers to use 16S rRNA both as a phylogenetic marker and as an identification tool [61].

Colony hybridization by species-specific probes

It has been demonstrated that different selective media are not quite selective or species-specific. Detection of different marine bacteria on selective media and subsequent colony hybridization with species-specific probes (probe is a fragment of DNA or RNA of variable length, used in DNA or RNA samples to detect the presence of nucleotide sequences), based on variable target regions of the 16S rRNA and other specific genes have been evaluated as an alternative fast screening tool for identification of marine bacteria [62-66]. However, there is nearly 100% 16S rRNA gene homology among many closely related bacterial species, viz. V. scophthalmi and V. ichthyoenteri, thus there is a significant possibility of cross-hybridization and misidentification of closely related species [64].

Table 2: PCR primers for identification of some important marine Vibrio

Primer Sequence (5'-3') Target species Expected Band Size (bp) Acc. Number ReferencesVca-hly5 CTATTGGTGGAACGCAC V. campbellii 328 AB271112 [73]vca-hly3 GTATTCTGTCCATACAAACVh-hly 1F GAGTTCGGTTTCTTTCAAG V. harveyi 454 DQ224369 [73]Vh-hly 1R TGTAGTTTTTCGCTAATTTCVp-tlh1 GATTTGGCGAACGAGAAC V. parahaemolyticus 695 M36437 [73]Vp-tlh2 CGTCTCGAACAAGGCGVctoxR403F GAAGCTGCTCATGACATC V. cholerae 275 CP000627 [69]VctoxR678R AAGATCAGGGTGGTTATTCWhA870F ACTCAACTATCGTGCACG V. vulnificus 366 AB124802 [69]WhA1236R ACACTGTTCGACTGTGAGVng F2 CCCGAACGAAGCGAAA V. nigripulchritudo 258 [92]VngR2 ACCTTTCAGTGGCAAGATGCPS F AGGGGATCCGATTATTACTG Photobacterium damselae 410 AB074290 [80]CPS R TCCCATTGAGAAGATTTGAT sp. PiscicidaF-gyrB ATTGAGAACCCGACAGAAGCGAAG V. alginoloticus 340 AF007288 [93]R-gyrB CCTAATGCGGTGATCAGTGTTACTHG-F1 GCTCTGTCGGAAAACTTGA Grimontia hollisae 363 AB027462 [94]HG-R1 ATGCTCAAAATGGAACACAGVc_dnaJF1 CGGTTCGYGGTGTTTCAAAA V. coralliilyticus 128 [95]

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Page 4 of 7

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

Fluorescent in situ hybridization

Fluorescent In Situ Hybridization (FISH) provides a powerful tool for identifying the location of cloned DNA sequences. It uses fluorescent probes to bind to those parts of chromosomes with which they show high degrees of similarity and is often used in the field of microbial ecology [67]. It has been reported that certain bacteria are metabolically active but may not be able to grow on selective media e.g., V. cholera. Nutrient limitation or starvation, variation of pH, salinity and temperature could lead to such a stage, for which they proposed the name “Viable But Non Culturable” (VBNC) [56,68]. VBNC forms of marine bacteria can be identified by direct extraction of nucleic acids from environmental samples (e.g. water, tissue, sediment etc.), followed by clonal library and 16S rRNA sequencing or alternative FISH of filter-fixed cells with oligonucleotide probes targeting the 16S rRNA and subsequent visualization by epifluorescent microscopy. The low fluorescence intensity of marine bacteria is one of the main drawbacks of FISH technology [69,70]. On the other hand, because several Vibrio species (e.g. V. harveyi, V. campbellii, V. rotiferianus, and other closely phylogenetic neighbours) have very similar 16S rRNA sequences, it may be difficult to perform reliable species identification. Recently, a one-step multi-probe FISH method has been developed. In short, the FISH method was combined with microcolony formation culture and is known as FISH following cultivation (FISHFC). It has the advantage of increasing not only the specificity of probes but also the development of microcolonies in selective media within a short time, increasing its applicability. A probe reacting to the microcolonies generates stronger fluorescence signals than that of a single colony [71]. In FISHFC, a variety of group or species-specific probes can be used.

Ribotyping

Ribotyping was one of the first fingerprinting techniques to be successfully used in the taxonomy of vibrios, and it has been particularly useful in the study of V. cholerae [72,73]. This technique is mainly used for epidemiological purposes. Ribotyping has been used to assess the genomic diversity of environmental Vibrio strains associated with fish and oysters [74]. According to Austin et al. [75], closely related Vibrio species, e.g., V. anguillarum and V. ordalii, can be differentiated on the basis of ribotyping [75]. In another recent study, Haldar et al. [38] successfully differentiated two very closely related Vibrio species such as V. harveyi and V. campbellii using the ribotyping method (Figure 1). Ribotyping consists of four main steps: (i) restriction of the bacterial chromosome with an endonuclease, (ii) gel electrophoresis of the resulting fragments, (iii) transfer of the fragments to a membrane, and (iv) hybridization of the gel with a labelled probe complementary to the 16S and 23S rRNAs [72]. This method is very sensitive but is comparatively lengthy.

Restriction Fragment Length Polymorphism (RFLP)

Restriction Fragment Length Polymorphism or RFLP is a technique that exploits variations in homologous DNA sequences. It refers to differences between samples of homologous DNA molecules that come from differing locations of restriction enzyme sites, and to a related laboratory technique by which these segments can be illustrated. In RFLP analysis, the DNA sample is broken into pieces (digested) by restriction enzymes and the resulting restriction fragments are separated according to their lengths by gel electrophoresis. A simple and rapid RFLP method was developed by Saha et al. [76] in 2006, based on the chromosomal ori sequence of V. cholerae. It was effective to delineate between two closely related biotypes of pathogenic Vibrio strains. In a recent study, Chowdhury et al. [77], has developed an

1 2 3 4 5 6 7

700500

300

bp bp

700500

300

Figure 2a: Specificity of the hly gene-based multiplex PCR. Lanes 1 and 7 are a 100 bp ladder (Takara Bio Inc.); 2, Vibrio campbellii ATCC 25920T; 3, Vibrio harveyi ATCC 12126T; 4, Vibrio parahaemolyticus NBRI 12711T; 5. V. campbellii, V. harveyi and V. parahaemolyticus; 6, E. coli C600. PCR products (5 µl each) were analysed by 1.5% agarose gel electrophoresis and visualized after ethidium bromide staining using Gel-Doc 2000 (Bio-Rad, CA, USA).

10 kb

M

IPE

Y37

IPE

Y52

IPE

Y41

IPE

Y55

IPE

Y60

IPE

Y67

IPE

Y70

IPE

Y72

IPE

Y74

IPE

Y76

IPE

Y77

IPE

Y78

IPE

Y82

IPE

Y84

IPE

Y87

IPE

Y45

IPE

Y46

IPE

Y50

IPE

Y53

IPE

Y54

IPE

Y53

IPE

Y64

IPE

Y65

IPE

Y71

IPE

Y79

IPE

Y80

IPE

Y83

IPE

Y88

AM

15

VP

61

Figure 1: Ribotype pattern of test strains along with V.harveyi (AM15) and V.parahaemolyticus (VP61) standard strains after digestion with BglI restriction enzyme. Differences in band positions are indicated by arrows (►). Three clusters are identified by solid line (Cluster I), square dot (Cluster II) and dashed line (Cluster III).

RFLP method targeting sections of the super integron region of the V cholerae genome, and demonstrated good delineation between different biotypes of V. cholerae strains.

Amplified Fragment Length Polymorphism (AFLP)

AFLP is another successful PCR-based method for differentiating closely related Vibrio species. The AFLP method consists of three main steps: (i) digestion of total genomic DNA with two restriction enzymes and subsequent ligation of the restriction half-site-specific adaptors to all restriction fragments; (ii) selective amplification of these fragments with two PCR primers that have corresponding adaptor and restriction site sequences as their target sites; and (iii) electrophoretic separation of the PCR products on polyacrylamide gels with selective detection of fragments which contain the fluorescently labeled primer and computer-assisted numerical analysis of the band patterns [55]. The original method described in 1995 by Vos et al. [78] used radioactively labelled primers, but it has since been modified to utilize fluorescent labels.

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Page 5 of 7

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

Random Amplified Polymorphic DNA (RAPD)

RAPD is a rapid, powerful and inexpensive PCR method using arbitrary primers to detect a segment of DNA in the genome. No knowledge of the DNA sequence of the targeted gene is required, as the primers will bind somewhere in the sequence. In recent years, RAPD has been used to characterize and trace the phylogeny of diverse plant and animal species. In V. harveyi it has been used to differentiate pathogenic and non-pathogenic strains and has been used in diversity studies of other Vibrios [79-81]. Some of the main drawbacks of this method are related to the fact that PCR is an enzymatic reaction, therefore the quality and concentration of template DNA, concentrations of PCR components, and the PCR cycling conditions may greatly influence the outcome. Thus, the RAPD technique is notoriously laboratory-dependent and needs carefully developed laboratory protocols to be reproducible.

ConclusionIn the present study, the bacterial identifications described were

based on culturing the strain in suitable media followed by extraction of DNA and final identification based on the diversity of DNA sequences. No emphasis was given to identify non-culturable Vibrio, which comprise a major percentage of the total Vibrio population, with the exception of the FISH technique. The rapid development of molecular biological techniques offers significant advantages for workers involved in fish disease diagnosis. Using nucleic acids as targets, new methods of analysing polymorphisms can improve specificity, sensitivity and speed of diagnosis and offer means of examining the relationships between genotypes and phenotypes of various pathogens. Further investigation and exploration of the biodiversity among marine vibrios using new molecular techniques will be an important topic for future research. In recent years, the number of publications describing new molecular techniques or methods has increased significantly. Such publications describe the development of new methods that appear very promising and useful. However, reports of applications of these techniques on a routine basis in diagnostic laboratories are few. In order for molecular biology to fulfil the promise of improved diagnosis and to be adopted by regulatory authorities, thorough trials of new methods are required

and the results must be disseminated. Molecular methods have slowly established a place in the diagnosis of disease in aquaculture.

Acknowledgment

We are thankful to Dr. S. R. Shetye, Director, NIO, Dr. S. N. Gajbhiye, Chief Scientist, NIO and Dr. N. Ramaiah, Chief Scientist, NIO, for extending permission, providing facilities and encouragement to complete this review article. This is NIO contribution number 5076.

References

1. FAO corporate document repository (2003) The role of aquaculture in improving food security and nutrition.

2. http://www.fao.org/docrep/013/i1820e/i1820e.pdf

3. Subasinghe RP, Bondad-Reantaso MG, McGladdery SE (2001) Aquaculture development, health and wealth. In: Aquaculture in the Third Millennium. Technical Proceedings of the Conference on Aquaculture in the Third Millennium ed., Subasinghe RP, Bueno P, Phillips MJ, Hough C, McGladdery SE, et al., (Eds.) Rome, Italy: NACA, Bangkok and FAO, 167-191.

4. Arias CR, Macian MC, Aznar R, Garay E, Pujalte MJ (1999) Low incidence of Vibrio vulnificus among Vibrio isolates from seawater and shellfish of the western Mediterranean coast. J Appl Microbiol 86: 125-134.

5. Pujalte MJ, Ortigosa M, Macian MC, Garay E (1999) Aerobic and facultative anaerobic heterotrophic bacteria associated to Mediterranean oysters and seawater. Int Microbiol 2: 259-266.

6. Pujalte MJ, Sitjà-Bobadilla A, Macián MC, Belloch C, Alvarez-Pellitero P, et al. (2003) Virulence and molecular typing of Vibrio harveyi strains isolated from cultured dentex, gilthead sea bream and European sea bass. Syst Appl Microbiol 26: 284-292.

7. Frans I, Michiels CW, Bossier P, Willems KA, Lievens B, et al. (2011) Vibrio anguillarum as a fish pathogen: virulence factors, diagnosis and prevention. J Fish Dis 34: 643-661.

8. Diggles BK, Moss GA, Carson J, Anderson CD (2000) Luminous vibriosis in rock lobster Jasus verreauxi (Decapoda: Palinuridae) phyllosoma larvae associated with infection by Vibrio harveyi. Dis Aquatic Org 43: 127-137.

9. Hispano C, Nebra Y, Blanch AR (1997) Isolation of Vibrio harveyi from an ocular lesion in the short sunfish (Mola mola). Bull Eur Ass Fish Pathol 17: 104-107.

10. Company R, Sitja-Bobadilla A, Pujalte MJ, Garay E, Alvarez-Pellitero P, et al. (1999) Bacterial and parasitic pathogens in cultured common dentex, Dentex dentex L. J Fish Dis 22: 299-309.

11. Alcaide E, Gil-Sanz C, Sanjuan E, Esteve D, Amaro C, et al. (2001) Vibrio harveyi causes disease in seahorse, Hippocampus sp. J Fish Dis 24: 311-313.

12. Liu PC, Lin JY, Chuang WH, Lee KK (2003) Infectious gastroenteritis caused by Vibrio harveyi (V. carchariae) in cultured red drum, Sciaenops ocellatus. J Appl Ichthyol 19: 59-61.

13. Zorrilla I, Morin˜igo MA, Castro D, Balebona MC, Borrego JJ (2003) Intra specific characterization of Vibrio alginolyticus isolates recovered from cultured fish in Spain. J Appl Microbiol 95: 1106-1116.

14. Fraser C, Hanage WP, Spratt BG (2007) Recombination and the nature of bacterial speciation. Science 26: 476-480.

15. Vandamme P, Pot B, Gillis M, de Vos P, Kersters K, et al. (1996) Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiol Rev 60: 407-438.

16. Rademaker JLW, Louws FJ, de Brujin FJ (1998) Characterization of the diversity of ecologically important microbes by rep-PCR genomic fingerprinting: 1-27. In: Van Elsas JD et al. (ed.), Molecular microbial ecology manual, vol. 3.4.3. Kluwer Academic Publishers, Dordrecht, The Netherlands.

17. Savelkoul PH, Aarts HJ, de Haas J, Dijkshoorn L, Duim B, et al. (1999) Amplified-fragment length polymorphism analysis: the state of an art. J Clin Microbiol 37: 3083-3091.

18. Olive DM, Bean P (1999) Principles and applications of methods for DNA-based typing of microbial organisms. J Clin Microbiol 37: 1661-1669.

19. Rademaker JL, Hoste B, Louws FJ, Kersters K, Swings J, et al. (2000) Comparison of AFLP and rep-PCR genomic fingerprinting with DNA- DNA homology studies: Xanthomonas as a model system. Int J Syst Evol Microbiol 50: 665-677.

1 2 3 4 5 6 7 8 9 10 11 12 13 14bp

700500300

bp

700500300

Figure 2b: Detection limit of the hly gene-based multiplex PCR. (b) Lanes: 1 and 14 are a 100 bp ladder (Takara Bio Inc.); 2, V. campbellii 104 CFU, 3, V. campbellii 103 CFU; 4, V. campbellii 102 CFU; 5, V. campbellii 101 CFU; 6, V. harveyi 104 CFU; 7, V. harveyi 103 CFU; 8, V. harveyi 102 CFU; 9, V. harveyi 101 CFU; 10, V. parahaemolyticus 104 CFU; 11, V. parahaemolyticus 103 CFU; 12, V. Parahaemolyticus 102 CFU, 13, V. Parahaemolyticus 101 CFU. PCR products (5µl each) were analysed by 1.5% agarose gel electrophoresis and visualized after ethidium bromide staining using Gel-Doc 2000 (Bio-Rad, CA, USA).

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Page 6 of 7

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

20. Dijkshoorn L, Towner KJ, Struelens M (2001) New approaches for the generation and analysis of microbial typing data. Elsevier, Amsterdam, The Netherlands.

21. Gurtler V, Mayall BC (2001) Genomic approaches to typing, taxonomy and evolution of bacterial isolates. Int J Syst Evol Microbiol 51: 3-16.

22. van Belkum A, Struelens M, de Visser A, Verbrugh H, Tibayrenc M (2001) Role of genomic typing in taxonomy, evolutionary genetics, and microbial epidemiology. Clin Microbiol Rev 14: 547-560.

23. Austin B, Austin DA (1993) Vibriosis, Bacterial fish pathogens and disease in farmed wild fish. Chapter 13, Ellis Harwood Ltd. England 263-287.

24. Hjeltnes B, Roberts RJ (1993) Vibriosis, In Bacterial Diseases of Fish, pg. 109-121. Edited by Inglis V, Roberts RJ, Bromage NR. Oxford: Blackwell Scientific.

25. Lightner DV (1993) Diseases of cultured penaeid shrimp. In CRC Handbook of Mariculture, 2nd edn, 1: 393-486. Edited by McVey JP. Boca Raton, FL: CRC Press.

26. Austin B, Austin DA (ed.) (1999) Bacterial fish pathogens. Disease of farmed and wild fish. Springer/Praxis Publishing, Chichester, UK.

27. Bergh O, Nilsen F, Samuelsen OB (2001) Diseases, prophylaxis and treatment of the Atlantic halibut Hippoglossus hippoglossus: a review. Dis Aquat Org 48: 57-74.

28. Lavilla-Pitogo CR, Leano EM, Paner MG (1998) Mortalities of pond-cultured juvenile shrimp Penaeus monodon associated with dominance of luminescent vibrios in the rearing environment. Aquaculture 164: 337-349.

29. Chen FR, Liu PC, Lee KK (2000) Lethal attribute of serine protease secreted by Vibrio alginolyticus strains in Kurama Prawn Penaeus japonicus. Zool Naturforsch 55: 94-99.

30. Lavilla-Pitogo CR, de la Pena LD (1998) Bacterial diseases in shrimp (Penaeus monodon) culture in Philippines. Fish Pathol 33: 405-411.

31. Austin B, Pride AC, Rhodie GA (2003) Association of a bacteriophage with virulence in Vibrio harveyi. J Fish Dis 26: 55-58

32. Guzm´an GA, Mart´ınez JGS R, Casta˜neda P, Monz´on AP, Rodr´ıguez TT, et al. (2010) Pathogenicity and Infection Route of Vibrio parahaemolyticus in American White Shrimp, Litopenaeus vannamei. J World Aqua Soc 41: 464-470

33. Haldar S, Maharajan A, Chatterjee S, Hunter SA, Chowdhury N, et al. (2010) Identification of Vibrio harveyi as a causative bacterium for a tail rot disease of sea bream Sparus aurata from research hatchery in Malta. Microbiol Res 165: 639-648.

34. Martin-Laurent F, Philippot L, Hallet S, Chaussod R, Germon JC, et al. (2001) DNA extraction from soils: old bias for new microbial diversity analysis methods. Appl Environ Microbiol 67: 2354-2359.

35. Austin B, Austin D, Southerland R, Thompson F, Swings J (2005) Pathogenicity of vibrios to rainbow traut (Oncothynchus mykiss, Walbaum) and Artemia nauplii. Environ Microbiol 7: 1488-1495.

36. Olsson JC, Westerdahl A, Conway PL, Kjelleberg S (1992) Intestinal colonization potential (Scophtalmus maximis) and dab (Limanda limanda)-associated bacteria with inhibitory effects against Vibrio anguillarum. Appl Environ Microbiol 58: 551-556.

37. Lavilla-Pitogo CR, Baticados MCL, Cruz-Lacierda ES, de la Pena LD (1990) Occurrence of luminous bacterial disease of Penaeus monodon nauplii in Philippines. Aquaculture 91: 1-13.

38. Haldar S, Chatterjee S, Sugimoto N, Das S, Chowdhury N, et al. (2011) Identification of Vibrio campbellii isolated from diseased farm-shrimps from south India and establishment of its pathogenic potential in an Artemia model. Microbiology 157: 179-188.

39. Molina-Aja A, Garcia-Gasca A, Abreu-Grobois A, Bolan-Mejia C, Roque A, et al. (2002) Plasmid profiling and antibiotic resistance of Vibrio strains isolated from cultured penaeid shrimp. FEMS Microbiol Lett 213: 7-12.

40. Kautsky N, Lubchenco J, Primavera J, Williams M (1998) Nature’s subsidies to shrimp and salmon farming. Nature 282: 883-884.

41. Naylor RL, Goldburg RJ, Primavera JH, Kautsky N, Beveridge MC, et al. (2000) Effect of aquaculture on world fish supplies. Nature 405: 1017-1024.

42. Ben-Haim Y, Thompson FL, Thompson CC, Cnockaert MC, Hoste B, et al.

(2003) Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen of the coral Pocillopora damicornis. Int J Syst Evol Microbiol 53: 309-315.

43. Neogi SB, Chowdhury N, Asakura M, Hinenoya A, Haldar S, et al. (2010) A highly sensitive and specific multiplex PCR assay for simultaneous detection of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus. Lett Appl Microbiol 51: 293-300.

44. Bramhachari PV, Dubey SK (2006) Rapid and specific detection of luminous and non-luminous Vibrio harveyi isolates by PCR amplification. Curr Sci 90: 1105-1108.

45. Fukui Y, Sawabe T (2007) Improved one step colony PCR for detection of Vibrio harveyi. Microbes Environ 22: 1-10.

46. Conejero MJU, Hedreyda CT (2003) Isolation of partial toxR gene of Vibrio harveyi and design of toxR-targeted PCR primers for species detection. J Appl Microbiol 95: 602-611.

47. Haldar S, Neogi SB, Kogure K, Chatterjee S, Chowdhury N, et al. (2010) Development of a haemolysin gene-based multiplex PCR for simultaneous detection of Vibrio campbellii,Vibrio harveyi and Vibrio parahaemolyticus. Lett Appl Microbiol 50: 146-152.

48. Smith SK, Sutton DC, Fuerst JA, Reichelt JL (1991) Evaluation of the genus Listonella and reassignment of Listonella damsela (Love et al.) MacDonell and Colwell to the genus Photobacterium as Photobacterium damsela comb. nov. with an emended description. Int J Syst Bacteriol 41: 529-534.

49. Truper HG, De Clari L (1997) Taxonomic note: necessary correction of specific epithets formed as substantives (nouns) in opposition. Int J Syst Bacteriol 47: 908-909.

50. Love M, Fisher DT, Hose JE, Farmer JJ, Hickman FW, et al. (1981) Vibrio damsela, a marine bacterium, causes skin ulcer on the damselfish Chromis punctipinnis. Science 214: 1139-1140.

51. Sakata T, Matsuura M, Shimkawa Y (1989) Characteristics of Vibrio damsela isolated from diseased yellowtail Seriola quinqueradiata. Bull Japanese Soc Fisheries Sci 55: 135-141.

52. Fouz B, Conchas RF, Magarinos B, Amaro C, Toranzo AE (1992a) Vibrio damsela strain virulence for fish and mammals. FHS/AFS Newsletter 20: 56-59.

53. Fouz B, Larsen JL, Nielsen B, Barja JL, Toranzo AE (1992b) Characterization of Vibrio damsela strain isolated from turbot Scophthalmus maximus in Spain. Dis Aqua Organisms 12: 155-166.

54. Rajan PR, Lin JHY, Ho MS, Yang HL (2003) Simple and rapid detection of Photobacterium damselae ssp. piscicida by a PCR technique and plating method. J Appl Microbiol 95: 1375-1380.

55. Gomez-Gil B, Soto-Rodrı´guez S, Garcı´a-Gasca A, Roque A, VazquezJuarez R, et al. (2004) Molecular identification of Vibrio harveyi-related isolates associated with diseased aquatic organisms. Microbiology 150: 1769-1777.

56. Maugeri TL, Carbone M, Fera MT, Gugliandolo C (2006) Detection and differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea. Res Microbiol 157: 194-200.

57. Chatterjee S, Haldar S, Asakura M, Yamasaki S, Balasubramanian T (2008) Molecular identification and phylogenetic status of marine Bacillus associated with coral sediment, showing antibacterial effects against human pathogens. Annal Microbiol 58: 309-312.

58. Gugliandolo C, Lentini V, Spano` A, Maugeri TL (2010) Conventional and molecular methods to detect bacterial pathogens in mussels. Let Appl Microbiol 52: 15-21.

59. Manmadan K, Sasaki H, Haldar S, Yamasaki S, Nagata S (2006) Antibacterial activities of marine epibiotic bacteria isolated from brown algae of Japan. Annal Microbiol 56: 167-173.

60. Haldar S, Mody KH, Jha B (2011b) Abundance, diversity and antibiotic resistance pattern of Vibrio spp. In coral ecosystem of Kurusadai island. J Basic Microbiol 51: 153-162.

61. Wiik R, Stackebrandt E, Valle O, Daae FL, Rodseth OM, et al. (1995) Classification of fish-pathogenic vibrios based on comparative 16S rRNA analysis. Int J Syst Bacteriol 45: 421-428.

62. Martı´nez-Picado J, Alsina M, Blanch AR, Cerda M, Jofre J (1996) Species-specific detection of Vibrio anguillarum in marine aquaculture environments by selective culture and DNA hybridization. Appl Environ Microbiol 62: 443-449.

Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002

Page 7 of 7

J Marine Sci Res Dev Fish Diseases & Diagnosis ISSN:2155-9910 JMSRD an open access journal

63. Cerda-Cue´llar M, Jofre J, Blanch AR (2000) A selective medium and a specific probe for detection of Vibrio vulnificus. Appl Environ Microbiol 66: 855-859.

64. Cerda-Cue´llar M, Blanch AR (2002) Detection and identification of Vibrio scophthalmi in the intestinal microbiota of fish and evaluation of host specificity. J Appl Microbiol 93: 261-268.

65. Tanaka R, Ootsubo M, Sawabe T, Tajima K, Vandenberghe J, et al. (2002) Identification of Vibrio halioticoli by colony hybridization with non-radioisotope labeled genomic DNA. Fish Sci (Tokyo) 68: 227-229.

66. Sloan E, O’Neill M, Kaysner C, DePaola A, Nordstrom JL, et al. (2003) Evaluation of two nonradioactive gene probes for the enumeration of Vibrio parahaemolyticus in crabmeat. J Rapid Methods Autom Microbiol 11: 297-311.

67. Thompson FL, Iida T, Swings J (2004) Biodiversity of Vibrios. Microbiol Mol bio Rev 68: 403-431.

68. Xu Q, Dziejman M, Mekalanos JJ (2003) Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro. Proc Natl Acad Sci USA 100: 1286-1291.

69. Eilers H, Pernthaler J, Glockner FO, Amann R (2000a) Culturability and In situ abundance of pelagic bacteria from the North Sea. Appl Environ Microbiol 66: 3044-3051.

70. Eilers H, Pernthaler J, Amann R (2000b) Succession of pelagic marine bacteria during enrichment: a close look at cultivation-induced shifts. Appl Environ Microbiol 66: 4634-4640.

71. Sawabe T, Yoshizawa A, Kawanishi Y, Komatsu-Takeda E, Nakagawa S, et al. (2009) Multi-Probe-Fluorescence in situ Hybridization for the rapid enumeration of viable Vibrio parahaemolyticus. Microbes Environ 24: 259-264.

72. Grimont F, Grimont PAD (1986) Ribosomal ribonucleic acid gene restriction patterns as potential taxonomic tools. Ann Inst Pasteur Microbiol 137B: 165-175.

73. Grimont PAD, Grimont F (2001) rRNA gene restriction pattern determination (Ribotyping) and computer interpretation, pp. 107-133. In: Dijkshoorn L, Towner KJ and Struelens M (ed.). New approaches for the generation and analysis of microbial typing data. Elsevier, Amsterdam, The Netherlands.

74. Austin B, Austin DA, Blanch AR, Cerda M, Grimont PAD, et al. (1997) A comparison of methods for the typing of fish-pathogenic Vibrio spp. Syst Appl Microbiol 20: 89-101.

75. Austin B, Alsina M, Austin DA, Blanch AR, Grimont PAD, et al. (1995) Identification and typing of Vibrio anguillarum: a comparison of different methods. Syst Appl Microbiol 18: 285-302.

76. Saha A, Deb R, Shah S, Ramamurthy T, Shinoda S, et al. (2006) PCR-based identification of Vibrio cholerae and the closely related species Vibrio mimicus using chromosomal ori sequence of Vibrio cholerae. FEMS Microbiol Lett 257: 84-91.

77. Chowdhury N, Asakura M, Neogi SB, Hinenoya A, Haldar S, et al. (2010) Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron. J Appl Microbiol 109: 304-312.

78. Vos P, Hogers R, Bleeker M, Reijans M, Vandelee T, et al. (1995) AFLP: a new technique for dna-fingerprinting. Nucleic Acids Res 23: 4407-4414.

79. Somarny WMZ, Mariana NS, Neela V, Rozita R, Raha AR (2002) Differentiation of pathogenic Vibrio species by RAPD. J Med Sci 2: 165-169.

80. Alavandi SV, Manoranjita V, Vijayan KK, Kalaimani N, Santiago TC (2006) Phenotypic and molecular typing of Vibrio harveyi isolates and their pathogenicity to tiger shrimp larvae. J Appl Microbiol 43: 566-570.

81. Maiti B, Shekar M, Khushiramani R, Karunasagar I, Karunasagar I (2009) Evaluation of RAPD-PCR and protein profile analysis to differentiate Vibrio harveyi strains prevalent along the southwest coast of India. J Genet 88: 273-279.

Submit your next manuscript and get advantages of OMICS Group submissionsUnique features:

• Userfriendly/feasiblewebsite-translationofyourpaperto50world’sleadinglanguages• AudioVersionofpublishedpaper• Digitalarticlestoshareandexplore

Special features:

• 200OpenAccessJournals• 15,000editorialteam• 21daysrapidreviewprocess• Qualityandquickeditorial,reviewandpublicationprocessing• IndexingatPubMed(partial),Scopus,DOAJ,EBSCO,IndexCopernicusandGoogleScholaretc• SharingOption:SocialNetworkingEnabled• Authors,ReviewersandEditorsrewardedwithonlineScientificCredits• Betterdiscountforyoursubsequentarticles

Submityourmanuscriptat:www.editorialmanager.com/environsci

This article was originally published in a special issue, Fish Diseases & Diagnosis handledbyEditor(s).Dr.MasahiroSakai,UniversityofMiyazaki,USA;Dr.SchauflerLE,TedStevensMarineResearchInstitute,USA