transmembrane protein 198 promotes lrp6 phosphorylation and wnt signaling activation

MOLECULAR AND CELLULAR BIOLOGY, July 2011, p. 2577–2590 Vol. 31, No. 130270-7306/11/$12.00 doi:10.1128/MCB.05103-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Transmembrane Protein 198 Promotes LRP6 Phosphorylationand Wnt Signaling Activation�

Juan Liang,1 Yu Fu,1 Cristina-Maria Cruciat,2 Shunji Jia,1 Ying Wang,1 Zhen Tong,1 Qinghua Tao,1Dierk Ingelfinger,4 Michael Boutros,4 Anming Meng,1 Christof Niehrs,2,3 and Wei Wu1*

Protein Science Laboratory of the Ministry of Education, School of Life Sciences, Tsinghua University, Beijing 100084,People’s Republic of China1; Division of Molecular Embryology, Deutsches Krebsforschungszentrum,

Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany2; Institute of Molecular Biology,D-55128 Mainz, Germany3; and Division of Signaling and Functional Genomics,

Deutsches Krebsforschungszentrum and University of Heidelberg, Department ofCell and Molecular Biology, Medical Faculty Mannheim,

Im Neuenheimer Feld 580, D-69120 Heidelberg, Germany4

Received 25 January 2011/Returned for modification 6 March 2011/Accepted 23 April 2011

Wnt/�-catenin signaling is fundamental in embryogenesis and tissue homeostasis in metazoans. Upon Wntstimulation, cognate coreceptors LRP5 and LRP6 ([LRP5/6] low-density lipoprotein receptor-related proteins5 and 6) are activated via phosphorylation at key residues. Although several kinases have been implicated, theLRP5/6 activation mechanism remains unclear. Here, we report that transmembrane protein 198 (TMEM198),a previously uncharacterized seven-transmembrane protein, is able to specifically activate LRP6 in transduc-ing Wnt signaling. TMEM198 associates with LRP6 and recruits casein kinase family proteins, via thecytoplasmic domain, to phosphorylate key residues important for LRP6 activation. In mammalian cells,TMEM198 is required for Wnt signaling and casein kinase 1-induced LRP6 phosphorylation. During Xenopusembryogenesis, maternal and zygotic tmem198 mRNAs are widely distributed in the ectoderm and mesoderm.TMEM198 is required for Wnt-mediated neural crest formation, antero-posterior patterning, and particularlyengrailed-2 expression in Xenopus embryos. Thus, our results identified TMEM198 as a membrane scaffoldprotein that promotes LRP6 phosphorylation and Wnt signaling activation.

Canonical Wnt signaling plays an essential role in embryonicdevelopment and adult homeostasis (10, 26, 50). Wnt signalingdysregulation is implicated in numerous human diseases in-cluding cancer (8, 13, 27). Two types of cell surface receptors,low-density lipoprotein receptor-related proteins 5 and 6(LRP5/6) (41, 47, 52) and Frizzled (Fz) (4, 54), are required forcanonical Wnt signal transduction. Upon Wnt ligand bindingto both receptors, LRP6, the single transmembrane protein, isclustered and phosphorylated with the assistance of Dishev-elled (Dsh; Dvl in mammals) and the Axin complex (5, 32, 57).With mechanisms not fully understood, phosphorylated LRP6prevents �-catenin degradation and activates �-catenin-depen-dent Wnt signaling (1, 27, 37). In this process, LRP6 phosphor-ylation is considered a key event for receptor activation.

LRP5/6 phosphorylation upon Wnt stimulation was first re-ported in 2004 (48), and several phosphorylation sites havesince been identified. Among them, Thr-1479, Ser-1490, andThr-1493 are the most extensively studied residues (37). Themotif containing phospho-Ser-1490/Thr-1493 configures adocking site for Axin, and the phosphorylation status is influ-enced by an upstream Ser/Thr cluster including Thr-1479 (56).Thr-1479/1493 are typical casein kinase targets and are con-firmed to be regulated by casein kinase 1 (CK1) family mem-bers, particularly CK1� (17, 58). Glycogen synthase kinase-3

(GSK3) represents another intracellular component of theWnt pathway, which directly interacts with and phosphorylatesSer/Thr residues in the LRP6 receptor cytoplasmic tail, includ-ing Ser-1490 (33, 58). Recently, another two kinases, G pro-tein-coupled receptor kinase 5 (GRK5) and PFTAIRE proteinkinase 1 (Pftk1), have been implicated (9, 16, 58). Furtherupstream, the Frizzled proteins are required via an unknownmechanism while Dvl proteins provide a platform for LRP6aggregation and phosphorylation (5, 14, 32). Furthermore,LRP6 phosphorylation occurs in acidic vesicles where vacuolarH�-ATPase is an indispensable component (7, 14, 36). Otherregulators are also involved such as Caprin-2 (20), a cytoplas-mic protein, and phosphatidylinositol (PtdIns) lipid phospha-tidylinositol 4,5-bisphosphate (PIP2) (38).

The precise mechanism that triggers LRP6 phosphorylationby its kinases remains elusive. To identify LRP6 regulators, wescreened a Xenopus tropicalis cDNA library and identifiedtransmembrane protein 198 (XtTMEM198) as a novel regula-tor. We found that TMEM198 can specifically activate LRP6 incanonical Wnt signaling by promoting aggregation and phos-phorylation. Epistatic analysis indicated that TMEM198 andcasein kinases are interdependent in LRP6 phosphorylation.Therefore, TMEM198 likely provides a membrane scaffoldthat recruits and facilitates kinases phosphorylating LRP6. Wefurther demonstrated that TMEM198 is required for neuralpatterning during Xenopus embryogenesis, supporting a role inWnt/�-catenin signaling in vivo. Thus, our results identify anew modulator for canonical Wnt signaling and provide thefirst biological activity of this functionally unknown transmem-brane protein family.

* Corresponding author. Mailing address: School of Life Sciences,Tsinghua University, Beijing 100084, People’s Republic of China.Phone: 86 10 62797127. Fax: 86 10 62703705. E-mail: [email protected].

� Published ahead of print on 2 May 2011.

2577

on April 12, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

MATERIALS AND METHODS

Constructs and small interfering RNA (siRNA). Full-length X. tropicalisTMEM198 (NM_001005013) was identified from a cDNA library as describedpreviously (17). A Wnt-responsive reporter screen was carried out as describedpreviously (25) except that LRP6 and Fz5 plasmids were cotransfected as baits.tmem198 and CK1 constructs were generated using PCR and subcloned intopCS2� vectors with a FLAG, Myc, or V5 tag. N-terminally tagged TMEM198constructs were generated by adding the signal peptide sequence from Kremenprotein (28) to the beginning of the coding region. To generate loss-of-functionmutations, we mutated clusters of conserved amino acids, especially serine andthreonine residues, using the QuikChange strategy (QuikChange Site-DirectedMutagenesis Kit; Stratagene, La Jolla, CA). TMEM198-M2, in which four aminoacids in intercellular loop 3 were mutated (T168P, S171A, T172A, and T174R),was selected for further investigation because almost no activity remained whilethe expression level and cellular distribution were similar to those of the wild-type protein. Deletion constructs of tmem198 were generated using PCR (X.tropicalis TMEM198-�C encoding amino acids 1 to 232, X. tropicalis TMEM198-M2�C encoding amino acids 1 to 232 with mutations as in M2, and humanTMEM198-C encoding amino acids 239 to 360). All constructs were confirmedusing DNA sequencing.

Human TMEM198 (NM_001005209) siRNA target sequences were the fol-lowing: siRNA-1, GCGTGCAACTGATGCGGAT; siRNA-2, GCCCATCAAACGCTTCAAT. The human TMEM198 short hairpin RNA (shRNA) target se-quence was GCTGTTTGTTTGGAGTCGTCT. Fz and Dvl siRNAs weresynthesized as described previously (38).

Cell culture, transfection, and reporter assay. HEK293T and HeLa cells weremaintained at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium(DMEM) containing 10% fetal calf serum (FCS). Plasmid DNA was transfectedusing Fugene-6 transfection reagent (Roche, Basel, Switzerland), and siRNAswere transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Theworking concentration of siRNAs was 100 nM.

For the luciferase reporter assay, HEK293T cells were seeded in 96-well platesand transfected in triplicates with plasmids or siRNAs, together with SuperTOP-FLASH or CAGA reporters and pRL-TK as the internal control. Lucifer-ase activity was determined at 36 h posttransfection. All experiments were re-peated at least three times. Plasmid DNAs used per well were as follows: 15 ngof Super TOP-FLASH or CAGA, 0.5 ng of pRL-TK, 5 ng of LRP6, 3 ng of Fz,5 ng of Wnt, 3 ng of CK1, 5 ng of Dvl, 10 ng of �-catenin, 5 ng of TMEM198, and15 ng of constitutively active transforming growth factor beta type I receptor(CA-TGF�RI).

Antibodies and immunoblotting. For immunoblotting, cells were seeded in24-well plates and at 36 h posttransfection were lysed on ice with lysis buffer(20 mM Tris, pH 7.4, 140 mM NaCl, 10% glycerol, 1% NP-40, 10 mM EDTA,2 mM sodium vanadate, 25 mM sodium fluoride, and a protease inhibitorcocktail). After centrifugation, the supernatant was subjected to SDS-PAGEand Western blotting using the following antibodies: FLAG (F3165; Sigma,St. Louis, MO), Myc (sc-40; Santa Cruz Biotechnology, Santa Cruz, CA), V5(A190-119A; Bethyl Laboratories, Montgomery, TX), HA (sc-7392; SantaCruz Biotechnology), �-catenin (610154; BD Biosciences, San Jose, CA),Dvl2 (3216; Cell Signaling Technology, Danvers, MA), Dvl3 (sc-8027; SantaCruz Biotechnology), total LRP6 (2560; Cell Signaling Technology), LRP6Sp-1490 (2568; Cell Signaling Technology), LRP6 Tp-1479 (17), and LRP6Tp-1493 (produced according to reference 58). Sp-1490, Tp-1479, and Tp-1493 represent antibodies that specifically recognize phosphorylated Ser-1490, Thr-1479, and Thr-1493, respectively.

Immunoprecipitation, immunofluorescence, and biotinylation. For immuno-precipitation, at 40 h posttransfection, cells in six-well plates were lysed on icewith TNE buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA)supplemented with 2 mM sodium vanadate, 25 mM sodium fluoride, and aprotease inhibitor cocktail. FLAG- or Myc-tagged proteins were recovered usinganti-FLAG agarose beads (M2; Sigma) or protein A/G plus Myc antibody,respectively. After samples were washed with TNE buffer, the bound proteinswere eluted with loading buffer and analyzed using immunoblotting.

For immunofluorescence, cells on coverslips in six-well plates were fixed with4% paraformaldehyde and permeabilized with 0.2% Triton X-100 in phosphate-buffered saline (PBS) and then blocked with 3% bovine serum albumin (BSA)-PBS before primary antibodies were applied. Secondary antibodies (donkeyanti-mouse–Alexa Fluor 568 and goat anti-rabbit–Alexa Fluor 488 antibodies)were purchased from Molecular Probes/Invitrogen. If necessary, cell nuclei werevisualized with 4�,6�-diamidino-2-phenylindole (DAPI) staining. Plasmid DNAsused for immunofluorescence were as follows: 2 �g of LRP6, 0.35 �g of Mesd, 0.5�g of TMEM198 or Frizzled, and 1 �g of TGF�RI.

Cell surface biotinylation was carried out in six-well plates, using 0.5 mg/mlsulfo-NHS-LC-biotin (sulfosuccinimidyl-6-biotinamido-hexanoate; Thermo Sci-entific, Waltham, MA) according to the manufacturer’s instructions. After biotinlabeling, immunoprecipitation was performed with FLAG-M2 beads, and thenthe samples were subjected to SDS-PAGE and immunoblotted using the FLAGantibody and streptavidin-horseradish peroxidase (HRP) (3999; Cell SignalingTechnology).

In vitro kinase assay and GST pulldown. Intracellular domains of LRP6 andTMEM198 were fused with maltose binding protein (MBP) and glutathioneS-transferase (GST) tags, respectively, and purified from Escherichia coli. Thekinase (casein kinase 1ε) was purified from transfected HEK293T cells usingFLAG-M2 beads (Sigma). For the in vitro kinase assay, substrates and kinaseswere mixed and incubated in kinase buffer (50 mM Tris, pH 7.4, 10 mM MgCl2,1 mM ATP, 2 mM dithiothreitol [DTT], 150 mM NaCl) for 1 h at 25°C, and thenSDS loading buffer was added to stop the reaction. The samples were thensubjected to SDS-PAGE.

For the GST pulldown assay, GST-TMEM198-C was first incubated withGS4B beads for 30 min at 4°C. After beads were washed with PBS, they werefurther incubated in TNE buffer for 2 h at 4°C with in vitro translated oroverexpressed CK1ε from transfected HEK293T cells. After samples werewashed with PBS, the bound proteins were eluted with SDS loading buffer andsubjected to SDS-PAGE.

Cell fractionation and sucrose gradient centrifugation. Fractionation of thecell membrane and cytosol was performed as previously described with minormodifications (17). Cells in six-well plates were collected in a low-salt buffer (5mM HEPES, pH 7.0, 1 mM MgCl2, 10 mM sodium pyrophosphate, 10 mMsodium fluoride, 5 mM sodium vanadate, and a protease inhibitor cocktail) andhomogenized with 40 Dounce strokes. After centrifugation (500 � g for 10 min),the supernatant was subjected to ultracentrifugation (100,000 � g for 1 h) usinga Beckman TLA100.3 rotor. The resultant supernatant was taken as the cytosolfraction. The pellet was solubilized with cholate buffer (20 mM HEPES, pH 7.4,150 mM NaCl, 1% sodium cholate, 10 mM EDTA, 10 mM sodium fluoride, 5mM sodium vanadate, and a protease inhibitor cocktail) and analyzed as themembrane fraction.

Sucrose gradient centrifugation was carried out as previously describedwith minor modifications (5). In brief, HEK293T cells in 10-cm dishes weretransfected with 4 �g of LRP6 and 0.7 �g of Mesd with or without 2 �g ofTMEM198. After 36 h, cells were washed and pelleted in PBS and then lysedfor 30 min in extraction buffer (30 mM Tris, pH 7.4, 140 mM NaCl, 1% TritonX-100, 25 mM sodium fluoride, 5 mM sodium vanadate, and a proteaseinhibitor cocktail). Lysates were clarified using centrifugation at 14,000 rpmfor 10 min at 4°C, and then the supernatant was layered on top of a 15 to 40%sucrose gradient prepared in 30 mM Tris, pH 7.4, 140 mM NaCl, 0.02%Triton X-100, 25 mM sodium fluoride, 5 mM sodium vanadate, and proteaseinhibitors. Ultracentrifugation was performed with a Beckman MLS50 rotorat 240,000 � g for 4 h at 4°C. After centrifugation, fractions were collectedfrom the bottom of the tube and analyzed using immunoblotting. For coim-munoprecipitation, fractions were pooled, and the sucrose was diluted byadding 800 �l of extraction buffer to a 400-�l sample and then incubated for4 h with FLAG-M2 beads (Sigma) at 4°C. After samples were washed withextraction buffer, bound proteins were eluted with SDS loading buffer andsubjected to SDS-PAGE.

Xenopus embryo assays. Xenopus embryos were cultured under standard con-ditions. mRNA was synthesized using a mMESSAGE mMACHINE SP6 kit(Ambion, Austin, TX) according to the manufacturer’s instructions. Antisenseand standard control morpholino (MO) oligonucleotides were purchased fromGene Tools, LLC (Philomath, OR). The MO sequences of Xenopus laevistmem198 (NM_001094258) were as follows: MO-1, CGGTGGGACAACAGACGATAGATCA; MO-2, GAATCTGGTGTTAAGTAAGCATGTC. Whole-mount in situ hybridization and LacZ staining were performed as describedpreviously (51). RNA probes were hybridized at 60°C, and BM purple substrate(Roche) was applied for the chromogenic reaction.

Total RNA isolation and reverse transcription-PCR (RT-PCR). Total RNAwas isolated using TRIzol reagent (Invitrogen), and reverse transcription wasperformed using the Reverse Transcription System (Promega, Fitchburg, WI).Primers used for human tmem198 were 5�-GCAAGGAGAAAAGGCGGAAAA-3� and 5�-CTGTGGGTGAGGCCATGAAG-3�. For X. laevis tmem198, theprimers were 5�-TGAACAGTTTTATCACCCGCC-3� and 5�-TATTATGACATCAGTATGAGAGAA-3�. Other primers were used as previously described(51).

2578 LIANG ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

RESULTS

TMEM198 promotes LRP6 signaling and is required forWnt signaling upstream of the �-catenin destruction complex.We screened a Xenopus tropicalis embryonic cDNA library andidentified a novel 7-transmembrane protein, TMEM198, thatspecifically and strongly cooperated with the Wnt coreceptorLRP6 in activating TOP-FLASH reporter expression (Fig.1A). Among many components in the canonical Wnt pathway,TMEM198 cooperated only with LRP6, and the cooperationwas dose dependent (Fig. 1A and data not shown). In addition,TMEM198 and LRP6 cooperated to induce �-catenin accu-mulation in the cytosol of HEK293T cells (Fig. 1B), a charac-teristic feature of Wnt signaling activation, and to enhance theexpression of direct Wnt target genes axin2 and cyclin D1 (Fig.1C). These results suggest that TMEM198 is able to activateLRP6 in Wnt signaling.

LRP5 is another Wnt coreceptor closely related to LRP6 interms of structure and function (23). However, in contrast toLRP6, LRP5 was not activated by coexpressed TMEM198,whereas Wnt3a was able to activate both coreceptors (Fig.1D). More interestingly, when the intracellular domain ofLRP5 was replaced with that of LRP6, the chimeric protein(LRP5-6) could be activated by TMEM198 as strongly asLRP6 (Fig. 1D). These results suggest that TMEM198 selec-tively cooperates with LRP6 but not LRP5, and the specificityrelies on the intracellular domain of the LRP5/6 receptors.Corroborating this conclusion, the constitutively active form ofLRP6, LRP6�E1-4, was further activated by TMEM198,whereas that of LRP5, LRP5 with a deletion of the N terminus(LRP5�N), was not activated (Fig. 1E). Of note, casein kinase1� (CK1�), a known kinase responsible for LRP6 phosphory-lation, displayed similar selectivity on full-length as well asconstitutively active LRP5/6 receptors (Fig. 1D and E). Thereason for this selectivity is unknown; however, we cannot ruleout a quantitative difference between LRP5 and LRP6 intransducing Wnt signaling.

TMEM198 is predicted to be a transmembrane protein andis conserved from fruit fly to human (Fig. 1F); however, itsorthologs have not been characterized in any organism includ-ing Drosophila (Drosophila tmem198; accession numberCG14234). Thus, we cloned TMEM198 homologues fromXenopus laevis (GeneID 447551), human (GeneID 130612), andmouse (GeneIDs 319998 and 73827) and confirmed that allretained similar activity levels in promoting LRP6 signaling(data not shown). Topology prediction using the SMART pro-gram (EMBL) suggested that TMEM198 consists of a veryshort extracellular domain (31 amino acids for X. tropicalisTMEM198), seven transmembrane domains, and a cytoplas-mic tail with �110 amino acids (Fig. 1G). To experimentallyconfirm this prediction, we transplanted the signal peptidefrom the Kremen protein (28) to the N terminus of TMEM198and found that this fusion protein was as active as the wild-typein promoting LRP6 signaling (data not shown). Moreover,TMEM198 became inactive when green fluorescent protein(GFP) was fused at the N terminus while retaining full activitywhen GFP was fused at the C terminus (data not shown).Immunofluorescent analysis of transfected HeLa cells indi-cated that a large amount of TMEM198 localized intracellu-larly in vesicle-like structures (Fig. 1H), suggesting that

TMEM198 may not be a typical plasma membrane protein.However, the plasma membrane-localized TMEM198 wasreadily detected by the cell surface biotinylation assay, con-firming that at least part of the overexpressed TMEM198 pro-teins were at the plasma membrane (Fig. 1I).

In parallel, TMEM198 was identified in a genome-widesiRNA screen for genes required for Wnt/�-catenin signalingin HEK293T cells (Fig. 2A) (14). To further address the in-volvement of TMEM198 in canonical Wnt signaling, we de-signed two specific siRNAs to knock down TMEM198 inHEK293T cells (Fig. 2B). As shown in Fig. 2C, Wnt3a signal-ing was significantly reduced when TMEM198 siRNAs wereapplied, while �-catenin signaling was largely unaffected. Sig-naling induced by Dvl2 was also markedly downregulated byTMEM198 siRNA (Fig. 2C), consistent with the model of Dvlinvolvement in promoting LRP6 activation and signaling viaLRP6 (5, 32, 44, 57). The siRNA effect was specific because theactivity was rescued by cotransfected X. tropicalis TMEM198(XtTMEM198) (Fig. 2D). Further confirming specificity,TMEM198 siRNA affected Wnt3a-induced TOP-FLASH ex-pression but had no effect on the expression of the CAGA-luciferase reporter induced by constitutively active TGF� typeI receptor (CA-TGF�RI) (Fig. 2E). Epistatically, TMEM198was required for �-catenin accumulation induced by Wnt3a butnot LiCl, a potent GSK3 inhibitor (Fig. 2F), suggesting thatTMEM198 functions upstream of �-catenin accumulation.Moreover, the TMEM198/LRP6 signal was completelyblocked with cotransfection of Axin, the scaffold protein of the�-catenin degradation complex (data not shown). Taken to-gether, these results indicate that TMEM198 is able to activateLRP6 and is required for canonical Wnt signaling upstream ofthe �-catenin destruction complex.

TMEM198 associates with LRP6 and promotes phosphory-lation. Next, we addressed whether TMEM198 was able tointeract with LRP6. In coimmunoprecipitation (co-IP) assayswith transfected HEK293T cells, TMEM198 associated withLRP6 (Fig. 3A). Since an antibody recognizing endogenousTMEM198 protein was lacking, we transfected FLAG-TMEM198 into HEK293T cells and detected coimmunopre-cipitated endogenous LRP6 (Fig. 3B). The interaction is likelymediated by the transmembrane domains because the TMEM198protein lacking the cytoplasmic portion (TMEM198-�C) wasalso coimmunoprecipitated with LRP6 (data not shown) andLRP6�E1-4, an extracellular truncated form of LRP6 (Fig.3C). The interaction between overexpressed TMEM198 andLRP5 was also detected (data not shown) although the latterwas not activated.

Activation of LRP6 in canonical Wnt signaling requiresphosphorylation; therefore, the status of LRP6 phosphoryla-tion at three key residues was monitored using phospho-spe-cific antibodies. As expected, LRP6 phosphorylation at Thr-1479, Ser-1490, and Thr-1493 was dramatically increased whenTMEM198 was coexpressed (Fig. 3D and E). As a positivecontrol, CK1� induced massive phosphorylation at Thr-1479,whereas GSK3� did not induce phosphorylation (Fig. 3D). Amutant form of TMEM198 (TMEM198-M2) was also tested inthis assay and showed no effect (Fig. 3E). Consistently, thismutant had greatly reduced activity in promoting LRP6 signal-ing (Fig. 3F). TMEM198-M2 was expressed at an equal level(Fig. 3A and E) and distributed in a similar pattern in HeLa

VOL. 31, 2011 TMEM198 ACTIVATES LRP6 DURING Wnt SIGNALING 2579


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

FIG. 1. TMEM198 specifically promotes LRP6 signaling in the canonical Wnt/�-catenin pathway. (A) Wnt-responsive TOP-FLASH reporterassay in HEK293T cells with indicated transfections. TMEM198 plasmid DNA was used at 1 ng and 10 ng. (B) Cytosol fractions from HEK293Tcells transfected with indicated DNA samples were immunoblotted with �-catenin or �-tubulin (loading control) antibodies. Cells in six-well plateswere transfected with 100 ng of TMEM198, 100 ng of Wnt3a, or 300 ng of LRP6 plasmid DNA as indicated. (C) The expression levels of Axin2and Cyclin D1 from transfected HEK293T cells were quantified using real-time PCR. Cells in six-well plates were transfected with 100 ng ofTMEM198 and/or 300 ng of LRP6 plasmid DNA. (D) Wnt reporter assay in HEK293T cells transfected with the indicated plasmids. LRP5-6 is achimeric protein in which the C terminus of LRP5 was replaced with that of LRP6 (schematically showing in the upper panel). Plasmid amountswere as follows: 5 ng LRP6, LRP5, and LRP5-6; 5 ng of Wnt3a; 5 ng of TMEM198; and 3 ng of CK1�. Note that TMEM198, like CK1�, activated



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

cells as the wild type (data not shown) and retained binding toLRP6 (Fig. 3A). As another control of the seven-transmem-brane protein, Frizzled 7 was cotransfected with LRP6, and noenhancement of LRP6 phosphorylation was observed (data notshown), suggesting that TMEM198 specifically promotedLRP6 phosphorylation. Further demonstrating the specificityand consistent with the results of the activity assay (Fig. 1D)were our findings that TMEM198 did not enhance Thr-1493phosphorylation of LRP5 while overexpression of GSK3/Axindid enhance phosphorylation (Fig. 3G). Together, these resultsindicate that TMEM198 specifically activates LRP6 by promot-ing phosphorylation.

TMEM198 facilitates casein kinase 1 family members inphosphorylating LRP6. Because there is no predicted kinasedomain within TMEM198, we speculate that TMEM198 can-not phosphorylate LRP6 directly. As shown in the in vitrokinase assay, unlike CK1ε, TMEM198 was not able to phos-phorylate purified LRP6-C, the cytoplasmic domain of LRP6

(Fig. 4A). This failure to phosphorylate the cytoplasmic do-main confirmed that TMEM198 per se is not a kinase; however,it may assist kinases. As casein kinase 1 (CK1) family membersand GSK3 have been implicated in LRP6 phosphorylation (17,58), we verified the potential interaction between TMEM198and casein kinase 1 or GSK3�. As shown in Fig. 4B, all fourCK1s (CK1/ε//�) were coimmunoprecipitated withTMEM198, whereas GSK3� was not coimmunoprecipitated(data not shown). In the Wnt-responsive reporter assay, LRP6/TMEM198 signaling was inhibited by dominant negative CK1�([DN-CK1�] which specifically blocks CK1� activity [17]) anddominant negative CK1 ([DN-CK1] which blocks the activityof both CK1ε and CK1 [58]) (Fig. 4C). The inhibition wasspecific because dominant negative CK1 ([DN-CK1] whichblocks CK1 activity [58]) had no effect (Fig. 4C). Moreover,DN-CK1� and DN-CK1, but not DN-CK1, significantlyblocked TMEM198-induced LRP6 phosphorylation (Fig. 4D).These results indicate that casein kinase 1 family members are

LRP6 and LRP5-6 but not LRP5. Wnt3a was used as a positive control to demonstrate that the LRP5 was functional. (E) Wnt-responsive reporterexperiment in HEK293T cells transfected with the indicated plasmids. Plasmid amounts were as follows: 1 ng of LRP6�E1-4, 1 ng of LRP5�N,5 ng of TMEM198, and 3 ng of CK1�. Note that TMEM198, like CK1�, further enhanced LRP6�E1-4 but not LRP5�N, while each truncatedreceptor itself was similarly active. (F) Percent similarities of amino acid sequences among TMEM198 proteins in different species. Two TMEM198homologues in mouse (mTMEM198-1 and mTMEM198-2) and zebrafish (zTMEM198-1A and zTMEM198-1B) and one homologue in X. laevis(XlTMEM198), X. tropicalis (XtTMEM198), Drosophila (dTMEM198), and human (hTMEM198) were analyzed. (G) Predicted topology ofTMEM198 protein. Dark lines represent the plasma membrane, and the N or C stands for N or C terminus of TMEM198 protein, respectively.(H) Confocal microscopy images of HeLa cells transfected with TMEM198-FLAG. The dashed lines indicate the nuclei. Note that overexpressedTMEM198 was localized at the plasma membrane as well as in intracellular vesicle-like structures. (I) Cell surface biotinylation experiment fromHEK293T cells transfected as indicated. Note that both TMEM198-FLAG and FLAG-TMEM198 were biotinylated and therefore cell surfacelocalized. Mesd-FLAG (an endoplasmic reticulum retention chaperon protein) and FLAG-Fz5 were used as a negative and positive control,respectively. The asterisk indicates the heavy chain of FLAG antibody. IP, immunoprecipitation; IB, immunoblotting.

FIG. 2. TMEM198 is required for canonical Wnt signaling upstream of the �-catenin destruction complex. (A) Wnt-responsive reporter assayin HEK293T cells. LOC130612 (human TMEM198) was identified in a genome-wide siRNA screen for genes required for Wnt/�-catenin signaling(14). Wnt signaling was activated by cotransfection of Wnt1 (5 ng), LRP6 (3.3 ng), and Fz8 (1 ng). (B) The siRNA knockdown efficiency ofTMEM198 in HEK293T cells determined by RT-PCR. Control (Ctrl) or two different TMEM198 siRNAs (TMEM198-1 and TMEM198-2) weretransfected in HEK293T cells. At 60 h posttransfection, total RNA was isolated, and RT-PCR was performed. Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was used as a loading control. (C to E) Luciferase reporter assay in HEK293T cells transfected with the indicatedplasmid DNAs and siRNA samples. Wnt3a CM, Wnt3a-conditioned medium. In panel D, 1 ng and 3 ng of X. tropicalis TMEM198 (XtTMEM198)plasmid DNA were used to rescue the signaling of Wnt3a CM and Wnt1/LRP6, respectively. (F) Western blots of cytosol fractions from HEK293Tcells transfected with indicated siRNAs and then treated with control, Wnt3a CM, or LiCl (20 mM) for 4 h before cell fractionation.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

required for TMEM198-induced LRP6 phosphorylation andactivation.

CK1 overexpression is able to induce LRP6 phosphoryla-tion. Therefore, we addressed whether endogenous TMEM198was involved in this process. As shown in Fig. 4E, knockdownof TMEM198 using siRNA significantly reduced Wnt signalingactivated by LRP6/CK1� or LRP6/CK1ε. Consistently, LRP6phosphorylation induced by either CK1� or CK1ε was alsoreduced with TMEM198 depletion (Fig. 4F and G). Takentogether, these results suggest that TMEM198 and casein ki-nases are mutually dependent for LRP6 phosphorylation andactivation.

TMEM198 is a multitransmembrane protein, and the C ter-minus likely extends toward the cytosol while the casein ki-nases are either membrane associated (CK1�, via lipid modi-fication) or cytosolic. The topology suggested that TMEM198might interact with CK1s via its C-terminal domain (C do-main). Indeed, TMEM198 with a deletion of the C terminus(TMEM198�C) exhibited greatly reduced interaction with allCK1s (Fig. 5A and data not shown) as well as significantlydecreased Wnt promoting activity (Fig. 5B). This result sug-gested that the TMEM198 C-terminal domain was crucial forCK1 binding. Similarly, TMEM198-M2, a mutant with greatlyreduced activities in Wnt signaling and in promoting LRP6phosphorylation (Fig. 3E and F), bound undetectable CK1ε orCK1� in the co-IP assay (Fig. 5C). Furthermore, although

either TMEM198-M2 or TMEM198�C retained some activity,TMEM198-M2�C was completely inactive (Fig. 5B), suggest-ing that the CK1 binding capacity is indispensable for promot-ing LRP6 signaling. Direct interactions between the C domainsof TMEM198 (GST-TMEM198-C purified from E. coli) andCK1ε that was either in vitro translated (Fig. 5D) or overex-pressed in HEK293T cells (data not shown) were detected inGST pulldown experiments. These results suggest that theTMEM198 cytoplasmic domain interacts with CK1 directly.

The above results suggested that TMEM198 likely activatedLRP6 via recruitment of casein kinase 1 family members.Therefore, we investigated whether TMEM198 was able toassist CK1 with phosphorylating LRP6. When cotransfected,minimal doses of TMEM198 and CK1ε indeed synergisticallypromoted LRP6 phosphorylation (Fig. 5E). To demonstrate acofactor feature of TMEM198 for CK-mediated LRP6 phos-phorylation, we fused the LRP6 cytoplasmic domain (LRP6-C)with the TMEM198 C domain (TMEM198-C) and testedwhether this fusion protein was an improved substrate forcasein kinases in transfected cells. As shown in Fig. 5F, thefusion protein (LRP6-C-TMEM198-C) was, indeed, morestrongly phosphorylated than LRP6-C. This result stronglysuggests that TMEM198 is able to facilitate CK1-mediatedLRP6 phosphorylation. Taken together, these results suggestthat TMEM198 promotes LRP6 phosphorylation and activa-tion partially via recruiting and facilitating CK1.

FIG. 3. TMEM198 associates with LRP6 and promotes phosphorylation. (A) Western blots of immunoprecipitates (IP) or initial lysates fromHEK293T cells transfected as indicated. TMEM198-M2-FLAG is a mutant form of TMEM198. Note that the precipitated LRP6 from a wild-typeTMEM198-cotransfected sample migrated more slowly than that from TMEM198-M2 because of heavy phosphorylation induced by the wild-typebut not mutant TMEM198. (B and C) Western blots of immunoprecipitates or initial lysates from HEK293T cells transfected as indicated.Endogenous LRP6 was detected in panel B. The asterisk in panel C indicates the antibody heavy chain. (D and E) Western blots of total cell lysatesfrom HEK293T cells transfected as indicated. Tp-1479, Sp-1490, and Tp-1493 represent antibodies that specifically recognize phosphorylatedThr-1479, Ser-1490, and Thr-1493 forms of human LRP6 protein, respectively. MT6-LRP6, Myc6-tagged LRP6. The asterisk in panel E indicatesa nonspecific band. Cells in 24-well plates were transfected with 200 ng of LRP6 and 50 ng of CK1�, GSK3�, or TMEM198 plasmid. (F) Wnt-responsive reporter experiment in HEK293T cells transfected with the indicated plasmids. Note that TMEM198-M2 was much weaker in activatingLRP6. (G) Western blots of total cell lysates from HEK293T cells transfected as indicated. MT6-LRP6/MT6-LRP5, Myc6-tagged LRP6 orMyc6-tagged LRP5. Cells in 24-well plates were transfected with 200 ng of tagged LRP6/LRP5 and 50 ng of GSK3�, Axin, or TMEM198 plasmid., anti.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

TMEM198 promotes LRP6 aggregation. TMEM198 pro-moted LRP6 phosphorylation at all three amino acid sitestested, Thr-1479, Ser-1490, and Thr-1493. Among them, Thr-1479 and Thr-1493 are typical casein kinase targets while Ser-1490 could be phosphorylated by GSK3, GRK5, or Pftk1 (9,16, 17, 58). Our results indicated that TMEM198 does notinteract with GSK3� or Pftk1 (data not shown), suggesting that

the effect on Ser-1490 by TMEM198 is secondary. One expla-nation could be that the phosphorylation on Thr-1479 en-hanced that on Ser-1490, and this possibility is supported by aprevious report (56). Another possibility is that TMEM198affects LRP6 phosphorylation globally and provides a microen-vironment that facilitates phosphorylation.

Dishevelled (Dvl)-mediated LRP6 clustering or aggregation

FIG. 4. Casein kinase 1 is involved in TMEM198 stimulated LRP6 phosphorylation. (A) Western blots and Coomassie blue staining ofSDS-PAGE samples after the in vitro kinase assay. Coomassie blue staining indicated MBP-LRP6-C protein. Tp-1493 staining indicatedphosphorylated LRP6 and FLAG antibody-detected purified TMEM198-FLAG or FLAG-CK1ε from transfected HEK293T cells. Ctrl, FLAGimmunoprecipitates from pCS2� vector-transfected cells. (B) Western blots of immunoprecipitates (IP) or initial lysates from HEK293T cellstransfected as indicated. (C) Wnt reporter assay in HEK293T cells with indicated transfections. DN, dominant negative. Five nanograms of eachDN-CK1 was used. (D) Western blots of total cell lysates from HEK293T cells transfected as indicated. MT6-LRP6, Myc6-tagged LRP6. Cells in24-well plates were transfected with 200 ng of LRP6, 50 ng of TMEM198, and 200 ng of each DN-CK1. (E) Wnt reporter assay in HEK293T cellstransfected as indicated (*, P � 0.05; **, P � 0.01; Student’s t test, n � 3). (F and G) Western blots of total cell lysates from HEK293T cellstransfected as indicated. A total of 200 ng of LRP6 and 50 ng of CK1�/CK1ε plasmid DNAs were used. MT6-LRP6, Myc6-tagged LRP6. Bandintensities were quantified, and phospho-signals were normalized against the signal of the corresponding total LRP6. The signal of controlsiRNA-transfected cells was designated 1.0, and the relative rates of TMEM198 siRNA-transfected cells are shown.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

has been proposed as a key step in LRP6 phosphorylation andactivation, and upon Wnt ligand stimulation the LRP6 signa-losome is induced (5, 32, 38). We therefore addressed whetherTMEM198 was able to affect the subcellular distribution ofLRP6. As shown in Fig. 6A, LRP6 was detected at the cellmembrane and colocalized with cotransfected Frizzled 5 (90%of cotransfected cells). In contrast, when TMEM198 wascotransfected, LRP6 formed cytosolic punctate structures to-gether with TMEM198 (95% of cotransfected cells), suggest-ing the formation of signalosome-like structures (Fig. 6A). Torule out unspecific aggregation with overexpressed transmem-brane proteins, we coexpressed TMEM198 together with theTGF� type I receptor (TGF�RI) and observed no colocaliza-tion although TMEM198 itself was punctate (100% of cotrans-fected cells) (Fig. 6A). The LRP6 signalosome has been shown

to consist of caveolin-containing acidic vesicles with an unclearidentity (5) but which are thought to correspond to multive-sicular bodies (MVBs) (46). We therefore performed immu-nofluorescence analysis and observed that TMEM198/LRP6structures were partially colocalized with caveolin but not withclathrin or EEA (an early endosome marker) (data notshown). To further confirm that TMEM198 was able to pro-mote LRP6 aggregation, we performed sucrose sedimentationexperiments using LRP6- or LRP6/TMEM198-transfectedHEK293T cells. As shown in Fig. 6B, significantly more totalLRP6 as well as phosphorylated LRP6 was detected in high-molecular-weight (HMW) fractions when TMEM198 was co-expressed. Importantly, when we separately harvested the low-molecular-weight (LMW) and HMW fractions and performedimmunoprecipitation against FLAG-TMEM198, much more

FIG. 5. TMEM198 recruits casein kinase via the cytoplasmic domain. (A) Western blots of immunoprecipitates (IP) or initial lysates fromHEK293T cells transfected as indicated. The asterisk indicates a nonspecific band. (B) Wnt-responsive reporter assay in HEK293T cells transfectedwith the indicated plasmids. Plasmid amounts used were as follows: 5 ng of LRP6, 5 ng of TMEM198, and mutants. The inset shows the expressionlevels of wild-type and various TMEM198 mutations. (C) Western blots of immunoprecipitates or initial lysates from HEK293T cells transfectedas indicated. Note that the mutant TMEM198 (TMEM198-M2) lost interaction with CK1�/ε. The asterisk indicates the antibody heavy chain.(D) Western blots and Coomassie blue staining of samples before (input) or after the GST pulldown assay as indicated. Coomassie blue stainingindicated GST fusion proteins. (E) Western blots of total cell lysates from HEK293T cells transfected as indicated. A total of 200 ng of LRP6 and30 ng of TMEM198 or CK1ε plasmid DNAs were used. MT6-LRP6, Myc6-tagged LRP6. (F) Western blots of immunoprecipitates from HEK293Tcells transfected as indicated. FLAG-tagged LRP6-C or FLAG-LRP6-C-TMEM198-C (LRP6-C fused with TMEM198-C) was immunoprecipi-tated using FLAG-M2 beads and then probed with the indicated antibodies. Note that the fusion protein became a smear, another indication ofphosphorylation. The asterisk indicates the phosphorylation signal of FLAG-LRP6-C-TMEM198-C.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

LRP6 was coprecipitated from the HMW fractions althoughless LRP6 was contained in the HMW fractions before precip-itation (Fig. 6C). Similarly, in the HMW precipitates, phospho-LRP6 was enriched (Fig. 6C). These results suggest thatTMEM198 is likely capable of promoting LRP6 aggregation,thus facilitating LRP6 phosphorylation.

It has been proposed that LRP6�E1-4, the constitutivelyactive form, signals independently of Dvl because of sponta-neous self-aggregation (5). However, how this ligand- and Dvl-

independent self-aggregation occurs was unknown. We foundthat TMEM198 was able to associate with LRP6�E1-4 (Fig.3C) to further enhance its activity (Fig. 1E) and was requiredfor its activation in the Wnt-responsive reporter assay (Fig.6D). Moreover, in sucrose sedimentation experiments, a sig-nificant portion of LRP6�E1-4 protein was detected in theHMW fractions (Fig. 6E), as previously reported (5). However,in TMEM198 knockdown cells (Fig. 6F) this HMW distribu-tion was slightly but consistently reduced (Fig. 6E). These

FIG. 6. TMEM198 promotes LRP6 aggregation and is required for the spontaneous aggregation and activation of LRP6�E1-4. (A) Confocalmicroscopy images of HeLa cells transfected as indicated. LRP6-GFP (green) was cotransfected with Mesd and Fz5 (red) or TMEM198 (red).TGF�RI (green) was used as a control. Yellow signals indicate colocalization. (B) Western blots of fractions from sucrose gradient sedimentation.HEK293T cells were transfected as indicated, and total cell lysates were separated in a sucrose gradient using ultracentrifugation. The fractionswere collected from the bottom up. Note that TMEM198 promoted high-molecular-weight aggregation of LRP6. H and L (high- and low-molecular-weight fractions, respectively) indicate the fractions that were pooled together for immunoprecipitation in panel C. (C) Western blotsof input or immunoprecipitates of pooled fractions from panel B. Note that significantly more LRP6 as well as phospho-LRP6 was detected in theinput from low-molecular-weight fractions (input, L), while LRP6 and phospho-LRP6 were specifically coimmunoprecipitated from the high-molecular-weight fractions (IP, H). (D) Wnt reporter assay in HEK293T cells transfected with indicated plasmids and siRNAs. Wnt3a CM,Wnt3a-conditioned medium. Plasmid amounts were 1 ng of LRP6�E1-4 and 10 ng of �-catenin. (E) Western blots of fractions from sucrosegradient sedimentation experiments. Four micrograms of LRP6�E1-4 was transfected into control (Ctrl) or TMEM198 shRNA-expressingHEK293T cells. Note that in TMEM198 knockdown cells, high-molecular-weight aggregation of LRP6�E1-4 was slightly reduced (upper panel).The lower panel indicates the quantification of the Western blots. Intensity ratio of each LRP6�E1-4 band from the TMEM198 shRNA cellsagainst the corresponding one from the control shRNA cells (TMEM198/Ctrl shRNA) in fractions 1 to 9 was calculated using Quantity Onesoftware (Bio-Rad) and plotted. The dashed line represents a 1:1 ratio. Note that in fractions 1 to 7, there was more LRP6�E1-4 in the controlshRNA sample while in fractions 8 and 9 there was more in the TMEM198 shRNA sample, suggesting that knockdown of TMEM198 reduced theformation of high-molecular-weight aggregation of LRP6�E1-4. (F) RT-PCR result showing that in specific-shRNA-expressing HEK293T cells,which were used in the experiment shown in panel E, the TMEM198 mRNA level was significantly downregulated. GAPDH was used as loadingcontrol. RT, minus reverse transcription control.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

results suggest that TMEM198 is probably involved in self-aggregation and spontaneous activation of LRP6�E1-4.

Previous studies revealed that Frizzled and Dishevelled pro-teins are required for Wnt-dependent LRP6 phosphorylation(5, 57). We next investigated whether they were involved inTMEM198-induced LRP6 phosphorylation and activation. InHEK293T cells, Fz2/Fz4/Fz5 (Fz2/4/5) and Dvl2/Dvl3 (Dvl2/3)are expressed at detectable levels, and previous reports haveconfirmed that siRNA-mediated knockdown of these genesefficiently blocks Wnt signaling or LRP6 receptor activation(38). We therefore used these siRNA combinations (Fig. 7Aand C) and found that knockdown of either Fz or Dvl proteinsdid not significantly affect TMEM198-induced LRP6 phos-phorylation (Fig. 7B and D). Moreover, TMEM198/LRP6-induced �-catenin accumulation was not affected by DvlsiRNAs (Fig. 7E). These results suggest that TMEM198 pro-motes LRP6 phosphorylation probably independent or down-stream of Dvl-mediated receptor aggregation. However, wenoted that when Fz genes were knocked down with siRNAs,TMEM198/LRP6-induced �-catenin accumulation was slightlyreduced (Fig. 7F). An explanation for this observation is thatbesides leading to LRP6 phosphorylation, Fz may have anotheractivity required for �-catenin stabilization.

TMEM198 activates LRP6 in Xenopus embryos and is in-volved in neural patterning. Canonical Wnt signaling plays avital role during early embryonic development (26, 27, 50). Toaddress TMEM198 function in Xenopus embryos, we analyzedits expression pattern by RT-PCR and in situ hybridization. ByRT-PCR, tmem198 mRNA was detected constantly from thetwo-cell stage to tadpole embryos (data not shown). By in situhybridization, tmem198 mRNA was detected in cleavage em-bryos with enrichment in the animal blastomeres, indicative ofmaternal distribution (Fig. 8A and data not shown). At stage

FIG. 7. TMEM198 promotes LRP6 phosphorylation independent of Fz and Dvl. (A to D) RT-PCR result shows that in specific-siRNA-expressing HEK293T cells, which were used in the experiments shown in panels B and F, Fz2, Fz4 and Fz5 mRNA levels were significantlydownregulated. GAPDH was used as a loading control. Western blots of total cell lysate from HEK293T cells transfected with the indicatedplasmids or siRNAs. Control (Ctrl) and Fz2/4/5 (A) or Dvl2/3 siRNAs were transfected 24 h before plasmid DNA transfection. At 36 h after theplasmid transfection, cells were lysed and probed with the indicated antibodies. The knockdown efficiencies of Dvl2 and Dvl3 were monitored byspecific antibodies, as shown in panel C. MT6-LRP6, Myc6-tagged LRP6. (E and F) Western blots of cytosol fractions from HEK293T cellstransfected with indicated plasmids and siRNAs. Control (Ctrl) and Fz2/4/5 (A) or Dvl2/3 siRNAs were transfected 24 h before plasmid DNAtransfection. At 36 h after the plasmid transfection, cells were lysed in low-salt buffer, and the cytosol fractions were isolated and probed with�-catenin or �-tubulin (as loading control) antibodies. The knockdown efficiencies of Dvl2 and Dvl3 were monitored by specific antibodies asshown in panel E. Note that whereas Fz2/4/5 siRNAs (F) slightly inhibited TMEM198/LRP6-induced �-catenin accumulation in the cytosol, Dvl2/3siRNAs did not (E).

FIG. 8. TMEM198 activates LRP6 in Xenopus embryos. (A to F)Whole-mount in situ hybridization of tmem198 mRNA in developingX. laevis embryos. (A) Stage 6.5, animal view. (B) Stage 10�, dorsal-vegetal view. (C) Stage 11.5, vegetal view with dorsal up. (D) Stage 14,dorsal-posterior view. (E) Stage 17, dorsal-anterior view. (F) Stage 28,lateral view. (G) Four-cell-stage embryos were injected animally intoeach blastomere with 100 pg of tmem198, 100 pg of CK1�, 500 pg ofLRP6, 8 pg of Wnt8 mRNA, or in combination as indicated. At stage8 to 9, animal caps were dissected and cultured until stage 11 forexpression analyses of the indicated marker genes using RT-PCR. RT, minus reverse transcription control; WE, whole embryo; H4,histone 4. (H) Eight-cell-stage embryos were injected in the animalblastomeres or in the animal pole regions of blastomeres with 400 pgof tmem198 or 2 ng of LRP6 mRNA as indicated.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

10�, tmem198 mRNA was detected mainly in the organizerregion, just above the dorsal blastopore lip (Fig. 8B). Its ex-pression extended toward the ventral side along the blastoporeformation (Fig. 8C). During gastrulation and neuralization, theexpression domain of tmem198 extended anteriorly and cov-ered the entire neural plate as well as the underlying meso-dermal cells (Fig. 8D and E and data not shown). At stage 14,a gradual enhanced expression was detected toward the pos-terior pore (Fig. 8D). At the late neural stage, tmem198 wasexpressed in the neural tube, brain subdomains, branch arches,and quite strongly in the eye regions (Fig. 8F).

In Xenopus embryos, TMEM198 cooperated with LRP6 inactivating Wnt-responsive reporter gene expression (data notshown) and inducing the expression of siamois (sia) and Xnr3,two direct Wnt target genes, in animal caps (Fig. 8G). Inaddition, tmem198 mRNA injection into animal blastomeresinhibited head formation (data not shown), a hallmark of over-activated Wnt signaling (11, 35), and a suboptimal dose ofTMEM198 cooperated with LRP6 in the same assay (n � 37embryos; 92%) (Fig. 8H). These results suggest thatTMEM198 is able to activate LRP6-mediated Wnt signaling inXenopus embryos.

Two independent morpholino antisense oligonucleotides(MO) were both effective in blocking mRNA translation ofXenopus laevis TMEM198 (Fig. 9A) and were used in combi-nation to assess whether TMEM198 is necessary for the nor-mal development of Xenopus embryos. Embryos injected withTMEM198-MOs developed largely unaffected at the gastrulaand early neurula stages. However, at the tadpole stage, mor-phants were often less pigmented (n � 94; 67%) with ventrallybent tails (n � 94; 47%) (Fig. 9B). Anteriorly, these embryosdeveloped smaller eyes (often only the dorsal half of the retinawas retained) and forebrain structures (n � 94; 62%) than thecontrol-MO-injected embryos (Fig. 9B). The overall pheno-type resembled that of the LRP6 morphants (22) as well asembryos that overexpressed Dkk1, a Wnt antagonist (21).TMEM198 morphants were specific because in X. tropicalistmem198 mRNA-coinjected embryos, the defects in pigmenta-tion, tail, and anterior structures were reduced to 11%, 9%,and 13%, respectively (Fig. 9B lower panel) (n � 45). Loss ofpigmentation is an indication of defective neural crest forma-tion, a process regulated by Wnt/�-catenin signaling (42, 43).We therefore investigated the role of tmem198 in neural crestdevelopment. Control- or TMEM198-MO, together with LacZmRNA as a lineage tracer, was injected into one of the twoblastomeres in two-cell-stage embryos, and at the early neurulastage, the expression of neural crest markers was examinedusing in situ hybridization. In the TMEM198-MO-injectedside, expression levels of Sox10 (n � 46; 96%), Sox9 (n � 28;50%), FoxD3a (n � 25; 60%), Slug (n � 20; 40%), and Twist(n � 26; 63%) were markedly reduced (Fig. 9C), confirmingthat TMEM198 is required for neural crest formation. In con-trast, the pan-neural marker Sox3 was not affected (data notshown), suggesting that the deficient formation of neuralcrests was not due to the defective neural induction. Thedownregulation of neural crest marker expression byTMEM198-MO was specific because the expression of Sox10was rescued in 63% of embryos coinjected with X. tropicalistmem198 mRNA, which is refractory to MO targeting X.laevis tmem198 (n � 28) (Fig. 9D).

Wnt/�-catenin signaling is involved in antero-posterior(A-P) body axis determination of both vertebrates and inver-tebrates (18, 34, 35, 39). To uncover a role of TMEM198 inWnt-mediated A-P patterning, we used Xenopus animal capsthat were neuralized with injected Noggin and further poste-riorized with coinjected Xenopus Wnt8. In this experiment,neuralized animal cap cells were transformed with Wnt/�-catenin signaling into posterior type neural tissues as indicatedby the expression of engrailed 2 (En2), a midbrain-hindbrain-boundary (MHB) marker, and HoxB9, a spinal cord marker(Fig. 10A). The neural crest marker gene Slug was also in-duced, which confirmed Wnt signaling involvement duringneural crest induction (Fig. 10A). As expected, depletion ofWnt coreceptor LRP6 using a specific MO abolished the in-duction of all three genes by Wnt. TMEM198-MO alsoblocked the activity of Wnt in inducing the expression of En2,HoxB9, and Slug, indicating that TMEM198 is required down-stream of Wnt ligand in this experimental setting (Fig. 10A).Coinjection of X. tropicalis tmem198 mRNA rescued En2 ex-

FIG. 9. TMEM198 functions in neural crest development.(A) Western blot of total cell lysate from Xenopus embryos injectedwith indicated RNA or morpholino oligonucleotides (MO). Fournanograms of X. laevis TMEM198-EGFP mRNA (XlTMEM198-EGFP) and 40 ng of control or two different TMEM198 MOs (MO1and MO2) were injected into two- to four-cell-stage embryos, and atstage 11, the embryos were lysed and analyzed with enhanced GFP(EGFP) and �-tubulin (as the loading control) antibodies. (B) Four-cell-stage embryos were injected animally with 40 ng of control mor-pholino oligonucleotide (Ctrl-MO), TMEM198-MO, or together with100 pg of XtTMEM198 mRNA. (C and D) Two-cell-stage embryoswere injected animally into one blastomere with 40 ng of controlmorpholino oligonucleotides (Ctrl-MO) or TMEM198-MO as indi-cated, together with 400 pg of LacZ RNA as a lineage tracer, andanalyzed at stage 15 using in situ hybridization for the indicated genes.A total of 100 pg of XtTMEM198 mRNA was coinjected to rescueSox10 expression in the experiment shown in panel D.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

pression, suggesting that the effect of TMEM198-MO was spe-cific (Fig. 10B). To further confirm that TMEM198 actedthrough the �-catenin-dependent Wnt signaling, we monitoredthe expression of a Wnt-responsive reporter gene in theseanimal caps and found that the reporter was consistently down-regulated by TMEM198-MO (Fig. 10C). Moreover, the block-ing effect of TMEM198-MO on Wnt-induced En2 expressionwas reversed by coinjection of �-catenin S37A, a constitutivelyactive form (Fig. 10D). These results indicate that TMEM198is required for Wnt/�-catenin-mediated posteriorization ofneural tissues.

Using in situ hybridization in whole embryos, we next veri-fied the expression of Otx2, Gbx2, En2, Krox20, and HoxB9,which are often used to demarcate different compartments ofthe central nervous system along the A-P axis. Surprisingly,none except En2 was consistently downregulated byTMEM198-MO injection, suggesting a rather specific role ofTMEM198 in the A-P patterning of the central nervous system(Fig. 10E and data not shown). En2 has been demonstrated asa direct target of Wnt/�-catenin signaling (30), and its expres-sion in the MHB was induced/maintained directly by Wnt1(31) and further upstream by fibroblast growth factor 8 (FGF8)(24, 55). We observed that the expression of neither wnt1 norfgf8 was altered in TMEM198-MO-injected embryos (Fig.10E), suggesting that TMEM198 likely functions downstreamof Wnt1. We also verified the expression of Otx2 and Gbx2, twotranscription factors that antagonistically regulate formation ofthe MHB and wnt1 expression. Our results revealed that theexpression levels of these two genes were also largely unaf-fected (data not shown), indicating that the specification of theMHB was not defective and suggesting again that TMEM198was required more downstream for Wnt1 signaling. In line withthis conclusion, we were able to demonstrate that in Noggin-neutralized animal caps, TMEM198 and LRP6 together couldmimic the activity of Wnt8 to activate the expression of En2and Slug (Fig. 10F). These results suggest that TMEM198 isrequired for Wnt-mediated induction of En2 expression inXenopus embryos.

DISCUSSION

The present study identified the first cellular activity of theTMEM198 family proteins. Our results suggest thatTMEM198 is a potent regulator of LRP6 phosphorylation andactivation. These data also demonstrate that TMEM198 func-tions in Wnt/�-catenin signaling-mediated neural patterning ofXenopus embryos.

Function of TMEM198 during Xenopus embryogenesis. Se-quence analysis indicates that there are two tmem198 homo-logues in the mouse genome while we identified only one in theXenopus genome. Both maternal and zygotic tmem198 tran-scripts were widely distributed in developing embryos. Duringgastrulation, stronger tmem198 expression was detected in theposterior end around the blastopore. Consistent with the re-sults from mammalian cells, TMEM198 was able to activatecanonical Wnt signaling together with LRP6 in Xenopus em-bryos (Fig. 8G and H). On the other hand, TMEM198-MOblocked Wnt-induced posteriorization in animal cap cells (Fig.10A and B) and En2 expression (Fig. 10A, B, D, and E), anMHB marker gene and known direct target of Wnt/�-catenin

FIG. 10. TMEM198 is required for Wnt-mediated antero-posteriorpatterning in Xenopus embryos. (A and B) Four-cell-stage embryoswere injected animally in each blastomere with 100 pg of noggin and 50pg of Wnt8 mRNA or 10 ng of control-MO (Ctrl-MO), 5 ng of LRP6-MO, and 10 ng of TMEM198-MO as indicated. At stage 8 to 9, animalcaps were dissected and cultured until equivalent to stage 15 for ex-pression analysis of the indicated marker genes using RT-PCR. RT,minus reverse transcription control; WE, whole embryo; H4, histone 4.In panel B, 200 pg of XtTMEM198 plasmid DNA was coinjected torescue En2 expression. (C) Wnt reporter assay in Xenopus animal caps.Each blastomere of four-cell-stage embryos was injected animally with100 pg of noggin mRNA, 75 pg of Wnt8 DNA, 10 ng of control-MO(Ctrl-MO), or 10 ng of TMEM198-MO as indicated. Twenty-fivepicograms of TOP-FLASH and 5 pg of pRL-TK plasmid DNAs werecoinjected in all samples. At stage 8 to 9, animal caps were dissected,cultured until equivalent to stage 15, and then lysed for luciferaseactivity determination. (D) The animal cap assay was performed asdescribed for panel B, except that 100 pg of �-catenin S37A (theconstitutively active form of �-catenin) plasmid DNA was coinjected torescue En2 expression. (E) One blastomere of two-cell-stage embryoswas injected animally with 40 ng of control morpholino oligonucleo-tides (Ctrl-MO) or TMEM198-MO, as indicated, together with 400 pgof LacZ RNA as a lineage tracer and analyzed at stage 14 using in situhybridization for the indicated genes. Note that En2 expression wasdownregulated (n � 42; 87%) by TMEM198-MO injection while thatof wnt1 (n � 36; 100%) and fgf8 (n � 27; 100%) was not affected.(F) Each blastomere of four-cell-stage embryos was injected animallywith 100 pg of noggin and 100 pg of tmem198 mRNA or 500 pg of LRP6mRNA as indicated. At stage 8 to 9, animal caps were dissected,cultured until equivalent to stage 15, and analyzed for expression of theindicated marker genes using RT-PCR. RT, minus reverse transcrip-tion control; WE, whole embryo; H4, histone 4. Fifty picograms ofWnt8 mRNA was coinjected with noggin as a positive control.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

signaling (30) in neurula embryos. These gain- and loss-of-function results together suggest that TMEM198 participatesin the neural patterning of Xenopus embryos by affecting Wnt/�-catenin signaling.

TMEM198 morphants also had defects in neural crest for-mation, as indicated by the reduction of neural crest markerexpression in gastrula embryos and less pigmented tail budembryos (Fig. 9B to D). In addition, craniofacial defects wereconsistently observed when TMEM198-MO was injected uni-laterally at the two-cell stage (data not shown). Neural crestcells are multipotent progenitors that are induced at the bor-der of the neural plate and nonneural ectoderm (12, 29).Canonical Wnt signaling has been extensively documented to playimportant roles during neural crest induction (3, 42, 43), andLRP6, as a coreceptor, is also indispensable (22, 45). Theexpression of Sox9, Slug, and Sox10 is under the control ofWnt/�-catenin signaling (2, 6, 49), and the promoters of Slugand Sox9 contain T-cell factor (TCF)-responsive-elements (6,49), which is indicative of direct regulation. Our results indi-cated that Xenopus tmem198 was essential for Slug expressionin neurula embryos (Fig. 9C), was required for Slug inductionby Wnt in animal caps (Fig. 10A), and was capable of promot-ing Slug expression together with LRP6 (Fig. 10F). These re-sults suggest that TMEM198 is involved in Wnt-mediated neu-ral crest induction during Xenopus embryogenesis and furthersupport a role for TMEM198 in LRP6 activation.

In the cleavage embryos, maternal Wnt/�-catenin signalingdetermines the dorsal-ventral axis and formation of the orga-nizer (19). Consistent with the role of TMEM198 in early Wntsignaling, tmem198 mRNA is maternally distributed. However,the organizer formation, as indicated by goosecoid (gsc) andchordin expression, was hardly affected in TMEM198 mor-phants (data not shown). This may be because of the functionalredundancy of another TMEM198-like protein. Alternatively,maternal depletion is required to demonstrate a role ofTMEM198 in pre-midblastula transition (pre-MBT) Wnt sig-naling, especially considering that LRP6 activation occurs veryearly following fertilization.

Regulation of LRP6 phosphorylation and activation duringcanonical Wnt signaling. As a coreceptor, LRP6 is indispens-able for Wnt/�-catenin signaling (23). LRP6 phosphorylationis regulated by the extracellular ligand and is required fortransducing stimuli further down to the �-catenin degradationcomplex (1, 27, 37). The phosphorylated motifs provide dock-ing sites for the Axin complex (17, 48, 58) and may, in addition,function as direct inhibitors of GSK3�, thus preventing�-catenin phosphorylation and degradation (15, 33, 40, 53).Although several kinases, including casein kinase 1�, GSK3,Pftk1, and GRK5, have been implicated in this process (9, 16,17, 37, 58), the phosphorylation-triggering mechanism is stillunknown. Our work also implicates TMEM198, a previouslyfunctional unknown protein, in LRP6 phosphorylation andactivation. We provide evidence showing the following: (i) thatTMEM198 is able to promote LRP6 phosphorylation and ac-tivation, (ii) that TMEM198 is able to recruit and facilitatecasein kinases for LRP6 phosphorylation, (iii) that TMEM198is able to promote LRP6 aggregation, and (iv) that TMEM198is required for Wnt signal transduction and CK1-mediatedLRP6 phosphorylation. These results support the hypothesisthat TMEM198 functions as a membrane scaffold protein as-

sembling kinases and substrates into a higher-molecular-weight complex, thereby facilitating the phosphorylation event.

We believe that TMEM198-promoted LRP6 activation isspecific. First, LRP6 phosphorylation is a tightly regulatedevent not triggered by coexpression with other seven-trans-membrane proteins like Fz (data not shown) or TMEM198-M2(Fig. 3E). Second, TMEM198 selectively promotes the phos-phorylation and activation of LRP6 but not LRP5 (Fig. 1D and3G). Third, TMEM198-promoted LRP6 aggregation is not anoverexpression artifact because this did not occur withTGF�RI (Fig. 6A), another single-transmembrane protein.Our results suggest that at least a part of TMEM198 activity isto recruit casein kinases through its cytoplasmic domain. Sup-porting this conclusion, the C domain is indeed required forCK1 binding and full activity (Fig. 5A and B). The lack of CK1binding and LRP6 activation of TMEM198-M2 suggests thatthe third intracellular loop (where the mutations reside) mayhave regulative roles affecting conformation or modification ofthe TMEM198 protein.

Previous reports proposed that Dvl functions in assemblingLRP6 signalosomes (5, 32, 44). Upon Wnt stimulation, Friz-zled recruits Dvl, and primarily phosphorylated LRP6 in turnrecruits the Axin complex. When Frizzled and LRP6 arebrought together by Wnt, Dvl assembles oligomeric receptor-ligand complexes via an interaction with Axin. Our resultsindicate that TMEM198 also promotes the formation of activeLRP6 aggregations but through a different mechanism.TMEM198 associates with LRP6 but exhibits no direct inter-action with Dvl2 or Axin (data not shown). Therefore,TMEM198 is probably another assembling factor functioningindependently or downstream of Dvl. Corroborating this con-clusion, TMEM198 is required for the spontaneous aggrega-tion and signaling of LRP6�E1-4 (Fig. 6D and E), which oc-curs without Dvl involvement (5).

We prefer to speculate that TMEM198 functions as a tissue-specific modulator rather than as a core component of thecanonical Wnt signaling pathway. TMEM198 cooperated spe-cifically with LRP6 but not LRP5 (Fig. 1D and E), which is alsoessential for Wnt signaling. Moreover, knockdown ofTMEM198 in HEK293T cells did not significantly reduceWnt3a-induced LRP6 phosphorylation (at least at Ser-1490and Thr-1493 sites) (data not shown). However, TMEM198was required for CK1-induced LRP6 phosphorylation whenboth the kinase and receptor were overexpressed (Fig. 4F andG). Our results did not rule out the possibility that TMEM198may also be implicated in other signaling pathways. Indeed,microinjecting higher doses of tmem198 mRNA into Xenopusembryos inhibited Xbra expression and proper gastrulation(data not shown). This could explain why TMEM198/LRP6 didnot induce the secondary body axis (data not shown). Inhibi-tion of Xbra expression might be because of its activity onTGF� or FGF signals. However, our loss-of-function studiesdid not support a role of TMEM198 in either of these path-ways. Identification of TMEM198 as a potent modulator ofWnt/�-catenin signaling raises intriguing questions about itsrole in other developmental processes as well as in humandiseases, especially considering the broad expression of humanTMEM198 detected using expressed sequence tag (EST) anal-ysis in the UniGene database.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

ACKNOWLEDGMENTS

We thank Randy Moon, Dianqing Wu, and Ye-Guang Chen forreagents and Roel Nusse, Xi He, and Weijun Pan for helpful discus-sions and suggestions.

This work was supported by grants to W.W. from the NationalNatural Science Foundation of China (30730048 and 30921004), MajorScience Programs of China (2006CB943402, 2011CB943803), andTsinghua University Initiative Scientific Research Program(2010THZ0). Work in the laboratories of M.B. and C.N. was sup-ported by the FOR1036 research group of the Deutsche Forschungs-gemeinschaft.

REFERENCES

1. Angers, S., and R. T. Moon. 2009. Proximal events in Wnt signal transduc-tion. Nat. Rev. Mol. Cell Biol. 10:468–477.

2. Aoki, Y., et al. 2003. Sox10 regulates the development of neural crest-derivedmelanocytes in Xenopus. Dev. Biol. 259:19–33.

3. Bastidas, F., J. De Calisto, and R. Mayor. 2004. Identification of neural crestcompetence territory: role of Wnt signaling. Dev. Dyn. 229:109–117.

4. Bhanot, P., et al. 1996. A new member of the frizzled family from Drosophilafunctions as a Wingless receptor. Nature 382:225–230.

5. Bilic, J., et al. 2007. Wnt induces LRP6 signalosomes and promotes Dishev-elled-dependent LRP6 phosphorylation. Science 316:1619–1622.

6. Blache, P., et al. 2004. SOX9 is an intestine crypt transcription factor, isregulated by the Wnt pathway, and represses the CDX2 and MUC2 genes.J. Cell Biol. 166:37–47.

7. Buechling, T., et al. 2010. Wnt/Frizzled signaling requires dPRR, the Dro-sophila homolog of the prorenin receptor. Curr. Biol. 20:1263–1268.

8. Cadigan, K. M., and M. Peifer. 2009. Wnt signaling from development todisease: insights from model systems. Cold Spring Harb. Perspect. Biol.1:a002881.

9. Chen, M., et al. 2009. G protein-coupled receptor kinases phosphorylateLRP6 in the Wnt pathway. J. Biol. Chem. 284:35040–35048.

10. Chien, A. J., W. H. Conrad, and R. T. Moon. 2009. A Wnt survival guide:from flies to human disease. J. Invest. Dermatol. 129:1614–1627.

11. Christian, J. L., and R. T. Moon. 1993. Interactions between Xwnt-8 andSpemann organizer signaling pathways generate dorsoventral pattern in theembryonic mesoderm of Xenopus. Genes Dev. 7:13–28.

12. Christiansen, J. H., E. G. Coles, and D. G. Wilkinson. 2000. Molecularcontrol of neural crest formation, migration and differentiation. Curr. Opin.Cell Biol. 12:719–724.

13. Clevers, H. 2006. Wnt/beta-catenin signaling in development and disease.Cell 127:469–480.

14. Cruciat, C. M., et al. 2010. Requirement of prorenin receptor and vacuolarH�-ATPase-mediated acidification for Wnt signaling. Science 327:459–463.

15. Cselenyi, C. S., et al. 2008. LRP6 transduces a canonical Wnt signal inde-pendently of Axin degradation by inhibiting GSK3’s phosphorylation ofbeta-catenin. Proc. Natl. Acad. Sci. U. S. A. 105:8032–8037.

16. Davidson, G., et al. 2009. Cell cycle control of Wnt receptor activation. Dev.Cell 17:788–799.

17. Davidson, G., et al. 2005. Casein kinase 1 gamma couples Wnt receptoractivation to cytoplasmic signal transduction. Nature 438:867–872.

18. De Robertis, E. M. 2010. Wnt signaling in axial patterning and regeneration:lessons from planaria. Sci. Signal. 3:pe21.

19. De Robertis, E. M., and H. Kuroda. 2004. Dorsal-ventral patterning andneural induction in Xenopus embryos. Annu. Rev. Cell Dev. Biol. 20:285–308.

20. Ding, Y., et al. 2008. Caprin-2 enhances canonical Wnt signaling throughregulating LRP5/6 phosphorylation. J. Cell Biol. 182:865–872.

21. Glinka, A., et al. 1998. Dickkopf-1 is a member of a new family of secretedproteins and functions in head induction. Nature 391:357–362.

22. Hassler, C., et al. 2007. Kremen is required for neural crest induction inXenopus and promotes LRP6-mediated Wnt signaling. Development 134:4255–4263.

23. He, X., M. Semenov, K. Tamai, and X. Zeng. 2004. LDL receptor-relatedproteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. De-velopment 131:1663–1677.

24. Joyner, A. L., A. Liu, and S. Millet. 2000. Otx2, Gbx2 and Fgf8 interact toposition and maintain a mid-hindbrain organizer. Curr. Opin. Cell Biol.12:736–741.

25. Kazanskaya, O., et al. 2004. R-Spondin2 is a secreted activator of Wnt/beta-catenin signaling and is required for Xenopus myogenesis. Dev. Cell 7:525–534.

26. Klaus, A., and W. Birchmeier. 2008. Wnt signalling and its impact on devel-opment and cancer. Nat. Rev. Cancer 8:387–398.

27. MacDonald, B. T., K. Tamai, and X. He. 2009. Wnt/beta-catenin signaling:components, mechanisms, and diseases. Dev. Cell 17:9–26.

28. Mao, B., et al. 2002. Kremen proteins are Dickkopf receptors that regulateWnt/beta-catenin signalling. Nature 417:664–667.

29. Mayor, R., and M. J. Aybar. 2001. Induction and development of neural crestin Xenopus laevis. Cell Tissue Res. 305:203–209.

30. McGrew, L. L., K. Takemaru, R. Bates, and R. T. Moon. 1999. Directregulation of the Xenopus engrailed-2 promoter by the Wnt signaling path-way, and a molecular screen for Wnt-responsive genes, confirm a role forWnt signaling during neural patterning in Xenopus. Mech. Dev. 87:21–32.

31. McMahon, A. P., A. L. Joyner, A. Bradley, and J. A. McMahon. 1992. Themidbrain-hindbrain phenotype of Wnt-1 /Wnt-1 mice results from step-wise deletion of engrailed-expressing cells by 9.5 days postcoitum. Cell 69:581–595.

32. Metcalfe, C., C. Mendoza-Topaz, J. Mieszczanek, and M. Bienz. 2010. Sta-bility elements in the LRP6 cytoplasmic tail confer efficient signalling uponDIX-dependent polymerization. J. Cell Sci. 123:1588–1599.

33. Mi, K., P. J. Dolan, and G. V. Johnson. 2006. The low density lipoproteinreceptor-related protein 6 interacts with glycogen synthase kinase 3 andattenuates activity. J. Biol. Chem. 281:4787–4794.

34. Niehrs, C. 2010. On growth and form: a Cartesian coordinate system of Wntand BMP signaling specifies bilaterian body axes. Development 137:845–857.

35. Niehrs, C. 2004. Regionally specific induction by the Spemann-Mangoldorganizer. Nat. Rev. Genet. 5:425–434.

36. Niehrs, C., and M. Boutros. 2010. Trafficking, acidification, and growthfactor signaling. Sci. Signal. 3:pe26.

37. Niehrs, C., and J. Shen. 2010. Regulation of Lrp6 phosphorylation. Cell.Mol. Life Sci. 67:2551–2562.

38. Pan, W., et al. 2008. Wnt3a-mediated formation of phosphatidylinositol4,5-bisphosphate regulates LRP6 phosphorylation. Science 321:1350–1353.

39. Petersen, C. P., and P. W. Reddien. 2009. Wnt signaling and the polarity ofthe primary body axis. Cell 139:1056–1068.

40. Piao, S., et al. 2008. Direct inhibition of GSK3� by the phosphorylatedcytoplasmic domain of LRP6 in Wnt/beta-catenin signaling. PloS One3:e4046.

41. Pinson, K. I., J. Brennan, S. Monkley, B. J. Avery, and W. C. Skarnes. 2000.An LDL-receptor-related protein mediates Wnt signalling in mice. Nature407:535–538.

42. Raible, D. W. 2006. Development of the neural crest: achieving specificity inregulatory pathways. Curr. Opin. Cell Biol. 18:698–703.

43. Sauka-Spengler, T., and M. Bronner-Fraser. 2008. Evolution of the neuralcrest viewed from a gene regulatory perspective. Genesis 46:673–682.

44. Schwarz-Romond, T., C. Metcalfe, and M. Bienz. 2007. Dynamic recruitmentof axin by Dishevelled protein assemblies. J. Cell Sci. 120:2402–2412.

45. Song, L., Y. Li, K. Wang, and C. J. Zhou. 2010. Cardiac neural crest andoutflow tract defects in Lrp6 mutant mice. Dev. Dyn. 239:200–210.

46. Taelman, V. F., et al. 2010. Wnt signaling requires sequestration of glycogensynthase kinase 3 inside multivesicular endosomes. Cell 143:1136–1148.

47. Tamai, K., et al. 2000. LDL-receptor-related proteins in Wnt signal trans-duction. Nature 407:530–535.

48. Tamai, K., et al. 2004. A mechanism for Wnt coreceptor activation. Mol. Cell13:149–156.

49. Vallin, J., et al. 2001. Cloning and characterization of three Xenopus slugpromoters reveal direct regulation by Lef/beta-catenin signaling. J. Biol.Chem. 276:30350–30358.

50. van Amerongen, R., and R. Nusse. 2009. Towards an integrated view of Wntsignaling in development. Development 136:3205–3214.

51. Wang, Y., et al. 2010. Xenopus skip modulates Wnt/beta-catenin signalingand functions in neural crest induction. J. Biol. Chem. 285:10890–10901.

52. Wehrli, M., et al. 2000. Arrow encodes an LDL-receptor-related proteinessential for Wingless signalling. Nature 407:527–530.

53. Wu, G., H. Huang, J. Garcia Abreu, and X. He. 2009. Inhibition of GSK3phosphorylation of beta-catenin via phosphorylated PPPSPXS motifs of Wntcoreceptor LRP6. PloS One 4:e4926.

54. Yang-Snyder, J., J. R. Miller, J. D. Brown, C. J. Lai, and R. T. Moon. 1996.A Frizzled homolog functions in a vertebrate Wnt signaling pathway. Curr.Biol. 6:1302–1306.

55. Ye, W., et al. 2001. Distinct regulators control the expression of the mid-hindbrain organizer signal FGF8. Nat. Neurosci. 4:1175–1181.

56. Yum, S., et al. 2009. The role of the Ser/Thr cluster in the phosphorylationof PPPSP motifs in Wnt coreceptors. Biochem. Biophys. Res. Commun.381:345–349.

57. Zeng, X., et al. 2008. Initiation of Wnt signaling: control of Wnt coreceptorLrp6 phosphorylation/activation via frizzled, dishevelled and axin functions.Development 135:367–375.

58. Zeng, X., et al. 2005. A dual-kinase mechanism for Wnt coreceptor phos-phorylation and activation. Nature 438:873–877.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

transmembrane protein 198 promotes lrp6 phosphorylation and wnt signaling activation

Documents