the of biological chemistry no. 25, in u. s. a. co ... · pdf fileco-regulation of a gene...

THE JOURNAL OF BIOLOGICAL CHEMISTRY (0 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 266, No. 21, Issue of July 25, pp. 13698-13705,1931 Printed in U. S. A .

Co-regulation of a Gene Homologous to Early Light-induced Genes in Higher Plants and ,&Carotene Biosynthesis in the Alga DunaZieZZa bardawiZ*

(Received for publication, March 29, 1991)

Amnon LersS, Haim Levy, and Ada ZamirQ From the Biochemistry Department, Weizmann Institute of Science, Rehovot 76100, Israel

Dunaliella bardawil, a unicellular green alga that can be induced to accumulate massive amounts of B- carotene, is particularly suitable for studies of carotenogenesis regulation and its links to developmental and adaptive processes in the chloroplast. A cDNA clone corresponding to a transcript accumulating coordinately with carotenogenesis induction was isolated by differential hybridization of a cDNA library made from intensely illuminated cells. This transcript was also abundant in algal mutants able to accumulate 8- carotene under relatively low light intensity. DNA sequence analysis indicates that cbr (for qarotene biosynthesis-related) is closely related to early light-induced genes (elip) of higher plants. Similarity also exists between repeated oligopeptide motifs in Cbr and Cab proteins of photosystems I and 11. Three upstream direct repeats in cbr include an octamer and hexamer related to mammalian sterol regulatory elements. The relationship between cbr transcript and &carotene accumulation, the structural similarity between Cbr and Cab proteins, and the presence of potential SRE- 1 elements lead us to propose that Cbr represents novel carotenoid binding proteins, whose synthesis might be coordinated with carotenogenic enzymes via an evolutionary conserved regulatory mechanism.

In photosynthetic organisms, carotenoids function as protein-associated accessory light-harvesting pigments in antennae and reaction centers and also fulfill a critical role as protective agents against damage by photooxidation (1). Iso- lated plastids (chromoplasts of fruits and flowers and chloroplasts of photosynthetic tissues) are able to convert isopen- tenyl diphosphate, the universal biosynthetic precursor of isoprenoids, into carotenoids. The C40 phytoene is the first intermediate committed to carotenoid biosynthesis. Later de- saturation and cyclization steps are thought to be catalyzed by membrane-integral enzymes whose exact number and nature may vary between different organisms. In greening plants, formation of carotenoids is coordinately regulated with chloroplast development, but the operating regulatory mechanisms have not been elucidated yet (1, 2).

* This work was supported in part by the Leo and Julia Forchhei- mer Center for Molecular Genetics, The Weizmann Institute of Science. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Present address: Botany Dept., Duke University, Durham, NC 27701.

§ To whom correspondence should be addressed. Tel.: 972-8- 342788 Fax: 972-8-344118.

The genus Dunaliella includes unicellular, extremely halo- tolerant, green algae containing a single large chloroplast and lacking a rigid cell wall. Like all other photosynthetic organisms, Dunaliella species synthesize carotenoids, but only some isolates, e.g. D. bardawil, exhibit an extraordinary potential to accumulate @-carotene to as much as 10% of the algal dry weight. The accumulated pigment is at least partially stored in thylakoid-associated globules (3-5). Overproduction of @-carotene is induced by high intensity light and by other environmental factors such as nutrient deprivation or high salt and is also observed in cells entering the stationary phase of growth (4, 6). Its exceptional @-carotene biosynthetic ca- pability and the variability of the factors inducing it make D. bardawil an intriguing model for studying the mechanism and control of carotene formation and the intricate regulatory links between carotene biosynthesis and other developmental and adaptive processes in the chloroplast.

In a previous study of D. bardawil ( 6 ) we determined the kinetics of the induction of accelerated @-carotene synthesis by intense illumination and by sulfate deprivation and showed that carotenogenesis induction by high light required de nouo transcription and translation and thus entailed gene activa- tion. In this article, we report the cloning and sequence determination of a gene from D. bardawil whose transcript accumulates in correlation with @-carotene overproduction under a variety of conditions and in mutants partially “constitutive” for @-carotene accumulation. The deduced gene product is closely related to products (Elips) of major mRNAs that accumulate transiently in etiolated seedlings of pea (Pisum satiuum) and barley (Hordeum uulgare) on their transfer to light (e.g. Ref. 7). Elips are likely to play a central role in chloroplast development, but their exact function has not been elucidated yet.

On the DNA level, the upstream region of the algal gene contains sequence repeats that show outstanding similarity to regulatory elements of mammalian genes encoding enzymes responsible for the biosynthesis of mevalonic acid, the earliest specific precursor of isoprenoids, and the LDL’ receptor which controls exogenous sterol uptake by the cells (8). The presence of these elements in a gene co-induced with accelerated carotenogenesis suggests both systems might share common regulatory features.

MATERIALS AND METHODS

Algal Strains and Growth Conditions-The origin and clone purification of D. bardawil and D. salina were as described (6,9). Complete and sulfate-depleted media and normal growth conditions were also as described (6).

Light Induction-Cells grown under low illumination conditions

’ The abbreviations used are: LDL, low density lipoprotein; SRE, sterol regulatory element; bp, base pair(s); kb, kilobase pair(s).

13698

Algal elip-like Gene and Carotenogenesis 13699

were exposed to intense illumination as previously described (6). Cell Growth and Pigment Determination-cell density and pigment

determinations were as described (6). DNA Purification from Dunaliella-DNA extraction from D. salina

and D. bardawil cells was performed essentially as described (10). Cells from a 1-liter culture of D. bardawil ( lo6 cells/ml) or D. salina (2-5 X lo6 cells/ml) were collected by centrifugation at 4000 rpm in a Sorvall GS3 rotor for 10 min and resuspended (on ice) in 2.5 ml of water. T o 3.3 ml of the lysate were added 6 ml of 2% sodium dodecyl sulfate, 0.4 M NaC1, 40 mM EDTA, 0.1 M Tris-HCI, pH 8.0, the suspension was gently shaken and incubated at 50 "C for 15 min, and 9.6 g of CsCl and 0.6 ml of 0.5 mg/ml ethidium bromide were added. After centrifugation at 1300 rpm in a Sorvall SS-34 rotor for 10 min, the supernatant was centrifuged a t 55,000 rpm (Beckman Ti-70.1 rotor) at 20 "C for 36 h. The DNA band was extracted to remove ethidium bromide, diluted, and ethanol-precipitated.

Total RNA and Poly(A)+ mRNA Purification from D. bardawil- Total RNA was extracted essentially as described (ll), with a final additional step of LiCl precipitation (12). Poly(A)+ mRNA was purified by two cycles of fractionation on oligo(dT)-cellulose. The final yield was 1-1.5% of the total RNA.

cDNA Synthesis and Library Preparation-Synthesis of cDNA for the preparation of cDNA libraries was essentially as described (13, 14) starting from 5 pg of poly(A)+ mRNA. The cDNA was ligated into Xgtll arms (Strategene) and in uitro packaged (Amersham Corp. in uitro packaging kit).

Preparation of Comprehensive and Size-selected Genomic DNA Libraries-D. bardawil DNA partially digested with Sau3A was cloned into BamHI-generated arms of EMBL3 phage DNA to give a comprehensive genomic DNA library. A size-selected genomic DNA library was prepared by EcoRI digestion of total algal DNA, agarose gel electrophoresis, elution of DNA fragments of the desired size (determined by Southern blot analysis), ligation into Xgtll arms, and packaging as described for the cDNA library.

Plasmid Constructions and E. coli Transformation-Procedures used were as described (15).

Preparation of DNA Probes-cDNA probes for differential hybridization of the cDNA library were prepared from 2-5 pg of poly(A)+ RNA with oligo(dT) as a primer as described (15).

Differential Screening of the cDNA Libra? and Phage Purifica- tion-Hybridization of phage plaques was performed on duplicate Hybond membranes with cDNA probes prepared from mRNA extracted from D. bardawil cells grown under low illumination or after 24 h of intense illumination. Differentially hybridizing plaques were purified by several cycles of replating and rehybridization.

DNA and RNA Analyses-Restriction endonuclease digestions of DNA, gel electrophoresis, radioactive labeling of the probes, and blotting and hybridization procedures for DNA or RNA were performed under the conditions recommended by the enzyme suppliers, or as described (15). Hybridizations were carried out at 42 "C in 5 X SSC, 5 X Denhardt's solution, 25 mM sodium phosphate, pH 6.5, 75 pg/ml salmon sperm single-stranded DNA, 25% formamide and 1-5 X lo6 cpm radioactive DNA probe. The filters were washed at 45 "C with 5 X SSC (low stringency), or at 65 "C with 0.1 X SSC (high stringency).

DNA Sequence Analysis-DNA fragments isolated from the cDNA or genomic libraries were cloned into the polylinker of Bluescript plasmids (Strategene). Nested deletions, generated by the ExoIII/ mung bean nuclease procedure, and DNA sequencing, by the chain termination method, using the Sequenase I kit (U. S. Biochemical Corp.), were performed according to the suppliers' instructions. In a few cases dITP replaced dGTP.

Computer Programs for the Analysis of DNA and Protein Se- quences-Programs used include the Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin and TFASTA ( 16).

RESULTS

Screening for Genes Co-regulated with Carotenogenesk- The initial search for genes potentially related to carotenogenesis was based on the dramatic increase in the rate of @- carotene synthesis during the first 24 h of exposure to intense light (6). Because @-carotene overproduction required de nouo transcription and translation, the 24-h highly illuminated cells were expected to be enriched in transcripts of carotenogenesis-related genes as compared to the low light-grown cells.

A cDNA library was therefore constructed in Xgtll using poly(A)+ mRNA from 24-h highly illuminated cells. Of the library, which contained approximately lo6 clones, lo4 plaques were screened in parallel with labeled cDNAs prepared from poly(A)+ mRNA from cells continuously grown in low light or from cells after 24 h of high illumination. In this screen, one plaque was found to hybridize more intensely with the cDNA from the light-induced as compared with noninduced cells. Following repurification, clone AL14 was shown to contain an insert of 0.5 kb (Fig. 1).

Several tests were performed to examine the correlation between the level of the ALI4-corresponding transcript and carotene accumulation. As shown previously, accelerated production of @-carotene occurred in two different stages. The early stage immediately followed the exposure of the cells to high intensity light; the second stage occurred several days later and coincided with the onset of the stationary phase of growth (6). In the first test, cells at different times during the first 24 h of exposure to high light were analyzed for transcripts corresponding to AL14 and, in parallel, for their @- carotene content. The results (Fig. 2) revealed a single transcript which was barely evident in noninduced cells but whose level rose rapidly during the first 13 h and leveled off, or even decreased, by 24 h of illumination. The @-carotene level rose continuously during the first 13 h and continued to rise to 24 h. Thus, maximal @-carotene accumulation was always preceded by an increase in transcript level.

Sa HI1 ADI R I Hf l

R l K 5

5'

I KD

a

h

C

FIG. 1. Physical map of cbr complementary and genomic DNA. Restriction mapping for several enzymes is shown for the longest cDNA clone (top line) and genomic DNA (bottom line). Connecting lines between the cDNA and genomic DNA maps define overlapping sequences in the two DNAs. The 0.5-kb insert in ALI4 (terminated between the closely spaced Hinfl and Sac1 sites) was not flanked by EcoRI sites and was first subcloned as a blunted MluI fragment including Xgtll flanking sequences (17) into the SmaI site of the SK plasmid (Bluescript, Stratagene). Using the KpnI site within the phage DNA (18) and the Sac1 site in the polylinker sequence of the vector, a fragment containing the entire ALI4 insert and approximately 900 bp of Xgtll DNA (18) was prepared and used in Northern blot analyses. The fragment used for rescreening the library was generated by digestion with PuuII, which cuts the phage DNA within several nucleotides of the EcoRI site used for cDNA cloning (destroyed in ALI4), and with EcoRI, which cuts within the algal DNA insert in ALII. Empty boxes, 3' and 5"untranslated regions; filled boxes, translated regions; horizontal lines, introns and cbr flanking sequences; a, b, c, fragments used for delineating the span of the cbr transcribed region; RI, EcoRI; Hfl, Hinfl; Sa, SacI; ApI, ApaI; B, BglI; P , PstI; H, HindIII; S, SalI; K, KpnI.

13700 n

Tlrne o f induction (hrs)

0 2 4 6 6 1 3 2 4

28S-

18s-

Algal elip-like Gene and Carotenogenesis E

T h e o f lnductlon (hrs)

2 4 6 8 1 3

FIG. 2. Analysis of ALI4-corresponding transcript and 8- carotene content at early t i m e s a f t e r exposure to high light. Sorthern blot analvsis was perf'ormed on RNA extracted from D. hnrdaccil cells at the indicated times after transfer to intense light. The hybridization prohes used were: A , the KpnI-Sac1 fragment of AL14 described in the legend to Fig. 1, or B, an insert of' another recombinant clone, ALI6, which contained a cDNA sequence overlapping that in AL14 ligated to another, uncharacterized cDNA sequence. 'The latter sequence recognized a transcript that remained invariable under different growth and induction conditions and, in the absence of suitable cloned genes from Dunnliella, was used to standardize the amounts of RNA analvzed in each blot. Position of ribosomal RNA markers is indicated. Lower panel in A, parallel cultures to those tested in the Northern blots were analyzed for \$carotene content.

In another, more prolonged analysis covering both early and late stages of accelerated p-carotene production, mRNA was isolated a t 24 h intervals following exposure to high light. The results (Fig. 3) showed that following the first day increase, the AL14 transcript declined to a barely detectable level on the 3rd day, but started to rise again between the 5th and 6th days, a time a t which the cells ceased to divide (6). Thus, as for p-carotene accumulation, the change in transcript level followed a biphasic pattern, with the rise in transcript preceding that of @-carotene for each of the phases.

To further examine the correlation between the level of the ALI4 transcript and the rate of P-carotene production, the transcript was analyzed in cells induced to accumulate p- carotene by sulfate deprivation. In this instance, the cells ceased to divide, but their carotene content kept increasing for several days, although a t a slower pace and to a lower maximal level than in cells induced by high light (6). In the experiment shown (Fig. 4), a 4-5-fold increase in p-carotene content was reached after 3 days of sulfate limitation, but an increase was already evident on the 2nd day. The level of the transcript corresponding to ALI4 started to rise already after the 1st day and reached its maximum after 4 days. Thus, in sulfate-starved cells the rise in transcript level also preceded the maximal accumulation of p-carotene.

Recently, UV-mutagenized D. bardawil strains were isolated which differed from the wild type in their higher p- carotene content when grown under relatively low light intensity.' In the absence of genetic tools or a DNA transformation method for Dunaliella, the relationships between these strains and the nature of their mutations still remain unknown. RNA

'A. Shaish, A. Ben Amotz, and M. Avron (1991) submit.ted for publication.

Time of induction (days)

0 1 2 3 4 5 6 7 8

A

B

FIG. 3. Analysis of ALI4-corresponding transcript and 8- carotene content during prolonged illumination by high light. Analvses were essentially as descrihed in Fig. 2 , hut the cell samples were withdrawn at daily intervals after transfer to intense light. Northern blot hybridization with the prohes described in Figs. 1 and 2: A, ALI4 fragment; H , ALI6 fragment (only the relevant part of the blot is shown). Lower panel in A , parallel cultures analyzed for /j- carotene.

was prepared from two constitutive isolates, DB1 and DB5, grown under a relatively low light intensity and from similarly grown wild type cells. Under the conditions of this experiment the p-carotene content of the mutants was approximately 2- fold higher than of the wild type cells. The results of Northern blot hybridization (Fig. 5) showed that the constitutive strains contained severalfold higher levels of the ALI4 transcript compared with the wild type cells. Further accumulation of p-carotene and cbr transcript could be induced in the mutant strains by intense illumination or sulfate deprivation (not shown).

Thus, in all the tests performed a correlation was observed between @-carotene overproduction and elevated levels of the ALI4-corresponding transcript. Based on this correlation we designated the gene represented by ALI4 as cbr, for carotene biosynthesis-related.

Genomic Analyses-Total DNA from D. bardawil as well as from D. salina, a strain not inducible for p-carotene overproduction (3), were subjected to Southern blot hybridization analysis with ALI4 DNA as a probe (Fig. 6). Under high stringency conditions, the analysis revealed a limited number of radioactive fragments in D. bardawil DNA, but not in the D. salina DNA. Under lower stringency conditions, additional hybridizing fragments became apparent in the D. bardawil DNA. In D. salina, the diffuse hybridizing band in the EcoRI- digested DNA overlapped undigested DNA or large EcoRI fragments typical for EcoRI digests of Dunaliella DNA. These results suggest that AL14 could represent a member of a


A Time of induction (days)

0 1 2 3 4 5

E Time of induction (days)

0 1 2 3 4 5

FIG. 4. Analysis of ALI4-corresponding transcript and .8- carotene content in sulfate-depleted cells. Cells were analyzed a t daily intervals after being suspended in a sulfate-free medium. Northern blot hybridization with the probes described in Figs. 1 and 2: A , ALI4 fragment; R, ALIG fragment (only the relevant part of the blot is shown). Lower panel in A , parallel cultures analyzed for 0- carotene.

A wt M1 M5

B

FIG. 5. Analysis of ALI4-corresponding transcript in mutant isolates of D. bardawil. Isolates DB1 (MI) and DB5 (M.5) and wild type algae (u t ) were grown under light intensity of 10 w m-’ and equal amounts of total RNA were analyzed by Northern blot hybridization with the probes described in Figs. 1 and 2: A , AL14 fragment; R, ALI6 fragment (only the relevant part of the blot is shown, which in this analysis contained another minor band).

multigene family in D. bardawil, but its presence in D. salina remains questionable.

Partial Sequence Determination of cbr cDNA-The nucleotide sequence of the AL14 insert revealed that the clone included the 3”untranslated region of the cDNA and 220 bp of coding sequence. The most extended of several hybridizing clones isolated after repeated screening of the cDNA library contained approximately 150 bp 5‘ to the sequence present in ALI4. Despite repeated efforts we were unable to isolate more extended cDNA clones, and the remainder of the sequence was therefore established for genomic DNA clones.

Isolation and Complete Sequence Determinution of cbr Ge-

A D.bardawil D.salina

I S RI Hf H I 1 S RI Hf_H 1

4.5 -

1 .7 -

D.bardawil D.salina

I S RI Hf HllS RI Hf H I

4.5

1.7

FIG. 6. Genomic Southern blot hybridization of D. bardawil and D. salina. Total algal DNA was digested with the indicated restriction enzymes and probed with ALI4 DNA under high ( A ) and low stringency ( E ) conditions as described under “Materials and Methods” and Fig. 1. S, Sau3A; RI, EcoRI; Hf, Hinff; HindIII.

nomic DNA-In ALI4, an EcoRI site is located approximately 300 bp from the polyadenylation site (Fig. 1). The genomic Southern analysis revealed two EcoRI fragments of approximately 1.7 and 4.5 kb, which hybridized with the AL14 probe (Fig. 6). On reprobing the blots with subfragments of AL14 from either side of the EcoRI site (not shown), the 1.7-kb fragment was shown to contain the 3’ portion of the gene, whereas the 4.5-kb fragment contained its 5’ end. In view of these results, two types of genomic DNA libraries were constructed. A comprehensive library in phage EMBL3 was made with Sau3A partially digested total DNA, and two other libraries were made in Xgtll with size-selected 1.7- or 4.5-kb EcoRI fragments. In the comprehensive library, a 15-kb insert was shown to include both the 4.5- and 1.7-kb EcoRI fragments. The restriction maps of the genomic clones showed a general correspondence to the cDNA sequence in AL14 (Fig. l), except for several fragments which appeared to be longer in the genomic clones as compared with the cDNA clones. As shown below these differences are accounted for by the presence of two introns within the cbr coding sequence. The 4.5- kb fragment was further analyzed to determine the 5”uppermost limit of the transcribed region. For this purpose, subfragments were used as probes in Northern blot analysis of RNA from 24-h light-induced cells. The results (not shown) indicated the mRNA hybridized with fragment a but not with fragments b or c (Fig. 1). Therefore, unless the gene contained additional very long introns, the PstI site delimiting the 5’ end of subfragment a represented the 5’-uppermost limit of the transcribed region.

13702 Algal elip-like Gene and Carotenogenesis

In addition to three overlapping cDNA clones, the genomic 1.7-kb EcoRI fragment as well as subclones of the genomic 4.5-kb EcoRI fragment were subjected to DNA sequence analysis. The exon sequences derived from the genomic clones fully agreed with the approximately 650-bp cDNA sequence encompassing the two complete 3' exons and part of the 5' exon and thus permitted the unambiguous determination of all the intron boundaries. The total length of the genomic sequence determined was 2952 bp.

Gene Organization-The cbr coding sequence is present in three exons (Fig. 7). The exon including the 3"untranslated region encodes the carboxyl-terminal 18 amino acids and is followed on its 5' end by a 288-bp intron. The middle exon codes for 85 amino acids and is followed on its 5' end by an approximately 700-bp intron (approximately 100 bp of the intron sequence have not been precisely determined yet). The third exon codes for the amino-terminal segment of the protein, which can be potentially initiated at one of two in-frame methionine codons starting at nucleotides 1223 and 1235. Upstream of nucleotide 1223, termination codons are found in all three reading frames. When initiated at the more

upstream of the two ATG codons, the amino-terminal sequence, Met-Gln-Leu, is identical to the corresponding sequence deduced for a Cab protein from D. salina (20). Because Cbr might be related to Cab proteins in structure, subcellular localization, and processing (as discussed below), and in the absence of additional data, we present the Cbr open reading frame as starting from the more upstream ATG. This choice does not affect any of the conclusions regarding the protein or the gene as discussed below.

The two cbr introns are bordered with the consensus GT/ AG splice sites. A more extensive correspondence is noticed with consensus splice sites for Chlamydomonas introns: 5'- GIGTGA/CGT/C - - - - - CAGIG-3' (21). The more upstream of the two introns is characterized by several blocks of CA repeats as well as by a single block of CAG repeats. This intron includes approximately 100 bp for which no final sequence has been determined, but similar to its flanking regions, also includes CA repeats. (CA), clusters are wide- spread in a variety of eukaryotic genomes (22), have been identified in specific introns (e.g. Ref. 23), and proposed to be involved in recombinational events (24).

FIG. 7. Genomic sequence of cbr and upstream region. Determined DNA and deduced amino acid sequences are shown. Sequences I-V, direct repeats; 1-4, boxes within these repeats; framed sequences, similarities to the SV40 core enhancer elements; broken underlines, putative CAAT and TATA boxes, -/I-, a gap in the deterermined sequence; double underlines, putative polyadenylation signals; arrow, polyadenylation site (could potentially be located also at the C residue preceding the indicated site); small vertical bars, intron-exon boundaries.

1 TCGGACGVIPITTTGCTGGACGCACGGCGGCGGA-~M~WLGTCCGAGTGTCCC~TGGC~-CCCTCUIGATCC

91 CCATTCGTCCTGTTTCTGGCTCTCTTCTAGGCTAGCTACGTCTAGTGTAffiTTCT~GGCCTCCTGGTGAGGCCTCT~TCTCCAATTA

181 M~CCTTCCCTTMTGCACGCGGCCTTGGCTTGCGT~CTTTTGGTTTTCTTTTCTTT~"TTATMTCATTT

271 T T T T C ~ T M T C A G A C A T T C A T G T A G C A C A G A C C A A C T T f f i T G T T A T C C T T C C A A C T C ~ T A T G C T T ~ T ~ T G W I C A A

361 T C ~ G C G A T T T A G C C A T C T C A G C T G A G A T G G C C T ~ C C T C G W I C C C ~ T T ~ T C C T C G W I C C ~ G ~ ~ T G C N C T C C ~ C

451 T A C C C C A C A T T C G G C T A G C A T G C A T G C A T G C A - ~ W I T G T G C C T T f f i T U I G C C T T ~ G G T G T ~ C T A T C C G C ~ T ~ C

541 T C T C C T A C T G C G C A U C A T G T G M T - C A C C T ~ T M T - G C C T T G G C T ~ T ~ C C T ~ T T ~ T G T T G T A ~ U I

631 G G O I P T U i G C T T C G G C T C G T C C T C A C C U I T G T T ~ C G C C ~ T G G T A ~ C C T G T G T A T G T G C G T G ~ - T ~ C

721 CCTATGCCGGCAGTTCCTGAGCACAAATGTGTGCTCGWITGAGACTGCGCNCZGCA~~CW~ , TGCCTTCCCTCMTTGAGTCTCC

I II m - , - 2 " 3 - L , " z " - 1 3 L L , - - L - 2 2

-3-

-1-4- x

811 ~ T C U L ~ ~ U I U I C A C A A T T A W I W I T G T W L C T C T T ~ T T W L G T A T C T ~ T ~ C - ~ ~ T ~ ~ C T ~ C C ~ G C ~

901 G C T T G C T C C T C A A C T G G C f f i T C A A C A C C C T C C A A C A R C ~ ~ T G T ~ C C G T W I T ~ C 6 T C G T G ~ ~ ~ ~ T T ~

991 A C A M C C T G T C U S J \ T T T T G T G G T A C T & ~ + C A A C G C A C T G G T T C A U I T T T C G C A C T C A M G C T C ~ ~ T T C

1081 T C G G A A T T T G A G G G T T C T C G C A C A A G T T T G C U I C C C T ~ T - ~ T ~ - ~ ~ C T - T ~ ~ - ~ ~ ~ ~ T C ~

1171 C T T G T G C A C C C _ T ~ ~ ~ ~ C C G G C G T A ~ C G C ~ ~ M ~ C ~ T C C ~ C C M C T A C G A T G C N C T - T ~ C C T G C C U I C C T C C C G W I T C G C W Q L B H N L P T S R I A

1261 G G C C G G T G C T T C C A T C A A T G T T C G T C C C G C A C C T C T C T T ~ G T A C T ~ T G C A C C - G C G T G T ~ T A T C G T ~ ~ ~ ~ A A G A S I N V R P A P L L R T A A P . . K R V C K E I V R A E N

1351 C A A C C C C T C U I C T C C C C C T C C A T C T A G C C C T T C C C C T C C C C C T C C C C C T C C U I C T C C T G C T G C C C C ~ C T G T ~ T G T ~ T I

N P S T P P P S S P S P P P P P P T P A A P T V T E

1441 CTAGCCATCCTGPJLCW\CCTCCCATGCTGGCTCATGT~CTT~TCTTT~T~)rCCTCCCTWLGTGTTTTIVIPICTOTTWUOCTI3rC1C

1531 A U I C T C G W I W I C A T A C A C A C A C R C A C A C A C A C A C A C A C A U L

1621 A C A C A C - / / - C G T T C A ~ G T C A C A C A G T G C G C T T A ~ U I - W I U I ~ C A U I C A ~ U I U I U I - U I U I ~ G W I T

1707 G A G T A C A T A W I C A C C C A C A C A A A C G T W L C T C A C A U I U I U I W I C A ~ U I ~ ~ C A U I T G W I U I C A ~ T - ~ ~ ~ C T

1797 C G C A C A C G C A C A C G C A C A C C A T T A T C A G C A G C A T T M ~ T C G A A G C A T G T A A C G G A T T A T ~ T G T G

1887 T T Q T C T G T T C T T T C T T C C T C T T C T C ~ T A G T ~ T T A T A ~ T T T ~ C T T C T T T A C T ~ T C ~ A C A R ~ ~ C T T G T ~ T T T T

1977 TTCCTGACTTCCCCTCCTGTTTCCTCCTTTACTTTGCCTCGWI-TUIT-TT~GTGGTGCCCUI~TUITCAATGGCC~CT

2067 C G C U T G C T C C C C T T T G T G G C A G C C C T A G G T ~ T ~ T C T C C A C T ~ G T C A G T G C T ~ C A ~ C T - ~ T W I ~ C U I C C C T U I ~

2157 T G C G C T T A C C T T T G T C C T C T T C T C T G C T G C A T C C C T C A T C C C T ~ C T T C - ~ ~ G A C ~ T A T - C C C T T ~ ~ C T G A

2241 T G C G W \ G A T C A C T M C G G T A G A T T T G C C A T G T G A G T T A C

I V W G F S G A P E I I N G R L

A H L G F V A A L G A E L S T G E S V L T Q L G D Q P T L I

A L T F V L F S A A S L I P A F A R R K G D A M G P F T P D I

A E M T N G R F A M

2337 T T G T T C C C C T G W V L U I C A C A T G T C T T C T G T A C G C T T A G C T ~ C ~ T ~ T A U I ~ C A A C U I C T G T ~ C C A A T T ~ A T G

2021 CATGGAATMGGT~TGCGTAGATAGCCTTCTTAGWITCT~TTTCACTUICTTGCGCTAUIUITTCTCA~CT~T~TT-CT

2517 GTTCTGMTGTGTGTGCACRTATCTTTGATTGCA~TT~TTTGCTGCUITGCT~TATAC~-TTCAA-TT~TCTGTT I

I G F A A Y L V Y E G I Q C I A L ?

2607 T T G A G A G C A G M T C T G T G G C T G A T C P ~ C M T T C T G G T A C T T G T C A A T G T C A ~ T T A T ~ T T G T ~ T A C ~ T ~ T G T G T G C T C t

2697 T T C A R C T C C A R T T G C C T T G A C A T T G C R T G T A C A C T ~ ~ C T G T A T T A ~ T C G T A C A A T f f i T - ~ T T G T A T T T C T ~ ~ T A

2787 A T A T G T C T C T C A C T G C T T G T A C C A R T G ~ T T C T T G T T T T T G T T C T C ~ T G T M T C T T T T T T T U I T ~ T A U I T C - C ~ T ~ ~

2877 J I T M T T A C A R C A C A A T C C ~ ~ C C T G C C G C T T A G T T G v -


The Deduced Structure of the Cbr Protein-The cbr open reading frame encodes a 172-amino acid polypeptide of 17,887 Da. The amino acid composition shows a high content of proline (12.8%) and alanine (14.5%). I t is particularly striking that of the 21 amino acid residues between positions 45 and 65, 13 are prolines, 9 of which are arranged in consecutive stretches of 3 and 6 residues. Of the remaining residues in this segment, 6 are serines or threonines and 2 are alanines. Repeated proline-rich peptides are characteristic of extensins, a family of hydroxyproline-rich glycoproteins that are major components of plant cell walls (25). These polypeptides generally assume polyproline I1 helical structures forming flexous rods. Another unique feature of Cbr is an internal duplication of a 23-amino acid motif (residues 78-100 and 146-168), described in more detail under "Discussion."

5'- and 3'-Flanking DNA Sequences and Potential Regula- tory Elements-The 280-bp-long 3'-untranslated region of cbr cDNA is characteristically AT-rich. Polyadenylation could start at either the C or A residues at positions 2888 or 2889, respectively. While the sequence lacks a canonical polyadenylation signal, it contains, at a distance of 10 and 40 bp from the polyadenylation site, two repeats of the sequence ATGTAAT. This sequence is found close to the polyadenylation site of Chlamydomonas cDNAs (26) as well as in the D. salina cab gene (20) and was suggested to function as a polyadenylation signal.

Examination of the sequence upstream of the open reading frame (Fig. 7) revealed potential TATA and CAAT elements. The search also identified in this region three sequence elements corresponding to the SV40 enhancer core elements GTGGTTTG or GTGGAAAG, in both orientations. Such elements were reported to be part of light-responsive elements in higher plants and algae (27). Screening of the upstream region for additional features of interest revealed three 21- bp-long, nearly perfect direct repeats and two additional, partially overlapping, 12-bp direct repeats (Fig. 7). The potential significance of these repeats is discussed below.

DISCUSSION

The relationship between cbr transcript accumulation and accelerated @-carotene production has been demonstrated in four different instances: during the early and late phases of @-carotene accumulation in strongly illuminated cells, in sulfate-depleted cells, and in mutants constitutive for @-carotene accumulation. In the first three instances, the increase in the level of the cbr transcript was shown to precede the maximal rise in @-carotene and to decline in periods when the cellular carotene level remained constant. In the constitutive mutants, a high level of transcript was present under normally nonin- ducing conditions for @-carotene accumulation. These results clearly support a link between the rate of @-carotene synthesis and the level of the cbr transcript.

While no meaningful homologies were found between cbr and known DNA sequences, the deduced protein sequence was closely similar to sequences of early light-induced proteins (Elips) from higher plants. Sequence alignment is shown for the primary translation products corresponding to Cbr and the Hv90 Elip from barley (7) which is closest in length to Cbr (Fig. 8). A high degree of similarity was also found in comparisons with the other three available Elip sequences (7, 28). The Cbr and Hv90 sequences show 36% identity and a higher degree of similarity when conservative replacements are included. Hydropathy plots of the Cbr and Hv90 sequences (Fig. 9) are nearly superimposable and thus further substan- tiate the close structural similarity between the algal and higher plant proteins.

Cbr 1 HQLHHNLPTSR1)rAOSIHAPL~TAAPXRVCKX.. IVRAENNPSTPPP 50

Hv90 1 ~ ~ H S S F A W U L ~ R S S ~ S F ~ ~ A L G ~ ~ Q T E . . . . . . 44 : :. l . : l : : l : . . I . : . . . :.:: : I l l : , :

51 S S P S P P P P P P T P A A P l " J T E V U G F S G . A P E I I N G W E I U i ' 9 9

45 . G P S A P P P M ( P ~ T S I V ~ S G P A P ~ I N O R W U N G 93

100 GESVLTQL..GDQPTLIALTFVLFS2ASLIPAFAPBlCGDAMGP..FTPDA 145

94 G D G Z L S Q L C S G T ~ A Y ~ A ~ S ~ L ~ L ~ E S ~ ~ I ~ 143

: I I : I I I ... I . . . : : I : I I I I l l I I I I I I l : I l I . I I : . I :

l : : : l . l l l . . . . : : l . l . . : : l I I I : I : . .:::.:. :.::I

146 EMTNGRPWIGFLWaVYEGIQGIALF 172 I : I I I I I I : I : . I : . I I I : ::

144 ELRNGRFIMLGLVALA&TEIITGAPFI 170

FIG. 8. Alignment of Cbr and an Elip from barley. The deduced amino acid sequences of cbr and barley Hv90 (7) were aligned by use of the Bestfit program. Vertical lines, conserved residues; dots, similar residues according to the scores used in the program.

2 - 2 1 - 1 0 - 0 1 - 1

Hv90

Cbr

R e s i d u e

FIG. 9. Hydropathy plots. The mean hydrophobicity was calcu- lated according to Ref. 29. Ouerlines, span of conserved oligopeptide repeats (shown in Fig 10).

Hv58

Hv90/

PEA

Cbr

I I11

'60 I I11 I I11 I I11

0. .. . ERINGBLAMV---GFVAALSVEA?.FG

ERINGBLAMV---.GFVTALAVEAGRG ELWNGBFML-"GLVALAATEFITG

ELWNGBFAML-"GLVALAATEIITG ERINGBLAMI---.GFVAAMGVEIAKG EFWNGBIAML-"GLVALAFTEFVKS EIINGBLAML---.GFVAALGAELSTG EMTNGEFAMI-"GFAAMLWEGIQG

€ah

PEA I 111

EVIHSBWAMLGALGCVFPELL-SRNG ELKNGBLAMFSMFGFGVPAIV-TGU

BARLEY I EVIHGBWAMLGALGCVFPELL-ARNG

D.salina I I11 EIKNGBLAMFSMFGFFVQAIV-TGG

I11 EIKNGBLAMFACLGFFVQAIV-TGKG ELIHABCGLLGALGMVTPELLADEDG

Residue NO 1 13 26

FIG. 10. Alignment of conserved oligopeptide repeats in Cbr/Elip and Cab proteins. Comparison of deduced amino acid sequences in the first, I , and third, IZI (from the amino terminus) hydrophobic regions in Cbr and Elips from barley, Hv90 (7), and pea (28) and from Cab1 from pea ( 3 3 ) , Cab2 from barley (34), and a Cab from D. salina (20). Underlines, generally conserved amino acids; asterisks, amino acids conserved in Cbr/Elip.

Elips are products of nuclear genes that are actively, but transiently, transcribed in etiolated seedlings of pea (P. satiuum) and barley (H. uulgare) soon after their transfer to light (7,8, 30-32). The elip transcripts characteristically disappear before the completion of the assembly of the light-harvesting complexes in the greening plants. Posttranslational, in vitro transport into chloroplasts and thylakoid insertion accom- panied by proteolytic processing were demonstrated for both pea and barley Elips (7,28,30-32).

For Elips, sequence similarity was previously pointed out between tridecapeptides that form part of domains I and I11 of the three hydrophobic domains. Most interestingly, similar internally repeated motifs were also identified in light harvesting chlorophyll a/b binding (Cab) proteins of both photosystems I and I1 (7). We show here (Fig. 10) that the repeated oligopeptide motif in the two protein families is in fact much more extended than previously proposed and spans 23 residues in Cbr/Elip and 25 or 26 residues in Cab proteins. Four residues are fully conserved between all the aligned

13704 Algal elip-like Gene and Carotenogenesis cbr BOX

Repeal 1 2 3 1

I TGUO CTCCTCG CACCCCACA

I I TGUO CTCCTCG CACCCCAC A

Ill TGUO CTCCTTG TACCCCACA

I V 03x5 CMjUITGc

v 1- ccGcAToc

L W Receptor Repeat

1. 3 CTCCTC

2 (SRE-I) CAccccAc

SRE-I COIISBIISUS u\ccg+C

FIG. 11. Comparison of sterol regulatory elements and putative regulatory elements in cbr. I-V and 1-4, cbr upstream sequences as shown in Fig. 7; LDL receptor repeats and SRE-1, as described (8, 19).

sequences and 2 more, Ala-8 and Met-9, are conserved in all but one sequence. Ile-3 is conserved in segment I of all the proteins compared, and Asn-4 and Gly-5 are invariant in segments I and 111 in Cbr/Elip and in segment I11 of Cabs. In general, the repeated motifs share a negatively charged amino acid at position 1, a positively charged residue in position 6, a partially conserved, negatively charged residue in positions 19 or 22, and a charged or hydrophilic residue in position 25. Apolar regions flanked by polar residues are characteristic of membrane-spanning domains (35). Indeed, in the extended form presented here, segments I and 111 precisely overlap hydrophobic domains I and I11 predicted from the hydropathy plots of both Cbr/Elip and Cab proteins (36). For Cab proteins, evidence has been presented that information residing within domain 111 is critical for thylakoid insertion of the protein (37, 38).

The presence of an elip-like gene in a unicellular green alga points to an early evolutionary origin of the Cbr/Elip group of proteins and hence to a universal function in photosynthetic eukaryotes. In this perspective, the absence of cbr cross- hybridizing sequences in D. salina cannot be taken to indicate the absence of Cbr/Elip proteins. Rather, the structural similarity between the members of this group of proteins might not always be enough for significant cross-hybridization of the corresponding DNAs.

Elips have been previously proposed to represent pigment- free protein substitutes for the Cab proteins in early developmental stages of active photosynthetic units (7). In view of the present results we propose that Cbr/Elip proteins, similar to Cab proteins, function as pigment-binding proteins whose synthesis is coordinately regulated with carotenogenic enzymes. The pigment binding specificities of Cbr/Elip might resemble those of Cab, but could also differ by including (3- carotene (Cab proteins typically bind xanthophylls and not &carotene). The role of Cbr/Elip could then be to deposit the newly formed carotenoids, and perhaps also chlorophylls, in the thylakoid membranes in a form available for later inte- gration into the light-harvesting and reaction center complexes. Another related function would be to provide photo- protection of the assemblying antennae and reaction center complexes. A high carotene to chlorophyll ratio is thought to be a critical factor in protection against photooxidative damage (39). It is therefore reasonable that formation and proper deposition of carotenoids should occur early in the development of photosynthetic membranes, or during their adapta- tion to excessive light intensity, as in D. bardawil.

In general, this proposal agrees with former observations indicating that the synthesis of photosynthetic pigments is coordinated with that of the pigment-binding apoproteins (40). Accelerated carotenogenesis in D. bardawil most likely

requires the induction of phytoene synthase as well as enzymes acting earlier in the biosynthetic pathway (6, 41). Because these early steps are common to other isoprenoid products, including sterols, it was striking to identify in the sequence upstream of the cbr coding region sequence repeats corresponding to sterol regulatory elements in mammalian genes (e.g. Ref. 19; for a review see Ref. 8). Sterol-dependent transcriptional regulation has been demonstrated for two genes for biosynthetic enzymes (hydroxymethylglutaryl-CoA synthase and hydroxymethylglutaryl-CoA reductase) of mevalonate, the first intermediate committed to isoprenoid biosynthesis, and for the gene encoding the cell surface receptor for the low density lipoprotein, LDL, active in cholesterol uptake. An 8-bp sequence (sterol regulatory element, SRE-1) has been demonstrated to be essential for this regulation. In the LDL receptor gene, this element is flanked by two other regulatory sequence repeats.

In the three upstream, 21-bp-long, nearly perfect direct repeats in cbr (Figs. 7 and ll), Box 3 contains an octamer identical or nearly identical to the SRE-1 octamer in the LDL receptor gene and corresponding to the consensus sequence of this element (Fig. 11). Another similarity is evident between Box 2 of the cbr 21-bp repeats and the hexamer 5”CTCCTC- 3’ found in the regulatory repeats flanking SRE-1 in the LDL receptor gene. The partially overlapping, 12-bp direct repeats IV and V (Figs. 7 and 11) do not share sequence similarity with the sterol regulatory elements, but only with Box 1 of the longer repeats.

The similarity of putative cis elements in cbr and regulatory motifs in mammalian genes encoding mevalonate biosynthesis and the LDL receptor suggests the operation of an evolutionary conserved regulatory mechanism. If the algal genes for mevalonate biosynthesis are also subject to a similar regulation then a basis can be offered for the co-regulation of cbr and carotenogenesis and, in a broader context, for the coordinated syntheses of pigment and apoprotein. To be effective this mechanism must also include elements that would divert the common isoprenoid biosynthetic intermediates preferen- tially towards carotenoid biosynthesis.

In conclusion, the co-regulation of cbr and carotenogenesis provides novel insights into the potential function of the Cbr/ Elip proteins in chloroplast development and into the regulatory mechanisms governing their synthesis.

Acknowledgments-We are grateful to A. Shaish and M. Avron for providing the D. bardawil wild type and mutant strains and for helpful advice and to A. Segal for algal cultivation.

REFERENCES

1. Bramley, P. M., and Mackenzie, A. (1988) Curr. Topics Mol.

2. Kleining H. (1989) Annu. Reu. Plant Physiol. Plant Mol. Biol.

3. Ben Amotz, A,, and Avron, M. (1981) Trends Biochem. Sci. 6,

4. Ben Amotz, A,, and Avron, M. (1983) Plant Physiol. 72,593-597 5 . Ben Amotz, A. (1987) J. Plant Physiol. 131, 479-487 6. Lers, A., Biener, Y. , and Zamir, A. (1990) Plant Physiol. 93,89-

7. Grimm, B., Kruse, E., and Kloppstech, K. (1989) Plant Mol. Biol.

8. Goldstein, J. L., and Brown, M. (1990) Nature 343, 425-430 9. Sadka, A., Lers, A., Zamir, A,, and Avron, M. (1989) FEBS Lett.

10. Weeks, D. D., Beerman, N., and Griffith, 0. M. (1986) Anal.

11. Logemann, J., Scell, J., and Willmitzer, L. (1987) Anal. Biochem.

12. Okita, T. W., and Greene, F. C. (1982) Plant Physiol. 69, 834-

Regul. 29,291-343

40,39-59

297-299

395

13,583-593

244,93-98

Biochem. 152, 376-385

163, 16-20

839


13. Gubler, U., and Hoffman, B. Gene (1983) (Amst.) 25, 263-269 28. Kolanus, W., Scharnhorst, C., Kuhne, U., and Herzfeld, F. (1987) 14. Sartoris, S., Cohen, E. B., and Lee, J. S. (1987) Gene (Amst.) 56, Mol. Gen. Genet. 209,234-239

15. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular 30. Meyer, G., and Kloppstech, K. (1984) Eur. J . Biochem. 38,201- C1oning:A Laboratory Manual, Cold Spring Harbor Laboratory, 207 Cold Spring Harbor, NY 31. Scharnhorst, C., Heize, H., Meyer, G., Kolnaus, W., Bartsch, K.,

16. Pearson, W. R., and Lipmann, D. J. (1988) Proc. Natl. Acad. Sci. Heinrichs, S., Gudschun, T., Moller, M., and Herzfeld, F. (1985) U. S. A. 85, 244-248 Plant Mol. Bid. 4, 241-245

17. Grossberger, D. (1978) Nucleic Acids Res. 15,6737 32. Grimm, B., and Kloppstech, K. (1987) Eur. J . Biochem. 207, 18. Moran, L. S., Maina, C. V., Poole, C. B., and Slatko, B. E. (1990) 493-499

Gene (Amst.) 93, 163-164 33. Coruzzi, G., Broglie, R., Cashmore, A., and Chua, N.-H. (1983) J. 19. Smith, J. R., Osborne, T. F., Goldstein, J. L., and Brown, M. S. Bid. Chem. 258, 1399-1402

(1990) J. Bid. Chem. 265, 2306-2310 34. Chitnis, P. R., Morishige, D. T., Nechushtai, R., and Thornber, 20. Long, Z., Wang, S.-Y., and Nelson, N. (1989) Gene (Amst.) 76, J. P. (1988) Plant Mol. Biol. 11, 95-107

299-312 35. Boyd, D., and Beckwith, J. (1990) Cell 62, 1031-1033 21. Zimmer, W. E., Schloss, J. A,, Silflow, C. D., Youngblom, J., and 36. Hoffman, N. E., Pichersky, E., Malik, V. S., Castresana, C., KO,

Watterman, D. M. (1988) J. Bid. Chem. 263, 19370-19383 K., Darr, S. C., and Cashmore, A. R. (1987) Proc. Natl. Acad. 22. Rogers, J. (1983) Nature 305, 101-102 Sci. U. S. A. 84,8844-8848 23. Stanton, L. W., Watt, R., and Marcu, K. B. (1983) Nature 303, 37. Kohorn, B. D., Harel, E., Chitnis, P. R., Thornber, J. P., and

24. Hamada, H., Petrino, G. M., and Kakunaga, T. (1982) Proc. Natl. 38. Kohorn, B. D., and Tobin, E. M. (1989) Plant Cell 1, 159-166 Acad. Sci. U. S.A. 79, 6465-6469 39. Taylor, W. C. (1989) Annu. Reu. Plant Physiol. Plant Mol. Biol.

25. Varner, J. E., and Lin, L.-S. (1989) Cell 56, 231-239 40,211-233 26. Silflow, C. D., Chisholm, R. L., Conner, T. W., and Ranum, L. 40. Chitnis, P. R., and Thornber, J. P. (1988) Photosynth. Res. 16,

P. W. (1985) Mol. Cell Biol. 5, 2389-2398 41-63 27. Nagy, F., Kay, S. A., and Chua, N.-H. (1988) Trends Genet. 4,7- 41. Ben Amotz, A., Gressel, J., and Avron, M. (1987) J. Phycol. 23,

42 176-181

301-307 29. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Bid. 157, 105-132

401-406 Tobin, E. M. (1986) J. Cell Biol. 102, 972-981

the of biological chemistry no. 25, in u. s. a. co ... · pdf fileco-regulation of a gene...

Documents