ANNALS OF CLINICAL AND LABORATORY SCIENCE, Vol. 26, No. 5 Copyright © 1996, Institute for Clinical Science, Inc.

The Effect of Storage on Guthrie Cards: Implications for Deoxyribonucleic Acid Amplification*GREGORY S. MAKOWSKI, Ph.D., ESTHER L. DAVIS, M.T.(ASCP), and SIDNEY M. HOPFER, Ph.D.Department of Laboratory Medicine, University of Connecticut School of Medicine,

Farmington, CT 06030

ABSTRACTThe effect of storage on (1) amplifiability of nucleic acid (present at low

level) and (2) properties of whole blood polymerase chain reaction (PCR) inhibitors (present at high levels) in Guthrie card bloodspots was evalu­ated. Natural PCR inhibitors (protein, hemoglobin, iron) were selectively eluted from Guthrie cards (1 to 30 mo storage) under nondenaturing con­ditions and quantitated. The PCR was performed by direct amplification. It was found that PCR inhibitors become increasingly resistant to elution (“fixed”) over time. For example, 600 |xg protein, 1.87 au hemoglobin, and 374 ng iron were solubilized from 1 mo bloodspots. In contrast, only 137 (jug protein (22 percent), 0.34 au hemoglobin (18 percent), and 147 ng iron (39 percent) were solubilized from 30 mo bloodspots. Fixation does not result from excessive desiccation since bloodspot weight 2.20 mg ± 0.21 (1 mo) and 1.92 mg ± 0.31 (30 mo) was not significantly changed (p > 0.05). The majority of protein was characterized as albumin, and two rbc metal- containing proteins, carbonic anhydrase and hemoglobin by sodium dode- cyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Despite the presence of “fixed” PCR inhibitors, it was found that bloodspots stored 1 to 30 mo could be amplified for two regions (98 bp and 491 bp amplicons) encoding the AF508 cystic fibrosis mutation. It is suggested that nucleic acid also becomes “fixed” to the filter paper matrix and accounts, in part, for the ability to amplify Guthrie cards by direct PCR and low yield of deoxyribonucleic acid (DNA) reported for microextraction methods.

IntroductionWhole blood dried on filter paper

(Guthrie card bloodspot) has provided an

* Send reprint requests f Sidney M. Hopfer, Ph.D., Department of Laboratory Medicine, Uni-

excellent means for neonatal screening of inborn errors of metabolism such as phe-

versity of Connecticut Health Center, MC-2235, 263 Farmington Avenue. Farmington, CT 06030. tel (860) 679-2665, fax (860) 679-2154 , e -m ail hopter@nso 1 .uchc .edu

4580091-7370/96/0500-0458 $01.80 © Institute for Clinical Science, Inc.

THE EFFECT OF STORAGE ON GUTHRIE CARDS 459

nylketonuria, galactosemia, homocysti- nuria, etc.1 The ability of polymerase chain reaction (PCR) to amplify small amounts of nucleic acid has led to the suggestion that stored Guthrie card bloodspots provide a valuable archive of genomic material.2,3,4,5,6 Despite these claims and the routine use of Guthrie cards for PCR,2,3’7’8 studies evaluating the effect of storage have been lacking.

Two factors which complicate PCR amplification o f stored Guthrie card bloodspots are the presence of high lev­els of whole blood components (heavy metals, protein, heme, and heme degra­dation products) which act as natural PCR inhibitors and low copy number of d eoxyrib on u cleic acid (DNA) tem ­plate.7,9,10,11,12,13 To amplify Guthrie card DNA, investigators have resorted to a combination of nucleic acid extraction methods using organic solvents (phenol/ chloroform, guanidine thiocyanate), detergents (sodium dodecyl sulfate), che­lators (ethylene diamine tetraacetic acid [EDTA], Chelex-100), proteases (protei­nase K), and p r éc ip ita n ts (e th a ­nol).7,10,11,12,14,15,16 These multi-step sepa­ration methods requiring complex and sometimes toxic solvents were found to be time consuming, labor intensive, and not readily amenable for large scale screening purposes.11,14,15,17

Amplification performed directly on a small piece of Guthrie card filter paper (“direct” method) was demonstrated by several investigators4,11,14 including our group17 as a viable alternative to elabo­rate microextraction methods. It was found, however, that direct amplification of genomic regions greater than 400 bp yielded variable product owing to the presence of whole blood PCR inhibi­tors.18 Heat treatment alone or in the presence of chelators (spermidine and Chelex-100) was suggested to eliminate inhibition by released protein and heavy metals.11,14 Recently, a simple water- based extraction method for Guthrie card

bloodspots was described which selec­tively eluted PCR inhibitors and retained amplifiable DNA on the filter paper.18 It was demonstrated that direct PCR could be successfully performed on filter paper with as little as 0.4 mm2 (0.2 |xl whole blood). Because of its simplicity, this method was found to be ideal for direct amplification of the AF508 mutation, the most common genetic defect in cys­tic fibrosis.17,18,19

A recent survey of the 53 state newborn screening laboratories in the United States (including the District of Colum­bia, Puerto Rico, and the Virgin Islands) indicated that most facilities store Guth­rie cards at room temperature for short time periods.6 Using direct PCR, it was shown that amplification could be rou­tinely performed on bloodspots stored for 18 months at room temperature.18 Other researchers have documented amplifica­tion of Guthrie cards stored for similar periods (i.e., 4 to 24 months)2,10,14,20 or longer less specified periods (i.e., up to10 years).16 In fact, on report by Williams et al3 cites successful amplification from a 17-year-old specimen. However, these studies, including ours, were limited in scope and failed to address adequately the effect of storage. For this purpose, the current authors have sought to expand earlier work and to document more fully the storage effects on properties of PCR inhibitors.

Materials and Methods

M a t e r ia l s

Unless specified all reagents were of the highest quality available.*

* Sigma Chemical Co., PO Box 14508, St. Louis, MO 63178.

460 MAKOWSKI, DAVIS, AND HOPFER

DNA P r e p a r a t i o n

Uniformly saturated Guthrie cards (903 filter paper)t were randomly selected from our neonatal archive stored at room temperature (1 to 30 months). Bloodspot template DNA was prepared for direct PCR as described.18 Briefly, bloodspots (3 mm diameter) were punched from Guthrie cards and incubated twice in 1 ml ultrapure water (30 min each) to elute whole blood PCR inhibitors (post 1 and post 2) (figure 1). The washed 3 mm filter paper disc was transferred to a PCR tube and direct amplification performed (post per) as will subsequently be described.Q u a n t it a t i v e A n a l y s is

Protein was determined in the pres­ence of bicinchoninic acid using bovine serum albumin as the standard by micro­titer plate analysist as described by Smith et al.21 Hemoglobin concentration was determ ined spectrophotom etri- cally.22 Iron was determined by auto- mated§ ferrozine dye binding.23 Blood­spot weight was determined on an ana­lytical balance.11 Samples were ana­lyzed in duplicate; data are expressed as mean (± standard deviation) and are rep­resentative of at least five indepen­dent determinations.SDS-PAGE

Sodium dodecyl sulfate-polyacryl- amide gel electrophoresis (SDS-PAGE) was performed on Laemmli slab gels as modified.24,25 Prior to electrophoresis, samples were concentrated 10-fold using

Bloodspot(3 mm)

Incubate(1 ml water, 30 min)

post 1(PCR inhibitors)

Incubate(1 ml water, 30 min)

post 2(PCR inhibitors)

F ig u r e 1. Preparation of Guthrie card blood­spots for direct PCR amplification.

PCR(direct)

opost per

t Schleicher & Schuell, Inc., 10 Optical Avenue, PO Box 2012, Keene, NH 03431.

% ThermoMAX, Molecular Devices, Inc., 1311 Orleans Drive, Sunnyvale, CA 94089.

§ M odel CX-7, Beckm an Instrum ents, Brea, CA 92621.

11 Model R 160 D, Brinkman Instruments, Inc., Westbury, NY 11590.

a macrosolute concentrator.^ Concen­trated samples were prepared in 2X Laemmli sample buffer24 and heat dena-

11 Amicon Instrum ents, Inc., 72 C herry H ill Drive, Beverly, MA 01915.

THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 1

TABLE I

Oligonucleotide Sequences

Oligonucleotide (5’ —> 3’) Amplicon

GTTTTCCTGGATTATGCCTGGGCAC (sense) 98 bpGTT GGCAT GCTTT G ATG ACGCTT C (antisense)

GC AG AGT ACCT G AAAC AGG A (sense) 491 bpCATTCACAGTAGCTTACCCA (antisense)

tured (100°C, 5 min). Samples (30 (xl) were electrophoresed (20 mA, constant current)** on 10 percent polyacrylamide gelstt at room temperature. Following electrophoresis, gels were stained with 2 g/L Coomassie brilliant blue (400 ml/L methanol, 100 ml/L acetic acid) and destained (400 ml/L methanol, 100 ml/L acetic acid) appropriately. Molecular weight standards were phosphorylase b (97-), bovine serum albumin (68-), oval­

bumin (45-), carbonic anhydrase (29-), soybean trypsin inhibitor (20-), and lac- talbumin (14.2-kDa).ttD i r e c t PCR A m p l i f i c a t i o n

Direct PCR amplification was per­formed as described.18 Briefly, a washed 3 mm bloodspot punch was placed in 66 (xl of water and overlaid with 50 (xl of mineral oil. The tube was heated in a thermal cycler§§ at 95°C for 5 min and

** Model PS500X, Hoefer Scientific Instruments, 654 Minnesota Street, Box 77387, San Francisco, CA 94107.

t t Model 61100, R. Shadel, Inc., 1684 Hudson Avenue, San Francisco, CA 94124.

t t Cat. No. 17-0446-01 Pharmacia Biotech, Inc., 800 Centennial Ave., P.O. Box 1327, Piscataway, NJ 08855.

§§ Original Model, Perkin/Elmer Corp., 761 Main Avenue, Norwalk, CT 06859.

Storage Time (mo)

F i g u r e 2. Effect of s to ra g e on b lo o d sp o t appearance. Pre, 3 mm bloodspot punches with­out treatment; post 1, fol­lowing first wash; post 2, following second wash; post per, following ther­mal cycling.

1 3 6 12 18 30pre • • • • • •

post 1 • • • • •

post 2 o • • • • •

>st per -J • • • • •

462 MAKOWSKI, DAVIS, AND HOPFER

3 6 12 18Storage Time (mo)

F i g u r e 3 . E f f e c t o f s t o r a g e o n b l o o d s p o t w e i g h t , e r r o r b a r , s t a n ­d a r d d e v i a t i o n ; n s , n o t s i g n i f i c a n t ( s t u d e n t ’ s t t es t ) .

cooled to 25°C. The PCR master mix (34 ixl)1111 was then added to all tubes to ach ieve final concentrations o f 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KC1, 200 (Jimol/L deoxyribonucleotide

1111 Cat. No. N801-0055 and N808-0068, Perkin/ E lm e r C o rp ., 761 M ain A v enu e, N orw alk , CT 06859.

triphosphates (dATP, dUTP, dCTP, and dGTP, each), 3 mmol/L MgCl2, 1.25 U Taq polymerase, 0.5 U uracil N-glycosy- lase, 0.1 g/L gelatin and 100 ng (each) oli­gonucleotide primer for the 98 bp and 491 bp regions (table I) encoding the AF508 cystic fibrosis m utation as described by Kerem et al.26,27 Oligonu­cleotide primers were synthesized by

TABLE II

Polymerase Chain Reaction Inhibitor Release from Guthrie Cards

Inhibitor1

(Percent)

Storage time (months)3 6 12

(Percent) (Percent) (Percent)18

(Percent)30

(Percent)

Protein (jxg) 597.9 485.4 449.1 304.7 182.5 137.3(100.0)a (81.3) (75.2) (51.0) (30.6) (23.0)

Hemoglobin (au)b 1.873 1.495 1.396 0.945 0.402 0.342(100.0) (79.8) (74.5) (50.5) (21.5) (18.3)

Iron (ng) 374.0 354.0 370.0 318.0 182.0 147.0(100.0) (94.6) (98.9) (85.0) (48.7) (39.3)

aRelease from bloodspots stored for one month assumed to be 100%. bRelative absorbance units.

THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 3

A.

o>3

£ 3 0 0 -o

F i g u r e 4 . E ffect of s to ra g e on re le a s e o f whole blood PCR inhibi­tors from bloodspots. A, protein; B, hemoglobin; and C, iron. Post 1 and p o s t 2 c o rre sp o n d to m aterial e lu ted in first and second wash, respec­tive ly . P ost p er co rre ­sponds to material eluted f o l l o w i n g t h e r m a l cycling, error bar, stan­dard deviation.

3 6 1 2 1 8

Stora ge T i m e (mo)

B.

w*-»c3

c!qoooE0)X

3 6 1 2 1 8

Sto ra ge T im e (mo)

automated phosphoramidite chemistry.1l 1i Carryover prevention was performed (37°C, 10 min) and uracil N-glycosylase inactivated (94°C, 10 min). PCR amplifi­cation consisted of dénaturation (94°C, 1 min), annealing (55°C, 1 min), and elon-

1111 C y c lo n e D NA S y n th e s iz e r , M illig e n / Biosearch, Inc., New Brunswick Scientific Co., PO Box 4005, 44 Talmadge Road, Edison, NJ 08818.

gation (72°C, 2 min) for 35 cycles. Ampli­fication products were analyzed by TBE- PAGE (see following).

TBE-PAGETris-borate-E DTA/polyacrylamide gel

electrophoresis (TBE-PAGE) was per­formed as described.28 Briefly, PCR sam­ples (20 jjlI) were mixed with 6X sample

464C.

MAKOWSKI, DAVIS, AND HOPFER

o > 3 0 0

<u FIGURE 4. Continued

3 6 1 2 1 8

S to ra g e T i m e (m o)

buffer containing bromophenol blue and Ficoll-type 400.28 Samples (15 |xl) were electrophoresed on 4 percent (491 bp) and 8 percent (98 bp) mini-polyacryl­amide gels (0.75 mm thickness)* in IX TBE at 75 V (constant voltage) for 1 h and 2.5 h, respectively, at 25°C.17,18 Gels were stained with ethidium bromide (0.5 (xg/ml, 10 min) and photographed with background UV illum ination.t E lec­trophoretic migration was compared relative to 123 bp DNA m olecular weight ladder s. tResultsE f f e c t o f S t o r a g e o n B l o o d s p o t A p p e a r a n c e P r e - a n d P o s t -P r o c e s s i n g

As can be seen, the two-step wash pro­tocol (as described in figure 1) resulted in

* Mini-PROTEAN II, Cat. No. 165-2940, Bio-Rad Laboratories, Life Science Group, 2000 Alfred Nobel Drive, Hercules, CA 94547.

t M odel 3-3100, Fotodyne, Inc., 950 W alnut Ridge Drive, Hartland, WI 53029.

t Cat. No. 15613-029, Gibco-BRL Laboratories, Inc., PO Box 68, Grand Island, NY 14072.

the elimination of most whole blood com­ponents from bloodspots stored for short time periods (1 to 3 months) (figure 2). In contrast, bloodspots stored for longer periods (> 3 m onths) dem onstrated increased retention of whole blood mate­rial. Water-based extraction of bloodspots stored for one year and longer did not appreciably alter appearance. Because repeated heating and cooling (thermal cycling) may result in additional release of whole blood components, washed bloodspots were placed in 100 (jul water, overlaid with mineral oil and cycled (post per). No additional change in bloodspot appearance was noted following thermal cycling. Although the solubility of mate­rial bound to the filter paper was effected by storage, relative bloodspot weight was not significantly changed over this period (figure 3). Released whole blood compo­nents were evaluated for protein, hemo­globin, and iron.Q u a n t it a t i v e A n a l y s is o f M a t e r i a l R e l e a s e d F r o m B l o o d s p o t s

Incubation of bloodspots in 1 ml water (post 1) was very effective in releasing

THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 5

the majority of whole blood components including protein, hemoglobin, and iron (figure 3). Some additional release was noted to occur during the second water incubation (post 2). Thermal cycling of washed bloodspot filters did not appre­ciably result in further release of whole blood material (post per). As can be seen, total protein, hem oglobin, and iron released by w ater-based extraction decreased substantially as a function of storage (table II). The solubility of pro­tein and hem oglobin decreased 4 to 5-fold over this time period. In contrast to high m olecular w eight com ponents (i.e., proteins), almost 40 percent of total iron c o u ld b e s o lu b i l iz e d from bloodspots stored for 30 months at room temperature.SDS-PAGE A n a l y s is

D ecreased elution of protein from stored bloodspots was confirmed by SDS-PAGE (figure 4). As can be seen, most protein was eluted in the first extraction (post 1) compared to the sec­ond extraction (post 2). Repeated heating and cooling (thermal cycling) did not release substantial protein. Three major bands of protein were evident at relative molecular weights o f68-, 28-, and 14-kDa which most likely correspond to albumin, carbonic anhydrase, and hemoglobin, respectively.13 In good agreement with quantitative protein, hemoglobin, and iron analysis (see previous material), there was a slight increase in the 14-kDa protein in the second elution (post 2) from bloodspots stored for 6 and 12 months. The reason for this elution profile is unclear; however, a small amount of 14-kDa protein was also noted in post per sam ples obtained from 18 month bloodspots.F i l t e r P a p e r D N A A m p l i f i c a t i o n

The effect of storage of bloodspot amplification efficiency was evaluated

using two sets of primers for genomic regions encoding the most common cys­tic fibrosis mutation (AF508).26,27 As can be seen, amplification of 98 and 491 bp amplicons was successful for bloodspots stored for up to 30 months (figure 5). Dif­ferences in ethidium bromide staining intensity observed between PCR prod­ucts (98 bp versus 491 bp) reflect relative mass not molar equivalency.Discussion

The effects of storage at room tem­perature on Guthrie card bloodspots have been evaluated. Because Guthrie card samples contain limited DNA and high levels of PCR inhibitors,7’9’10’11’12’13 it was decided to determine whether or not storage specifically effected (1) the am plifiability of template DNA and (2) the properties o f w h ole b lood PCR inhibitors.

To perform this study, Guthrie card bloodspots were subjected to a water- based extraction method which specifi­cally eluted PCR inhibitors and retained nucleic acid (figure l) .18 In contrast to extraction protocols which utilize organic solvents, water-based elution releases PCR inhibitors under nondenaturing conditions. Thus, eluted materials can be quantitated and characterized. Further­more, direct amplification of the filter paper is possible.

Using selective elution, whole blood components which act as natural PCR inhibitors (protein, hem oglobin, and iron)7,9,12’13 were found to becom e increasingly fixed to the filter paper matrix with time. Relatively constant bloodspot weight indicated that fixation did not result from excessive desiccation (figure 3). Despite repeated heating and cooling (thermal cycling), fixation was irreversible (<25 percent total) for higher molecular weight components (protein and hem oglobin). Iron, in contrast,

4 6 6 MAKOWSKI, DAVIS, AND H O PFER

A B CStorage (mo) " Storage (mo) " Storage (mo)1 3 6 12 18 30 1 3 6 12 18 30 1 3 6 12 18 30

kDa

9 7 -

6 8 -4 5 -

2 9 -

2 0 - 1 4 -

FlGURE 5. SDS-PAGE analysis of protein released from stored bloodspots. A, post 1 (protein eluted in first wash); B, post 2 (protein eluted in second wash); and C, post per (protein eluted following thermal cycling). Relative positions of protein molecular weight markers shown on left.

remained much more freely soluble (approximately 40 percent total). It is expected that rigorous extraction meth­ods {i.e., phenol/chloroform , guani­dine thiocyanate) may be more effective in the solubilization of these whole blood components.

The SDS-PAGE revealed that the majority of protein released during water-based extraction corresponded to relative molecular weights of approxi­mately 68-, 28- and 14-kDa (figure 5). These three proteins are likely albumin, and red blood cell metal-containing car­bonic anhydrase and h em oglob in , respectively.13 Elimination of these pro­teins prior to PCR is essential to avoid the formation of dense aggregates of ther­mally denatured material which may deplete Taq DNA polymerase.13 Zinc and iron released from carbonic anhy­drase and globin, respectively, may com­plete or interfere with essential PCR cofactors such as magnesium or catalyze DNA hydrolysis at high temperature.9,12 The elution profile of the 14-kDa protein

(i.e., hemoglobin) corresponded well to quantitative iron analysis (see pre­vious paragraph).

The retention of whole blood PCR inhibitors on the filter paper matrix did not interfere with direct amplification of bloodspots stored 1 to 30 months. Although minor amounts of protein, hemoglobin, and iron were released from older bloodspots (12 to 30 months) during thermal cycling (figure 4), these quanti­ties appeared insufficient to inhibit PCR of short (98 bp) and moderate (491 bp) size amplicons (figure 6).

Decreased yield of DNA microex­tracted from Guthrie card bloodspots fol­lowing short-term storage (4.5 months) at room temperature has been reported by McCabe et al.10 This study, however, used a complex nucleic acid extraction protocol including treatment with SDS and proteinase K, three phenol and ether extractions, and ethanol precipitation.10 In our experience13,18 and in other pub­lished reports,14,29 DNA has high avidity for solid support filters and strongly

THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 7

A. Storage (mo)

Mw 1 3 6 12 18 30

F i g u r e 6 . E ffect of storage on direct blood­spot PCR amplification. A, 98 bp and B, 491 bp ampli- cons. Mw, 123 bp ladder.

-9 8 bp

B. Storage (mo)

Mw 1 3 6 12 18 30

-491 bp

resists extraction — a property essential for direct amplification. In view of the previously mentioned data, nucleic acid may also become “fixed” to the filter paper matrix. Thus, poor DNA recovery using microextraction may result from

loss typical of multi-step methods as well as an inability to partition effectively nucleic acid into the soluble phase. Guthrie cards impregnated with guani­dine thiocyanate have been suggested by Harvey et al30 as a mechanism to over­

4 6 8 MAKOWSKI, DAVIS, AND HOPFER

come DNA:matrix interaction. In con­trast, by simple eluting PCR inhibitors and avoiding ancillary extraction loss, it was possible to amplify Guthrie card DNA from specimens stored up to 30 months at room temperature.

The use of stored Guthrie cards as a genomic archive has considerable bene­fit. The collection of whole blood on Guthrie cards is simple and well estab­lished for neonates.1 Samples are easy to transport and have minimal storage requirements {i.e., room temperature). The DNA co llected on filter paper appears relatively stable,3,5,14 and whole blood collected from neonates contains 2-3-fold higher levels of nucleic acid than that collected from adults.7 Of the neona­tal screening laboratories surveyed by McEwen and Reilly in 1994,6 most indi­cated that they plan to establish more permanent collection systems. Thus, molecular methods aimed at exploring this resource have considerable value and merit further study.Acknowledgment

The assistance of Francesca Nadeau and Cathy Kolakoski is greatly appreciated.

References1. Guthrie R. Organization of a regional newborn

screening laboratory. In: Bickel H, Guthrie R, Hammersen G, editors. Neonatal screening for inborn erro rs o f m etabo lism . New York: Springer Press, 1980:259-70.

2. Lyonnet S, Caillaud C, Rey F, Berthelon M, Frezal J, Rey J, Munnich A. Guthrie cards for detection of point mutations in phenylketo­nuria. Lancet 1988; 1:507.

3. Williams C, Weber L, Williamson R, Hjelm M. Guthrie spots for DNA-based carrier testing in cystic fibrosis. Lancet 1988;2:693.

4. Schwartz E l, Khalchitsky SE, Eisensmith RC, Woo SLC. Polymerase chain reaction amplifi­cation of dried blood spots on Guthrie cards. Lancet 1990;1:629-30.

5. McCabe ER. Utility of PCR for DNA analysis from dried blood spots on filter paper blotter. PCR Meth Appl 1991;1:99-106.

6 . McEwen JE, Reilly PR. Stored Guthrie cards as DNA “banks” . Am J Hum Genet 1994;55:196- 200.

7. Jinks DC, Minter M, Tarver DA, Vanderford M, H ejtm ancik JF , M cCabe ERB. M olecular genetic diagnosis of sickle cell disease using dried blood specimens on blotters used for new born screening. H um G enet 1989;81: 363-6.

8 . Prior TW, Highsm ith WE Jr, Friedm an KJ, Perry TR, Scheuerbrandt G, Silverman LM. A model for molecular screening of newborns: simultaneous detection of Duchenne/Becker muscular dystrophies and cystic fibrosis. Clin Chem 1990;36:1756-9.

9. Higuchi R. 1989. Simple and rapid preparation of samples for PCR. In: Ehrlich HE, editor. PCR technology: principles and applications for DNA amplification. New York: Stockton Press, 1989:31-8.

10. McCabe ERB, Huang S-Z, Seltzer WK, Law ML. DNA microextraction from dried blood spots on filter paper blotters: potential applica­tions to newborn screening. Hum Genet 1987; 75:213-6.

11. Raskin S, Phillips JA III, Dawson E, Kaplan G, McClure M, Vnencak-Jones C. Cystic fibrosis genotyping by direct PCR analysis of Guthrie card blood spots. PCR M eth Appl 1992;2: 154-6.

12. Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Bio- Techniques 1991;10:506-13.

13. M akow ski GS, D av is E L , H o p fe r SM. Enhanced direct amplification of Guthrie card DNA following selective elution of PCR inhib­itors. Nucl Acids Res 1995;23:3788-9.'

14. Descartes M, Huang Y, Zhang YH, McCabe LL, Gibbs R, Therell BL, McCabe ERB. Genotypic confirmation from the original dried blood specimens in a neonatal hemoglobinopathy screen ing program . P ed ia tr Res 1992;31: 217-21.

15. Schneeberger C, Kury F, Larsen J, Speiser P, Zeillinger R. A simple method for extraction of DNA from G uthrie cards. PCR M eth Appl 1992;2:177-9.

16. Verlingue C, Mercier B, Lecoq I, Audrezet MP, Laroche D, Travert G, Ferec C. Retrospective study of the cystic fibrosis transmembrane con­ductance regulator (CFTR) gene mutations in Guthrie cards from a large cohort of neonatal screening for cystic fibrosis. Hum Genet 1994; 93:429-34.

17. Makowski GS, Aslanzadeh J, Hopfer SM. Mini­gel PAGE for enhanced resolution of polymer­ase chain reaction detection of AF508 deletion in cystic fibrosis. Clin Chem 1993;39:2204-5.

18. Makowski GS, Aslanzadeh J, Hopfer SM. In situ PCR amplification of Guthrie card DNA to detect cystic fibrosis mutations. Clin Chem 1995;41:447-9.

19. Hopfer SM, Makowski GS, Davis EL, Aslanza­deh J. Detection of the cystic fibrosis AF508 mutation by anti-double-stranded DNA anti­body. Ann Clin Lab Sei 1995;25:475-84.

THE EFFECT OF STORAGE ON GUTHRIE CARDS 469

20. Audrezet MP, Costes B, Ghanem N, Fanen P, Verlingue C, Morin JF, Mercier B, Goossens M, Ferec C. Screening for cystic fibrosis in dried blood spots of newborns. Molec Cell Probes 1993;7:497-502.

21. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC. Measure­m ent of protein using bicinchoninic acid. Anal Biochem 1985;150:76-85.

22. Fairbanks VF, Ziesmer SC, O’Brien PC. Meth­ods for measuring plasma hemoglobin in micro­m olar concentration compared. Clin Chem 1992;38:132-40.

23. Carter P. Spectrophotometric determination of serum iron at the submicrogram level with a new reagent (ferrozine). Anal Biochem 1971; 40:450-8.

24. Laemmli UK. Cleavage of structural proteins during the assembly of the head of the bacte- riphage T4. Nature 1970;227:680-5.

25. Makowski GS, Ramsby ML. pH modification to enhance the molecular seiving properties of sodium dodecyl sulfate-10 percent polyacryl­amide gels. Anal Biochem 1993;212:283-5.

26. Kerem B-S, Rommens JM, Buchanan JA, Mar- kiewicz D, Cox TK, Chakravarti A, Buchwald M, Tsui L-C. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245: 1073-80.

27. Kerem B-S, Zielenski J, Markiewicz D, Bozon D, Gazit E, Yahav J, Kennedy D, Riordan JR, Collins FS, Rommens JM, Tsui L-C. 1990. Identification of mutations in regions corre­sponding to the two putative nucleotide (ATP)- binding folds of the cystic fibrosis gene. Proc Natl Acad Sei USA 1990;87:8447-51.

28. Sambrook J, Fritsch EF, Maniatis T. In: Molecu­lar cloning: a laboratory manual, 2nd edition. New York: Cold Spring Harbor Laboratory Press, 1989.

29. Skryabin BV, Khalchitsky SE, Kuzjmin AI, Kaboev OK, Kalinin VN, Schwartz E l. A crude lysate of cells immobilized on solid support can serve as a matrix for enzymatic DNA amplifica­tion. Nucl Acids Res 1990;18:4289.

30. Harvey MA, KingTH, Burghoff R. Impregnated 903 blood collection paper: a tool for DNA preparation from dried blood spots for PCR a m p lif ic a tio n . In : T e c h n ic a l B u lle t in , Schleicher & Schuell, Inc., Keene, NH, 1995.