targeting rna-polymerase i in both chemosensitive and ... · genesis, and targeting this process...

Cancer Therapy: Preclinical

Targeting RNA-Polymerase I in BothChemosensitive and Chemoresistant Populationsin Epithelial Ovarian CancerRobert Cornelison1, Zachary C. Dobbin2, Ashwini A. Katre3, Dae Hoon Jeong4,Yinfeng Zhang5, Dongquan Chen6, Yuliya Petrova1, Danielle C. Llaneza1,Adam D. Steg3, Laura Parsons1, David A. Schneider5, and Charles N. Landen1

Abstract

Purpose: A hallmark of neoplasia is increased ribosome bio-genesis, and targeting this process with RNA polymerase I (Pol I)inhibitors has shown some efficacy. We examined the contribu-tion and potential targeting of ribosomal machinery in chemo-therapy-resistant and -sensitive models of ovarian cancer.

Experimental Design: Pol I machinery expression was exam-ined, and subsequently targeted with the Pol I inhibitor CX-5461,in ovarian cancer cell lines, an immortalized surface epithelialline, and patient-derived xenograft (PDX) models with and with-out chemotherapy. Effects on viability, Pol I occupancy of rDNA,ribosomal content, and chemosensitivity were examined.

Results: In PDX models, ribosomal machinery componentswere increased in chemotherapy-treated tumors compared withcontrols. Thirteen cell lines were sensitive to CX-5461, with IC50s25 nmol/L–2 mmol/L. Interestingly, two chemoresistant lines

were 10.5- and 5.5-fold more sensitive than parental lines.CX-5461 induced DNA damage checkpoint activation andG2–Marrest with increased gH2AX staining. Chemoresistant cellshad 2- to 4-fold increased rDNA Pol I occupancy and increasedrRNA synthesis, despite having slower proliferation rates, whereasribosome abundance and translational efficiency were notimpaired. In five PDXmodels treated with CX-5461, one showeda complete response, one a 55% reduction in tumor volume, andone maintained stable disease for 45 days.

Conclusions: Pol I inhibition with CX-5461 shows high activ-ity in ovarian cancer cell lines and PDXmodels, with an enhancedeffect on chemoresistant cells. Effects occur independent of pro-liferation rates or dormancy. This represents a novel therapeuticapproach that may have preferential activity in chemoresistantpopulations. Clin Cancer Res; 23(21); 6529–40. �2017 AACR.

IntroductionAlthough ovarian cancer patients usually present with

advanced disease, most will have a positive response to initialtherapy consisting of surgical debulking and combined platinum/taxane chemotherapy (1). Nonetheless, as many as 80% ofpatients will ultimately develop recurrence with chemoresistantdisease, suggesting that a small chemoresistant population mustbe identified and targeted to achieve durable cures (2). Althoughin recent years evaluation of multiple chemotherapeutic andtargeted agents, alone or in combination, has yielded a modest

improvement in survival, drug resistance remains themajor causeof death of ovarian cancer patients (3–5).

An increase in size and number of nucleoli was one of theearliest hallmarks of cancer identified and is still a useful prog-nostic indicator today (6). The nucleolus is the primary site ofribosomal biogenesis and enlarged nucleoli correlate with accel-erated ribosomal RNA (rRNA) synthesis by RNA polymerases(6, 7). Synthesis of ribosomes is one of the most complex andenergy demanding processes in cells. RNA polymerase I (Pol I)transcribes the ribosomal DNA (rDNA) to produce the pre-rRNAprecursor that is processed into 18S, 5.8S and 28S rRNAs througha number of nucleolytic steps (8). RNA polymerase III (Pol III)synthesizes the 5S rRNA, which is also a structural component ofthe ribosome. Together Pol I andPol III account for approximately80% of total nuclear transcription (8). An increase in ribosomalRNA synthesis in the nucleolus by Pol I has been correlated withan adverse prognosis in cancer (9).

A number of clinically approved chemotherapeutic drugs act, atleast in part, through inhibition of ribosomal RNA synthesis (10).However, none of these drugs directly target Pol I (10–12).Recently, small-molecule inhibitors have been developed, suchas CX-5461 and CX-3543, which have apparent specificity forRNA Pol I (13–16). CX-5461 does not inhibit mRNA synthesis byRNA polymerase II, does not inhibit DNA replication or proteinsynthesis, and has preferential activity for cancer cells over non-transformed cells (13). Bywater and colleagues (17) showed thatCX-5461 exhibits inhibition of rRNA transcription dependent onTP53 mutational status and induces TP53-dependent apoptotic

1Department of Obstetrics and Gynecology, University of Virginia, Charlottes-ville, Virginia. 2Department of Obstetrics andGynecology, University of Chicago,Chicago, Illinois. 3Department of Radiation Oncology, University of Alabama atBirmingham, Birmingham, Alabama. 4Department of Obstetrics and Gynecol-ogy, Busan Paik Hospital, Busan, Korea. 5Department of Biochemistry andMolecular Genetics, University of Alabama at Birmingham, Birmingham, Ala-bama. 6Department of Medicine, Division of Preventive Medicine, University ofAlabama at Birmingham, Birmingham, Alabama.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

R. Cornelison and Z.C. Dobbin contributed equally to this article.

Corresponding Author: Charles N. Landen, University of Virginia, 1240 LeeStreet, Second Floor, Charlottesville, VA 22908. Phone: 434-243-6131; Fax: 434-982-1840; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-17-0282

�2017 American Association for Cancer Research.

ClinicalCancerResearch

www.aacrjournals.org 6529

on January 15, 2021. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst August 4, 2017; DOI: 10.1158/1078-0432.CCR-17-0282

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-17-0282&domain=pdf&date_stamp=2017-10-11

http://clincancerres.aacrjournals.org/

cell death of hematologic malignancies, while maintaining nor-mal cells.

Our interest in CX-5461 came from the discovery that inheterogeneous patient-derived xenograft (PDX) models of ovar-ian cancer treated with chemotherapy, high-throughput analysissuggested that ribosomal machinery was upregulated in thesurviving population. Other investigators have suggested thatribosomal biogenesis is increased in gynecologic cancers and(18) might be a key component in the efficacy of some targetedtherapies, such as RUNX factors (19) and c-MYC's role in bothcancer and global gene expression.However, an associationof thisprocess with chemoresistance and a mechanism to directly targetribosomal biogenesis in ovarian cancer has not been examined.In this study, we further investigate the activity of RNA Pol I intreated tumors and the effects andmechanisms of CX-5461 on theviability of both chemosensitive and chemoresistant ovariancancer, in cell lines and PDX models. We show that CX-5461 hasactivity alone on ovarian cancer cells and demonstrates increasedefficacy in taxane-resistant ovarian cancer cells, independent ofTP53 mutational status. Chemoresponsive ovarian PDX tumorsshow an increase in Pol I activity after chemotherapy, and have avariable response to Pol I inhibition, achieving a completeresponse in one model. These findings suggest that targeting PolI is an exciting opportunity as a therapeutic strategy in treatingovarian cancer, particularly in targeting the chemoresistantpopulation.

Materials and MethodsReagents and cell culture

CX-5461 was purchased from ChemScene and dissolved in50 mmol/L NaH2PO4 (pH 4.5) to make 10 mmol/L stock solu-tion. The chemosensitive and chemoresistant ovarian cancer cellline matched pairs A2780ip2, A2780cp20, HeyA8, HeyA8MDR,SKOV3ip1, and SKOV3TRip2 as well as PEO1, PEO4, ES2,OVCAR3, CaOV3, OV90, OAW42, OVSAHO, and HIO-180(20–25) were maintained in RPMI1640 medium supplementedwith 10% FBS (Hyclone). A2780cp20 (platinum-resistant),HeyA8MDR (paclitaxel-resistant), and SKOV3TRip2 (paclitaxel-

resistant, a kind gift ofDr.Michael Seiden; ref. 26)were previouslygenerated by sequential exposure to increasing concentrations ofchemotherapy. All ovarian cancer cell lines were routinelyscreened for Mycoplasma species (GenProbe Detection Kit;Fisher) with experiments carried out at 70% to 80% confluentcultures. Purity of stock cell lines was confirmed with shorttandem repeat genomic analysis, and all cell lines were usedwithin 20 passages from stocks.

Ovarian cancer patient-derived xenograft modelMultiple ovarian cancer PDX models were developed and

previously characterized by our group (27). Briefly, freshly col-lected untreated patient tumors collected at the time of primarydebulking were implanted subcutaneously into SCID mice andallowed to propagate. For 6 models, mice with established PDXtumors (approximately 1 cm in greatest diameter) were treatedwith weekly doses of carboplatin (90 mg/kg) and paclitaxel(20 mg/kg), intraperitoneally, for 4 weeks. All tumors had greaterthan 50% reduction in size, and were collected in multipleformats. RNA-Seq was performed on treated and untreatedtumors, and expression profiles in matched pairs were comparedusing IPA software.

To evaluate changes in nucleoli after chemotherapy, staffpathologists took four random images of cancer cell–rich areasof hematoxylin and eosin (H&E)–stained PDX tissue samplesbefore and after combined carboplatin/paclitaxel therapy. Cellswere counted bothmanually and automatically with CellProfiler,quantitating nucleolar area changes and determining statisticalsignificance using GraphPad Prism.

For examination of the efficacy of CX-5461 in PDX models,previously collected PDX tumors either 2 or 3 generations fromoriginal collection, from 5 separate patients, were reimplantedinto 5 mice per model, with 2 tumors per mouse. After tumorsreached 1 cm in at least 1 dimension, treatment with single-agentCX-5461 (50 mg/kg every 3 days) was initiated and response wasfollowed using caliper measurements. Tumor volume was calcu-lated using the formula (length � width2)/2. Tumors responsewas averaged among all tumors and presented as change involume compared with volume at initiation of treatment.

Assessment of cell viability and cell-cycle analysisTwo-thousand cells per well were plated on 96-well plates and

treated the next day with increasing concentrations of CX-5461,alone or in combination with carboplatin or paclitaxel, in trip-licate. Viability was assessed by 2-hour incubation with 0.15%MTT (Sigma) and spectrophotometric analysis at OD570 (opticaldensity at 570 nm). IC50 calculation was performed in GraphPadPrism (version 6.0, La Jolla, CA) using variable slope, four-parameter logistic curve where the model is: Y ¼ Bottom þ(Top�Bottom)/(1þ10^((LogIC50�X) � HillSlope)). Drug con-centration data (log transformed) and the percent inhibition datacompared with vehicle control were fitted to the four-parametermodel.

For cell-cycle analysis, cells were treated with vehicle alone orCX-5461 at the IC50 and IC90 dose for 48 hours, trypsinized, andfixed in 100% ethanol overnight. Cells were then centrifuged,washed in PBS, and suspended in PBS containing 0.1% TritonX-100 (v/v) 200 mg/mL DNase-free RNase A, and 20 mg/mLPropidium iodide (PI). PI fluorescence was assessed by flowcytometry and the percentage of cells in sub-G0, G0–G1, S-, and

Translational Relevance

Ovarian cancer remains a devastating diagnosis, with serousepithelial ovarian cancer (EOC) patients succumbing to recur-rent chemoresistant disease in 80% of cases. There is a greatneed for novel therapeutics that specifically target the che-moresistant populations. Our results indicate that in patient-derived xenograft model's cancer cell populations survivingchemotherapy, the basal ribosomal machinery is upregulated.This evidence led us to ask whether attacking ribosomalbiogenesis could be a viable therapeutic target in EOC. Weshow that the Pol I inhibitor CX-5461 displays efficacy in EOCboth in vitro and in vivo, induces significant G2 arrest throughmitotic catastrophe, and may have preferential activity in thechemoresistant population. Cancer cells are especially sensi-tive to CX-5461, which was well-tolerated in mice. Inhibitingribosomal synthesis with Pol I inhibitors may be a promisingstrategy in targeting the deadly chemoresistant population inovarian cancer.

Cornelison et al.

Clin Cancer Res; 23(21) November 1, 2017 Clinical Cancer Research6530




G2–M phases was calculated by the cell-cycle analysis module forFlow Cytometry Analysis Software (FlowJo v7.6.1).

Immunoblotting and immunofluorescenceFor immunoblotting: 15 mg of cell lysate was run on 10%

Bis-Tris NuPage gels (Thermo Fisher Scientific), transferred to0.45 mm PVDF using a semi-dry Midi transfer system (ThermoFisher Scientific), blocked in 5% (w/v) nonfat dry milk andincubated overnight with primary antibodies at 4�C. After detec-tion with the appropriate horseradish peroxidase–conjugatedsecondary antibody, blots were developed using SuperSignalWest PicoChemiluminescent Substrate (ThermoFisher Scientific)and imaged using X-ray film. Antibodies used were incubatedat manufacturer's recommended dilutions: pCHK1(ser317;1:1,000), pCHK2(Thr68; 1:1,000), pCDC2(Tyr15; 1:1,000),gH2AX(ser139; 1:2,000), Cyclin-B (1:500), a-tubulin(1:5,000), and p21 (1:1,000) from Cell Signaling Technology.

For immunofluorescence, cells were plated in 8-well chamberslides (Nunc Lab-Tek II CC2, Thermo Scientific) at densities of10,000 cells per well. Cells were fixed with 4% paraformaldehydeand blocked with 2% BSA for one hour. After primary antibodyincubation, wells were detected with anti-rabbit/mouse Alexa-Flour 568 (Cell Signaling Technology) at 1:500 dilution for onehour at room temperature and counterstained/mounted withDAPI in Prolong Gold Antifade (Invitrogen). A random selectionof multiple images was captured using a Photometrix Cool-SnapHQ CCD camera with a �20 objective and analyzed bothmanually and with the image analysis software CellProfiler(Broad Institute, Cambridge, MA).

RNA extraction and reverse transcriptionTotal RNA was extracted from the ovarian cancer cell lines and

ovarian cancer PDX tumors using the RNeasy Mini kit per themanufacturer's instructions (Qiagen). The concentrations of allRNA samples were quantified using spectrophotometric absor-bance at 260/280 nm. cDNA was prepared using the High Capac-ity Reverse Transcription Kit (Applied Biosystems).

Quantitative PCRPrimer and probe sets for UBTF (Hs01115792_g1), 18S

(Hs99999901_s1), RNA28S (Hs03654441_s1), b-Actin(Hs01060665_g1, Housekeeping Gene), POLR1B(Hs00219263_m1), and RRN3 (Hs01592557_m1) wereobtained from Applied Biosystems and used according to themanufacturer's instructions. ITS1, pre-rRNA, was customordered from Applied Biosystems (Forward Primer:CCGCGCTCTACCTTACCTACCT, 30-Primer: GCATGGCT-TAATCTTTGAGACAAG, Probe: TTGATCCTGCCAGTAGC).PCR amplification was performed on an ABI Prism 7900HTand gene expression was calculated using the comparative Ct

method as described previously (28).

Polysome fraction assayFor an assessment of ribosomal subunit populations and

efficiency of translation, sucrose gradient fractionation was per-formed. Cells were grown to approximately 70% confluence inRPMI (10% FBS), treated with cycloheximide (100 mg/mL),washed in PBS, and cytoplasmic extracts were layered onto10% to 50% linear sucrose gradients and centrifuged at30,000 rpm in a Beckman SW41 ultracentrifuge rotor for 5 hours.To visualize ribosome populations, 60% sucrose was pumped

into the bottom of each column and absorbance at 254 nm wasmonitored during elution from the top. Three different biologicalreplicates were performed for each cell line, and representativetraces are shown.

Chromatin immunoprecipitationSKOV3ip1 and SKOV3TRip2 cells were grown to approximate-

ly 80% confluence and treated with formaldehyde (1% finalconcentration) for 10 minutes and then incubated in0.125 mol/L glycine for an additional 5 minutes. Cells werewashed in cold 1� PBS, and then processed for ChIP as describedpreviously (29). Immunoprecipitation was performed with ananti-RPA194 antibody (Santa Cruz Biotechnology; SC-48385).

Isotopic labeling of cellular RNACells were grown to approximately 80% confluence as

described above in 6-well dishes. At time zero, 32P-orthophos-phate was added to each well (20 mCi/ml) and incubated for theindicated times. Medium was removed and TRIzol was addeddirectly to the cells for harvest. RNAwas purified and run on a 1%formaldehyde:agarose denaturing gel. RNA was transferred fromthe gel onto Zeta-Probe blotting membrane (Bio-Rad), dried andanalyzed by phosphoimaging.

ResultsIncrease in expression of ribosomal machinery bychemotherapy

As previously reported (27), six PDX models were establishedimmediately after resection from advanced high-grade serousovarian cancer patients, with 10 mice per model. When tumorswere 0.75 cm in at least one dimension, mice were treated witheither vehicle or combined carboplatin/paclitaxel, weekly for4 weeks. 7 days after the final dose (to allow acute effects ofchemotherapy to dissipate), tumors were collected and preservedinmultiple formats. RNAwas extracted and subjected to RNA-Seqanalysis. IPA pathway analysis comparing matched treated anduntreatedPDX, describedmore thoroughly inour previous report,found that ribosomal synthesis machinery was significantly dif-ferent in all pairs, and was the most commonly upregulatedpathway after treatment in 4 of the 6 pairs. Our first priority afterthis preliminary global analysis was to confirm whether findingsrelated to increases in ribosomal machinery with treatment couldbe verified. To confirm these high-throughput data, qPCR wasconducted on thematched treated–untreated ovarian cancer PDXfor UBTF, POLR1B, and RRN3. These genes encode transcriptionfactors for rRNA synthesis (UBTF and RRN3) as well as the secondlargest subunit of Pol I (POLR1B), and can influence the rate ofrRNA synthesis when differentially expressed (15, 30). In all 6pairs, either UBTF, POLR1B, or both were significantly upregu-lated in the posttherapy samples compared with their untreatedtumor, with RRN3 upregulated in two (Fig. 1A–C). The degree ofincrease was, however, highly variable in the 6 models. In addi-tion, the amount of 18S rRNA and 28S rRNAwas determined, as ameasure of overall ribosomal content. There was a surprisingincrease in the relative expression of ribosomes after chemother-apy treatment. 18S levels increased 6.59-fold (P¼ 0.010) and 28Slevels increased 5.53-fold (P¼ 0.019; Fig. 1D). This was especiallysurprising, given our previous finding that IHC staining ofthese same samples for Ki-67 showed that proliferation wassignificantly reduced, on average from 67% in untreated and

Targeting RNA-Polymerase I in Epithelial Ovarian Cancer

www.aacrjournals.org Clin Cancer Res; 23(21) November 1, 2017 6531




12% in treated samples. Dogma would suggest that ribosomalproduction should correlate with proliferation rates, but clearlydoes not in the setting of chemotherapy. The significant upregula-tion of ribosomal activity and total ribosomes in survivingcells led us to hypothesize that inhibiting ribosomal synthesismay be amethod for targeting ovarian cancer, and specifically thecell populations surviving primary chemotherapy. We previouslypresented a principal component analysis of 6 pairs of untreated/treated PDX tumors, showing that although tumors had a differ-ent baseline expression profile, as would be expected from 6different patients, the changes when comparing matched treatedand untreated tumors were similar. This relationship suggests thatalthough tumors are different initially, globally they are havingvery similar responses to chemotherapy.

The increase in ribosomal synthesis activity led us to patho-logically examine nucleoli of untreated and treated tumors. Wefound that nucleoli were much more prominent in PDX tumorsafter treatment (Fig. 1E). The examining pathologist noted thatthis was a common finding seen in patient samples collected afterneoadjuvant chemotherapy, and has been previously publishedin breast and ovarian cancer (31). In a blinded manner, thepathologist scored the percentage of malignant cells that would

be considered to have prominent "macronucleoli." In 3 of the 4paired sections in which enough tumor was available to examine,there were significantly more macronucleoli after chemotherapytreatment (Fig. 1F).

RNA Pol I inhibition diminishes cell viability in ovariancancer cell lines

CX-5461 has recently been reported as a selective inhibitor ofPol 1with the ability to inhibit solid tumor growth (15), althoughin some settings, it has been reported to be more effective in cellswith wild-type TP53. In high-grade serous ovarian cancer, TP53mutations have been identified in 96% of tumors (32). None-theless, based on the RNA-seq and follow up qPCR data, weexamined the response of multiple ovarian cancer cell lines, andin 3 instances had matched chemoresistant lines: A2780ip2/A2780cp20, SKOV3ip1/SKOV3TRip2, and HeyA8/HeyA8MDR.Viability as measured by the MTT assay demonstrated an IC50

range of 32 nmol/L–5.5 mmol/L (Table 1). Interestingly, in thematched chemosensitive/chemoresistant pairs, the two taxane-resistant lines SKOV3TRip2 and HeyA8MDR were more sensitiveto CX-5461 than their matched chemosensitive SKOV3ip1 andHeyA8 lines, by 5.5- and 10.5-fold, respectively (Fig. 2A and B).

0

2

4

6

8

18s 28s

Aver

age

2–ΔΔ

C t

Gene

Changes in expression a�er chemotherapy

untx

tx

0

5

10

106 108 115 116 121 136

UBTF UntreatedTreated

0

1

2

3

106 108 115 116 121 136

RRN3 UntreatedTreated

0

1

2

3

106 108 115 116 121 136

POLR1B UntreatedTreated

A

B

C

D

E

F

200x200x

* P = 0.011 ** P = 0.019

* **

* * *

* * * *

*

Changes in nucleolar area

prepost

0

50

100

150

Nuc

leol

ar a

rea

in p

ixel

s

P < 0.0001

*

Figure 1.

Expression of RNA polymerase Iinitiation factors in ovarian cancer PDXmodels. Comparison of 6 pairs ofuntreated/treated (Carbo/taxol) PDXtumors showed similar changes inexpression profiles. One commonpathway was ribosomal synthesis.A–C, qPCR was conducted on 6 pairsof ovarian cancer PDX treated withcarboplatin and paclitaxel or controlforUBTF, POLR1B, and RRN3 and geneexpression was compared with theuntreated matched PDX. The tumorcell population surviving initialchemotherapy generally had a greaterexpression of UBTF, POLR1B, andRRN3 (� , P < 0.05). D, Total level ofribosomal subunits 18S and 28S wasdetermined. Treated ovarian cancerPDXs had a 37.9-fold increase of 18S(P¼0.010) and a 39.0-fold increase of28S (P¼ 0.019). E,Comparison of H&Esections with and without treatment,demonstrating marked macronucleoliby quantification of macronucleolibefore and after chemotherapytreatment in PDX models (F).

Cornelison et al.





This difference was independent of TP53 status, as both SKOV3lines have a missense mutation with no detectable expression atthe protein level; and both HeyA8 lines are TP53 wild-type (28)and (33). These genotypes were confirmed in our cell lines (datanot shown). Interestingly, A2780ip2 was more sensitive toCX-5461 than the platinum-resistant A2780cp20, with an IC50

of 32 nmol/L compared with 146 nmol/L (Fig. 2C). TP53 statuswas examined in these lines, and it was discovered thatA2780cp20 at some point in its evolution acquired a TP53mutation [missense previously published (ref. 34) and confirmedin our cells]. This mutation in TP53 likely explains the differencein CX-5461 sensitivity. Together, these differential effects dem-onstrate that although TP53 mutations can affect CX-5461 sen-sitivity, TP53-mutated cells in many cases have excellent sensi-tivity. These data also suggest that the mechanism of action ofCX-5461 goes beyond that mediated by TP53. In addition, theincreased sensitivity in taxane-resistant cells suggests that thismight be an outstanding therapy in the setting of resistant disease,consistent with the in vivo observation that treated tumors hadincreased ribosomal synthesis.

CX-5461 causes cell-cycle arrest in G2–MTo examine the biologic effects of CX-5461, we first examined

cell-cycle composition with treatment, employing PI incorpo-ration and flow cytometric analysis. The six chemosensitive/chemoresistant paired cell lines were treated with either vehiclecontrol, the IC50 of CX-5461, or the IC90 of CX-5461 for 48 hours.Interestingly, there was pronounced G2–M arrest in both SKOV3cell lines with the IC90 dose, from 24.48% to 37.89% inSKOV3ip1, and 36.45% to 56.16% in SKOV3TRip2 (Fig. 2E).This was also observed with the IC90 dose in A2780cp20 (38.86%to 69.61%), HeyA8MDR (31.75% to 51.49%) and the IC50 dosein A2780ip2 (26.31% to 42.71%; Fig. 2D and F). An arrest inG2–Mis consistent with prior observations that Pol I activity is thehighest in the G2–M phase (35).

To confirm arrest at G2–M, cyclin B was measured by immu-nofluorescence. The G2–M transition is tightly regulated by theinterplay of cyclin B and CDC2, with the dephosphorylation ofCDC2 being required for movement into mitosis by the phos-phatase CDC25. G2-arrested cells should show a buildup of cyclin

B and pCDC2 (tyr15) in arrested cells. Immunofluorescence aftertreatment with CX-5461 showed intense staining of cyclin Bappearing perinuclear after treatment (Fig. 2G). Furthermore,immunoblotting indicated an increase in pCDC2 (tyr15) andcyclin B after treatment in all cell lines (Fig. 2H), verifyingsignificant arrest in late G2.

Transcription of rDNA is increased in chemoresistant cell linesdespite lower overall growth rate

Because protein synthesis rate is directly proportional to cellgrowth rate, ribosomal production is traditionally thought tomirror proliferation rates. However, this paradigm is not consis-tent with our in vivo observation that treated tumors had upre-gulation of Pol I machinery despite low proliferation rates, andthe SKOV3TRip2 andHeyA8MDR cell linesweremore sensitive toCX-5461 despite their lower doubling times. To identify thepotential mechanism by which chemoresistant tumor cells aremore sensitive to inhibition of rRNA synthesis, we characterizedrRNA synthesis in SKOV3ip1 and SKOV3TRip2 cells. On the basisof isotopic labeling (Fig. 3A), we observed a dramatic increase inrRNA synthesis in the chemoresistant line compared with thecontrol cells. To confirm our isotopic labeling results, we mea-sured pre-rRNA abundance using RT-qPCR, probing for the 50-external transcribed sequence (50-ETS; Fig. 3B). As this RNAspecies is short-lived, its abundance is used as a measure of rRNAsynthesis rate. We observed a significant increase in HeyA8MDRcompared with parental HeyA8; in SKOV3TRip2 compared withSKOV3ip1; but a nonsignificant decrease in A2780cp20 com-pared with A2780ip2. Therefore, relative sensitivity to CX-5461does followwith rRNA synthesis rate, at least when comparing thepairs. It does not followwith sensitivity when comparing differentcell lines, and therefore cannot be used as an absolute marker ofresponse alone. However, it does confirm that rRNA productiondoes not follow precisely with proliferation rate, and is increasedin the taxane-resistant lines when compared with parental con-trols. Increased total rRNA can be achieved by increasing the rateof transcription by Pol I, by inhibition of rRNA decay, or by acombination of these mechanisms. To test whether transcriptionby Pol I was induced, wemeasured polymerase occupancy on therDNA repeat using chromatin immunoprecipitation (ChIP). Weobserved a 2- to 3-fold increase in polymerase occupancy of thegene in the SKOV3TRip2 cells compared with the parental line(Fig. 3C). Together, these data suggest that synthesis of rRNA byPol I is increased in the taxane-resistant line, despite its slowergrowth rate.

Enhanced production of rRNA could suggest that more ribo-somes are present and functional in the taxane-resistant cells, ormay represent an overproduction in response to faulty ribosomalfunctionality. To semiquantitatively examine engagement of ribo-somes onto mRNA, we performed sucrose gradient fractionationof cytoplasmic fractions from cycloheximide-treated cells. Asshown in Fig. 3D, ribosomes profiles from equal cell numbersreveal competent ability of ribosomes to bind to mRNA in bothcell lines. Each peak following the 40S, 60S, and 80S peaksrepresents an mRNA strand with at least 2 ribosomes attached.The first peak is composed of an mRNA with 2 ribosomesattached, the next with 3 ribosomes, and so on. There is asuggestion that there are actually more actively translating ribo-somes/mRNA units, though this method is semiquantitative andthat conclusion is not definitive. However, the prominent poly-some peaks do confirm that there is not a decrease in the number

Table 1. IC50s of CX-5461 in ovarian cell lines

Matched pairsChemosensitive/chemoresistant

TP53State

CX-5461 IC50

(mmol/L)

A2780ip2 WT 0.032A2780cp20 MT 0.146SKOV3ip1 MT 0.595SKOV3TRip2 MT 0.109HeyA8 WT 2.05HeyA8MDR WT 0.191

Other cancer cell linesPEO1 MT 0.525PEO4 MT 1.20OV90 MT 1.06OVCAR3 MT 2.00OAW42 WT 0.300OVSAHO MT 0.636CAOV3 MT 0.955COV362 MT 0.645ES2 MT 0.294

Normal immortalized cellsHIO-180 WT 5.49






100A D 100

Sub G0

G2

G1

S

SKOV3ip1SKOV3TRip2

HeyA8HeyA8MDR

A2780ip2A2780cp20

SKOV3ip1 c

ontro

l

SKOV3ip1-I

C50

SKOV3ip1-I

C90SKOv3

TRip2-IC

50

SKOV3TRip2

-IC90

SKOV3TRip2

contr

ol

9080706050403020100

100

Sub G0

G1

G2

S

MDR-IC90

HeyA8-I

C90

HeyA8-I

C50

HeyA8 c

ontro

l

MDR-IC50

MDR contr

ol

9080706050403020100

100

Sub G0

G1

G2

S

A2780

ip2A27

80ip2

-IC50

A2780

ip2-IC

90

A2780

cp20

contr

ol

A2780

cp20

-IC50

A2780

cp20

-IC90

908070605040302010

0

80

60

40

20

0−9 −8 −7 −6 −5

Log dose CX-5461

% V

iabi

lity

100

80

60

40

20

0−9 −8 −7 −6 −5

Log dose CX-5461

% V

iabi

lity

100

80

60

40

20

0−9 −8 −7 −6 −5

Log dose CX-5461

A2780ip2

CX-5461

pCDC-2

Cyclin-B

Tubulin

- -+ -+ -+ -+ -+ +

A2780cp20 Heya8 Heya8mdr skov3ip1 Skov3TR

% V

iabi

lity

B E

C

G

H

F

Figure 2.

Response of ovarian cancer cell lines to CX-5461. Cellviability and cell-cycle analysis was conducted on 3pairs of chemosensitive and chemoresistant ovariancancer cell lines. A–C, Dose–response curves fromMTT assay of each pair. Results show bothSKOV3TRip2- and HeyA8MDR-resistant lines beingmore sensitive to CX-5461 treatment than theirchemosensitive parental line. D–F, Cell-cycle analysisof SKOV3ip1, SKOV3TRip2, HeyA8, HeyA8MDR,A2780ip2, and A2780cp20 using propidium iodideafter 48-hour treatment with the control, IC50, or IC90

dose of CX-5461. In general, treatment with CX-5461resulted in an increase in sub-G0 fraction and aportion of cells in the S–G2 phase. G,Immunofluorescence assay example verifying G2–Mphase cell-cycle arrest in A2780cp20-treated cellswith 1 mmol/L CX-5461 versus vehicle control. Resultsshow an increase in Cyclin-B perinuclear staining inarrested cells compared with untreated control. H,Western blot analysis verifying G2–Mphase arrest in 6cell lines. Treatment with IC50 dosages of CX-5461showed an increase in expression of pCDC2(tyr15)and Cyclin-B versus untreated controls at 72 hours.

Cornelison et al.





of translating ribosome/mRNAunits in the SKOV3TRip2 line, andtherefore increased production of ribosomes is not due to defec-tive ribosomal functionality. It does suggest that the increasedribosome production leads to increased translation. Therefore,chemoresistant cells appear to be using increasing translation as amechanism of chemoresistance.

Together, all of these data suggest that rRNA synthesis byPol I is dramatically increased in the taxane-resistant cellswithout a complementary increase in ribosome concentration,or a deficiency in ribosomal functionality, despite its slowergrowth rate. This is contrary to the dogma that proliferationand ribosomal production/activity are universally directlycorrelated.

Treatment with CX-5461 increases DNA damage markers inovarian cancer cell lines

G2–M checkpoint arrest is a frequent consequence of geno-toxic insult and is used to prevent entry into mitosis after DNAdamage has occurred by a variety of mechanisms (36). Earlysensing of DNA damage is done by the kinases ATM and ATRand further activation of the checkpoint is mediated through avariety of signals, both TP53 dependent and independent (37–39). An indicator of multiple forms of DNA damage is markedvia phosphorylation of the histone gH2AX at Ser139 by thekinases ATM and ATR (40). After treatment with CX-5461,ovarian cancer cell lines showed a significant increase ingH2AX(Ser139) foci in the nucleus (Fig. 4A). After DNA dam-age is detected, the ATM/ATR kinases also activate their down-stream effectors CHK1 and CHK2, beginning a broad range ofsignaling, from inactivation of CDC25 leading to G2 arrest toTP53-mediated apoptosis. Immunoblotting after CX-5461treatment showed an increase in the phosphorylated forms ofCHK1(Ser317) and CHK2(Tyr68) as well as a dramatic increase

in the TP53-mediated tumor-suppressor p21 in the TP53 wild-type cell line A2780ip2 (Fig. 4B).

CX-5461 induces mitotic catastropheIn performing immunofluorescent stains, it was noted that

there was a significant increase in the size and presence ofmultinucleated cells with CX-5461 treatment. During the finalstages of functional mitosis, a cleavage furrow is formed and acontractile ring pinches off the nascent daughter cells. Thus, cellswere stained with F-actin to identify cell membranes, and mul-tinucleated cells were quantified (Fig. 4C). Surprisingly, theseimages are collected at equal power, which can be appreciated ifone focuses on the size of the nuclei, which are not significantlydifferent, whereas the total body size is increased dramatically.Characterization and quantitation of binuclei, using bothmanualand image analysis–based methods (Supplementary Fig. S1),showed a dramatic increase in cell volume after treatment withCX-5461, as well as an increase in the number of multinucleatedcells. We also performed immunofluorescent staining for Aurora-B kinase, as correct localization of this protein is required forcytokinesis. Normally Aurora-B is localized at the condensingcontractile ring in between the two daughter cells. In CX-5461–treated cells, however, Aurora-B kinase showed mislocalizationduring cytokinesis, lateralized relative to the nucleus, suggestingmitotic catastrophe (Fig. 4D).

Ovarian cancer PDXs have variable response to Pol I inhibitionOn the basis of the activity of CX-5461 in vitro, even in the

presence of TP53 mutations, five different ovarian cancer PDXmodels (from 5 advanced-stage papillary serous ovarian cancerpatients) were treated with single-agent CX-5461 at 50 mg/kgevery 3 days for 45 days. Treatment was initiated when tumorswere approximately 1.0 cm in at least one dimension, and

Figure 3.

rRNA synthesis and polymeraseoccupancy is increased inSKOV3TRip2 cells compared withSKOV3ip1 cells. A, Cells were pulselabeled with 32P-orthophosphate as afunction of time. Total RNA waspurified by TRIzol, run on aformaldehyde denaturing agarose gel,dried, and visualized byautoradiography. The rate of 32Pincorporation into rRNA inSKOV3TRip2 cells was 2.1-fold (�0.3)higher than in SKOV3ip1 cells. B, rDNAtranscription was analyzed by RT-qPCR by targeting short-lived 5'ETS,and the rRNA signal was normalized tothe control GAPDH mRNA. C, ChIPanalysis of RPA194 association withrDNA. Pol I molecules wereimmunoprecipitated by anti-RPA194mAb. The mean and SD are shown.D, Polysome profiles were performedby sucrose-gradient centrifugation.






responses are reported as maximal change after initiation oftreatment. Response was varied among the 5 models, with PDX208 and 182 growing on treatment, PDX 127 having stabledisease, and PDX 153 and 225 showing response, with PDX225having a complete regression of tumor (Fig. 5A). As ameasureof health of the mice during treatment, weight was collected witheach treatment, and behaviors carefullymonitored. Therewere nobehavioral changes, or functional abnormalities such as diarrhea.There was an appropriate weight gain throughout the treatmentcourse (Fig. 5B), as has been demonstrated at this dose level inprior studies (17). Tissue sections of liver, kidney, heart, and lungwere examined pathologically and there was no gross toxicity tothese major organs.

To determine whether baseline expression of Pol I-associatedgenes correlated with the response to treatment, in an effort toidentify a potential biomarker for response, previously collecteduntreated tumors from each PDX model were analyzed using

qPCR for POLR1B, RRN3, and UBTF (Fig. 5C). There was nosignificant association between expression of these factors andresponse to treatment.

Next, to determine the effects ofCX-5461onexpressionof thesegenes, qPCR was performed on the treated PDXs 208, 182, 127,and 153 for POLR1B, RRN3, and UBTF; in addition, ITS1 wasexamined as a quantification of pre-rRNA. As PDX 225 had acomplete response toCX-5461, therewasno tumor to analyze andcompare with the untreated sample. Of these genes, the onlycorrelative marker for model 153, which had a positive response,was a decrease in POLR1B, which was not noted in the other 3models (data not shown). Interestingly, ITS1 decreased withtreatment of the 208 and 182 models. These data suggest thatalthough CX-5461 may be targeting and inhibiting ribosomesynthesis, the lack of effect in some models may be due to otherunknown mechanisms. Additional models and more thoroughinterrogation of the full expression profiles of these tumors will be

Figure 4.

CX-5461 induces DNA damageresponse via ATM/ATR inovarian cancer cell lines. A,Immunofluorescent detection of thegH2AX in control SKOV3ip1 cells (red)and cells exposed to 500 nmol/L ofCX-5461. The punctate nuclearstaining illustrated an accumulation ofDNA damage foci. Pairs ofchemosensitive/chemoresistantovarian cancer cell lines were treatedwith their respective IC50 dosages ofCX-5461. B, Western blot analysisshows activation of the pCHK1(ser317)and pCHK2(Thr68), downstreamsubstrates of ATM and ATR kinases.TP53 wild-type cell lines showed asubsequent activation of p21 but drugresponse was independent of TP53status. C,DAPI (blue) labeling showedfailed cytokinesis and an accumulationof multinucleated cells after CX-5461treatment, with F-actin (red),indicating shared cytoplasm.D, Aurora-B kinase (red) detectionshowing normal localization to thecleavage furrow during cytokinesis incontrol SKOV3ip1 cells. Aftertreatment with CX-5461, Aurora-Bmislocalization was apparent in anaccumulation of multinucleated cells.

Cornelison et al.





required to fully understand the variability in response andpotentially identify biomarkers predictive of response.

DiscussionOvarian cancer unfortunately has limited chemotherapeutic

options after patients develop resistance to the standard regimentof platinum- and taxane-based therapy. Therefore, it is imperativeto identify novel targets that could be used in conjunction withstandard therapy to hopefully improve patient outcomes. Previ-ously, our group has developed and characterized an ovariancancer PDXmodel that recapitulates the complexity of a patient'stumor in termsofheterogeneity andbiological activity (27).Whenwe conducted RNA-seq analysis comparing matched chemother-apy treated and untreated PDXs, we found that genes related toribosomal synthesis were significantly upregulated in the tumorcells surviving a platinum and taxane-based therapy. In this study,

we confirm that ribosomalmachinery, particularly basal ribosom-al RNA transcription components, are increased in survivingtumors, and that targeting Pol I is effective in cell lines and PDXmodels in vivo. We show that efficacy is not entirely dependent onTP53 status or proliferation rates, and is more effective in taxane-resistant cell lines. Themechanism of its toxicity is in part throughinduction of arrest in G2–Mof the cell cycle with frequent mitoticcatastrophe, and significant DNA damage.

Transcriptionof rRNAgenesbyPol I and subsequent processingof the rRNA are fundamental control steps in the synthesis offunctional ribosomes (6, 7, 11). Chemotherapeutic agents havebeen known for years to cause an increase in nucleolar size andreorganization of nucleolar morphology (41). Although it isgenerally thought that increases in nucleolar size are associatedwith increased ribosomal biogenesis, it is a matter of debate as towhat the increase means after chemotherapy. He and colleagues(42) have presented evidence suggesting a ribosomal autophagy

–100

–50

0

50

100

150

Perc

ent

chan

ge in

tum

or v

olum

e

0123456789

10

ΔCt

POLR1B

RRN3

UBTF

A

C

B

0

5

10

15

20

25

30

35

40

Mou

se w

eigh

t

0 4 7 11 14 18 21 25 28 33 35 39 42 46Days of CX-5461 treatment

127182153208225

Figure 5.

Response of ribosomal translation factors after CX-5461 treatment. A, Waterfall plot displaying percent change of tumor volume in PDXs 208, 182, 127, 153,and 225 after 45 days of treatment with 50 mg/kg CX-5461 every 3 days. B, Weight of mice through duration of treatment with CX-5461. C, qPCRof Pol I initiation factors RRN3, POLR1B, and UBTF. DCT was calculated. There was not an association between baseline expression of these genes and responseto CX-5461.






(ribophagy) pathway can be activated in cancer cells after che-motherapy as part of the survival process. This pathway is distinctfrom the general autophagy pathway, and it is thought that thiscan be both a mechanism the cell can use to lower energydemands in times of nutrient deprivation, and also a way toglobally shut down translation rapidly by consuming mature 60sand 40s ribosomal subunits. If the latter is active then thegeneration of nascent ribosomes to replace the degraded maturesubunits could account for the overall increase in nucleolar size(35). This could account for the overall increased sensitivity of thechemoresistant population to CX-5461 treatment. If rRNA tran-scription in the nucleolus is inhibited, cells undergo cell-cyclearrest associated with apoptosis, senescence, or autophagy (43).Aberrant regulation of rRNA synthesis by Pol I and ribosomebiogenesis (the complex and highly coordinated cellular processleading to the production of ribosomes) is associated with theetiology of a broad range of human diseases and is especiallypervasive in cancer (9, 44, 45).

Admittedly, our discovered association between ribosomalbiogenesis and survival after chemotherapy treatment does notdelineate whether we are seeing changes that are induced byexposure to chemotherapy, or if treatment with chemotherapyselects cells with inherently different ribosomal biogenesis pro-cesses ongoing that allow for their survival, and thus are revealedby our selection method. Furthermore, our analysis does notdistinguish between different types of ribosomes destined tomediate transcription of particular genes. It has been shown thatthere are specialized subpopulations of ribosomes (46). Furtherstudies are needed to distinguish between these possibilities, anddiscover how cells respond to chemotherapy that may allowsurvival.

There have been numerous chemotherapeutic drugs developedthat have an impact on ribosomal biogenesis, even if the effects arenonspecific, including cisplatin, actinomycin D, camptothecin(irinotecan/topotecan), mitomycin C, 5-fluorouracil, and doxo-rubicin (10–12). However, none of these chemotherapeutic drugsselectively targets Pol I to allow definitive conclusions on whatdegree their therapeutic effect is mediated through ribosomebiogenesis (45). CX-5461 was recently developed by CylenePharmaceuticals and is an orally available small molecule thattargets transcription by Pol I selectively (13, 15). CX-5461 isthought to impair initiation of Pol I transcription by disruptingthe binding of the Pol I transcription initiation factor SL-1 to theribosomal DNApromoter (13, 15). Themarking of double strandbreaks by gH2AX is a well-characterized phenomenon (36–38,47, 48). Double-strand breaks do induce gH2AX but this phos-phorylation is not limited only to DNA-strand breakage (49).The consistent, late (48–72 hours) marking of gH2AX after CX-5461 treatment in ovarian cancer cells could indicate a senes-cent state after an overwhelming amount of nucleolar stress.Quin and colleagues (50) have found a similar noncanonicalATM/ATR response phenotype, and our results agree withtheirs. Andrews and colleagues (51) put forth evidence thatthe stabilization of g-quadruplex formation may play a role inCX-5461's mechanism of action at the rDNA promoter, and ourresults show DNA damage response machinery as the mostprobable route of efficacy, with TP53 activation being a laterevent that is dependent on DNA damage response machinery asopposed to nucleolar stress.

Bywater and colleagues (17) demonstrated that human hema-tologic cancer cells (leukemia and lymphoma) with TP53 wild-

type are more sensitive to CX-5461 than TP53-mutant cellsin vitro and in vivo. As a result, they suggested that CX-5461has therapeutic effect for hematologic malignancies by TP53mutational status–dependent apoptosis. But, in solid tumor celllines, CX-5461 induces both senescence and autophagy by aTP53-independent process (15, 52). These differential responsesbetween the nucleolar stress and cell death according to differenttypes of cancer may mean that hematologic malignancies haveunique nucleolar biology susceptible to activation of TP53-dependent apoptosis following acute perturbations of ribosomebiogenesis. We have seen that CX-5461 is more potent againstA2780ip2 cells with TP53wild-type than against A2780cp20witha TP53 mutation. However, we found that the taxane-resistantlines SKOV3TRip2 and HeyA8MDR were more sensitive to Pol Iinhibition than their parental lines, even though SKOV3 has amutation in TP53 in both lines, while HeyA8 is wild-type for TP53inboth lines. These data demonstrate that there are also importantTP53-independent mechanisms induced by CX-5461, which stillneed to be elucidated. Interestingly, another inhibitor of RNAPol I has been developed, BMH-21. This molecule binds prefer-entially to rRNA-encoding DNA, and reportedly behaves in aTP53-independent manner (16). Further studies are required todetermine whether this molecule also has preferential activityagainst chemoresistant populations.

On the basis of our RNAseq data and the in vitro cell line data,we moved forward with treating 5 PDX lines with CX-5461 in asingle-agent setting. If upregulation of ribosomal synthesis is ahallmark of aggressive cancer and is required for cellular prolif-eration, inhibition may lead to a novel treatment approach. In asingle agent setting, we found a 60% clinically significant benefitrate (complete or partial response, or stable disease). An appro-priate concern is whether inhibition of such an important processwill be tolerable in patients. We and others have not seen grossorgan damage at the pathologic level, and no weight loss intreatment mice. It may be that, similar to cytotoxic agents, cancercells have higher susceptibility with inhibition of ribosomalbiogenesis, and a therapeutic window can be found which is safeinpatients.Manymore extensive studies are required in this arena,and phase I trials with this medication are underway in Canada(https://clinicaltrials.gov/ct2/show/NCT02719977). Regarding apredictive biomarker, in our investigation, the only unifyingfeature is that higher basal levels of Pol I initiation factors RRN3and POLR1B correlated with a greater response to therapy. Moredata will be required in a larger cohort to confirm where these areeffective biomarkers for response. However, overall these datademonstrate the potential of CX-5461, and potentially otherinhibitors of ribosomal synthesis, as a new approach to ovariancancer, both in chemosensitive and chemoresistant tumors.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: R. Cornelison, D.C. Llaneza, C.N. LandenDevelopment of methodology: R. Cornelison, Z.C. Dobbin, D.H. Jeong,Y. Zhang, D.A. Schneider, C.N. LandenAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): R. Cornelison, Z.C. Dobbin, D.H. Jeong, Y. Petrova,A.D. Steg, D.A. Schneider, C.N. LandenAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): R. Cornelison, Z.C. Dobbin, Y. Zhang, D. Chen,Y. Petrova, D.A. Schneider, C.N. Landen

Cornelison et al.




https://clinicaltrials.gov/ct2/show/NCT02719977


Writing, review, and/or revision of the manuscript: R. Cornelison,Z.C. Dobbin, D.C. Llaneza, A.D. Steg, D.A. Schneider, C.N. LandenAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): Z.C. Dobbin, D.C. Llaneza, C.N. LandenStudy supervision: C.N. LandenOther (performed scientific experiments): A.A. KatreOther (developed chemoresistant cell line): L. Parsons

Grant SupportFunding support provided inpart byUABMedical Scientist Training Program

(NIGMS T32GM008361; to Z.C. Dobbin); GM084946 (to D.A. Schneider);

UAB CCTS Award (UL1TR001417; to D. Chen); and by the Norma LivingstonOvarianCancer Foundation, the Research Scientist Development Program (K12HD00849), the Department of Defense Ovarian Cancer Research Academy(OC093443), and UVA Cancer Center Support Grant (P30 CA44579; to C.N.Landen).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received January 30, 2017; revised May 25, 2017; accepted July 25, 2017;published OnlineFirst August 4, 2017.

References1. Berek JS, Crum C, Friedlander M. Cancer of the ovary, fallopian tube, and

peritoneum. Int J Gynaecol Obstet 2012;119 Suppl:S118–29.2. Bowtell DD, B€ohm S, Ahmed AA, Aspuria PJ, Bast RC Jr, Beral V, et al.

Rethinking ovarian cancer II: reducing mortality from high-grade serousovarian cancer. Nat Rev Cancer 2015;15:668–79.

3. Armstrong DK. Relapsed ovarian cancer: challenges and managementstrategies for a chronic disease. Oncologist 2002;7 Suppl 5:20–8.

4. Borst P. Cancer drug pan-resistance: pumps, cancer stem cells, quiescence,epithelial to mesenchymal transition, blocked cell death pathways, pers-isters or what? Open Biol 2012;2:120066.

5. Rubin SC, Randall TC,ArmstrongKA,ChiDS,HoskinsWJ. Ten-year follow-up of ovarian cancer patients after second-look laparotomy with negativefindings. Obstet Gynecol 1999;93:21–4.

6. Shiue CN, Arabi A, Wright AP. Nucleolar organization, growth control andcancer. Epigenetics 2010;5:200–5.

7. Thomson E, Ferreira-Cerca S, Hurt E. Eukaryotic ribosome biogenesis at aglance. J Cell Sci 2013;126:4815–21.

8. White RJ. RNA polymerases I and III, non-coding RNAs and cancer. TrendsGenet 2008;24:622–9.

9. Williamson D, Lu YJ, Fang C, Pritchard-Jones K, Shipley J. Nascent pre-rRNA overexpression correlates with an adverse prognosis in alveolarrhabdomyosarcoma. Genes Chromosomes Cancer 2006;45:839–45.

10. Burger K,M€uhl B, Harasim T, RohrmoserM,Malamoussi A, OrbanM, et al.Chemotherapeutic drugs inhibit ribosome biogenesis at various levels.J Biol Chem 2010;285:12416–25.

11. HannanKM, Sanij E, RothblumLI,Hannan RD, PearsonRB.Dysregulationof RNA polymerase I transcription during disease. Biochim Biophys Acta2013;1829:342–60.

12. Drygin D, Rice WG, Grummt I. The RNA polymerase I transcriptionmachinery: an emerging target for the treatment of cancer. Annu RevPharmacol Toxicol 2010;50:131–56.

13. Haddach M, Schwaebe MK, Michaux J, Nagasawa J, O'Brien SE, WhittenJP, et al. Discovery of CX-5461, the first direct and selective inhibitor ofRNA polymerase I, for cancer therapeutics. ACS Med Chem Lett 2012;3:602–6.

14. Drygin D, Siddiqui-Jain A, O'Brien S, Schwaebe M, Lin A, Bliesath J, et al.Anticancer activity of CX-3543: a direct inhibitor of rRNA biogenesis.Cancer Res 2009;69:7653–61.

15. Drygin D, Lin A, Bliesath J, Ho CB, O'Brien SE, Proffitt C, et al. TargetingRNApolymerase Iwith anoral smallmoleculeCX-5461 inhibits ribosomalRNA synthesis and solid tumor growth. Cancer Res 2011;71:1418–30.

16. Peltonen K, Colis L, Liu H, J€a€amaa S, Zhang Z, Af H€allstr€om T, et al. Smallmolecule BMH-compounds that inhibit RNA polymerase I and causenucleolar stress. Mol Cancer Ther 2014;13:2537–46.

17. Bywater MJ, Poortinga G, Sanij E, Hein N, Peck A, Cullinane C, et al.Inhibition of RNApolymerase I as a therapeutic strategy topromote cancer-specific activation of p53. Cancer Cell 2012;22:51–65.

18. Artero-Castro A, Castellvi J, García A, Hern�andez J, Ram�on y Cajal S,Lleonart ME. Expression of the ribosomal proteins Rplp0, Rplp1, andRplp2 in gynecologic tumors. Hum Pathol 2011;42:194–203.

19. Deltcheva E, Nimmo R. RUNX transcription factors at the interface of stemcells and cancer. Biochem J 2017;474:1755–68.

20. Louie KG, Behrens BC, Kinsella TJ, Hamilton TC, Grotzinger KR, McKoyWM, et al. Radiation survival parameters of antineoplastic drug-sensitiveand -resistant human ovarian cancer cell lines and their modification bybuthionine sulfoximine. Cancer Res 1985;45:2110–5.

21. Landen CN, Kim TJ, Lin YG, Merritt WM, Kamat AA, Han LY, et al. Tumor-selective response to antibody-mediated targeting of alphavbeta3 integrinin ovarian cancer. Neoplasia 2008;10:1259–67.

22. Halder J, Kamat AA, Landen CN Jr, Han LY, Lutgendorf SK, Lin YG, et al.Focal adhesion kinase targeting using in vivo short interfering RNAdeliveryin neutral liposomes for ovarian carcinoma therapy. Clin Cancer Res2006;12:4916–24.

23. Buick RN, Pullano R, Trent JM. Comparative properties of five humanovarian adenocarcinoma cell lines. Cancer Res 1985;45:3668–76.

24. Moore DH, Allison B, Look KY, Sutton GP, Bigsby RM. Collagenaseexpression in ovarian cancer cell lines. Gynecol Oncol 1997;65:78–82.

25. Yu D, Wolf JK, Scanlon M, Price JE, Hung MC. Enhanced c-erbB-2/neuexpression in human ovarian cancer cells correlates with more severemalignancy that can be suppressed by E1A. Cancer Res 1993;53:891–8.

26. DuanZ, Feller AJ, TohHC,Makastorsis T, SeidenMV. TRAG-3, a novel gene,isolated from a taxol-resistant ovarian carcinoma cell line. Gene 1999;229:75–81.

27. Dobbin ZC, Katre AA, Steg AD, Erickson BK, Shah MM, Alvarez RD, et al.Using heterogeneity of the patient-derived xenograft model to identify thechemoresistant population inovarian cancer.Oncotarget 2014;5:8750–64.

28. Steg A, Wang W, Blanquicett C, Grunda JM, Eltoum IA, Wang K, et al.Multiple gene expression analyses in paraffin-embedded tissues by Taq-Man low-density array: application to hedgehog andWnt pathway analysisin ovarian endometrioid adenocarcinoma. J Mol Diagn 2006;8:76–83.

29. Peltonen K, Colis L, Liu H, Trivedi R, Moubarek MS, Moore HM, et al. Atargeting modality for destruction of RNA polymerase I that possessesanticancer activity. Cancer Cell 2014;25:77–90.

30. Schneider DA. RNA polymerase I activity is regulated at multiple steps inthe transcription cycle: recent insights into factors that influence transcrip-tion elongation. Gene 2012;493:176–84.

31. Wang Y, Wang Y, Zheng W. Cytologic changes of ovarian epithelial cancerinduced by neoadjuvant chemotherapy. Int J Clin Exp Pathol 2013;6:2121–8.

32. Cancer Genome Atlas Research Network, Bell D, Berchuck A, Birrer M,Chien J, CramerD, et al. Integrated genomic analyses of ovarian carcinoma.Nature 2011;474:609–15.

33. Crane EK, Kwan SY, Izaguirre DI, Tsang YT, Mullany LK, Zu Z, et al. Nutlin-3a: a potential therapeutic opportunity for TP53 wild-type ovarian carci-nomas. PLoS ONE 2015;10:e0135101.

34. Skilling JS, Squatrito RC, Connor JP, Niemann T, Buller RE. p53 genemutation analysis and antisense-mediated growth inhibition of humanovarian carcinoma cell lines. Gynecol Oncol 1996;60:72–80.

35. Klein J, Grummt I. Cell cycle-dependent regulation of RNA polymerase Itranscription: the nucleolar transcription factor UBF is inactive in mitosisand early G1. Proc Natl Acad Sci U S A 1999;96:6096–101.

36. Liang Y, Lin SY, Brunicardi FC, Goss J, Li K. DNA damage responsepathways in tumor suppression and cancer treatment. World J Surg2009;33:661–6.

37. Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM. DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139.J Biol Chem 1998;273:5858–68.

38. Yuan J, Adamski R, Chen J. Focus on histone variant H2AX: to be or not tobe. FEBS Lett 2010;584:3717–24.

39. Burma S, Chen BP, MurphyM, Kurimasa A, Chen DJ. ATM phosphorylateshistone H2AX in response to DNA double-strand breaks. J Biol Chem2001;276:42462–7.






40. HuenMS, Chen J. TheDNAdamage response pathways: at the crossroad ofprotein modifications. Cell Res 2008;18:8–16.

41. McCluggageWG, Lyness RW, Atkinson RJ, Dobbs SP, Harley I, McClellandHR, et al. Morphological effects of chemotherapy on ovarian carcinoma. JClin Pathol 2002;55:27–31.

42. He J, Yu JJ, XuQ,Wang L, Zheng JZ, Liu LZ, et al. Downregulation of ATG14by EGR1-MIR152 sensitizes ovarian cancer cells to cisplatin-inducedapoptosis by inhibiting cyto-protective autophagy. Autophagy 2015;11:373–84.

43. Hannan RD, Drygin D, Pearson RB. Targeting RNA polymerase I transcrip-tion and the nucleolus for cancer therapy. Expert Opin Ther Targets2013;17:873–78.

44. Narla A, Ebert BL. Translational medicine: ribosomopathies. Blood2011;118:4300–1.

45. Bywater MJ, Pearson RB, McArthur GA, Hannan RD. Dysregulation of thebasal RNA polymerase transcription apparatus in cancer. Nat Rev Cancer2013;13:299–314.

46. Xue S, Barna M. Specialized ribosomes: a new frontier in gene regulationand organismal biology. Nat Rev Mol Cell Biol 2012;13:355–69.

47. Bewersdorf J, Bennett BT, Knight KL. H2AX chromatin structures and theirresponse to DNA damage revealed by 4Pi microscopy. Proc Natl Acad SciU S A 2006;103:18137–42.

48. Kinner A, Wu W, Staudt C, Iliakis G. Gamma-H2AX in recognition andsignaling of DNA double-strand breaks in the context of chromatin.Nucleic Acids Res 2008;36:5678–94.

49. Turinetto V, Giachino C. Multiple facets of histone variant H2AX: a DNAdouble-strand-break marker with several biological functions. NucleicAcids Res 2015;43:2489–98.

50. Quin J, Chan KT, Devlin JR, Cameron DP, Diesch J, Cullinane C, et al.Inhibition of RNA polymerase I transcription initiation by CX-5461activates non-canonical ATM/ATR signaling. Oncotarget 2016;7:49800–18.

51. AndrewsWJ, Panova T,NormandC,GadalO, Tikhonova IG, PanovKI.Olddrug, new target: ellipticines selectively inhibit RNA polymerase I tran-scription. J Biol Chem 2013;288:4567–82.

52. Li L, Li Y, Zhao J, Fan S, Wang L, Li X. CX-5461 induces autophagy andinhibits tumor growth via mammalian target of rapamycin-related signal-ing pathways in osteosarcoma. Onco Targets Ther 2016;9:5985–97.


Cornelison et al.




2017;23:6529-6540. Published OnlineFirst August 4, 2017.Clin Cancer Res Robert Cornelison, Zachary C. Dobbin, Ashwini A. Katre, et al. Chemoresistant Populations in Epithelial Ovarian CancerTargeting RNA-Polymerase I in Both Chemosensitive and

Updated version

10.1158/1078-0432.CCR-17-0282doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2017/08/02/1078-0432.CCR-17-0282.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/23/21/6529.full#ref-list-1

This article cites 52 articles, 18 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/23/21/6529.full#related-urls

This article has been cited by 4 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/23/21/6529To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-17-0282

http://clincancerres.aacrjournals.org/content/suppl/2017/08/02/1078-0432.CCR-17-0282.DC1

http://clincancerres.aacrjournals.org/content/23/21/6529.full#ref-list-1

http://clincancerres.aacrjournals.org/content/23/21/6529.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/23/21/6529


targeting rna-polymerase i in both chemosensitive and ... · genesis, and targeting this process...

Documents