ANNALS OF CLINICAL AND LABORATORY SCIENCE, Vol. 26, No. 5 Copyright © 1996, Institute for Clinical Science, Inc.
The Effect of Storage on Guthrie Cards: Implications for Deoxyribonucleic Acid Amplification*GREGORY S. MAKOWSKI, Ph.D., ESTHER L. DAVIS, M.T.(ASCP), and SIDNEY M. HOPFER, Ph.D.Department of Laboratory Medicine, University of Connecticut School of Medicine,
Farmington, CT 06030
ABSTRACTThe effect of storage on (1) amplifiability of nucleic acid (present at low
level) and (2) properties of whole blood polymerase chain reaction (PCR) inhibitors (present at high levels) in Guthrie card bloodspots was evaluated. Natural PCR inhibitors (protein, hemoglobin, iron) were selectively eluted from Guthrie cards (1 to 30 mo storage) under nondenaturing conditions and quantitated. The PCR was performed by direct amplification. It was found that PCR inhibitors become increasingly resistant to elution (“fixed”) over time. For example, 600 |xg protein, 1.87 au hemoglobin, and 374 ng iron were solubilized from 1 mo bloodspots. In contrast, only 137 (jug protein (22 percent), 0.34 au hemoglobin (18 percent), and 147 ng iron (39 percent) were solubilized from 30 mo bloodspots. Fixation does not result from excessive desiccation since bloodspot weight 2.20 mg ± 0.21 (1 mo) and 1.92 mg ± 0.31 (30 mo) was not significantly changed (p > 0.05). The majority of protein was characterized as albumin, and two rbc metal- containing proteins, carbonic anhydrase and hemoglobin by sodium dode- cyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Despite the presence of “fixed” PCR inhibitors, it was found that bloodspots stored 1 to 30 mo could be amplified for two regions (98 bp and 491 bp amplicons) encoding the AF508 cystic fibrosis mutation. It is suggested that nucleic acid also becomes “fixed” to the filter paper matrix and accounts, in part, for the ability to amplify Guthrie cards by direct PCR and low yield of deoxyribonucleic acid (DNA) reported for microextraction methods.
IntroductionWhole blood dried on filter paper
(Guthrie card bloodspot) has provided an
* Send reprint requests f Sidney M. Hopfer, Ph.D., Department of Laboratory Medicine, Uni-
excellent means for neonatal screening of inborn errors of metabolism such as phe-
versity of Connecticut Health Center, MC-2235, 263 Farmington Avenue. Farmington, CT 06030. tel (860) 679-2665, fax (860) 679-2154 , e -m ail hopter@nso 1 .uchc .edu
4580091-7370/96/0500-0458 $01.80 © Institute for Clinical Science, Inc.
THE EFFECT OF STORAGE ON GUTHRIE CARDS 459
nylketonuria, galactosemia, homocysti- nuria, etc.1 The ability of polymerase chain reaction (PCR) to amplify small amounts of nucleic acid has led to the suggestion that stored Guthrie card bloodspots provide a valuable archive of genomic material.2,3,4,5,6 Despite these claims and the routine use of Guthrie cards for PCR,2,3’7’8 studies evaluating the effect of storage have been lacking.
Two factors which complicate PCR amplification o f stored Guthrie card bloodspots are the presence of high levels of whole blood components (heavy metals, protein, heme, and heme degradation products) which act as natural PCR inhibitors and low copy number of d eoxyrib on u cleic acid (DNA) tem plate.7,9,10,11,12,13 To amplify Guthrie card DNA, investigators have resorted to a combination of nucleic acid extraction methods using organic solvents (phenol/ chloroform, guanidine thiocyanate), detergents (sodium dodecyl sulfate), chelators (ethylene diamine tetraacetic acid [EDTA], Chelex-100), proteases (proteinase K), and p r éc ip ita n ts (e th a nol).7,10,11,12,14,15,16 These multi-step separation methods requiring complex and sometimes toxic solvents were found to be time consuming, labor intensive, and not readily amenable for large scale screening purposes.11,14,15,17
Amplification performed directly on a small piece of Guthrie card filter paper (“direct” method) was demonstrated by several investigators4,11,14 including our group17 as a viable alternative to elaborate microextraction methods. It was found, however, that direct amplification of genomic regions greater than 400 bp yielded variable product owing to the presence of whole blood PCR inhibitors.18 Heat treatment alone or in the presence of chelators (spermidine and Chelex-100) was suggested to eliminate inhibition by released protein and heavy metals.11,14 Recently, a simple water- based extraction method for Guthrie card
bloodspots was described which selectively eluted PCR inhibitors and retained amplifiable DNA on the filter paper.18 It was demonstrated that direct PCR could be successfully performed on filter paper with as little as 0.4 mm2 (0.2 |xl whole blood). Because of its simplicity, this method was found to be ideal for direct amplification of the AF508 mutation, the most common genetic defect in cystic fibrosis.17,18,19
A recent survey of the 53 state newborn screening laboratories in the United States (including the District of Columbia, Puerto Rico, and the Virgin Islands) indicated that most facilities store Guthrie cards at room temperature for short time periods.6 Using direct PCR, it was shown that amplification could be routinely performed on bloodspots stored for 18 months at room temperature.18 Other researchers have documented amplification of Guthrie cards stored for similar periods (i.e., 4 to 24 months)2,10,14,20 or longer less specified periods (i.e., up to10 years).16 In fact, on report by Williams et al3 cites successful amplification from a 17-year-old specimen. However, these studies, including ours, were limited in scope and failed to address adequately the effect of storage. For this purpose, the current authors have sought to expand earlier work and to document more fully the storage effects on properties of PCR inhibitors.
Materials and Methods
M a t e r ia l s
Unless specified all reagents were of the highest quality available.*
* Sigma Chemical Co., PO Box 14508, St. Louis, MO 63178.
460 MAKOWSKI, DAVIS, AND HOPFER
DNA P r e p a r a t i o n
Uniformly saturated Guthrie cards (903 filter paper)t were randomly selected from our neonatal archive stored at room temperature (1 to 30 months). Bloodspot template DNA was prepared for direct PCR as described.18 Briefly, bloodspots (3 mm diameter) were punched from Guthrie cards and incubated twice in 1 ml ultrapure water (30 min each) to elute whole blood PCR inhibitors (post 1 and post 2) (figure 1). The washed 3 mm filter paper disc was transferred to a PCR tube and direct amplification performed (post per) as will subsequently be described.Q u a n t it a t i v e A n a l y s is
Protein was determined in the presence of bicinchoninic acid using bovine serum albumin as the standard by microtiter plate analysist as described by Smith et al.21 Hemoglobin concentration was determ ined spectrophotom etri- cally.22 Iron was determined by auto- mated§ ferrozine dye binding.23 Bloodspot weight was determined on an analytical balance.11 Samples were analyzed in duplicate; data are expressed as mean (± standard deviation) and are representative of at least five independent determinations.SDS-PAGE
Sodium dodecyl sulfate-polyacryl- amide gel electrophoresis (SDS-PAGE) was performed on Laemmli slab gels as modified.24,25 Prior to electrophoresis, samples were concentrated 10-fold using
Bloodspot(3 mm)
Incubate(1 ml water, 30 min)
post 1(PCR inhibitors)
Incubate(1 ml water, 30 min)
post 2(PCR inhibitors)
F ig u r e 1. Preparation of Guthrie card bloodspots for direct PCR amplification.
PCR(direct)
opost per
t Schleicher & Schuell, Inc., 10 Optical Avenue, PO Box 2012, Keene, NH 03431.
% ThermoMAX, Molecular Devices, Inc., 1311 Orleans Drive, Sunnyvale, CA 94089.
§ M odel CX-7, Beckm an Instrum ents, Brea, CA 92621.
11 Model R 160 D, Brinkman Instruments, Inc., Westbury, NY 11590.
a macrosolute concentrator.^ Concentrated samples were prepared in 2X Laemmli sample buffer24 and heat dena-
11 Amicon Instrum ents, Inc., 72 C herry H ill Drive, Beverly, MA 01915.
THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 1
TABLE I
Oligonucleotide Sequences
Oligonucleotide (5’ —> 3’) Amplicon
GTTTTCCTGGATTATGCCTGGGCAC (sense) 98 bpGTT GGCAT GCTTT G ATG ACGCTT C (antisense)
GC AG AGT ACCT G AAAC AGG A (sense) 491 bpCATTCACAGTAGCTTACCCA (antisense)
tured (100°C, 5 min). Samples (30 (xl) were electrophoresed (20 mA, constant current)** on 10 percent polyacrylamide gelstt at room temperature. Following electrophoresis, gels were stained with 2 g/L Coomassie brilliant blue (400 ml/L methanol, 100 ml/L acetic acid) and destained (400 ml/L methanol, 100 ml/L acetic acid) appropriately. Molecular weight standards were phosphorylase b (97-), bovine serum albumin (68-), oval
bumin (45-), carbonic anhydrase (29-), soybean trypsin inhibitor (20-), and lac- talbumin (14.2-kDa).ttD i r e c t PCR A m p l i f i c a t i o n
Direct PCR amplification was performed as described.18 Briefly, a washed 3 mm bloodspot punch was placed in 66 (xl of water and overlaid with 50 (xl of mineral oil. The tube was heated in a thermal cycler§§ at 95°C for 5 min and
** Model PS500X, Hoefer Scientific Instruments, 654 Minnesota Street, Box 77387, San Francisco, CA 94107.
t t Model 61100, R. Shadel, Inc., 1684 Hudson Avenue, San Francisco, CA 94124.
t t Cat. No. 17-0446-01 Pharmacia Biotech, Inc., 800 Centennial Ave., P.O. Box 1327, Piscataway, NJ 08855.
§§ Original Model, Perkin/Elmer Corp., 761 Main Avenue, Norwalk, CT 06859.
Storage Time (mo)
F i g u r e 2. Effect of s to ra g e on b lo o d sp o t appearance. Pre, 3 mm bloodspot punches without treatment; post 1, following first wash; post 2, following second wash; post per, following thermal cycling.
1 3 6 12 18 30pre • • • • • •
post 1 • • • • •
post 2 o • • • • •
>st per -J • • • • •
462 MAKOWSKI, DAVIS, AND HOPFER
3 6 12 18Storage Time (mo)
F i g u r e 3 . E f f e c t o f s t o r a g e o n b l o o d s p o t w e i g h t , e r r o r b a r , s t a n d a r d d e v i a t i o n ; n s , n o t s i g n i f i c a n t ( s t u d e n t ’ s t t es t ) .
cooled to 25°C. The PCR master mix (34 ixl)1111 was then added to all tubes to ach ieve final concentrations o f 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KC1, 200 (Jimol/L deoxyribonucleotide
1111 Cat. No. N801-0055 and N808-0068, Perkin/ E lm e r C o rp ., 761 M ain A v enu e, N orw alk , CT 06859.
triphosphates (dATP, dUTP, dCTP, and dGTP, each), 3 mmol/L MgCl2, 1.25 U Taq polymerase, 0.5 U uracil N-glycosy- lase, 0.1 g/L gelatin and 100 ng (each) oligonucleotide primer for the 98 bp and 491 bp regions (table I) encoding the AF508 cystic fibrosis m utation as described by Kerem et al.26,27 Oligonucleotide primers were synthesized by
TABLE II
Polymerase Chain Reaction Inhibitor Release from Guthrie Cards
Inhibitor1
(Percent)
Storage time (months)3 6 12
(Percent) (Percent) (Percent)18
(Percent)30
(Percent)
Protein (jxg) 597.9 485.4 449.1 304.7 182.5 137.3(100.0)a (81.3) (75.2) (51.0) (30.6) (23.0)
Hemoglobin (au)b 1.873 1.495 1.396 0.945 0.402 0.342(100.0) (79.8) (74.5) (50.5) (21.5) (18.3)
Iron (ng) 374.0 354.0 370.0 318.0 182.0 147.0(100.0) (94.6) (98.9) (85.0) (48.7) (39.3)
aRelease from bloodspots stored for one month assumed to be 100%. bRelative absorbance units.
THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 3
A.
o>3
£ 3 0 0 -o
F i g u r e 4 . E ffect of s to ra g e on re le a s e o f whole blood PCR inhibitors from bloodspots. A, protein; B, hemoglobin; and C, iron. Post 1 and p o s t 2 c o rre sp o n d to m aterial e lu ted in first and second wash, respective ly . P ost p er co rre sponds to material eluted f o l l o w i n g t h e r m a l cycling, error bar, standard deviation.
3 6 1 2 1 8
Stora ge T i m e (mo)
B.
w*-»c3
c!qoooE0)X
3 6 1 2 1 8
Sto ra ge T im e (mo)
automated phosphoramidite chemistry.1l 1i Carryover prevention was performed (37°C, 10 min) and uracil N-glycosylase inactivated (94°C, 10 min). PCR amplification consisted of dénaturation (94°C, 1 min), annealing (55°C, 1 min), and elon-
1111 C y c lo n e D NA S y n th e s iz e r , M illig e n / Biosearch, Inc., New Brunswick Scientific Co., PO Box 4005, 44 Talmadge Road, Edison, NJ 08818.
gation (72°C, 2 min) for 35 cycles. Amplification products were analyzed by TBE- PAGE (see following).
TBE-PAGETris-borate-E DTA/polyacrylamide gel
electrophoresis (TBE-PAGE) was performed as described.28 Briefly, PCR samples (20 jjlI) were mixed with 6X sample
464C.
MAKOWSKI, DAVIS, AND HOPFER
o > 3 0 0
<u FIGURE 4. Continued
3 6 1 2 1 8
S to ra g e T i m e (m o)
buffer containing bromophenol blue and Ficoll-type 400.28 Samples (15 |xl) were electrophoresed on 4 percent (491 bp) and 8 percent (98 bp) mini-polyacrylamide gels (0.75 mm thickness)* in IX TBE at 75 V (constant voltage) for 1 h and 2.5 h, respectively, at 25°C.17,18 Gels were stained with ethidium bromide (0.5 (xg/ml, 10 min) and photographed with background UV illum ination.t E lectrophoretic migration was compared relative to 123 bp DNA m olecular weight ladder s. tResultsE f f e c t o f S t o r a g e o n B l o o d s p o t A p p e a r a n c e P r e - a n d P o s t -P r o c e s s i n g
As can be seen, the two-step wash protocol (as described in figure 1) resulted in
* Mini-PROTEAN II, Cat. No. 165-2940, Bio-Rad Laboratories, Life Science Group, 2000 Alfred Nobel Drive, Hercules, CA 94547.
t M odel 3-3100, Fotodyne, Inc., 950 W alnut Ridge Drive, Hartland, WI 53029.
t Cat. No. 15613-029, Gibco-BRL Laboratories, Inc., PO Box 68, Grand Island, NY 14072.
the elimination of most whole blood components from bloodspots stored for short time periods (1 to 3 months) (figure 2). In contrast, bloodspots stored for longer periods (> 3 m onths) dem onstrated increased retention of whole blood material. Water-based extraction of bloodspots stored for one year and longer did not appreciably alter appearance. Because repeated heating and cooling (thermal cycling) may result in additional release of whole blood components, washed bloodspots were placed in 100 (jul water, overlaid with mineral oil and cycled (post per). No additional change in bloodspot appearance was noted following thermal cycling. Although the solubility of material bound to the filter paper was effected by storage, relative bloodspot weight was not significantly changed over this period (figure 3). Released whole blood components were evaluated for protein, hemoglobin, and iron.Q u a n t it a t i v e A n a l y s is o f M a t e r i a l R e l e a s e d F r o m B l o o d s p o t s
Incubation of bloodspots in 1 ml water (post 1) was very effective in releasing
THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 5
the majority of whole blood components including protein, hemoglobin, and iron (figure 3). Some additional release was noted to occur during the second water incubation (post 2). Thermal cycling of washed bloodspot filters did not appreciably result in further release of whole blood material (post per). As can be seen, total protein, hem oglobin, and iron released by w ater-based extraction decreased substantially as a function of storage (table II). The solubility of protein and hem oglobin decreased 4 to 5-fold over this time period. In contrast to high m olecular w eight com ponents (i.e., proteins), almost 40 percent of total iron c o u ld b e s o lu b i l iz e d from bloodspots stored for 30 months at room temperature.SDS-PAGE A n a l y s is
D ecreased elution of protein from stored bloodspots was confirmed by SDS-PAGE (figure 4). As can be seen, most protein was eluted in the first extraction (post 1) compared to the second extraction (post 2). Repeated heating and cooling (thermal cycling) did not release substantial protein. Three major bands of protein were evident at relative molecular weights o f68-, 28-, and 14-kDa which most likely correspond to albumin, carbonic anhydrase, and hemoglobin, respectively.13 In good agreement with quantitative protein, hemoglobin, and iron analysis (see previous material), there was a slight increase in the 14-kDa protein in the second elution (post 2) from bloodspots stored for 6 and 12 months. The reason for this elution profile is unclear; however, a small amount of 14-kDa protein was also noted in post per sam ples obtained from 18 month bloodspots.F i l t e r P a p e r D N A A m p l i f i c a t i o n
The effect of storage of bloodspot amplification efficiency was evaluated
using two sets of primers for genomic regions encoding the most common cystic fibrosis mutation (AF508).26,27 As can be seen, amplification of 98 and 491 bp amplicons was successful for bloodspots stored for up to 30 months (figure 5). Differences in ethidium bromide staining intensity observed between PCR products (98 bp versus 491 bp) reflect relative mass not molar equivalency.Discussion
The effects of storage at room temperature on Guthrie card bloodspots have been evaluated. Because Guthrie card samples contain limited DNA and high levels of PCR inhibitors,7’9’10’11’12’13 it was decided to determine whether or not storage specifically effected (1) the am plifiability of template DNA and (2) the properties o f w h ole b lood PCR inhibitors.
To perform this study, Guthrie card bloodspots were subjected to a water- based extraction method which specifically eluted PCR inhibitors and retained nucleic acid (figure l) .18 In contrast to extraction protocols which utilize organic solvents, water-based elution releases PCR inhibitors under nondenaturing conditions. Thus, eluted materials can be quantitated and characterized. Furthermore, direct amplification of the filter paper is possible.
Using selective elution, whole blood components which act as natural PCR inhibitors (protein, hem oglobin, and iron)7,9,12’13 were found to becom e increasingly fixed to the filter paper matrix with time. Relatively constant bloodspot weight indicated that fixation did not result from excessive desiccation (figure 3). Despite repeated heating and cooling (thermal cycling), fixation was irreversible (<25 percent total) for higher molecular weight components (protein and hem oglobin). Iron, in contrast,
4 6 6 MAKOWSKI, DAVIS, AND H O PFER
A B CStorage (mo) " Storage (mo) " Storage (mo)1 3 6 12 18 30 1 3 6 12 18 30 1 3 6 12 18 30
kDa
9 7 -
6 8 -4 5 -
2 9 -
2 0 - 1 4 -
FlGURE 5. SDS-PAGE analysis of protein released from stored bloodspots. A, post 1 (protein eluted in first wash); B, post 2 (protein eluted in second wash); and C, post per (protein eluted following thermal cycling). Relative positions of protein molecular weight markers shown on left.
remained much more freely soluble (approximately 40 percent total). It is expected that rigorous extraction methods {i.e., phenol/chloroform , guanidine thiocyanate) may be more effective in the solubilization of these whole blood components.
The SDS-PAGE revealed that the majority of protein released during water-based extraction corresponded to relative molecular weights of approximately 68-, 28- and 14-kDa (figure 5). These three proteins are likely albumin, and red blood cell metal-containing carbonic anhydrase and h em oglob in , respectively.13 Elimination of these proteins prior to PCR is essential to avoid the formation of dense aggregates of thermally denatured material which may deplete Taq DNA polymerase.13 Zinc and iron released from carbonic anhydrase and globin, respectively, may complete or interfere with essential PCR cofactors such as magnesium or catalyze DNA hydrolysis at high temperature.9,12 The elution profile of the 14-kDa protein
(i.e., hemoglobin) corresponded well to quantitative iron analysis (see previous paragraph).
The retention of whole blood PCR inhibitors on the filter paper matrix did not interfere with direct amplification of bloodspots stored 1 to 30 months. Although minor amounts of protein, hemoglobin, and iron were released from older bloodspots (12 to 30 months) during thermal cycling (figure 4), these quantities appeared insufficient to inhibit PCR of short (98 bp) and moderate (491 bp) size amplicons (figure 6).
Decreased yield of DNA microextracted from Guthrie card bloodspots following short-term storage (4.5 months) at room temperature has been reported by McCabe et al.10 This study, however, used a complex nucleic acid extraction protocol including treatment with SDS and proteinase K, three phenol and ether extractions, and ethanol precipitation.10 In our experience13,18 and in other published reports,14,29 DNA has high avidity for solid support filters and strongly
THE EFFECT OF STORAGE ON GUTHRIE CARDS 4 6 7
A. Storage (mo)
Mw 1 3 6 12 18 30
F i g u r e 6 . E ffect of storage on direct bloodspot PCR amplification. A, 98 bp and B, 491 bp ampli- cons. Mw, 123 bp ladder.
-9 8 bp
B. Storage (mo)
Mw 1 3 6 12 18 30
-491 bp
resists extraction — a property essential for direct amplification. In view of the previously mentioned data, nucleic acid may also become “fixed” to the filter paper matrix. Thus, poor DNA recovery using microextraction may result from
loss typical of multi-step methods as well as an inability to partition effectively nucleic acid into the soluble phase. Guthrie cards impregnated with guanidine thiocyanate have been suggested by Harvey et al30 as a mechanism to over
4 6 8 MAKOWSKI, DAVIS, AND HOPFER
come DNA:matrix interaction. In contrast, by simple eluting PCR inhibitors and avoiding ancillary extraction loss, it was possible to amplify Guthrie card DNA from specimens stored up to 30 months at room temperature.
The use of stored Guthrie cards as a genomic archive has considerable benefit. The collection of whole blood on Guthrie cards is simple and well established for neonates.1 Samples are easy to transport and have minimal storage requirements {i.e., room temperature). The DNA co llected on filter paper appears relatively stable,3,5,14 and whole blood collected from neonates contains 2-3-fold higher levels of nucleic acid than that collected from adults.7 Of the neonatal screening laboratories surveyed by McEwen and Reilly in 1994,6 most indicated that they plan to establish more permanent collection systems. Thus, molecular methods aimed at exploring this resource have considerable value and merit further study.Acknowledgment
The assistance of Francesca Nadeau and Cathy Kolakoski is greatly appreciated.
References1. Guthrie R. Organization of a regional newborn
screening laboratory. In: Bickel H, Guthrie R, Hammersen G, editors. Neonatal screening for inborn erro rs o f m etabo lism . New York: Springer Press, 1980:259-70.
2. Lyonnet S, Caillaud C, Rey F, Berthelon M, Frezal J, Rey J, Munnich A. Guthrie cards for detection of point mutations in phenylketonuria. Lancet 1988; 1:507.
3. Williams C, Weber L, Williamson R, Hjelm M. Guthrie spots for DNA-based carrier testing in cystic fibrosis. Lancet 1988;2:693.
4. Schwartz E l, Khalchitsky SE, Eisensmith RC, Woo SLC. Polymerase chain reaction amplification of dried blood spots on Guthrie cards. Lancet 1990;1:629-30.
5. McCabe ER. Utility of PCR for DNA analysis from dried blood spots on filter paper blotter. PCR Meth Appl 1991;1:99-106.
6 . McEwen JE, Reilly PR. Stored Guthrie cards as DNA “banks” . Am J Hum Genet 1994;55:196- 200.
7. Jinks DC, Minter M, Tarver DA, Vanderford M, H ejtm ancik JF , M cCabe ERB. M olecular genetic diagnosis of sickle cell disease using dried blood specimens on blotters used for new born screening. H um G enet 1989;81: 363-6.
8 . Prior TW, Highsm ith WE Jr, Friedm an KJ, Perry TR, Scheuerbrandt G, Silverman LM. A model for molecular screening of newborns: simultaneous detection of Duchenne/Becker muscular dystrophies and cystic fibrosis. Clin Chem 1990;36:1756-9.
9. Higuchi R. 1989. Simple and rapid preparation of samples for PCR. In: Ehrlich HE, editor. PCR technology: principles and applications for DNA amplification. New York: Stockton Press, 1989:31-8.
10. McCabe ERB, Huang S-Z, Seltzer WK, Law ML. DNA microextraction from dried blood spots on filter paper blotters: potential applications to newborn screening. Hum Genet 1987; 75:213-6.
11. Raskin S, Phillips JA III, Dawson E, Kaplan G, McClure M, Vnencak-Jones C. Cystic fibrosis genotyping by direct PCR analysis of Guthrie card blood spots. PCR M eth Appl 1992;2: 154-6.
12. Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Bio- Techniques 1991;10:506-13.
13. M akow ski GS, D av is E L , H o p fe r SM. Enhanced direct amplification of Guthrie card DNA following selective elution of PCR inhibitors. Nucl Acids Res 1995;23:3788-9.'
14. Descartes M, Huang Y, Zhang YH, McCabe LL, Gibbs R, Therell BL, McCabe ERB. Genotypic confirmation from the original dried blood specimens in a neonatal hemoglobinopathy screen ing program . P ed ia tr Res 1992;31: 217-21.
15. Schneeberger C, Kury F, Larsen J, Speiser P, Zeillinger R. A simple method for extraction of DNA from G uthrie cards. PCR M eth Appl 1992;2:177-9.
16. Verlingue C, Mercier B, Lecoq I, Audrezet MP, Laroche D, Travert G, Ferec C. Retrospective study of the cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Guthrie cards from a large cohort of neonatal screening for cystic fibrosis. Hum Genet 1994; 93:429-34.
17. Makowski GS, Aslanzadeh J, Hopfer SM. Minigel PAGE for enhanced resolution of polymerase chain reaction detection of AF508 deletion in cystic fibrosis. Clin Chem 1993;39:2204-5.
18. Makowski GS, Aslanzadeh J, Hopfer SM. In situ PCR amplification of Guthrie card DNA to detect cystic fibrosis mutations. Clin Chem 1995;41:447-9.
19. Hopfer SM, Makowski GS, Davis EL, Aslanzadeh J. Detection of the cystic fibrosis AF508 mutation by anti-double-stranded DNA antibody. Ann Clin Lab Sei 1995;25:475-84.
THE EFFECT OF STORAGE ON GUTHRIE CARDS 469
20. Audrezet MP, Costes B, Ghanem N, Fanen P, Verlingue C, Morin JF, Mercier B, Goossens M, Ferec C. Screening for cystic fibrosis in dried blood spots of newborns. Molec Cell Probes 1993;7:497-502.
21. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC. Measurem ent of protein using bicinchoninic acid. Anal Biochem 1985;150:76-85.
22. Fairbanks VF, Ziesmer SC, O’Brien PC. Methods for measuring plasma hemoglobin in microm olar concentration compared. Clin Chem 1992;38:132-40.
23. Carter P. Spectrophotometric determination of serum iron at the submicrogram level with a new reagent (ferrozine). Anal Biochem 1971; 40:450-8.
24. Laemmli UK. Cleavage of structural proteins during the assembly of the head of the bacte- riphage T4. Nature 1970;227:680-5.
25. Makowski GS, Ramsby ML. pH modification to enhance the molecular seiving properties of sodium dodecyl sulfate-10 percent polyacrylamide gels. Anal Biochem 1993;212:283-5.
26. Kerem B-S, Rommens JM, Buchanan JA, Mar- kiewicz D, Cox TK, Chakravarti A, Buchwald M, Tsui L-C. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245: 1073-80.
27. Kerem B-S, Zielenski J, Markiewicz D, Bozon D, Gazit E, Yahav J, Kennedy D, Riordan JR, Collins FS, Rommens JM, Tsui L-C. 1990. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)- binding folds of the cystic fibrosis gene. Proc Natl Acad Sei USA 1990;87:8447-51.
28. Sambrook J, Fritsch EF, Maniatis T. In: Molecular cloning: a laboratory manual, 2nd edition. New York: Cold Spring Harbor Laboratory Press, 1989.
29. Skryabin BV, Khalchitsky SE, Kuzjmin AI, Kaboev OK, Kalinin VN, Schwartz E l. A crude lysate of cells immobilized on solid support can serve as a matrix for enzymatic DNA amplification. Nucl Acids Res 1990;18:4289.
30. Harvey MA, KingTH, Burghoff R. Impregnated 903 blood collection paper: a tool for DNA preparation from dried blood spots for PCR a m p lif ic a tio n . In : T e c h n ic a l B u lle t in , Schleicher & Schuell, Inc., Keene, NH, 1995.