tham-vol5no1 3/19/05 10:59 am page 1 angiotensin ii ...tors (ppars) are ligand-dependent nuclear...

The Journal of Applied Research • Vol. 5, No. 1, 2005 1

PPAR-a Activation AttenuatesAngiotensin II-Induced VascularInflammation, Arterial LDLAccumulation and EndothelialLayer Permeability in MiceDoris M. Tham, PhD*

Lening Zhang, PhD*

Baby Martin-McNulty†

Yi-Xin Wang, MD†

Mark E. Sullivan, PhD†

John C. Rutledge, MD*

*Department of Internal Medicine, School of Medicine, University of California at Davis, Davis,California†Department of Pharmacology, Berlex Biosciences, Richmond, California

tors, 2) attenuation of arterial low-den-sity lipoprotein (LDL) accumulation,and 3) attenuation of endothelial layerpermeability. To examine the effects ofa PPAR-a agonist on vascular inflam-mation, we administered a diet contain-ing fenofibrate (40 mg/kg/day) for 5weeks to male apolipoprotein E-defi-cient (apoE-KO) mice that were infusedwith Ang II (1.44 mg/kg/day).Fenofibrate reversed the pro-inflamma-tory genes induced by Ang II, and up-regulated PPAR-a mRNA expression inthe aorta. To determine whether fenofi-brate could reverse the functional con-sequences of Ang II, arterial LDLaccumulation and endothelial layer per-meability from isolated mouse carotidarteries were assessed by quantitativefluorescence microscopy. Fenofibratesignificantly attenuated both the rate ofarterial LDL accumulation and

KEY WO R D S : a t h e r o s c l e r o s i s,c h e m o k i n e s, i n f l a m m a t i o n , e n d o t h e l i a lc e l l , l i p o p r o t e i n s

ABSTRACTThe peroxisome proliferator-activatedreceptors (PPARs) have been shown tobe important in modulating vascularinflammation and atherosclerosis.Angiotensin II (Ang II) is known topromote vascular inflammation andaccelerate atherosclerosis. We demon-strated that these vascular changesinduced by Ang II are associated withup-regulation of pro-inflammatorygenes, as well as down-regulation ofPPAR-a expression. We hypothesizedthat a PPAR-a agonist would have vas-culoprotective effects in a mouse modelof Ang II-induced atherosclerosis by: 1)attenuation of pro-inflammatory media-

Tham-vol5no1 3/19/05 10:59 AM

Vol. 5, No. 1, 2005 • The Journal of Applied Research2

endothelial layer permeability inducedby acute administration of Ang II. Ourstudies demonstrate that PPAR-a acti-vation has functional effects to reduceLDL accumulation and endothelial layerpermeability in the arterial wall. Thepleiotropic effects of PPAR-a agonistson vascular wall inflammation certainlyparticipate in the inhibition of athero-sclerosis development.

INTRODUCTIONPeroxisome proliferator-activated recep-tors (PPARs) are ligand-dependentnuclear transcription factors that form asubfamily of the nuclear receptor super-family. PPARs regulate target geneexpression by binding to specific peroxi-some proliferator response elements(PPREs) in enhancer sites of regulatedgenes. PPAR-a regulates genes involvedin the b-oxidative degradation of fattyacids.1,2 Fatty acids and their derivativeshave been identified as natural ligandsfor PPAR-a. PPAR-a also is the pri-mary target of numerous classes of syn-thetic ligands, including lipid-loweringfibrates. The Helsinki Heart Study wasthe first large clinical trial to show bene-fits from the use of a fibrate by whichgemfibrozil reduced the incidence ofcoronary heart disease in men with dys-lipidemia.3 The Veterans Affairs HDL

Cholesterol Intervention Trial demon-strated that gemfibrozil therapy resultedin a significant reduction in the risk ofmajor cardiovascular events in patientswith coronary disease.4 Although attrib-uted mainly to the hypolipidemic andHDL-raising actions of fibrate drugs,other actions of these PPAR-a agonistson the vasculature may also have contributed to the benefits seen in these trials.

PPAR-a is normally present at highlevels in the liver, where its activationincreases fatty acid oxidation and altersapolipoprotein expression. PPAR-a alsois expressed in the vascular wall inendothelial cells, smooth muscle cells,monocytes/macrophages, and foamcells.5-8 There is strong evidence suggest-ing that PPAR-a agonists have a poten-tial modulatory role in the pathogenesisof atherosclerosis related to effects onvascular inflammation and metabolicrisk factors. Possible mechanisms for theanti-atherogenic effects of PPAR-a acti-vators on the vessel wall include theinhibitory effects of PPAR-a on foamcell formation, expression of cell adhe-sion molecules, cytokine and chemokineproduction, and the indirect effects ofdecreasing lipids.4,6,9,10

We and others have recentlydemonstrated that angiotensin II (Ang

Table 1. Effects of Angiotensin II (Ang II) and Ang II + Fenofibrate on Gene Expression in theAorta of Apolipoprotein E-deficient (apoE-KO) Mice*

Ang II (n = 4) Ang II + fenofibrate (n = 5)

PPAR-a/GAPDH 3.47 ± 0.77 12.64 ± 2.02‡

MCP-1/vWF 6.74 ± 2.78 1.96 ± 0.5 M-CSF/vWF 17.59 ± 3.43 2.11 ± 0.19†

E-selectin/vWF 9.76 ± 0.51 3.68 ± 0.32§

ICAM-1/vWF 6.64 ± 2.79 2.85 ± 0.48 VCAM-1/vWF 7.03 ± 1.29 1.94 ± 0.33†

*PPAR-a indicates peroxisome proliferator-activated receptor-alpha; MCP-1, monocyte chemotactic protein-1; M-CSF,macrophage-colony stimulating factor; E-selectin, endothelial-selectin; ICAM-1, intercellular adhesion molecule-1; andVCAM-1, vascular cell adhesion molecule-1. Values were normalized to either glyceraldehyde-3 phosphate dehydro-genase (GAPDH) or to von Willebrand Factor (vWF). Statistical analysis was performed using one-way ANOVA anddata are expressed as mean ± SEM. †P < 0.05, ‡P < 0.01, §P < 0.001, significantly different from Ang II alone.

Tham-vol5no1 3/19/05 10:59 AM


II) promotes vascular inflammation andaccelerates atherosclerosis.14-16 Thesevascular changes were associated withactivation of nuclear factor-kappa B(NF-kB)-mediated induction ofchemokines and endothelial cell adhe-sion molecules, as well as down-regula-tion of PPAR-a expression.14 Wepostulated that the down-regulation ofPPAR-a by Ang II may diminish theanti-inflammatory potential of PPAR-a,thus contributing to enhanced vascularinflammation. We hypothesized that aPPAR-a agonist would have vasculopro-tective effects by attenuation of pro-inflammatory mediators. Also, thereduction in vascular inflammationwould attenuate arterial low-densitylipoprotein (LDL) accumulation andendothelial layer permeability. To exam-ine the effects of a PPAR-a agonist onthe vascular wall, we administeredfenofibrate to male apolipoprotein E-deficient mice (apoE-KO) that weretreated with Ang II to promote vascular

inflammation and accelerate atheroscle-rosis. We measured the expression ofpotential target genes in the artery wall,arterial LDL accumulation, endotheliallayer permeability, the effects on lipidand glucose metabolism, and the extentof atherosclerosis. Our data suggest thatfenofibrate has direct beneficial vasculareffects as demonstrated by anti-inflam-matory changes in gene regulation andtranscription factor activation in theaorta. In addition, our studies demon-strate that PPAR-a activation has func-tional effects to reduce LDLaccumulation and endothelial layer per-meability in the arterial wall, potentialmechanisms for the prevention ofatherogenesis.

METHODSAnimals All animal protocols were approved bythe Institutional Animal Care and UseCommittee at the University ofCalifornia at Davis and Berlex

Figure 1. Serum lipoproteins in apolipoprotein E-deficient (apoE-KO) mice treated withangiotensin II (Ang II) and Ang II plus fenofibrate. Statistical analysis was performed using one-way ANOVA and data are expressed as mean ± SEM. *P < 0.001, significantly different from AngII treatment alone.

Tham-vol5no1 3/19/05 10:59 AM


Biosciences. Six-month old maleapolipoprotein E-deficient (apoE-KO)mice were fed a diet containing eitherfenofibrate (4, 20, 40 mg/kg/day) or nor-mal chow. After 7 days, all mice weresubcutaneously implanted with osmoticminipumps (Alzet, Model 2004; ALZA,Palo Alto, Calif) containing Ang II (1.44mg/kg/day; CalBiochem, La Jolla,Calif).14,15,17 Both diet and Ang II infu-sion continued for an additional 30 days.Mice and feed were weighed daily. After

30 days, systolic blood pressure wasmeasured in conscious mice using a tail-cuff system (Kent Scientific, Litchfield,Conn). Mice were trained to lie quietlyin a restrainer placed on a warm pad fora period of at least 30 minutes for 1 to 4days before the study. On the day of thestudy, the mice were placed in the tem-perature-controlled restrainer for 15minutes. Blood pressure was then meas-ured repeatedly and recorded on a dataacquisition system (PowerLab, 16/s,

Figure 2. Liver weight and enzymes, serum glutamic pyruvic transaminase (SGPT) and alkalinephosphatase, in apolipoprotein E-deficient (apoE-KO) mice treated with angiotensin II (Ang II)and Ang II plus fenofibrate. Statistical analysis was performed using one-way ANOVA and dataare expressed as mean ± SEM. *P < 0.001, significantly different from Ang II treatment alone.

Tham-vol5no1 3/19/05 10:59 AM


ADInstruments, Australia). Systolicblood pressure was averaged from con-secutive 5 measurements. Mice wereeuthanized by CO2 asphyxiation.

Quantification of Atherosclerosis.The left and right carotid arteries weredissected, cut open longitudinally, andpinned down individually on silicon-coated petri dishes. Atheroscleroticplaques were visible without staining.The images of the open luminal surfaceof both carotid arteries were recordedby a digital camera (Sony, Japan) mount-ed on a dissecting microscope. Theplaque area was quantified using C-Imaging Systems (Compix, CranberryTownship, Pa) and expressed as a per-centage of the total luminal surface areaof the carotid arteries as previouslydescribed.18-20

Metabolic Studies Fasting serum glucose was measured ona Beckman glucose analyzer 2(Beckman, Brea, Calif) using the glucoseoxidase method and fasting insulin lev-els were assayed by radioimmunoassay

(Linco Research, St. Charles, Mich).Total cholesterol (TC), high densitylipoprotein (HDL), and triglyceride(TG) were directly measured in fastingserum by standard clinical laboratoryanalysis (IDEXX, Sacramento, Calif).Low-density lipoprotein (LDL) valueswere calculated. Serum glutamic pyruvictransaminase (SGPT) and alkaline phos-phatase (AP) levels were also measuredto assess potential liver toxicity(IDEXX).

RT-PCR-based Quantitative GeneExpression Analysis Real-time detection of PCR was per-formed using the GeneAmp 5700Sequence Detection System (AppliedBiosystems, Foster City, Calif). The dif-ferential displays of aortic mRNAs forPPAR-a, monocyte chemotactic protein-1 (MCP-1), macrophage-colony stimulat-ing factor (M-CSF), endothelial-selectin(E-selectin), intercellular adhesion mole-cule-1 (ICAM-1), and vascular cell adhe-sion molecule-1 (VCAM-1) weredetermined. Total RNA from the aortawas isolated using an RNA isolation

Figure 3. Change in gene expression of in the aortas of apolipoprotein E-deficient (apoE-KO)mice treated with angiotensin II (Ang II) plus fenofibrate compared to Ang II alone. Total RNAextracted from the aorta was subjected to quantitative RT-PCR using primers specific for peroxi-some proliferator-activated receptor-alpha (PPAR-a), monocyte chemotactic protein-1 (MCP-1),macrophage-colony stimulating factor (M-CSF); endothelial-selectin (E-selectin); intercellularadhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1).

Tham-vol5no1 3/19/05 10:59 AM


reagent (Rneasy kit, QIAGEN, Valencia,Calif). Total RNA was used to generatecDNA for oligo dT oligodeoxynu-cleotide primer (T12-18) following theprotocol for SuperScript II Rnase H-Reverse Transcriptase (GibcoBRL,Rockville, Md). The following primerswere designed using Primer Expresssoftware (Applied Biosystems) and syn-thesized by Operon (Alameda, Calif):

PPAR-a:5’CCTCTTCCCAAAGCTCCTTCA3’ (forward);5’CTGCGTCGGACTCGGTCTT3’ (reverse);MCP-1:5’CAGCCAGATGCAGTTAACGC3’ (forward),5 ’ G C C TAC T CAT T G G G AT CAT C T T G 3’ (reverse);M-CSF:5’AGCATGGACAGGCAGGGAC3’ (forward),5’CTGCGTGCCTTTATGCCTTT3’ (reverse);E-selectin:5 ’ G G CAG ACATAT T G G C T T TAT C C C 3 ’ ( f o r w a r d ) ,5’GATGGATCTCATGCTGGCTTC3’ (reverse);ICAM-1:5 ’ G AG T T T TAC CAG C TAT T TAT T G AG TACCC3’

(forward), 5’CTCTCACAGCATCTGCAGCAG3’(reverse);VCAM-1:5’TTAAAGTCTGTGGATGGCTCGTAC3’ (forward),5’CTTAATTGTCAGCCAACTTCAGTCTT3’(reverse);GAPDH: 5’GCAACAGGGTGGTGGACCT3’(forward), 5’GGATAGGGCCTCTCTTGCTCA3’(reverse);vWF: 5’AATGCCTTATTGGCGAGCAC3’ (forward),5’CACTGCTTGCTGTACACCAGAAA3’(reverse).

Equal amounts of cDNA were used induplicates and amplified with the SYBRGreen I Master Mix (AppliedBiosystems). The thermal cycling param-eters were as follows: thermal activationfor 10 minutes at 95˚C, and 40 cycles ofPCR (melting for 15 minutes at 95˚Cand annealing/extension for 1 minute at60˚C). A standard curve was constructedwith a dilution curve (1:5, 1:10, 1:20,

Figure 4. Induction of nuclear factor-kappa B (NF-kB) binding activity in the aortas ofapolipoprotein E-deficient (apoE-KO) mice treated with angiotensin II (Ang II) and Ang II plusfenofibrate. Nuclear extracts prepared from the aortas of apoE-KO mice were used to bind the3’-biotin-labeled NF-kB oligonucleotide and the appearance of the sequence-specific NF-kBbinding activity was detected by electrophoretic mobility shift assay. NF-kB activation wasquantified by densitometry and expressed as arbitrary densitometry units. Statistical analysis wasperformed using two-tailed Student t test and data are expressed as mean ± SEM. *P < 0.05, sig-nificantly different from Ang II treatment alone.

Tham-vol5no1 3/19/05 10:59 AM


1:40, 1:80, 1:160, 1:320, 1:640) of totalRNA from mouse aorta. A “no templatecontrol” was included with each PCR.Amplification efficiencies were validat-ed and normalized against glyceralde-hyde-3 phosphate dehydrogenase(GAPDH) or von Willebrand Factor(vWF). Correct PCR product size wasconfirmed by electrophoresis through a1% agarose gel stained with ethidiumbromide. Purity of the amplified PCRproducts was determined by a heat-dis-sociation protocol to enable detection ofnonspecific amplification.

Assessment of NF-kB Activation byElectrophoretic Mobility Shift AssayNuclear extracts of aortic tissue wereisolated using NE-PER Nuclear and

Cytoplasmic Extraction Reagents(Pierce, Rockford, Ill). Tissues werehomogenized on ice using a TissueTearor (Biospecs Products, Racine, Wis).Protein concentration was measured bya modified Lowry assay kit (Bio-Rad,Hercules, Calif) using bovine IgG as thestandard. The NF-kB consensus oligonu-cleotide (5’-AGTTGAGGGGACTTTC-CCAGGC-3’; Santa Cruz Biotechnology,Santa Cruz, Calif) was 3’ end-labeledwith biotin (Pierce). The binding reac-tions containing equal amounts of pro-tein (10 µg) and 20 fmol ofoligonucleotide were performed for 20minutes in binding buffer (2.5% glyc-erol, 5 mmol/L MgCl2, 50 ng/µL poly(dI-dC) 0.05% NP-40; Pierce). The reac-tion volumes were held constant to 20

Figure 5. Effects of angiotensin II (Ang II) and Ang II plus fenofibrate on arterial low-densitylipoprotein (LDL) accumulation. Carotid arteries from apolipoprotein E-deficient (apoE-KO) micewere perfused with angiotensin II (Ang II) or Ang II plus fenofibrate. Arterial LDL accumulationwas determined by measuring 1,1’-dioctadecyl-1,3,3,3’,3’-tetramethyl-indocarbocyanine (DiI)-LDL accumulation in the artery wall. There was a significant decrease in the rate of arterial LDLaccumulation (n = 6) in the fenofibrate-perfused vessels compared to Ang II alone after 5 hours.Statistical analysis was performed using one-way ANOVA and data are expressed as mean ±SEM. *P < 0.05, significantly different from Ang II treatment alone.

Tham-vol5no1 3/19/05 10:59 AM


µL. The reaction products were separat-ed in a 6% polyacrylamide gel, detectedwith streptavidin-horseradish peroxidaseand analyzed by autoradiography. TheNF-kB activation was quantified usingthe Kodak ElectrophoresisDocumentation & Analysis System 290(Eastman Kodak, Rochester, NY). Todemonstrate specificity of binding of theNF-kB oligonucleotide, a mutant NF-kBconsensus oligonucleotide (Santa CruzBiotechnology) was used as a negativecontrol. Competition assays with 50 ngof unlabeled oligonucleotides were alsoused to confirm the specificity of thisNF-kB binding assay.

Assessment of Transcription FactorActivation Nuclear extracts of aortic tissue wereisolated and quantified as describedabove. Using the Myria protein/DNA

array kit (Panomics, Redwood City,Calif), a set of biotin-labeled DNA bind-ing oligonucleotides were pre-incubatedwith aortic nuclear extracts in order toallow the formation of DNA/proteincomplexes. The DNA/protein complexeswere then extracted and hybridized tothe MYRIA array that contained 54consensus-binding sequences correspon-ding to a specific eukaryotic transcrip-tion factor. Detection of signals wasquantified using the KodakElectrophoresis Documentation &Analysis System 290 (Eastman Kodak).Activated transcription factors werecompared between treatment groups bynormalization to biotinylated DNAspotted on each array. All experimentswere performed in duplicates.

Fluorescent LDL Preparation LDL was isolated and labeled as

Figure 6. Effects of angiotensin II (Ang II) and Ang II plus fenofibrate on endothelial layer perme-ability. Carotid arteries from apolipoprotein E-deficient (apoE-KO) mice were perfused withangiotensin II (Ang II) or Ang II plus fenofibrate. Endothelial layer permeability was determinedby measuring TRITC-dextran (4,400 MW) accumulation. There was a significant decrease in therate of endothelial layer permeability (n = 7) in the fenofibrate-perfused vessels compared toAng II alone after 5 hours. Statistical analysis was performed using one-way ANOVA and dataare expressed as mean ± SEM. *P < 0.05, significantly different from Ang II treatment alone.

Tham-vol5no1 3/19/05 10:59 AM


described by Pitas et al.21 Briefly, bloodfrom fasting nonsmoking human maleswas obtained in vacutainers containingEDTA and centrifuged for 10 minutes at2,800 rpm at 4˚C. The plasma was isolat-ed and LDL (density = 1.01 to 1.06) andlipoprotein-deficient plasma wereobtained by sequential density gradientultracentrifugation. LDL was labeledwith the fluorophore 1,1’-dioctadecyl-1,3,3,3’,3’-tetramethyl-indocarbocyanine[DiI] (Molecular Probes, Eugene, Ore)and dialyzed in PBS at 4˚C for 48 hours.The spectral properties of DiI are 540nm excitation maximum and 556 nmemission maximum.

Measurement of Arterial LDLAccumulationArterial LDL accumulation experimentsfrom 6-month old male apoE-KO micewere evaluated by measuring DiI-LDLaccumulation in either Ang II (10-6 M)or Ang II plus fenofibrate (200 µM) per-fusate solution. Animals were anes-thetized with an intraperitonealinjection of pentobarbital sodium (0.1mL of 50 mg/mL per 100 g body wt).The carotid arteries were isolated andadjacent tissues were carefully dissectedaway. The isolated arteries were placedin the perfusion apparatus and the rateof LDL accumulation in the artery wallwas determined by quantitative fluores-cence microscopy as previouslydescribed.22-24 A control level of fluores-cence intensity was established duringperfusion of a nonfluorescent solution(1% BSA-Krebs-Henseleit buffer con-sisting of 116 mM NaCl, 5 mM KCl, 2.4mM CaCl2.H2O, 1.2 mM MgCl2, 1.2 mMNH2PO4, and 11mM glucose). At theend of a 5 minutes perfusion with solu-tion containing DiI-LDL with Ang II orAng II plus fenofibrate, the vessel lumenwas cleared of DiI-LDL. Measurementsof the rate of LDL accumulation wereperformed under control conditions andcompared to treatment conditions.

Initially, 3 control runs were performedon both left and right vessels from samemouse to obtain a control rate of accu-mulation. At 0 hours, vessels were treat-ed with or without 200 µM fenofibrate.After 2.5 hours, 3 control runs wererepeated on both vessels. Both vesselswere then treated with 10-6 M Ang II. At5.0 hours, 3 control runs were per-formed. All treatments were addeddirectly to both the nonfluorescent andfluorescent solutions used to perfuse thearteries. Once the lumen was cleared ofthe fluorescent-labeled solution, anyremaining fluorescence is a measure ofthe number of molecules of DiI-LDLthat remains bound to the endothelialsurface or in the vessel wall. It is duringthe washout phase that the analysis ofLDL accumulation is performed.Measurement of accumulation involvesanalysis of washout data as two distinctprocesses: a rapid washout of the lumenfluorescence, followed by a slower vesselwall fluorescence washout. Calculationof fluorescence intensity (If) accumula-tion (the amount of fluorescent-labeledmolecules in the artery wall) involvesfinding the intersection of tangentsdrawn to approximate these twoprocesses. To determine accumulationrate, If accumulation is divided by thelength of dye perfusion (5 min). Finally,an appropriate conversion factor is usedto convert millivolts per minute tong.min-1.cm2. This conversion factorcomes from four measurements: 1) thesurface area; 2) the lumen volume of thevessel in the photometric window; 3) themaximum If at time 0 (If0), which occursat the beginning of dye perfusion; and 4)the concentration of fluorophore.Throughout the perfusion experiment,the vessel was perfused at a rate of 1.5mL/min at 37˚C and pH 7.4.

Measurement of Arterial Permeability Vascular permeability from 6-month oldmale apoE-KO mice was evaluated by

Tham-vol5no1 3/19/05 10:59 AM


measuring tetramethylrhodamine isoth-iocyanate (TRITC)-dextran accumula-tion in either Ang II (10-6 M) or Ang IIplus fenofibrate (200 µM) perfusatesolution. Animals were anesthetizedwith an intraperitoneal injection of pen-tobarbital sodium (0.1 mL of 50 mg/mLper 100 g body wt). The carotid arterieswere isolated and adjacent tissues werecarefully dissected away. As describedabove, 3 control runs established controllevels of dextran (4,400 MW) accumula-tion with two sets of three runs per-formed with Ang II or Ang II plusfenofibrate perfusate solution in eachcarotid as described above. Each runconsisted of 5 minutes of washout withthe nonfluorescent solution. Bothcarotid arteries were examined in eachanimal.

Statistical Analysis Data are expressed as mean ± SEM.Statistical analysis was performedbetween two groups using two-tailedStudent t test for unpaired values. One-way ANOVA (with a Bonferroni’s posthoc test) was performed when compar-ing groups of three or more. P < 0.05was considered statistically significant.

RESULTSEffects of a PPAR-a Agonist on BodyWeight, Blood Pressure, Fasting SerumChemistries and Atherosclerotic Lesions PPAR-a agonist treatment with fenofi-brate did not have a significant effect onbody weight (27.4 ± 0.6 vs 27.5 ± 0.3 g),systolic blood pressure (202 ± 17 vs 160± 12 mm Hg), fasting serum glucose (92± 8 vs 107 ± 7 mg/dL) or insulin (0.43 ±0.03 vs 0.54 ± 0.09 ng/dL) compared toAng II treatment alone. However, AngII plus fenofibrate treatment increasedblood lipid levels. Total cholesterol (TC),low density lipoprotein (LDL) andtriglyceride (TG) levels were significant-ly increased by Ang II plus fenofibratecompared to Ang II treatment alone

(Figure 1). High density lipoprotein(HDL) levels, however, were not affect-ed by a PPAR-a agonist treatment com-pared to Ang II treatment alone (68 ± 9vs 65 ± 5 mg/dL).

A significant dose-dependent (4, 20,40 mg/kg/day) increase in the liverweight was observed in the Ang II plusfenofibrate group compared to the AngII treatment group (Figure 2). This dose-dependent increase in liver weight wasaccompanied by a dose-dependentincrease in SGPT and AP suggestingpotential liver toxicity (Figure 2).However, histological examination ofthe liver revealed no gross necrosis orinflammation. In addition, no significantfat was noted in the liver sectionsstained with oil red O (data not shown).In this milieu of increased lipids, liverweight and liver enzymes, there was nosignificant change in carotid plaque areaobserved with Ang II plus fenofibratetreatment (43.1 ± 2.6 vs 34.6 ± 3.6%)compared to Ang II treatment alone.

PPAR-a Agonist Activated Aortic GeneExpression of PPAR-a and Down-regu-lated Chemokines and Endothelial CellAdhesion Molecules To investigate the potential effects of aPPAR-a agonist on patterns of pro-inflammatory gene expression involvedwith the initiation and progression ofthe atherosclerotic process within thearterial wall, the differential displays ofaortic mRNAs for PPAR-a, MCP-1, M-CSF, E-selectin, ICAM-1, and VCAM-1were determined in apolipoprotein E-deficient (apoE-KO) mice treated withAng II and Ang II plus fenofibrate. ThemRNA level of PPAR-a was significant-ly up-regulated in the Ang II plus fenofi-brate-treated group compared to theAng II treatment alone (Table 1 andFigure 3). In addition, Ang II plusfenofibrate treatment significantlyreduced both chemokine (M-CSF) andendothelial cell adhesion molecule

Tham-vol5no1 3/19/05 10:59 AM


(E-selectin and VCAM-1) mRNAexpression compared to the Ang IItreatment alone (Table 1 and Figure 3).In addition, Ang II plus fenofibratedecreased MCP-1 and ICAM-1 expres-sion by 71% and 57%, respectively,when compared to the Ang II treatmentalone (Table 1 and Figure 3).

PPAR-a Agonist Decreased AorticTranscriptional Factor Activation of NF-kB, Egr-1 and Sp-1 In order to determine the molecularmechanisms underling the inducibleexpression of pro-inflammatory media-tors in the vascular tissue, we first meas-ured the nuclear translocation of NF-kBin the aorta. In this study, Ang II plusfenofibrate-treated nuclear extracts dis-played a 51% decrease in the bindingactivity of NF-kB by electromobilityshift assay with the use of a 3’-endbiotin-labeled consensus probe for NF-kB, compared with nuclear extracts pre-pared from Ang II-treated aorta (P <0.05) (Figure 4). As expected, reactionswith the NF-kB mutant oligonucleotideresulted in no detectable binding activityand competition assays with unlabeledNF-kB oligonucleotides confirmed thespecificity of this NF-kB DNA bindingassay (data not shown).

We also analyzed Egr-1 and Sp-1transcription factor binding activity.Nuclear extracts prepared from the aor-tas of apoE-KO mice were used to bindthe 3’-biotin-labeled DNA bindingoligonucleotides and the appearance ofthe sequence-specific Egr-1 and Sp-1binding activity was detected on aDNA/protein array. Egr-1 and Sp-1binding activity was quantified by den-sitometry and expressed as fold change.Ang II plus fenofibrate treatment result-ed in a 2.4-fold decrease (1.2 X 106 vs 3.0X 106 arbitrary densitometry units) inEgr-1 transcription factor binding activi-ty in the aortas compared to the Ang IItreatment group. Sp-1 transcription fac-

tor binding activity in the aortas of theAng II plus fenofibrate-treated groupwas also decreased by 2.1-fold (1.2 X 106

vs 2.6 X 106 arbitrary densitometryunits) compared compared to the AngII-treated group.

PPAR-a Agonist Attenuates Ang II-induced Vascular Injury To address whether acute exposure ofAng II or Ang II plus fenofibrate affectsarterial LDL accumulation and/orendothelial layer permeability, experi-ments were performed by perfusingcarotid arteries taken from 6 month-oldmale apoE-KO mice. LDL accumulationwas determined by measuring DiI-LDLaccumulation in the artery wall, whileendothelial layer permeability wasdetermined by measuring TRITC-dex-tran (4,400 MW) accumulation in theartery wall. Three runs established con-trol levels of either DiI-LDL or dextranaccumulation with subsequent runs per-formed in the presence of Ang II or AngII plus fenofibrate in each carotid artery.Ang II plus fenofibrate treatment signif-icantly decreased LDL accumulation byapproximately 57% after 5 hours ofexposure compared to vessels perfusedwith Ang II alone (P < 0.05) (Figure 5).In addition, Ang II plus fenofibratetreatment significantly decreasedendothelial layer permeability byapproximately 25% after 5 hours ofexposure compared to vessels perfusedwith Ang II alone (P < 0.05) (Figure 6).

DISCUSSIONThis present study demonstrated thattreatment with a PPAR-a ligand, such asfenofibrate, had broad effects to attenu-ate the pro-inflammatory effects of AngII in the aorta as demonstrated by: 1)up-regulation of PPAR-a expression; 2)down-regulation of chemokines andendothelial cell adhesion moleculesexpression; and 3) reduction of multipletranscriptional factor activation, such as

Tham-vol5no1 3/19/05 10:59 AM


NF-kB, Egr-1 and Sp-1. These molecularchanges in the artery wall caused reduc-tion of arterial LDL accumulation andendothelial layer permeability. Our datasuggest that PPAR-a ligands are novelregulators of gene expression in vascularcells that can modulate the functionalinflammatory response.

As demonstrated in our previousstudy, the consequences of Ang II infu-sion was the up-regulation of a numberof pro-inflammatory mediators andaccelerated atherosclerosis.14

Concomitant with the enhanced pro-inflammatory response, Ang II treat-ment also decreased expression ofPPAR-a in the aortic wall. In this study,treatment with fenofibrate attenuatedproduction of chemokines and endothe-lial cell adhesion molecules induced byAng II. The results in this study indicatethat PPAR-a expression itself is anothersite of interaction between PPAR-a ago-nists and inflammatory mediators. It hasbeen demonstrated that the humanPPAR-a gene can positively auto-regu-late its own expression.25 The inductionof PPAR-a expression may have impor-tant implications due of its ability toexert anti-inflammatory activities.

Several regulatory pathways caninduce the expression of potentially pro-inflammatory genes, such as chemokinesand endothelial cell adhesion molecules,which have been implicated in the pro-gression of atherosclerosis.26-31 Theseinclude NF-kB, Egr-1 and Sp-1 signalingpathways.32,33 Many stimuli associatedwith the development of vascular dis-ease, including Ang II, are capable ofinducing these transcription factors.34,35

Once activated, the transcription factorsNF-kB, Egr-1 and Sp-1, bind to recogni-tion elements in the promoter region ofpro-inflammatory genes and act as adominant regulator of transcription ofthese genes to induce inflammation.36,37

Since activation of NF-kB, Egr-1 and Sp-1 are linked to enhanced expression of

genes predominantly implicated inatherogenesis, we examined whetherchanges in pro-inflammatory geneexpression detected with PPAR-a ago-nist treatment were associated withchanges in transcriptional binding activi-ty of NF-kB, Egr-1 and Sp-1. Indeed, ourstudy showed that aortic NF-kB, Egr-1and Sp-1 transcriptional binding activitywas dramatically decreased followingPPAR-a agonist treatment compared toAng II treatment alone. Computer-assisted analysis of the human PPAR-apromoter sequence identified variousputative transcription factor bindingsites for members of the Egr gene fami-ly, as well as potential sites for NF-kB.25

These data suggest that decreased NF-kB, Egr-1 and Sp-1 nuclear translocationfollowing PPAR-a agonist treatmentmay be responsible for the decrease inAng II-induced gene transcription ofchemokines and endothelial cell adhe-sion molecules in the vascular wall. Thereduction in expression of these pro-inflammatory mediators in the vascularwall observed with PPAR-a activationmay have direct anti-inflammatory andanti-atherogenic mechanisms. Moreover,the ability of PPAR-a ligands to inter-fere with the vessel’s inflammatoryprocess in vivo holds promise in preven-tion and therapy of atherosclerosis.

PPAR-a agonists are known toreduce vascular inflammation and ather-osclerosis in mouse models of vasculardisease.38 A number of possible mecha-nisms for this have been proposed suchas the inhibitory effects of PPAR-a onfoam cell formation, expression of celladhesion molecules, cytokine andchemokine production, and the indirecteffects of decreasing lipids.4,6,9-13 Ourstudies support a new mechanism bywhich PPAR-a agonists can mitigateatherosclerosis: by preventing increasedendothelial layer permeability inducedby Ang II treatment, resulting indecreased LDL accumulation in the

Tham-vol5no1 3/19/05 10:59 AM


artery wall. A second mechanism involv-ing LDL flux in the artery wall also ispossible. It is likely that the inflammato-ry milieu present in the artery wall treat-ed with Ang II provides the conditionsfor modification of LDL and binding ofthe LDL to the artery wall components,including lipid-filled macrophages,heparin sulfate proteoglycans, andlipoprotein lipase. Thus, by preventingartery wall inflammation, PPAR-a ago-nists reduce entry of lipoproteins intothe artery wall and, as a result of notbinding lipoproteins to the intima of theartery wall, efflux of LDL from theartery wall is maintained. Th u s, t h epathophysiological mechanism that wepropose here involves a reduction ofLDL entry into the artery wall and facili-tation of LDL efflux from the artery wall.

Previous metabolic studies have sug-gested that PPARs may have anti-atherogenic effects attributed toimprovements in serum lipids.39 In thisstudy, mice treated with the specificPPAR-a ligand exhibited a significantincrease in serum lipoproteins. Thiseffect has also been seen by other inves-tigators.38 Hypercholesterolemia is amajor risk factor leading to the progres-sion of atherosclerosis. Animals withhypercholesterolemia, resulting fromeither a high cholesterol diet20,40-43 orfrom inherited defects in lipid metabo-lism,20,44-46 develop atheroscleroticplaques in the vascular wall.47,48 Despitethe hyperlipidemia and absence of ananti-atherogenic effect observed in thePPAR-a agonist-treated animals in ourstudy, arterial inflammation, endotheliallayer permeability and LDL accumula-tion were all decreased. While otherinvestigators have been able to demon-strate a reduction in atheroma forma-tion using PPAR-a agonists,38,49,50 theincrease in advanced and complexlesions attributed to hyperlipidemia,increased age and Ang II treatment mayhave been too severe in our study to

induce a reduction in atherosclerosiswith PPAR-a agonist treatment in ourexperimental animal model. Also, westudied carotid athersclerosis, whereasprevious studies examined coronarysinus and aortic atherosclerosis. Recentstudies have demonstrated the existenceof regional differences in atheroscleroticlesion susceptibility.38,51-53 It is possiblethat the atherosclerotic lesions meas-ured in the carotid arteries in this studymay not have been as responsive to thein vivo PPAR-a agonist treatment ascompared to other aortic regions.

The decline in liver functionobserved with fenofibrate treatment alsomay have played a role in the increasedplasma levels of pro-atherogeniclipoproteins. These findings may be spe-cific to this animal model of disease.Species differences in response to perox-isome proliferators may be attributed todifferences both in quantity of hepaticPPAR-a and to the functionality andquality of the pathway components, suchas the gene promoters that regulate per-oxisome proliferator-mediated genetranscription. Further studies are neededto determine the paradoxical elevationof serum lipids in this mouse modelPPAR-a agonists.

In conclusion, despite severe hyper-lipidemia this study provides evidencethat a PPAR-a agonist can attenuatepro-inflammatory mediators induced byAng II in the aorta by decreasing tran-scription factors, chemokines andendothelial cell adhesion moleculesassociated with the development of ath-erosclerosis. Functionally, this study hasalso demonstrated that a PPAR-a ago-nist can attenuate the rate of arterialLDL accumulation and endothelial layerpermeability induced by Ang II. Furtherstudies building on these new datashould provide important insights intothe overall benefits of activating PPAR-a clinically for the treatment and pre-vention of vascular disease.

Tham-vol5no1 3/19/05 10:59 AM


ACKNOWLEDGEMENTSThis work was supported by grants fromthe Biotechnology Strategic Targets forAlliances in Research, the Richard A.and Nora Eccles Harrison EndowedChair in Diabetes Research, theAmerican Federation for AgingResearch and NHLBI HL55667. We aregrateful to Jefferson Davis for his excel-lent technical assistance.

REFERENCES1. Gulick T, Cresci S, Caira T, Moore DD, Kelly

DP. The peroxisome proliferator-activatedreceptor regulates mitochondrial fatty acidoxidative enzyme gene expression. Proc NatlAcad Sci U S A. 1994;91:11012-11016.

2. Keller H, Dreyer C, Medin J, Mahfoudi A,Ozato K, Wahli W. Fatty acids and retinoidscontrol lipid metabolism through activationof peroxisome proliferator-activated receptor-retinoid X receptor heterodimers. Proc NatlAcad Sci U S A. 1993;90:2160-2164.

3. Frick MH, Elo O, Haapa K, et al. HelsinkiHeart Study: primary-prevention trial withgemfibrozil in middle-aged men with dyslipi-demia. Safety of treatment, changes in riskfactors, and incidence of coronary heart dis-ease. N Engl J Med. 1987;317;1237-1245.

4. Rubins HB, Robins SJ, Collins D, et al.Gemfibrozil for the secondary prevention ofcoronary heart disease in men with low levelsof high-density lipoprotein cholesterol.Veterans Affairs High-Density LipoproteinCholesterol Intervention Trial Study Group.N Engl J Med. 341:1999;410-418.

5. Jackson SM, Parhami F, Xi XP, Berliner JA,Hsueh WA, Law RE, Demer LL. Peroxisomeproliferator-activated receptor activators tar-get human endothelial cells to inhibit leuko-cyte-endothelial cell interaction. ArteriosclThromb Vascular Biol. 1999;19;2094-2104.

6. Marx N, Sukhova GK, Collins T, Libby P,Plutzky J. PPARalpha activators inhibitcytokine-induced vascular cell adhesion mol-ecule-1 expression in human endothelial cells.Circulation. 1999;99:3125-3131.

7. Shu H, Wong B, Zhou G, et al. Activation ofPPARalpha or gamma reduces secretion ofmatrix metalloproteinase 9 but not inter-leukin 8 from human monocytic THP-1 cells.Biochem Biophys Res Commun.2000;267:345-349.

8. Neve BP, Corseaux D, Chinetti G, et al.PPARalpha agonists inhibit tissue factorexpression in human monocytes andmacrophages. Circulation. 2001;103:207-212.

9. Chinetti G, Gbaguidi FG, Griglio S, et al.CLA-1/SR-BI is expressed in atheroscleroticlesion macrophages and regulated by activa-tors of peroxisome proliferator-activatedreceptors. Circulation. 2000;101:2411-2417.

10. Devchand PR, Keller H, Peters JM, VazquezM, Gonzalez FJ, Wahli W. The PPARalpha-leukotriene B4 pathway to inflammation con-trol [comments]. Nature. 1996;384:39-43.

11. Delerive P, De Bosscher K, Besnard S, et al.Peroxisome proliferator-activated receptoralpha negatively regulates the vascularinflammatory gene response by negativecross-talk with transcription factors NF-kappaB and AP-1. J Biol Chem.1999;274:32048-32054.

12. Staels B, Koenig W, Habib A, et al. Activationof human aortic smooth-muscle cells is inhib-ited by PPARalpha but not by PPARgammaactivators. Nature. 1998;393:790-793.

13. Chinetti G, Lestavel S, Bocher V, et al.PPAR-alpha and PPAR-gamma activatorsinduce cholesterol removal from humanmacrophage foam cells through stimulationof the ABCA1 pathway [comment in: NatMed. 2001;7(1):23-24.]. Nature Medicine.2001;7:53-58.

14. Tham DM, Martin-McNulty B, Wang YX, etal. Angiotensin II is associated with activationof NF-kappaB-mediated genes and downreg-ulation of PPARs. Physiol Genomics.2002;11:21-30.

15. Daugherty A, Manning MW, Cassis LA.Angiotensin II promotes atheroscleroticlesions and aneurysms in apolipoprotein E-deficient mice. J Clin Invest. 2000;105:1605-1612.

16. Weiss D, Kools JJ, Taylor WR. Angiotensin II-induced hypertension accelerates the devel-opment of atherosclerosis in apoE-deficientmice. Circulation. 2001;103:448-454.

17. Tham DM, Martin-McNulty B, Wang YX, etal. Angiotensin II injures the arterial wallcausing increased aortic stiffening inapolipoprotein E-deficient mice. Am JPhysiol Regul Integr Comp Physiol.2002;283:R1442-R1449.

18. Tse J, Martin-McNaulty B, Halks-Miller M, etal. Accelerated atherosclerosis and prematurecalcified cartilaginous metaplasia in the aortaof diabetic male Apo E knockout mice can beprevented by chronic treatment with 17 beta-estradiol. Atherosclerosis. 1999;144:303-313.

19. Wang YX, Martin-McNulty B, Freay AD, etal. Angiotensin II increases urokinase-typeplasminogen activator expression and inducesaneurysm in the abdominal aorta ofapolipoprotein E-deficient mice. Am J Pathol.2001;159:1455-1464.

Tham-vol5no1 3/19/05 10:59 AM


20. Wang YX, Martin-McNulty B, Huw LY, et al.Anti-atherosclerotic effect of simvastatindepends on the presence of apolipoprotein E.Atherosclerosis. 2002;162:23-31.

21. Pitas RE, Innerarity TL, Weinstein JN,Mahley RW. Acetoacetylated lipoproteinsused to distinguish fibroblasts frommacrophages in vitro by fluorescencemicroscopy. Arteriosclerosis. 1981;1:177-185.

22. Mullick AE, Walsh BA, Reiser KM, RutledgeJC, Chronic estradiol treatment attenuatesstiffening, glycoxidation, and permeability inrat carotid arteries. Am J Physiol Heart CircPhysiol. 2001;281:H2204-H2210.

23. Walsh BA, Mullick AE, Banka CE, RutledgeJC. 17beta-estradiol acts separately on theLDL particle and artery wall to reduce LDLaccumulation. J Lipid Res. 2000;41:134-141.

24. Rutledge JC, Mullick AE, Gardner G,Goldberg IJ. Direct visualization of lipid dep-osition and reverse lipid transport in a per-fused artery: roles of VLDL and HDL.[comment in: Circ Res. 2000;86(7):715-716].Circ Res. 2000;86:768-773.

25. Pineda Torra I, Jamshidi Y, Flavell DM,Fruchart JC, Staels B. Characterization of thehuman PPARalpha promoter: identificationof a functional nuclear receptor response ele-ment. Mol Endocrinol. 2002;16:1013-1028.

26. Barnes PJ. Nuclear factor-kappa B. Int JBiochem Cell Biol. 1997;29:867-870.

27. Read MA, Whitley MZ, Williams AJ, CollinsT. NF-kappa B and I kappa B alpha: aninducible regulatory system in endothelialactivation. J Exp Med. 1994;179:503-512.

28. Ledebur HC, Parks TP. Transcriptional regu-lation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in humanendothelial cells. Essential roles of a variantNF-kappa B site and p65 homodimers. J BiolChem. 1995;270:933-943.

29. Shu HB, Agranoff AB, Nabel EG, et al.Differential regulation of vascular cell adhe-sion molecule 1 gene expression by specificNF-kappa B subunits in endothelial andepithelial cells. Mol Cell Biol. 1993;13:6283-6289.

30. Newton R, Kuitert LM, Bergmann M,Adcock IM, Barnes PJ. Evidence for involve-ment of NF-kappaB in the transcriptionalcontrol of COX-2 gene expression by IL-1beta. Biochem Biophys Res Commun.1997;237:28-32.

31. Lin YL,Lin JK. (-)-Epigallocatechin-3-gallateblocks the induction of nitric oxide synthaseby down-regulating lipopolysaccharide-induced activity of transcription factornuclear factor-kappaB. Mol Pharmacol.1997;52:465-472.

32. Barnes PJ, Karin M. Nuclear factor-kappaB: apivotal transcription factor in chronic inflam-matory diseases. N Engl J Med.1997;336:1066-1071.

33. Goetze S, Kintscher U, Kaneshiro K, et al.TNFalpha induces expression of transcriptionfactors c-fos, Egr-1, and Ets-1 in vascularlesions through extracellular signal-regulatedkinases 1/2. Atherosclerosis. 2001;159:93-101.

34. Khachigian LM, Collins T. Inducible expres-sion of Egr-1-dependent genes. A paradigmof transcriptional activation in vascularendothelium. Circ Res. 1997;81:457-461.

35. Khachigian LM, Lindner V, Williams AJ,Collins T. Egr-1-induced endothelial geneexpression: a common theme in vascularinjury. Science. 1996;271:1427-1431.

36. Harrington MA, Edenberg HJ, Saxman S,Pedigo LM, Daub R, Broxmeyer HE. Cloningand characterization of the murine promoterfor the colony-stimulating factor-1-encodinggene. Gene. 1991;102:165-170.

37. Maltzman JS, Carmen JA, Monroe JG.Transcriptional regulation of the Icam-1 genein antigen receptor- and phorbol ester-stimu-lated B lymphocytes: role for transcriptionfactor EGR1. J Exp Med. 1996;183:1747-1759.

38. Duez H, Chao YS, Hernandez M, et al.Reduction of atherosclerosis by the peroxi-some proliferator-activated receptor alphaagonist fenofibrate in mice. J Biol Chem.2002;277:48051-48057.

39. Brown PJ, Winegar DA, Plunket KD, et al. Aureido-thioisobutyric acid (GW9578) is a sub-type-selective PPARalpha agonist with potentlipid-lowering activity. J Med Chem.1999;42:3785-3788.

40. Nascimento CA, Kauser K, Rubanyi GM.Effect of 17beta-estradiol in hypercholes-terolemic rabbits with severe endothelial dys-function. Am J Physiol.1999;276:H1788-H1794.

41. Masuda J, Ross R. Atherogenesis during lowlevel hypercholesterolemia in the nonhumanprimate. II. Fatty streak conversion to fibrousplaque. Arteriosclerosis. 1990;10:178-187.

42. Masuda J, Ross R. Atherogenesis during lowlevel hypercholesterolemia in the nonhumanprimate. I. Fatty streak formation.Arteriosclerosis. 1990;10:164-177.

43. van Ree JH, van den Broek WJ, DahlmansVE, et al. Diet-induced hypercholesterolemiaand atherosclerosis in heterozygousapolipoprotein E-deficient mice.Atherosclerosis. 1994;111:25-37.

44. Wang YX, Halks-Miller M, Vergona R, et al.Increased aortic stiffness assessed by pulsewave velocity in apolipoprotein E-deficient

Tham-vol5no1 3/19/05 10:59 AM


mice. Am J Physiol Heart Circ Physiol.2000;278:H428-H434.

45. Rosenfeld ME, Tsukada T, Chait A, BiermanEL, Gown AM, Ross R. Fatty streak expan-sion and maturation in Watanabe HeritableHyperlipemic and comparably hypercholes-terolemic fat-fed rabbits. Arteriosclerosis.1987;7:24-34.

46. Rosenfeld ME, Tsukada T, Gown AM, RossR. Fatty streak initiation in WatanabeHeritable Hyperlipemic and comparablyhypercholesterolemic fat-fed rabbits.Arteriosclerosis. 1987;7:9-23.

47. Steinberg D, Parthasarathy S, Carew TE,Khoo JC, Witztum JL. Beyond cholesterol.Modifications of low-density lipoprotein thatincrease its atherogenicity [comments]. NEngl J Med. 1989;320:915-924.

48. Napoli C, D’Armiento FP, Mancini FP,Postiglione A, Witztum JL, Palumbo G,Palinski W. Fatty streak formation occurs inhuman fetal aortas and is greatly enhancedby maternal hypercholesterolemia. Intimalaccumulation of low density lipoprotein andits oxidation precede monocyte recruitmentinto early atherosclerotic lesions. J ClinInvest. 1997;100:2680-2690.

49. Li AC, Brown KK, Silvestre MJ, Willson TM,Palinski W, Glass CK. Peroxisome prolifera-tor-activated receptor gamma ligands inhibitdevelopment of atherosclerosis in LDLreceptor-deficient mice. J Clin Invest.2000;106:523-531.

50. Tordjman K, Bernal-Mizrachi C, Zemany L,et al. PPARalpha deficiency reduces insulinresistance and atherosclerosis in apoE-nullmice. J Clin Invest. 2001;107:1025-1034.

51. Barry-Lane PA, Patterson C, van der MerweM, et al. p47phox is required for atheroscle-rotic lesion progression in ApoE(-/-) mice. JClin Invest. 2001;108:1513-1522.

52. Nakashima Y, Plump AS, Raines EW,Breslow JL, Ross R. ApoE-deficient micedevelop lesions of all phases of atherosclero-sis throughout the arterial tree. ArteriosclerThromb. 1994;14:133-140.

53. Reddick RL, Zhang SH, Maeda N.Atherosclerosis in mice lacking apo E.Evaluation of lesional development and pro-gression. Arterioscler Thromb. 1994;14:141-147.

Tham-vol5no1 3/19/05 10:59 AM

tham-vol5no1 3/19/05 10:59 am page 1 angiotensin ii ...tors (ppars) are ligand-dependent nuclear...

Documents