testing the role of an arf gtpase-activating protein …...students in our lab. thanks to both of...
TRANSCRIPT
Testing the Role of an Arf GTPase-activating
Protein dASAP in Epithelial Cell Polarity
in the Drosophila Embryo
by
Wei Shao
A thesis submitted in conformity with the requirements
for the Degree of Master of Science
Graduate Department of Cell and Systems Biology
University of Toronto
©Copyright by Wei Shao 2010.
ii
Thesis title: Testing the role of an Arf GTPase-activating protein dASAP in
epithelial cell polarity in the Drosophila embryo
Master of Science
2010
Wei Shao
Graduate Department of Cell and Systems Biology
University of Toronto
ABSTRACT
Baz/PAR3 is a key regulator of epithelial cell polarity (ECP). To identify
proteins functioning with Baz, I completed a baz genetic interaction screen by
localizing 15 GFP-tagged candidates. Then I tested the role of a top candidate,
dASAP (Drosophila Arf GTPase-activating protein with SH3 domain, Ankyrin
repeat and PH domain), in Drosophila ECP. To determine whether dASAP
might interact with polarity players, I defined the localization of dASAP
throughout embryogenesis with GFP-tagged proteins and an anti-dASAP
antibody. To study how loss of dASAP function affects ECP, I generated a
deletion allele by imprecise P-element excision. To evaluate how each of the
six domains of dASAP contributes to its localization and functions, I generated
constructs deleting each domain. I found associations between dASAP, actin
and the apical domain. The six domains may act redundantly to localize
dASAP, although interactions between domains may affect the degree of
membrane association.
iii
ACKNOWLEDGEMENTS
A part of the results presented in this thesis was previously published in:
Shao, W., Wu, J., Chen, J., Lee, D.M., Tishkina, A., and Harris, T.J.C. (2010).
A modifier screen for Bazooka/PAR-3 interacting genes in the Drosophila
embryo epithelium. Public Library of Science One. 5: e9938.
Figure 2 and 4 were adopted from this publication.
I would like to thank my supervisor Professor Tony Harris. As an open,
supportive and inspiring mentor, Tony guided me through the tough yet fruitful
trip of scientific pursuit. In particular, Tony has introduced me to an artistic and
exciting world of cells. More importantly, I have learned so much else from
Tony, from as simple as to how to survive in science as a graduate student, to
as complicated as to how to thrive in science as a future scientist. I am also
very grateful about Tony’s strong recommendation that promoted me for
advanced-level studies in the United States. I would also like to thank my
supervisory committee members Professor Andrew Wilde and Professor
Dorothea Godt for sharing insightful suggestions that helped direct my
research at critical moments and for helping me get into advanced-level
studies in the United States as well. I also want to thank Professor Andrew
Wilde as a graduate course instructor together with Professor Julie Brill. I
would like to thank Professor Ashley Bruce as my external examiner and as a
graduate course instructor together with Professor Rudolf Winklbauer. I’d also
like to thank Professor Gabrielle Boulianne for sharing the anti-Amphiphysin
antibody.
I would like to give special thanks to all my labmates for everything they
have done to help me. I often recall the time when Hoon and I were working
iv
really hard to do live imaging in my first year. I hope what I have taught to and
learned from Hoon will remain a precious treasure between us. Partnership
and friendship will be the most durable when facing tough moments. Hoon,
thank you very much for becoming my first “student” in this lab. I wish you
realize your dream in both becoming a physician-scientist and a good Jazz
drummer. I’d like to thank Andrew and Daryl, as “role models” of graduate
students in our lab. Thanks to both of you guys for helping me in my
experiments while showing me how to enjoy life as a graduate student.
Andrew, thank you for sharing your interesting outdoor experiences in various
places. Daryl, thank you very much for your joyful sense of humor and advice
about teaching. I also receive a lot of support from Mel for both science and
non-science. Mel, thank you very much for being willing to hear me talk in the
lab and showing me some interesting facets of local life. I also want to thank
CQ for his generous technical support that helped me carry out what I want to
do. I would like to thank every undergraduate in our lab for doing all the
routine maintenance and bringing some fresh air to the lab. Thank you,
Francisco, Jenny, Ted, and Yani (with a special thanks to Ted for the
conservations we’ve had so far)! Francisco, I hope I pass my stuff clearly to
you. Thank you for becoming my last “student” in this lab. Believe me, ASAP
rocks! Go ASAP! Last but not least, I would like to thank the people on the
sixth floor who helped me before, including Dave, Felix, Katie, Melina, Michael,
Ridhdhi, and Sandy.
Outside the lab, I would like to thank my housemates Jiayi and
Nathaniel for becoming my friends and kindly hosting me in each of their
homes in Canada and the United States. I am very glad that Nathaniel talked
v
to me so many times about almost everything with the by-product of my better
English.
Finally, I would like to give my biggest ever thanks to my parents for
their endless support. Please allow me to express my feeling using an English
translation from a Chinese poem:
A Song of Wanderer
Stretching a thread in her hand, the loving mother is making warm
clothes for her departing son. Carefully she sews the clothes stitch by stitch,
fearing that he will not be back for long. How can the little grateful grass
repay the nurture from the sunshine of spring?
vi
TABLE OF CONTENTS
ABSTRACT ...................................................................................................... ii
ACKNOWLEDGEMENTS ............................................................................... iii
A part of the results presented in this thesis was previously published in: .. iii
TABLE OF CONTENTS .................................................................................. vi
LIST OF TABLES ............................................................................................ xi
LIST OF FIGURES ........................................................................................ xii
LIST OF APPENDICES ................................................................................. xv
LIST OF ABBREVIATIONS .......................................................................... xvi
INTRODUCTION ............................................................................................. 1
1. Epithelia .................................................................................................1
2. Epithelial cell polarity ..............................................................................2
2.1 Introduction to epithelial cell polarity. ................................................... 2
2.2 Establishment and maintenance of epithelial cell polarity.................... 2
3. Adherens junctions.................................................................................6
4. Roles of membrane trafficking in epithelial cell polarity ..........................7
4.1 General trafficking routes in polarized epithelial cells. ......................... 7
4.2 Membrane trafficking and polarity proteins. ......................................... 8
5. Actin cytoskeleton and epithelial cell polarity .........................................9
5.1 Actin cytoskeleton. .............................................................................. 9
5.2 The actin cytoskeleton and membrane trafficking. ......................... 10
5.3 General functions of the actin cytoskeleton in epithelia. ................ 12
6. Bazooka and epithelial cell polarity ...................................................... 12
6.1 Baz: a key regulator of epithelial cell polarity. .................................... 12
vii
6.2 Identification of baz-interacting genes in Drosophila embryonic
epidermis ................................................................................................. 16
7. ADP Ribosylation Factors .................................................................... 19
7.1 The structure of ADP ribosylation factors. ......................................... 19
7.2 Classical Functions of Arf GTPases. ............................................. 19
7.3 Regulators of Arf GTPase Activity: Arf Guanine Nucleotide
Exchange Factors and Arf GTPase-activating Proteins. ......................... 21
7.4 Arf GTPases/ Arf regulators and epithelial cell polarity. .................... 25
8. ASAP (Arf GTPase-activating protein with SH3 domain, Ankyrin Repeat
and PH domain) .......................................................................................... 26
9. Drosophila embryonic epithelia as a model to study the role of dASAP
in epithelial cell polarity ............................................................................... 31
10. Objectives ............................................................................................ 33
MATERIALS AND METHODS ....................................................................... 35
1. Drosophila stocks ................................................................................. 35
2. cDNA clones and plasmids .................................................................. 37
3. Antibodies and stains ........................................................................... 41
4. Gene cloning and transgenics .............................................................. 42
5. Antibody production ............................................................................. 43
6. Embryo staining and treatment ............................................................ 43
7. Image acquisition and manipulation ..................................................... 45
8. Generation of new mutant alleles of dASAP ........................................ 45
viii
RESULTS ...................................................................................................... 48
1. Subcellular localizations of candidate proteins identified from the
genetic screen ............................................................................................ 48
2. Subcellular localization of dASAP with GFP tagged protein throughout
embryonic development .............................................................................. 53
2.1 GFP::dASAP colocalizes with F-actin during cellularization. ......... 53
2.2 GFP::dASAP gradually accumulates apically from cellularization to
gastrulation. ............................................................................................. 53
2.3 GFP::dASAP colocalizes with F-actin at apical domain during dorsal
closure. .................................................................................................... 58
2.4 GFP::dASAP generally overlaps with Crumbs and DE-cadherin at
the apical domain during dorsal closure. ................................................. 58
2.5 GFP::dASAP colocalizes with ectopic F-actin after cytochalasin D
treatment at gastrulation. ......................................................................... 63
2.6 GFP::dASAP and dASAP::GFP share similar localizations during
embryogenesis. ....................................................................................... 66
3. Probing the subcellular localization of dASAP with anti-dASAP
antibodies ................................................................................................... 69
3.1 Production of anti-dASAP antibody. .............................................. 69
3.2 The immunofluorescence of anti-dASAP antibody colocalizes with
Bazooka and DE-cadherin during embryogenesis. ................................. 74
3.3 Overexpression of GFP::dASAP alters the immunofluorescence
pattern of anti-dASAP antibody. .............................................................. 75
3.4 Heat fixation changes the immunofluorescence pattern of anti-
dASAP antibody at cellularization. ........................................................... 80
ix
3.5 The immunofluorescence of anti-dASAP antibody is not decreased
in zygotic dASAP deletion mutant embryos at dorsal closure.................. 83
3.6 The immunofluorescence of anti-dASAP antibody is lost in zygotic
baz mutant embryos at dorsal closure. .................................................... 84
4. Generation of a new mutant allele of dASAP ....................................... 89
5. Subcellular localization of deletion constructs of dASAP ..................... 94
5.1 All six deletion constructs have similar localizatons to the full length
GFP::dASAP at cellularization and dorsal closure. .................................. 94
5.2 GFP::dASAPΔGAP mislocalizes during early embryogenesis ...... 97
DISCUSSION AND FUTURE DIRECTIONS ............................................... 101
1. Our screen suggests connections between membrane trafficking and
epithelial cell polarity ................................................................................ 101
2. Polarized localizations of Arf GTPases and their regulators suggest a
general involvement in epithelial cell polarity in Drosophila ...................... 101
3. Interaction with the actin cytoskeleton may be important for the
localization and function of dASAP. .......................................................... 106
4. A loss of function approach to analyze the role of dASAP in epithelial
cell polarity. ............................................................................................... 107
5. dASAP’s domains may be redundant in localizing the protein. .......... 108
6. The mislocalization of GFP::dASAPΔGAP at early embryogenesis
suggests a role for the GAP domain in regulating plasma membrane
association ................................................................................................ 109
7. Solving the discrepancy between GFP-tagged dASAP and the
immunofluorescence of the anti-dASAP antibody ..................................... 114
x
8. Summary ............................................................................................ 114
REFERENCES ............................................................................................ 116
APPENDIX ................................................................................................... 133
xi
LIST OF TABLES
Table I. Drosophila stocks and alleles ............................................................ 35
Table II. cDNA clones used for gene cloning ................................................. 37
Table III. Vectors/Constructs .......................................................................... 38
Table IV. Primary antibodies and stains ......................................................... 41
xii
LIST OF FIGURES
Figure 1. Schematics of epithelial development in Drosophila embryogenesis ..
......................................................................................................................... 4
Figure 2. Domain architecture of Baz and its interaction partners in Drosophila.
....................................................................................................................... 14
Figure 3. baz genetic modifier screen for novel baz-interacting genes in
Drosophila embryonic epithelia. ..................................................................... 18
Figure 4. The Arf GTPase cycle. .................................................................... 23
Figure 5. Domain architectures and alignment of dASAP and human ASAP1,
and interaction partners of human ASAP1. .................................................... 29
Figure 6. Subcellular localizations of candidate proteins encoded by the baz-
interacting genes. ........................................................................................... 52
Figure 7. GFP::dASAP colocalizes with F-actin during cellularization. ........... 55
Figure 8. GFP::dASAP is gradually enriched at the apical domain from
cellularization to gastrulation. ......................................................................... 57
Figure 9. GFP::dASAP colocalizes with F-actin at apical domain during dorsal
closure. .......................................................................................................... 60
Figure 10. GFP::dASAP generally overlaps with Crumbs and DE-cadherin
during dorsal closure. ..................................................................................... 62
Figure 11. GFP::dASAP colocalizes with ectopic cytoplasmic F-actin puncta
after Cytochalasin D treatment of embryos at early gastrulation. ................... 65
Figure 12. dASAP::GFP has similar subcellular localizations as GFP::dASAP
at both early and late embryogenesis. ........................................................... 68
Figure 13. Purification of GST-PH fusion protein for generation of anti-dASAP
antibodies. ..................................................................................................... 71
xiii
Figure 14. Comparison of immunofluorescence signals from different anti-
dASAP antibodies at both early and late embryogenesis. ............................. 73
Figure 15. The immunofluorescence of dASAP colocalizes with Baz and DE-
cad at both early and late embryogenesis. .................................................... 77
Figure 16. Overexpression of GFP::dASAP alters the subcellular localization
of the immunofluorescence of anti-dASAP antibody at early embryogenesis.
....................................................................................................................... 79
Figure 17. Heat fixation alters the subcellular localization of the
immunofluorescence of anti-dASAP antibody at cellularization. .................... 82
Figure 18. Comparison of the immunofluorescence of anti-dASAP antibody
between wild type embryos and zygotic dASAP deficiency embryos at dorsal
closure. .......................................................................................................... 86
Figure 19. The immunofluorescence of anti-dASAP antibody is absent in
zygotic baz mutant embryos at dorsal closure. .............................................. 88
Figure 20. Using imprecise P-element excision to screen for new dASAP
mutant alleles. ................................................................................................ 91
Figure 21. dasap908WB has a 1.75 kb downstream deletion including the start
codon. ............................................................................................................ 93
Figure 22. Subcellular localization of GFP-tagged dASAP deletion protein at
both early and late embryogenesis. ............................................................... 96
Figure 23. GFP::dASAPΔGAP mislocalizes to special cellular structures
throughout early embryogenesis. ................................................................. 100
Figure 24. The model of the role of dASAP in endocytosis at the apical
domain of epithelial cells. ............................................................................. 104
xiv
Figure 25. Models of the role of the GAP domain in the plasma membrane
association of dASAP. .................................................................................. 112
xv
LIST OF APPENDICES
Appendix I. List of primers ........................................................................... 133
Appendix II. Injection scheme of the immuogen GST-PH fusion protein ...... 137
Appendix III: My published article titled “A modifier screen for Bazooka/PAR-3
interacting genes in the Drosophila embryo epithelium” .............................. 138
xvi
LIST OF ABBREVIATIONS
a.a.: Amino acid residue
ABP1: Actin-binding protein 1
ACAP: Arf GTPase-activating protein with coiled-coil, Ankyrin repeat, and PH
domain
ADAP: Arf GTPase-activating protein with dual PH domain
AGAP: Arf GTPase-activating protein with GTPase domain, Ankyrin repeat,
and PH domain
AGFG: Arf GTPase-activating protein with FG repeats
AJ: Adherens junction
AKR: Ankyrin repeat
Alt: Aluminum tube
AP: Adaptor protein
APC: Adenomatous polyposis coli
aPKC: atypical Protein Kinase C
ARAP: Arf GTPase-activating protein with Rho GAP domain, Ankyrin repeat,
and PH domain
ARE: Apical recycling endosome
Arf: ADP ribosylation factor
Arm: Armadillo
ARNO: Arf nucleotide-binding site opener
Arp2/3: Actin-related protein 2/3
ASAP: Arf GTPase-activating protein with SH3 domain, Ankyrin repeat, and
PH domain
Asp: Abnormal spindle
xvii
BAR: Bin/Amphiphysin/Rvs domain
bal: Balancer chromosome
Baz: Bazooka
BDP: BAR domain-containing protein
BIG: Brefeldin A-inhibited Guanine nucleotide exchange factor
bp: Base pair
C-terminus: Carboxyl terminus
CD2AP: CD2-associated protein
CFA: Complete Freund’s Antigen
CIN85: Cbl interaction protein of 85 kDa
CIP4: Cdc42 interaction protein 4
COPI: Coat protein I
Cora: Coracle
CR: Conserved region
Crb: Crumbs
CrkL: Crk-like protein
Cul5: Cullin-5
DE-cad: Drosophila epithelial cadherin
Df: Deficiency
Dlg: Discs large
DMSO: Dimethyl sulfoxide
ECM: Extracellular matrix
ECP: Epithelial cell polarity
Ed: Echinoid
EGTA: Ethylene glycol tetraacetic acid
xviii
ER: Endoplasmic reticulum
F-actin: Filamentous actin
FAK: Focal adhesion kinase
FBXO8: Arf Guanine nucleotide exchange factor with F-box 8
Fj: Four-jointed
FP: Forward primer
FRMD4A: FERM domain containing 4A
G-actin: Globular actin
GAP: GTPase-activating protein domain
GBF: Golgi-specific Brefeldin A-resistance factor
GDP: Guanosine diphosphate
GEF: Guanine nucleotide exchange factor
GFP: Green fluorescent protein
GFP::ΔGAP: GFP::dASAPΔGAP
GGA: Golgi-localizing protein
GIT: G protein receptor kinase interacting Arf GTPase-activating protein
GP: Guinea pig
GST: Glutathione S-transferase
GTP: Guanosine 5’-triphosphate
hk: Hook
IFA: Incomplete Freund’s Antigen
HIP: Huntingtin interacting protein
IQSEC: Arf Guanine nucleotide exchange factor with IQ motif and Sec7
domain
kb: Kilobase pair
xix
kDa: Kilodalton
Lgl: Lethal giant larvae
mCherry: Monomeric Cherry
MDCK cell: Madin-Darby Canine Kidney cell
NPF: Nucleation promotion factor
Nrx-IV: Neurexin-IV
N-terminus: Amino terminus
N-WASP: Neural Wiskott-Aldrich syndrome protein
OD: Oligomerization domain
PA: phosphatidic acid
PAR: Partition defective
Pals1: Protein associated with Lin Seven 1
Patj: Pals1-associated tight junction
PCR: Polymerase chain reaction
PDZ: PSD95/Dlg/ZO-1 domain
PH: Pleckstrin homology domain
PIPs: Phospholipids
PIP2: Phosphatidylinositol (4,5)-bisphosphate
PIP3: Phosphatidylinositol (3,4,5)-trisphosphate
PSD: Arf Guanine nucleotide exchange factor with PH and Sec 7 domains
PTEN: Phosphatase and tensin homologue deleted on chromosome 10
Pyk2: Proline-rich tyrosine kinase 2
Rab11FIP3: Rab11 family interaction protein 3
Rb: Rabbit
Roc2: Regulator of cullins-2
xx
RP: Reverse primer
SAJ: Spot adherens junction
SCAR: Suppressor of cAMP receptor
Scrib: Scribble
Sds22: The suppressor of the dis2 mutant
SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis
Sep5: Septin-5
SH3: Src homology 3 domain
SMAP: Small Arf GTPase-activating protein
Src: Sarcoma kinase
µg: Microgram
µl: Microliter
µm: Micrometer
UniP: Universal primer
UTR: Untranslated region
WASP: Wiskott-Aldrich syndrome protein
WAVE: WASP-family verprolin homology protein.
WT: Wild type
1
INTRODUCTION
1. Epithelia
Epithelia are composed of adherent cell layers that separate body
compartments. To perform particular functions, epithelial cells accommodate
different morphologies, including cuboidal, columnar, and squamous cell shapes.
Some epithelia are monolayers while others are stratified.
Epithelia serve critical functions in development and adult physiology. In
development, the morphogenetic movement of epithelial cells is important for
gastrulation and subsequent organogenesis, such as cell intercalation in
convergent extension and apical constriction during tissue invagination. In adult
organisms, epithelia protect underlying tissues from damage. Epithelia also
separate two biochemically distinct environments from each other in order to
control the substance exchange between two sides. For instance, epithelial cells
along the renal tubule and the collecting duct of kidney can excrete waste and
reabsorb useful materials. Epithelial cells in glands secrete hormones and
enzymes into the lumen or circulatory system. Simple squamous epithelia lining
the lung facilitate gas diffusion. Specialized epithelial cells sense external stimuli
and send signals to the connecting nerve (Alberts et al., 2008).
The importance of epithelia is also highlighted in pathogenesis. Most types
of cancer arise from abnormal epithelia. At the initiation of metastasis, epithelial
cells lose intercellular junctions and increase cell motility, and eventually acquire
metastatic properties of cancer cells. Malfunction of epithelia also results in
physiological diseases. In the genetic disease of cystic fibrosis, epithelial cells
2
have impaired transport of water and salt, leading to accumulation of mucus and
subsequent blockage of airways and glands (Alberts et al., 2008).
2. Epithelial cell polarity
2.1 Introduction to epithelial cell polarity.
As discussed, epithelial cells usually face different biological environments on
each side. Consistent with this, epithelial cells are polarized with distinct apical
and basolateral plasma membrane domains separated by adherens junctions
(AJs) (Figure 1B). The apical domain faces the lumen or external environment
while the basolateral domain contacts extracellular matrix (ECM). The apical and
basolateral domains are both structurally different (e.g. the apical domain usually
has microvilli or cilia for specific functions), and biochemically distinct with
enrichment of different proteins and membrane lipids. This is essential for
maintaining each domain as functionally different. Such epithelial apico-basal
polarity is critical for guiding normal embryonic development and for adult
functions (Alberts et al., 2008).
2.2 Establishment and maintenance of epithelial cell polarity.
Since epithelial cell polarity (ECP) is essential for the structure and functions
of epithelia, it is important to investigate how ECP is established and maintained.
In mammalian cell culture, the establishment of ECP is initiated by cell-cell
adhesion and cell-ECM adhesion (Yeaman et al., 1999). In particular, individual
cells migrate towards each other and initiate the contact by cell protrusions with
3
Figure 1. Schematics of epithelial development in Drosophila
embryogenesis.
Schematics of epithelial development at cellularization (A) and following epithelial
cell formation (B) are shown. Focal planes at various positions with the
corresponding names are shown. Images at these focal planes are later shown in
the results. Adherens junctions labeled by grey box. Abbreviation: AJ (Adherens
junction), SAJ (Spot adherens junction).
4
Figure 1. Schematics of epithelial development in Drosophila embryogenesis
5
the subsequent cadherin-catenin (AJ components) clustering. Then the cadherin-
catenin clusters promote actin protrusions to expand AJs. Afterwards, AJs
facilitate the recruitment of α-catenin and PAR-3 (Partition defective 3) to
regulate AJ signaling and remodel the actin cytoskeleton. Eventually, it leads to
AJ maturation by the formation of contractile actin bundles underneath AJs
(Harris and Tepass, 2010). During this process, cell-cell adhesions segregate
different membrane lipids and proteins at the plasma membrane to create
asymmetry. Later on, this polarity is reinforced and maintained by polarized
membrane trafficking (Yeaman et al., 1999). However, AJs are not always at the
top of the polarity establishment hierarchy. In the Drosophila embryo,
cellularizing epithelia are formed with cell membranes already in contact. Here
Bazooka (Baz, the Drosophila PAR-3 homologue) acts upstream of adherens
junctions in establishing ECP (Harris and Peifer, 2004). Baz accumulates apically
in the absence of AJs, but not vice versa, suggesting apical accumulation of AJs
depends on Baz. Still, because the basolateral marker Discs large fails to be
removed from the apical domain in the absence of junctions (Harris and Peifer,
2004), AJs seem to be involved in establishing epithelial cell polarity to some
extent.
The elaboration and maintenance of epithelial cell polarity depends on
several key polarity protein complexes: the Crb/Pals1/Patj protein complex
defines the apical membrane, the PAR-3/Par6/aPKC protein complex functions
at the apicolateral membrane, and the Lgl/Scrib/Dlg protein complex marks the
basolateral membrane. Genetic interaction analysis reveals that the mutual
6
interactions between the three complexes maintain the identity of each domain
(Tepass et al., 2001; Tanentzapf and Tepass, 2002; Bilder et al., 2002). Recently,
a fourth polarity complex of Yurt/Cora/Nrx-IV/Na+,K+-ATPase was found to be
essential for the basolateral domain and it functions to counteract the apical Crb
protein complex (Laprise et al., 2009).
3. Adherens junctions
Adherens junctions are intercellular junctions mediated by homophilic
interactions of classic cadherins. Classic cadherins are single-pass
transmembrane proteins with multiple extracellular cadherin domains and a
cytoplasmic tail. The extracellular domain of E-cadherin (Epithelial cadherin) is
responsible for mediating the interaction of E-cadherin molecules between
neighboring cells. The cytoplasmic tail of E-cadherin binds β-catenin. β-catenin
interacts with α-catenin which can then bind to the actin cytoskeleton directly or
indirectly through actin-binding proteins. Therefore the whole cadherin-catenin
complex links AJs to the actin cytoskeleton circumferential belt underneath
(Harris and Tepass, 2010).
AJs play an essential role in epithelial biology. As mentioned, AJs serve as
a landmark to separate the apical and basolateral domains in epithelial cell
polarity. AJs are also critical for maintaining the integrity of epithelial tissues.
Loss of AJs results in dissociation and depolarization of epithelial cells in the
Drosophila embryo (Cox et al., 1996). In addition, AJs interact extensively with
the cytoskeleton inside epithelial cells. AJs remodel the actin cytoskeleton during
7
AJs assembly in mammalian epithelial cell culture (McNeill et al., 1993; Harris
and Tepass, 2010). AJs are also linked to microtubules through several adaptor
proteins (Ligon et al., 2001; Karki et al., 2002; Meng et al., 2008). Such
microtubule attachment allows the delivery of membrane proteins to organize
epithelial cell polarity (Shaw et al., 2007; Nejsum and Nelson, 2007). In
development, epithelial tissues often undergo dramatic morphogenesis which
requires remodeling of AJs (Bertet et al., 2004; Blankenship et al., 2006). AJs
need to be removed from the plasma membrane when cell-cell contacts are
being shortened. Conversely, additional AJs are required to insert into cell-cell
contacts when epithelial cells are elongating or after new contacts are made. The
changes are at least partially due to membrane trafficking of junctional
components (Harris and Tepass, 2010).
4. Roles of membrane trafficking in epithelial cell polarity
4.1 General trafficking routes in polarized epithelial cells.
Epithelial cell polarity is established and maintained so that different
membrane proteins segregate into either apical or basolateral domains. However,
it is well known that the plasma membrane is highly dynamic with constant
insertion and removal of membranes and their associated proteins (Steyer and
Almers, 2001; Grant and Donaldson, 2009). As a result, membrane trafficking
has to be fine-tuned in order to maintain the asymmetric distribution of proteins
along the plasma membrane. At least three trafficking routes have to be tightly
regulated: delivery of newly synthesized proteins, recycling of pre-existing
8
proteins, and degradation of pre-existing proteins (Rodriguez-Boulan et al., 2005;
Folsch, 2008). New membrane proteins have to be sorted at the Golgi apparatus
before delivery to either the apical or basolateral domain along the biosynthetic
trafficking pathway (Mellman and Nelson, 2008). Once pre-existing proteins are
removed from the plasma membrane, they have two destinations: being recycled
back to the plasma membrane or being degraded in the lysosome, depending on
whether the protein is required for subsequent cellular processes or not.
4.2 Membrane trafficking and polarity proteins.
As mentioned, membrane trafficking in polarized epithelial cells needs tight
regulation, including transport of polarity determinants and junctional proteins.
Several lines of evidence indicate extensive interactions between polarity
proteins and trafficking in epithelial cells.
PAR proteins regulate trafficking of polarity proteins. In the early Drosophila
embryo, Cdc42 and PAR protein complex (Baz-Par6-aPKC) maintain dynamic
adherens junctions by inhibiting endocytosis of Crumbs and promoting its
progression from early endosomes into multivesicular bodies in the
neuroectoderm (Harris and Tepass, 2008). Trafficking of Crb also seems to
depend on apical recycling endosomes (AREs). In Drosophila embryonic
epidermal cells, disruption of ARE marker Rab11 functions causes loss of Crb
from the apical domain before destabilization of AJs (Roeth et al., 2009). To
support this point, Crb is found to accumulate in expanded Rab11-positive
9
recycling endosomes in the Drosophila mutant embryo defective in exocytosis
(Blankenship et al., 2007).
PAR proteins also regulate trafficking of junctional proteins. In Drosophila
pupae, Cdc42, aPKC and PAR6 cooperate with actin assembly machinery
WASP (Wiskott-Aldrich Syndrome Protein) and Arp2/3 (Actin-binding protein 2/3)
to stabilize adherens junctions by promoting endocytosis and thus recycling of
DE-cadherin in the notum of the dorsal thorax (Georglou et al., 2008; Leibfried et
al., 2008).
In addition to apical polarity proteins, basolateral polarity proteins may be
involved in regulating trafficking at the basolateral membrane. In MDCK cells, Lgl
was shown to interact with syntaxin-4, a component of the basolateral exocytic
machinery (Musch et al., 2002).
5. Actin cytoskeleton and epithelial cell polarity
5.1 Actin cytoskeleton.
Filamentous actin (F-actin) is assembled from the polymerization of
monomeric globular actin (G-actin). F-actin can further form polarized structures
like bundles or dendritic networks. This process is regulated by small Rho
GTPases, including Rho1, Rac1 and Cdc42. Rho GTPases regulate the actin
nucleation process to initiate actin polymerization at the site that Rho GTPases
are activated. Active GTP-bound Rho GTPases activate actin nucleation factors
either directly or indirectly. For example, Rho1 directly binds to the nucleation
factor Formin which promotes actin polymerization to form bundle-like actin
10
structures. Rac1 and Cdc42 instead activate nucleation promotion factors (NPFs)
first, such as WASP/N-WASP, WAVE (WASP-family verprolin homology protein)
and SCAR (Suppressor of cAMP receptor), and then NPFs can bind to and
activate the nucleation factor Arp2/3 protein complex which mediates the
branching of actin cytoskeleton from pre-existing F-actin (Li and Gundersen,
2008). In addition, Rho1 can regulate the assembly of contractile actinomyosin
cytoskeleton through Rho kinase. Rho kinase can activate myosin light chain and
inhibit myosin light chain phosphatase (Riento and Ridley, 2003).
The actin cytoskeleton can associate with the plasma membrane through
actin-binding proteins that directly or indirectly bind to the plasma membrane
(Sechi and Wehland, 2000). Such cellular architecture allows the actin
cytoskeleton to model the plasma membrane and localize actin cytoskeleton-
dependent cellular processes at specific membrane domains, such as adherens
junctions or polarized membrane trafficking.
5.2 The actin cytoskeleton and membrane trafficking.
The actin cytoskeleton is essential for various types of membrane trafficking,
including endocytosis, exocytosis, endosome trafficking, and vesicular trafficking
at the Golgi apparatus (Lanzetti, 2007). The coupling of actin cytoskeleton
dynamics and membrane trafficking is usually controlled by the Rho, Rab and Arf
small GTPase families and the large GTPase dynamin.
Actin polymerization is important in both clathrin-dependent and clathrin-
independent endocytosis (Lanzetti, 2007; Romer et al., 2010). Actin
11
polymerization and its dynamics are involved in several steps of vesicle formation
during clathrin-dependent endocytosis, including coated pit formation, tubulation,
constriction, and vesicle scission (Merrifield et al., 2005; Yarar et al., 2005;
Kaksonen et al., 2006). Some endocytic proteins directly bind to the actin
cytoskeleton, such as intersectin-1 and HIPs (Huntingtin interacting proteins)
(Lanzetti, 2007). Other endocytic proteins can interact with regulators of actin
assembly, for instance, cortactin can activate the Arp2/3 complex (Takenawa and
Miki, 2001). Another emerging class of proteins that integrate the actin
cytoskeleton and membrane trafficking are BAR domain-containing proteins
(BDPs). The BAR domain is a membrane associated domain that can sense
and/or induce membrane curvature (Frost et al., 2009). BDPs usually have
multiple domains. Most BDPs bind to dynamin and some can bind to the Arp2/3
activator N-WASP through some of their protein domains. An example is
Drosophila Cip4/Toca-1 (Cdc42 interaction protein 4), which was shown to
integrate membrane trafficking and actin dynamics through WASP and
SCAR/WAVE (Fricke et al., 2009).
The actin cytoskeleton also plays a critical role in exocytosis, including
stabilizing the docking of exocytic vesicles to facilitate the closure of exocytic
fusion pores (Lanzetti, 2007). Exo70, a component of the exocyst complex
responsible for exocytosis, was shown to bind to Arp2/3 (Zuo et al., 2006).
Other than endocytosis and exocytosis at the plasma membrane, the
actin cytoskeleton also drives vesicle movement. Actin can assemble into the
actin “comet tail” on one side of endosomes which probably propels the vesicles
12
to move short distances (Fehrenbacher et al., 2006). In addition, myosin motor
proteins can transport cargoes along the actin cytoskeleton (Apodaca et al., 2001)
5.3 General functions of the actin cytoskeleton in epithelia.
Besides its function in membrane trafficking, the actin cytoskeleton also plays
other roles in various cellular processes. In the epithelia, the actin cytoskeleton
forms a circumferential belt underneath AJs to support cell junctions so that
epithelial tissues can resist mechanical forces without falling apart (Lecuit and
Lenne, 2007). Together with myosin, the actin cytoskeleton can also facilitate cell
shape change during epithelial development, such as cell intercalation during
convergent extension and apical constriction of cells during tissue invagination
(discussed in detail below).
6. Bazooka and epithelial cell polarity
6.1 Baz: a key regulator of epithelial cell polarity.
Baz is an evolutionarily conserved scaffold protein with three conserved
regions (CR) (Figure 2). CR1 at the N-terminus allows the oligomerization of
Baz/PAR-3. Three PDZ domains in CR2 mediate protein-protein interactions.
The kinase domain of aPKC can bind to CR3 close to the C-terminus (St
Johnston and Ahringer, 2010).
The positioning of Baz on the plasma membrane of epithelial cells is subject to
various regulatory mechanisms. Recent work revealed that Baz contains a C-
13
Figure 2. Domain architecture of Baz and its interaction partners in
Drosophila.
The oligomerization domain allows self oligomerization (Benton and St Johnston,
2003A). The first PDZ domain binds to PAR-6 (Petronczki and Knoblich, 2001;
Morais-de-Sa et al., 2010). The three PDZ domains interact with C-terminus of
Armadillo and Echinoid (Wei et al., 2005). The third PDZ domain binds to PTEN.
The C-terminal aPKC binding site binds to the kinase domain of aPKC (Morais-
de-Sa et al., 2010). The C-terminal membrane targeting motif binds to
phospholipids.
Abbreviations: aPKC (atypical Protein Kinase C), Arm (Armadillo), CR
(Conserved region), Ed (Echinoid) OD (Oligomerization domain), PDZ
(PSD95/Dlg/ZO-1 domain), PIPs (phospholipids), PTEN (Phosphatase and
tensin homologue deleted on chromosome 10).
14
Figure 2. Domain architecture of Baz and its interaction partners in Drosophila.
15
terminal phospholipid binding site involved in membrane targeting (Krahn et al.,
2010). Interestingly, Baz is positioned below its typical interaction partners aPKC
and Par-6 in Drosophila epithelial cells (Harris and Peifer, 2005). The exclusion
of Baz from the apical surface membrane involves phosphorylation of Baz by
aPKC and competitive binding of Par-6 by Crb (Morais-de-Sa et al., 2010). Baz
is also excluded from the basolateral domain by PAR-1 kinase. In particular,
PAR-1 phosphorylates Baz and thereby inhibits its oligomerization and the
formation of Baz/PAR-6/aPKC polarity complex (Benton and St Johnston, 2003B).
As a key regulator of ECP, Baz recruits both AJ components and polarity
proteins. It functions as an early apical polarity cue upstream of AJs in
Drosophila embryonic primary epithelia. Baz was shown to recruit DE-cadherin
and Armadillo (Drosophila β-catenin homologue) to the apical cortex for spot
adherens junction (precursor of AJ belt) assembly in Drosophila cellularizing
embryos (Harris and Peifer, 2004). It also recruited polarity protein Crb to the
apical cortex (Bilder et al., 2003). In addition, Baz regulates cytoskeletal
organization by localizing Bitesize which can recruit the actin-binding protein
Moesin to form a continuous actin belt to stabilize AJs (Pilot et al., 2006). Baz
may also regulate ECP through phospholipid asymmetry and signaling.
Specifically, the third PDZ domain of Baz can bind to the lipid phosphatase PTEN
that converts PIP3 to PIP2 (von Stein et al., 2005), indicating Baz may help
generate phospholipid asymmetry and integrate phosphoinositide signaling in
ECP.
16
6.2 Identification of baz-interacting genes in Drosophila embryonic epidermis
To identify novel baz-interacting genes in Drosophila embryonic epithelia, our
lab previously performed a baz modifier screen on the second and third
chromosomes (Figure 3A and B). Using deficiency mapping, bioinformatics and
available single mutant fly lines, we were able to identify 17 candidate genes
which significantly enhanced the cuticle phenotype of baz zygotic mutant
embryos (CG30372 (dASAP) shown as an example in Figure 3C). These genes
encode known and putative polarity, signaling, cytoskeletal, transmembrane, and
trafficking proteins. Most of them were linked to ECP for the first time.
Interestingly, both Arf79F (the Drosophila ADP ribosylation factor 1, dArf1) and
the Arf1 GAP homologue CG30372 (dASAP) were found in this screen (Shao et
al., 2010).
17
Figure 3. baz genetic modifier screen for novel baz-interacting genes in
Drosophila embryonic epithelia.
(A) The mating scheme to map deficiencies that enhance zygotic baz cuticle
phenotype on 2nd and 3rd chromosomes. Abbreviations: Df (deficiency), bal
(balancer chromosome). (B) Representative examples of cuticle phenotypes of
the F2 generation from the scheme in (A). A WT cuticle phenotype is shown.
Cuticle defects are ranked from the weakest (minor) to the strongest (scraps).
Minor and morphological categories marked by arrows. Sheet, sheets/scraps,
and scraps categories bracketed. Non-linear level adjustments were done to
accentuate the cuticle phenotypes without interference from the surrounding
vitelline membrane (γ value were set to 2.0 in Photoshop). (C) An example of
cuticle phenotype distributions in candidate genes identified from the screen. In
the deficiency of interest, each candidate gene was tested using the same
scheme in (A) (here the deficiency is replaced by the single mutant line of each
candidate gene). The results of baz zygotic mutant alone and CG30372 (dasap)
in baz zygotic mutant background are shown. (Published in Shao et al., 2010)
18
Figure 3. baz genetic modifier screen for novel baz-interacting genes in Drosophila embryonic epithelia.
19
7. ADP Ribosylation Factors
7.1 The structure of ADP ribosylation factors.
ADP Ribosylation Factors (Arfs) are well-conserved small GTPases of the
Ras superfamily. Arf GTPases exist as either GTP-bound forms (active) or GDP-
bound forms (inactive). The cycling between these two states determines the
activity of Arf GTPases. Core members of the Arf GTPase family are divided into
three classes based on sequence similarity. They also share several common
structural features: a myristoyl group usually linked to the N-terminal amphipathic
helix and an interswitch region between two switch regions. All these features are
important for coupling GTP binding of Arf GTPases with their membrane
association: upon GTP binding, the N-terminal amphipathic helix is released from
a hydrophobic pocket by the interswitch region, and inserted together with the N-
terminal myristoyl group into the membrane. Once GTP is hydrolyzed, the GDP-
bound Arf GTPase spontaneously dissociates from membranes without the help
of GDP displacement inhibitors, in contrast to other small GTPases. Therefore,
Arf GTPases exert their functions when they are membrane-bound (Gillingham
and Munro, 2007).
7.2 Classical Functions of Arf GTPases.
Arf GTPases generally regulate membrane trafficking and cellular organelle
structures. To do so, Arf GTPases recruit coat proteins, manipulate phospholipid
metabolism and regulate the actin cytoskeleton. By localizing to different cellular
compartments, each member of the Arf GTPase family interacts with a distinct
20
set of effectors to perform unique functions (D’Souza-Schorey and Chavrier,
2006). Here I briefly discuss the functions of two best characterized Arf GTPases:
Arf1 and Arf6.
Arf1 is typically associated with the Golgi apparatus to regulate the early
secretory membrane transport and maintain the structure of the Golgi apparatus.
To regulate the secretory pathway, Arf1 usually recruits different coat
proteins/adaptor proteins to budding vesicles at particular vesicular
compartments. In particular, COPI is recruited by Arf1 for vesicle budding at cis-
Golgi in retrograde vesicle transport to ER (Bonifacino and Glick, 2004; Lee et al.,
2004). Similarly, clathrin-coated vesicle formation at trans-Golgi and late
endosomes is regulated by Arf1-dependent recruitment of adaptor proteins AP-
1/3/4 and GGA (Kirchhausen, 2000; Bonifacino, 2004). In addition to coat
proteins, the actin cytoskeleton also plays pronounced roles in vesicle trafficking.
Arf1 has also been shown to stimulate actin polymerization at the site for vesicle
budding: Arf1 recruits GTP-bound Cdc42 which subsequently binds ABP1 and N-
WASP to initiate the actin assembly machinery in Golgi-ER trafficking, while it
recruits cortactin and dynamin-2 for actin assembly in post-Golgi transport
(D’Souza-Schorey and Chavrier, 2006). Moreover, some evidence suggests Arf1
modulates local lipid metabolism to facilitate vesicle formation. Arf1 can bind to
phospholipase D which produces phosphatidic acid (PA), and PI(4)P 5-kinase
which produces PIP2, lipid species implicated in membrane trafficking
(Zimmerberg and Kozlov, 2006).
21
In contrast to Arf1, Arf6 primarily regulates the endocytic pathway at the
plasma membrane and recycling endosomes, and actin cytoskeleton remodeling
at the cell periphery. Arf6 is shown to be critical for internalization of ligands
through multiple endocytic pathways (D’Souza-Schorey and Chavrier, 2006).
Arf6 can regulate clathrin-dependent endocytosis through direct binding to
protein factors in vesicle formation. For example, Arf6 is known to recruit a
nucleoside diphosphate kinase NM23-H1 to supply dynamin with GTP for vesicle
fission (Palacios et al., 2002). Similar to Arf1, Arf6 may also modulate
phospholipid metabolism at the cell surface to promote clathrin-dependent
endocytosis. (Brown et al., 1993; Honda et al., 1999; Paleotti et al., 2005;
Jovanovic et al., 2006). Arf6 can also interact with components of the exocyst
complex to deliver membrane proteins to the cell surface. Through these
mechanisms, Arf6 functions in cell migration, formation of specialized membrane
protrusions/extensions (e.g. invadopodia, membrane ruffles, and pseudopodia),
and phagocytosis (Palaclois et al., 2001; Radhakrishna et al., 1996; Hashimoto
et al., 2003; Zhang et al., 1998).
7.3 Regulators of Arf GTPase Activity: Arf Guanine Nucleotide Exchange Factors
and Arf GTPase-activating Proteins.
The activity of Arf GTPases depends on their association with GTP or GDP,
which is regulated by Arf Guanine nucleotide exchange factors (Arf GEFs) and
Arf GTPase-activating proteins (Arf GAPs) (Figure 4). The inactive GDP-bound
Arf GTPase is activated by Arf GEFs through replacement of GDP with GTP.
22
Figure 4. The Arf GTPase cycle.
Arf GTPases cycle between the active GTP-bound form and the inactive GDP-
bound form. This is regulated by Arf GEFs and Arf GAPs. Arf GEFs replace GDP
with GTP in order to activate Arf GTPases. While Arf GAPs stimulate GTP
hydrolysis of Arf GTPases in order to inactivate Arf GTPases. Abbreviation: Arf
GAP (Arf GTPase-activating protein) Arf GEF (Arf Guanine nucleotide exchange
factor), GDP (Guanosine diphosphate), GTP (Guanosine 5’-trisphosphate).
23
Figure 4. The Arf GTPase cycle.
24
When the active GTP-bound Arf GTPase needs to be turned off, the low intrinsic
GTPase activity of Arf GTPase is stimulated to hydrolyze GTP into GDP by Arf
GAPs. Each Arf GEF or Arf GAP has its own Arf specificity and localizes to
specific cellular compartments (e.g. the plasma membrane, Golgi apparatus or
endosomes). This is thought to control the activity of each Arf GTPase at
particular cellular compartments (D’Souza-Schorey and Chavrier, 2006).
Arf GEF proteins usually have a Sec7 domain which is responsible for
catalyzing the conversion from GDP to GTP. Arf GEFs can be classified into the
following families with different additional domains: GBF, BIG, PSD, IQSEC,
Cytohesin, FBXO8, and Sec12 (the Sec12 family has no Sec7 domain)
(Gillingham and Munro, 2007). Arf GAP proteins can be categorized into several
families based on their domain architecture: ArfGAP1, ArfGAP2, ADAP, SMAP,
AGFG, GIT, ACAP, AGAP, ASAP, and ARAP (Kahn et al., 2008). Since most Arf
GEF and Arf GAP proteins have multiple functional domains other than the GAP
or Sec7 domain, they may be functionally versatile. Some domains may help
localize these regulators to specific cellular compartments. For example, PH
domains are common in both Arf GEFs and Arf GAPs and can target them to
plasma membrane domains enriched with particular phospholipid species (Macia
et al., 2008). Other domains of Arf GAP proteins may facilitate the corresponding
Arf GTPases in vesicle formation. The ALPS motifs can sense membrane
curvature and help ArfGAP1 family members bind to Arf GTPases at the vesicle
budding site. The BAR domains of ACAP and ASAP proteins sense or even
create membrane curvatures at the site of vesicle formation. The SH3 domains
25
and Proline-rich regions containing SH3 domain binding motif in some Arf GAP
proteins mediate SH3 domain-dependent protein-protein interactions. Other
domains may help integrate signaling pathways: the ARAP protein family
possess both an Arf GAP domain and a Rho GAP domain pointing towards
integration of Arf and Rho signalings (Gillingham and Munro, 2007).
7.4 Arf GTPases/ Arf regulators and epithelial cell polarity.
Regulation of cellular processes at the plasma membrane is important for the
cell polarity machinery. Although Arf1 usually performs its function at the Golgi,
there is increasing evidence suggesting that Arf1 may also localize to and/or
affect cellular processes at the plasma membrane. Overexpression of the Arf1
GEF ARNO relocalized Arf1 to the plasma membrane (Vitale et al., 2002). In
another case, an Arf1 mutant resistant to GTP hydrolysis relocalized to the
plasma membrane (Luo et al., 2005). This suggests Arf1-GTP may be only
transiently present at the plasma membrane in the presence of its regulators.
Moreover, the active Arf1 was present at distinct puncta on the plasma
membrane and regulated dynamin-independent endocytosis in mammalian cell
culture (Kumari and Mayor, 2008). In polarized cells, Arf1 seems to function at
the apical domain. Recently, our work showed that dArf1::GFP was weakly
present at the apical circumference of epithelial cells in the Drosophila embryo
(Shao et al., 2010). Consistently, human Arf1 was shown to be localized at the
apical domain of renal epithelia cells (El Annan et al., 2004). In rhabdomere
biogenesis of Drosophila, enhanced dArf1 activity disrupted apical membrane
26
transport (Raghu et al., 2008). Thus Arf1 may exert its effect on ECP through its
function at the Golgi apparatus and/or the plasma membrane.
Similar to Arf1, Arf6 also has polarized cellular distributions and activities.
Drosophila Arf6::GFP was localized to basolateral puncta along the cell cortex
with exclusion from the apical domain in Drosophila embryonic epithelia (Huang
et al., 2009). In the human kidney, the localization of Arf6 is context-dependent.
In the proximal tubule it is apically enriched, whereas in the collecting tubule it is
primarily localized to the basolateral domain (Annan et al., 2003). Arf6 recruits
NM23H1 to stimulate dynamin-dependent endocytosis of E-cadherin in
mammalian cell culture (Palacios et al., 2002). Interestingly, recent work placed
the activation of Arf6 downstream of PAR-3 in AJ assembly in mammalian cell
culture (Ikenouchi and Umeda, 2010).
8. ASAP (Arf GTPase-activating protein with SH3 domain, Ankyrin Repeat
and PH domain)
The ASAP family has three members (ASAP1, ASAP2 and ASAP3) in
vertebrates, only one in other metazoans (including Drosophila), and none in
lower eukaryotes (Gillingham and Munro, 2007). They are scaffold proteins with
six functional domains/motifs; from N-terminus to C-terminus a BAR domain, PH
domain, ArfGAP domain, Ankyrin repeat region (AKR), Proline-rich region and
SH3 domain (Figure 5).
Arf1 appears to be one substrate of the GAP activity of ASAP1. In vitro
biochemical assays showed that ASAP catalyzed GTP hydrolysis on Arf1 and
27
Arf5, and to a lesser extent on Arf6 (Kam et al., 2000). In vivo, siRNA-mediated
knock-down of ASAP1 increased cellular levels of Arf1-GTP (Liu et al., 2005),
and a GTP-hydrolysis resistant Arf1 mutant altered the localization of ASAP1 at
the plasma membrane (Luo et al., 2005).
Among the three members of the vertebrate ASAP family, ASAP1 is the best
studied. In mammalian cell culture, ASAP1 localizes to focal adhesions and
membrane ruffles, and also to the perinuclear reticulate network (Randazzo et al.,
2000; Brown et al., 1998), suggesting a role at the plasma membrane and in
post-Golgi trafficking.
Specific ASAP1 domains are implicated in regulating membrane trafficking
and actin cytoskeleton (Figure 5). Both in vitro and in vivo membrane tubulation
studies show that its BAR domain creates membrane curvatures (Nie et al.,
2006). This BAR domain also functions in trafficking of epidermal growth factor
receptor (Nie et al., 2006). Additionally, the BAR domain can bind to the Rab11
effector, FIP3 and regulate Rab11-mediated trafficking (Inoue et al., 2008). The
BAR domain may also autoinhibit the GAP activity of ASAP1 through
intramolecular interaction with the PH domain and/or the GAP domain (Jian et al.,
2008).
The PH domain adjacent to the BAR domain of ASAP1 seems to interact
with lipids at the membrane. The PH domain can bind to various phospholipids in
vitro (Kruljac-Letunic et al., 2003). Both PA and PIP2 function as allosteric
activators of GAP domain activity through the PH domain based on an in vitro
enzyme assay (Brown et al., 1998). The PH domain may also transiently interact
28
Figure 5. Domain architectures and alignment of dASAP and human ASAP1,
and interaction partners of human ASAP1.
Sequence similarity of each domain between dASAP and human ASAP1 are
indicated as positive residues/ total residues and the corresponding percentage.
Both identical residues and residues of conservative substitution are considered
as positive. In human ASAP1, the BAR domain can bind to Rab11FIP3. The PH
domain interacts with phospholipids. The GAP domain binds to Arf GTPases.
The proline-rich region binds to the SH3 domain of CIN85, CD2AP, Cortactin, Src
and CrkL. The SH3 domain interacts with FAK, Pyk2 and APC. Abbreviations:
AKR (Ankyrin repeat), APC (Adenomatous polyposis coli), Arf (ADP ribosylation
factor), BAR (Bin/Amphiphysin/Rvs domain), CD2AP (CD2-associated protein),
CIN85 (Cbl interaction protein of 85 kDa), CrkL (Crk-like protein), FAK (Focal
adhesion kinase), GAP (GTPase-activating protein domain), PH (Pleckstrin
homology domain), PIPs (phospholipids), Pyk2 (Proline-rich tyrosine kinase 2),
Rab11FIP3 (Rab11 family interaction protein 3), SH3 (Src homology 3 domain),
Src (Sarcoma kinase) .
29
Figure 5. Domain architectures and alignment of dASAP and human ASAP1, and interaction partners of human ASAP1.
30
with the GAP domain and contribute to the GAP activity by positioning Arf1-GTP
(Luo et al., 2008).
Together with the GAP domain, the Ankyrin repeats seem to form a
relatively rigid structure and thus contribute to the overall structural stability
(Martin and Jackson, 2005). ASAP1 also has a proline-rich region (an SH3
domain binding motif) and an SH3 domain at its C-terminus, offering a versatile
platform for SH3 domain-mediated protein-protein interactions. The C- terminal
region appears to physically link ASAP1 to important players in various cellular
activities including membrane trafficking and organization of actin cytoskeleton
especially organization of actin-based cellular structures like invadopodia and
focal adhesions. The proline-rich region contains binding motifs for the SH3
domains of CIN85 (Kowanetz et al., 2004), CD2AP (Liu et al., 2005), and
Cortactin (Onodera et al., 2005): CIN85 is an adaptor protein that is important in
clathrin-dependent endocytosis and F-actin bundling (Gaidos et al., 2007);
CD2AP is a scaffold protein that can bind to and regulate actin cytoskeleton (Liu
et al., 2005); Cortactin is an important component of invadopodia in addition to its
role in vesicle scission during endocytosis (Onodera et al., 2005; Chen et al.,
2006). The proline-rich region also binds to critical signaling proteins including
Src (Brown et al., 1998) and CrkL (Oda et al., 2002). The SH3 domain can bind
to the proline-rich region of Focal adhesion kinase (Liu et al., 2002) and the
tyrosine kinase Pyk2 (Kruljac-Letunic et al., 2003) and to the SAMP motif of APC,
a microtubule binding protein and a component of Wnt signaling (Kaieda et al.,
2010).
31
Deregulation of ASAP1 expression has been linked to multiple types of
cancer (Ehlers et al., 2005; Lin et al., 2008; Muller et al., 2010). In particular,
overexpression of ASAP1 stimulated metastasis (Muller et al., 2010) possibly
through promoting the formation of cellular structures like invadopodia and focal
adhesions (Onodera et al., 2005). Since ASAP1 interacts with the oncogenes Src
(Brown et al., 1998) and CrkL (Oda et al., 2002) and the tumor suppressor APC
(Kaieda et al., 2010), it is also possible that upregulation of ASAP1 alters the
activity of these proteins.
9. Drosophila embryonic epithelia as a model to study the role of dASAP in
epithelial cell polarity
Since ASAP proteins have not been studied in adherent cells or any intact
organism, Drosophila embryonic primary epithelia may serve as an excellent
model to study its role in actin cytoskeleton assembly and membrane trafficking
in regulating epithelial cell polarity.
After fertilization, the single-celled Drosophila embryo starts thirteen cycles of
syncytial cell divisions (nuclear division without cytokinesis). Nuclei migrate to the
embryo periphery after nine cycles of divisions. At the end of thirteen cycles of
divisions, cellularization begins with the invagination of plasma membrane to
separate each nucleus into individual cells eventually forming an epithelial
monolayer (Figure 1A). During this process, the actin cytoskeleton is enriched at
the furrow canal, the basal most part of the growing membrane, where it is
coupled with endocytic events (Sokac and Wieschaus, 2008A; Sokac and
32
Wieschaus, 2008B). Exocytosis is also essential for lateral membrane growth
(Pelissier et al., 2003; Murthy et al., 2010).
After cellularization, epithelial cells have fully formed (Figure 1B). The onset
of ventral furrow formation marks the beginning of gastrulation. In this process, a
stripe of cells along the ventral midline of the early Drosophila embryo
invaginates to form the mesoderm. This is initiated with apical constriction.
Actinomyosin meshworks attach to AJs and undergo periodic cycles of assembly
and disassembly to drive constriction of the apical domain (Martin et al., 2010;
Martin et al., 2009). Shortly after the initiation of ventral furrow formation, the
germband along the lateral side of the embryo starts to extend to the dorsal side
of the embryo. This occurs through convergent extension. The germband
extends its length along the anterior-posterior (A-P) axis with simultaneous
narrowing along the dorsal-ventral axis (D-V). This is primarily driven by cell
intercalation, in which cell-cell contacts are shortened along the A-P axis and
lengthened along the D-V axis. To initiate the first step of cell intercalation,
cortical actinomyosin becomes enriched at the cell borders along the A-P axis to
drive shortening of the cell-cell contacts (Harris and Tepass, 2010). When the
germband is almost fully extended, the neuroectoderm on either side of the
midline starts extensive delamination of neuroblast cells, which requires
substantial junctional remodeling to fill up the gaps left in the epidermis.
Therefore, it requires continuous turnover of AJs by vesicle trafficking (Harris and
Tepass, 2008).
33
During germband extension, an extraembryonic tissue called amnioserosa
forms. It covers the dorsal side when the germband retracts from the dorsal side
of the embryo. Then the embryo goes through dorsal closure in which the lateral
epidermal cells elongate and cover the amnioserosa. Similar to the invaginating
cells at the ventral furrow, amnioserosa cells apically constrict as well.
Interestingly, recent work identified an analogous role of actinomyosin meshwork
in apical constriction of amnioserosa cells during dorsal closure of Drosophila
embryogenesis (Solon et al., 2009; David et al., 2010). This change
accompanied by organogenesis and further development leads to hatching of the
larvae.
In summary, Drosophila embryonic epithelial cells constantly remodel the
plasma membrane, AJs and the actin cytoskeleton to drive and to accommodate
morphogenesis. Therefore, Drosophila embryonic epithelia is a great model to
study how dASAP may regulate epithelial cell polarity through actin cytoskeleton
and membrane trafficking.
10. Objectives
My thesis project began with the completion of a baz genetic interaction
screen through localizing fifteen candidates as GFP fusion proteins. Then I
sought to test the role(s) of a top candidate, dASAP, in epithelial cell polarity in
Drosophila with three major objectives. First, to determine when and where
dASAP might interact with major polarity players, I defined the localization of
dASAP throughout embryonic development after generating GFP fusion proteins
34
and an anti-dASAP antibody. Second, to study how loss of dASAP function
affects epithelial cell polarity, I used imprecise P-element excision to generate a
deletion allele of dASAP. Third, to study how each of the six functional domains
of dASAP contributes to its subcellular localization and functions, I generated
transgenic fly lines with constructs deleting each domain. My work reveals
associations between dASAP, actin and the apical domain. The six domains
appear to act redundantly to localize dASAP, although interactions between
domains affecting the degree of membrane association are apparent. Future
work is required to determine the role of dASAP in ECP.
35
MATERIALS AND METHODS
1. Drosophila stocks
Table I. Drosophila stocks and alleles
Stock/Allele Remarks
y1 bazxi106/FM7a BDSC1 3295
w1118; Df(2R)ED1735, P{3'.RS5+3.3'}ED1735/SM6a BDSC 9275
w1118; Df(2R)Exel7094/CyO BDSC 7859
y1 w67c23; P{SUPor-P}dASAPKG03963 BDSC 13356
w[*]; wg[Sp-1]/CyO; ry[506] Sb[1] {Δ2-3}99B/TM6B, Tb[1] BDSC 3629
act5C-GAL4/TM3, Sb Ser Modified from BDSC
4414
matα4-tub>GAL4::VP16 Gift from Eric Wieschaus
GFP-histone Gift from Andrew Wilde
w[1118]; In(2LR)Gla, wg[Gla-1]/CyO, P{GAL4-twi.G}2.2, P{UAS-
2xEGFP}AH2.22
BDSC 6662
y[1] w[*]N[1]/FM7c, P{GAL4-twi.G}108.4, P{UAS-2xEGFP}AX BDSC 6873
UAS- dASAP::GFP Generated in this work
UAS- GFP::dASAP Generated in this work
UAS- GFP::dASAPΔBAR (23-248) Generated in this work
UAS- GFP::dASAP ΔPH (313-399) Generated in this work
UAS- GFP::dASAPΔGAP( 427-540) Generated in this work
UAS- GFP::dASAP ΔAKR (547-684) Generated in this work
UAS- GFP::dASAP ΔProR (856-1026) Generated in this work
36
UAS-Alt::GFP Generated in this work
UAS-Arf79F::GFP Generated in this work
UAS-Asp::GFP Generated in this work
UAS-CG1951::GFP Generated in this work
UAS-CG5823::GFP Generated in this work
UAS-CG10702::GFP Generated in this work
UAS-CG11210::GFP Generated in this work
UAS-Cul-5::GFP Generated in this work
UAS-Fj::GFP Generated in this work
UAS-hk::GFP Generated in this work
UAS-Muskelin::GFP Generated in this work
UAS-Roc2::GFP Generated in this work
UAS-Sds22::GFP Generated in this work
UAS-Sep5::GFP Generated in this work
dasap908WB deletion allele Generated in this work
yellow white Used as wild type
1Bloomington Drosophila Stock Center
2Abbreviation as Gla/CyOTwiGFP
37
2. cDNA clones and plasmids
Table II. cDNA clones used for gene cloning
Gene cDNA clone ID Antibiotics Resistance Source
Alt LD29525 Chloramphenicol CDMC1
Arf79F LD24904 Chloramphenicol CDMC
Asp LD18929 Chloramphenicol DGRC2
CG1951 LD39455 Chloramphenicol CDMC
CG5823 RE16955 Ampicillin CDMC
CG10702 LD35811 Chloramphenicol CDMC
CG11210 RE44586 Ampicillin DGRC
CG30372 (dASAP) RH04774 Ampicillin DGRC
Cul-5 RE55959 Ampicillin CDMC
Fj RE18087 Ampicillin CDMC
hk LD05265 Ampicillin CDMC
Muskelin AT11715 Chloramphenicol CDMC
Roc2 RE61847 Ampicillin CDMC
Sds22 GH07711 Chloramphenicol CDMC
Sep5 LD28935 Chloramphenicol CDMC
1Canadian Drosophila Microarray Center
2Drosophila Genomics Resource Center
38
Table III. Vectors/Constructs
Vector/Construct Source Purpose
pENTR2B Invitrogen Gene Cloning
pENTR2B-Alt Generated in this work Gene Cloning
pENTR2B-Arf79F Generated in this work Gene Cloning
pENTR2B-Asp Generated in this work Gene Cloning
pENTR2B-CG1951 Generated in this work Gene Cloning
pENTR2B-CG5823 Generated in this work Gene Cloning
pENTR2B-CG10702 Generated in this work Gene Cloning
pENTR2B-CG11210 Generated in this work Gene Cloning
pENTR2B-dASAP Generated in this work Gene Cloning
pENTR2B-Cul-5 Generated in this work Gene Cloning
pENTR2B-Fj Generated in this work Gene Cloning
pENTR2B-hk Generated in this work Gene Cloning
pENTR2B-Muskelin Generated in this work Gene Cloning
pENTR2B-Roc2 Generated in this work Gene Cloning
pENTR2B-Sds22 Generated in this work Gene Cloning
pENTR2B-Sep5 Generated in this work Gene Cloning
pENTR2B-dASAP-N1 Generated in this work Gene Cloning
pENTR2B-dASAP-C2 Generated in this work Gene Cloning
pENTR2B-dASAPΔBAR Generated in this work Gene Cloning
pENTR2B-dASAPΔPH Generated in this work Gene Cloning
pENTR2B-dASAPΔGAP Generated in this work Gene Cloning
39
pENTR2B-dASAPΔAKR Generated in this work Gene Cloning
pENTR2B-dASAPΔProR Generated in this work Gene Cloning
pENTR2B-dASAPΔSH3 Generated in this work Gene Cloning
pPGW.attB Carnegie Institution of
Washington
Transgenics
pPWG.attB Carnegie Institution of
Washington
Transgenics
pPWG.attB-Alt Generated in this work Transgenics
pPWG.attB-Arf79F Generated in this work Transgenics
pPWG.attB-Asp Generated in this work Transgenics
pPWG.attB-CG1951 Generated in this work Transgenics
pPWG.attB-CG5823 Generated in this work Transgenics
pPWG.attB-CG10702 Generated in this work Transgenics
pPWG.attB-CG11210 Generated in this work Transgenics
pPWG.attB-dASAP Generated in this work Transgenics
pPWG.attB-Cul-5 Generated in this work Transgenics
pPWG.attB-Fj Generated in this work Transgenics
pPWG.attB-hk Generated in this work Transgenics
pPWG.attB-Muskelin Generated in this work Transgenics
pPWG.attB-Roc2 Generated in this work Transgenics
pPWG.attB-Sds22 Generated in this work Transgenics
pPWG.attB-Sep5 Generated in this work Transgenics
pPGW.attB-dASAP Generated in this work Transgenics
40
pPGW.attB-dASAPΔBAR Generated in this work Transgenics
pPGW.attB-dASAPΔPH Generated in this work Transgenics
pPGW.attB-dASAPΔGAP Generated in this work Transgenics
pPGW.attB-dASAPΔAKR Generated in this work Transgenics
pPGW.attB-dASAPΔProR Generated in this work Transgenics
pPGW.attB-dASAPΔSH3 Generated in this work Transgenics
pGEX6P-1 GE Healthcare Life
Sciences
Protein Expression
pGEX6P-1-PH (300-414) Generated in this work Protein Expression
1: The coding region of dASAP gene is to be added with an N-terminal GFP tag
in the destination vector pPGW.attB.
2: The coding region of dASAP gene is to be added with a C-terminal GFP tag in
the destination vector pPWG.attB.
41
3. Antibodies and stains
Table IV. Primary antibodies and stains
Antibody/Dye Dilution Source
Rabbit anti-dASAP Rb3, pAb 1:700 Generated in this work
Rabbit anti-dASAP Rb4, pAb 1:700 Generated in this work
Guinea Pig anti-dASAP GP1, pAb 1:700 Generated in this work
Guinea Pig anti-dASAP GP2, pAb 1:3000 Generated in this work
Mouse anti-Crumbs mAb (CQ4) 1:350 DSHB1
Rabbit anti-Amphiphysin pAb 1:1000 G. Bouliane, University of Toronto
Mouse anti-Armadillo mAb (N2 7A1) 1:100 DSHB
Rabbit anti-Bazooka pAb 1:3000 Our lab
Rat anti-DE-cadherin mAb (DCAD2) 1:100 DSHB
Phalloidin-Alexa546 1:200 Invitrogen
1Developmental Studies Hybridoma Bank
Secondary antibodies were Alexa488, 546, and 647 and were obtained from
Invitrogen with pre-absorption and dilution before application.
42
4. Gene cloning and transgenics
For cloning the 15 candidate genes, cDNAs were obtained from the
Canadian Drosophila Microarray Center and Drosophila Genomic Resource
Center. The coding region with partial 5’ UTR of cDNA clones were amplified by
PCR (please refer to Appendix I for more details), cloned into pENTR2B gateway
entry vectors and recombined into pPWG.attB or pPGW.attB gateway destination
vectors to add an upstream UAS sequence and GFP tag at either the N-terminus
(pPGW.attB) or the C-terminus (pPWG.attB). For cloning the deletion constructs,
forward and reverse primers with NgoMIV restriction sites (please refer to
Appendix I for more details) were used to flank the deletion region in opposite
directions on pENTR2B-dASAP-N. Then the rest of the sequence was PCR-
amplified with Phusion DNA polymerase (Finnzymes). The amplified fragment
with the region of interest deleted was digested by NgoMIV (New England
Biolabs) and self ligated by T4 DNA ligase (Fermentas). The pENTR2B
constructs with the deletion were recombined into pPGW.attB gateway
destination vectors to add an upstream UAS sequence and GFP tag at the N-
terminus. Transgenic flies were generated by Genetic Services Inc. with
transgenes inserted into the attp2 site. To examine embryos at early
embryogenesis, transgenic lines were crossed to matα-Gal4-VP16 females for
imaging embryos of the F2 generation. To examine embryos at late
embryogenesis, transgenic lines were crossed to act5C-Gal4 females for imaging
embryos of the F1 generation.
43
5. Antibody production
The coding region for the PH domain of dASAP (a.a. 300-414, including 10
extra a.a. beyond each border of the PH domain) was amplified by PCR (please
refer to Appendix I for more details) and cloned into pGEX6P-1 vector to add a
N-terminal GST tag. GST-PH fusion protein was expressed in transformed E. coli
strain BL21 and purified using a GST affinity column. The expression and
stability of GST-PH protein was assessed by SDS-PAGE. The yield of GST-PH
protein was assessed by Bradford protein assay. Two rabbits and two guinea
pigs were injected with GST fusion proteins according to an injection scheme
(please refer to Appendix II). The anti-serums were obtained through the Animal
Facility at the Department of Cell and Systems Biology, University of Toronto.
6. Embryo staining and treatment
In sample preparation, 4-hour collection of embryos is used to examine early
embryogenesis. 12-hour collection of embryos is used to examine late
embryogenesis. For the heat fixation method was adopted from Muller and
Wieschaus (1996). For immunofluorescence staining with heat fixation, embryos
were firstly dechorionated in 50% bleach and washed with 68 mM NaCl/0.1%
Triton X-100. Then embryos were transferred to hot 68 mM NaCl/0.1% Triton X-
100 in boiling water for 5 seconds before incubation on ice with cold 68 mM
NaCl/0.1% Triton X-100. After removing all liquids, embryos were de-vitellinized
by 1:1 heptane: methanol/5% EGTA and incubated on ice with methanol/5%
EGTA for 2 hours. Embryos were rinsed twice with methanol/5% EGTA before
44
blocking. For immunofluorescence staining with formaldehyde fixation, embryos
were firstly dechorionated in 50% bleach and washed with 0.1% Triton X-100.
For staining with phalloidin, embryos were fixed for 10 minutes in 1:1 10%
formaldehyde in PBS/heptane and de-vitellinized by hand peeling. For other
staining, embryos were fixed for 20 minutes in 1:1 3.7% formaldehyde in
PBS/heptane and de-vitellinized by methanol. Then embryos were incubated in
the block solution containing PBS/1% normal goat serum (NGS) /0.1% Triton X-
100 for 1.5 hours. All antibodies were diluted in NGS block solution as listed in
Table IV. The embryos were stained with the primary antibody mixture overnight
at 4°C and then with the secondary antibody mixture for 2 hours at room
temperature.
To compare the immunofluorescence level of anti-dASAP antibody between
GFP-histone and Df(2R)Exel7094/CyO, TwiGFP lines, 12-hour collections of
embryos from each line were mixed and processed as a single sample in
subsequent immunostaining procedures.
The cytochalasin D treatment was adapted from Harris and Peifer (2005).
Dechorionated embryos were washed twice with 0.9% NaCl and incubated in 1:1
octane/ 10 μg/ml cytochalasin D (Sigma-Aldrich) in 0.9% NaCl for 30 min at room
temperature with nutation. After removing all liquids, embryos were washed twice
with heptane before fixation with formaldehyde. The working solution of
cytochalasin D was prepared freshly from a 1 mg/ml solution in DMSO. For the
control, the embryos were treated with DMSO only.
45
7. Image acquisition and manipulation
For immunofluorescence imaging, stained embryos were mounted in Aqua
PolyMount solution (Polysciences) and imaged with a Quorum spinning disk
confocal microscope (Quorum Technologies) with a Hamamatsu EM CCD
camera and Volocity software (Improvision). Images were collected at room
temperature with a 63X (Plan-Apochromat; NA 1.4) objective and a piezo top
plate. Z stacks were collected with a spacing of 0.3 μm. Xcite epifluorescence
was used for genotyping of embryos
For time-lapse microscopy, embryos were dechorionated in 50% bleach and
washed in 0.1% Triton X-100 and then mounted in halocarbon oil (series 700;
Halocarbon Products) on a gas permeable membrane dish (petriPERM; Sigma).
Live embryos were imaged using the previously-mentioned spinning disk
confocal microscope with the same setup. The autofluorescent vitelline
membrane of the embryo was used as a marker for the apical surface of the cells
found just underneath it.
All images for immunofluorescence and live imaging, unless otherwise
stated, are deconvolved by Volocity software (Improvision) before analysis.
8. Generation of new mutant alleles of dASAP
The P element was mobilized by crossing the insertion line (dASAPKG03963) to
the transposase line females (wg/CyO;Δ2-3,Sb/TM6). Individual mosaic-eyed
males from the F1 generation were crossed to the balancer line Gla/CyO. P
element excised lines were established by crossing single white-eyed males of
46
the F2 generation to the balancer line Gla/CyO. Adult flies were then genotyped
by PCR using a three-primer strategy (please refer to Figure 20 for more details
of the strategy and Appendix I for more details of the primers). Briefly, the
forward primer binds to the sequence upstream of the P element insertion site.
The reverse primer binds to the sequence downstream of P element insertion
site. The universal primer binds to the inverted repeats at each border of the P
element. The upstream amplicon of 0.56 kb is to detect upstream deletions, and
the downstream amplicon of 0.98 kb is to detect downstream deletions. When
the P element is absent or precisely excised, the whole amplicon is 1.54 kb. If the
excision happened precisely, only the band at 1.54 kb would appear. If the
excision was imprecise and happened within the P element, at least two bands at
0.56 kb and 0.98 kb would appear. If an upstream deletion happened, the band
at 0.56 kb would be absent. If a downstream deletion happened, the band at 0.98
kb would disappear. If the deletion happened at both sides, the two bands at 0.56
kb and 0.98 kb would disappear, but the presence of extra band(s) depends on
the extent of the deletion. If a balancer chromosome is present, it contributes to
the band at 1.54 kb. After detecting the deletion, the size of the deletion was
mapped by PCR with the same forward primer paired with two different reverse
primers respectively. In particular, the amplicon between the forward primer (FP)
and the first reverse primer (RP1) is 2.57 kb, which can detect a deletion up to
2.57 kb. The amplicon between the forward primer and a further downstream
reverse primer (RP2) is 5.76 kb, which allows for detecting a deletion ranging
47
from 2.57 kb to 5.76 kb. The region covering the deletion was amplified by the
closest pair of primers and sequenced to define the deleted region.
48
RESULTS
1. Subcellular localizations of candidate proteins identified from the
genetic screen
Among 17 candidates from the baz genetic interaction screen, the subcellular
localizations of Rho1 (Magie et al., 2002; Fox et al., 2005) and PAR-1 (Bayraktar
et al., 2006) have been previously described. Therefore, to determine the
localization of the other 15 candidates (please refer to Table II for the list of
fifteen candidates), I tagged the candidate proteins with GFP at the C-terminus,
and used the UAS-Gal4 system to express the fusion protein ubiquitously. Then I
examined the subcellular localization of GFP tagged proteins in lateral epidermal
cells at dorsal closure.
Five candidate proteins (CG30372, Arf79F, CG11210, Sds22, and Sep5)
showed specific localizations at the apical cortex. Compared to the mid-lateral
section, CG30372::GFP was enriched at the apical circumference (Figure 6A,
white arrow) and apical surface puncta (Figure 6A, yellow arrow). Similarly,
Arf79F::GFP was localized weakly at the apical circumference (Figure 6B white
arrow), and large puncta throughout cytosol (Figure 6B, yellow arrow).
CG11210::GFP also accumulated in the apical circumference (Figure 6C, white
arrow) and apical surface puncta (Figure 6C, yellow arrow). In addition, large
cytoplasmic puncta (Figure 6C, cyan arrow) were found in mid-lateral sections.
Despite high cytosolic fluorescence, Sds22::GFP was enriched at the apical
circumference (Figure 6D, white arrow). Septin 5 was localized weakly along the
49
apical circumference in a punctate pattern (Figure 6E, white arrow) with
cytoplasmic puncta (Figure 6E, yellow arrow).
Nine other candidates showed specific localization patterns, and one,
Cul5::GFP did not exhibit any fluorescence in the transgenic line. CG1951::GFP
labeled cytoplasmic puncta of various sizes (Figure 6F, yellow arrow). Fj::GFP
was localized to small cytoplasmic puncta (Figure 6G, yellow arrow) which is
consistent with its known localization to the Golgi apparatus (Ishikawa et al.,
2008). Alt::GFP, CG5823::GFP, and CG10702::GFP shared similar subcellular
localizations to large intracellular compartments (Figure 6H, I, J respectively,
yellow arrow in H) and the nuclear envelope (Figure 6H, I, J respectively, cyan
arrows) suggesting endoplasmic reticulum (ER) localization. However, in contrast
to the relatively even distribution of fluorescence in CG5823::GFP and
CG10702::GFP, Alt::GFP was concentrated more locally inside cells (Figure 6H,
note the bright patches). hk::GFP highlighted cellular compartments with GFP-
negative centers (Figure 6K, yellow arrow) consistent with its know localization to
multivesicular bodies (Kramer and Phistry, 1996). Asp::GFP was weakly present
along parallel linear structures (Figure 6L, yellow arrow). Muskelin::GFP was in
cytosol (Figure 6M). Roc2 was cytosolic with nuclear enrichment (Figure 6N).
Since CG30372 was enriched at the apical circumference and apical surface
puncta at late embryogenesis, I chose this candidate to further characterize its
subcellular localization throughout embryonic development. Based on the
sequence similarity to human ASAP1, CG30372 was renamed as dASAP
50
(Drosophila Arf GTPase-activating protein with SH3 domain, Ankyrin Repeat and
PH domain) (Gillingham and Munro, 2007).
51
Figure 6. Subcellular localizations of candidate proteins encoded by the
baz-interacting genes.
Live images of GFP-tagged versions of the proteins in lateral epidermal cells at
stage 15 are shown. (A-E) Both apical and mid-lateral of the same cells are
shown. (F-K and M-N) Mid-lateral sections of the cells are shown. (L) An apical
section is shown. (A) CG30372::GFP localizes to the apical circumference (white
arrow) and at apical surface (yellow arrow). (B) Arf79F::GFP localizes to the
apical circumference (white arrow) and at cytoplasmic puncta (yellow arrow). (C)
CG11210::GFP localizes to the apical circumference (white arrow), at apical
surface (yellow arrow) and at cytoplasmic puncta (cyan arrow). (D) Sds22::GFP
localizes to the apical circumference (white arrow). (E) Septin 5::GFP localizes to
the apical circumference (white arrow) and at cytoplasmic puncta (yellow arrow).
(F-G) CG1951::GFP and Fj::GFP at cytoplasmic puncta (yellow arrows). (H-J)
Alt::GFP, CG5823::GFP and CG10702::GFP over large cytoplasmic
compartments (yellow arrow in H) and at nuclear membrane (cyan arrows). (K)
hk::GFP at intermediate-sized compartments (yellow arrow). (L) Asp::GFP in
parallel linear structures (yellow arrows). (M) Muskelin::GFP diffusely in
cytoplasm. (N) Roc2::GFP diffusely in the cytoplasm and with nuclear enrichment.
Scale bar: 5 μm. (Published in Shao et al., 2010)
52
Figure 6. Subcellular localizations of candidate proteins encoded by the baz-interacting genes.
53
2. Subcellular localization of dASAP with GFP tagged protein throughout
embryonic development
To examine the subcellular localization of dASAP throughout embryogenesis,
I analyzed dASAP tagged with GFP at either the N-terminus or C-terminus.
2.1 GFP::dASAP colocalizes with F-actin during cellularization.
At cellularization, GFP::dASAP was enriched basally along the invaginating
membrane (Figure 7A, red arrow). To determine which cellular structure
GFP::dASAP localized to, I stained the GFP::dASAP embryos for F-actin.
GFP::dASAP localized to F-actin positive puncta at the apical surface,
presumably the apical microvilli (Figure 7A-C, white arrows). GFP::dASAP also
colocalized with F-actin at the basal furrow canals (Figure 7A-C, red arrows).
2.2 GFP::dASAP gradually accumulates apically from cellularization to
gastrulation.
To determine when GFP::dASAP starts to accumulate apically, I live imaged
GFP::dASAP embryos through early embryogenesis. As previously mentioned,
GFP::dASAP was enriched at the basal furrow canals (Figure 8A, red arrow)
during cellularization. At stage 6, GFP::dASAP appeared at the lateral cell
circumference (Figure 8B, red brackets) and apical surface puncta (Figure 8B,
green arrow), however the fluorescence was relatively equal along lateral
membranes (Figure 8B, white bracket). Shortly afterwards at stage 7,
GFP::dASAP accumulated apically (Figure 8C, white arrow) at the cell
54
Figure 7. GFP::dASAP colocalizes with F-actin during cellularization.
(A-C) GFP::dASAP (green) and F-actin (red) at cellularization are shown. Images
are deconvolved. (Top panels) Single X-Y plane images at the apical surface,
apico-lateral section and furrow canals. GFP::dASAP colocalizes with F-actin
positive puncta at the apical surface, which may represent microvilli (white
arrows). (Bottom panels) Cross sections (side) showing invaginating membranes.
GFP::dASAP colocalizes with F-actin and is enriched at the furrow canals (red
arrows). Merged images shown in (C). Scale bar: 5 μm.
55
Figure 7. GFP::dASAP colocalizes with F-actin during cellularization.
56
Figure 8. GFP::dASAP is gradually enriched at the apical domain from
cellularization to gastrulation.
(A-D) Live images of GFP::dASAP at cellularization (A), stage 6 (B), stage 7 (C),
and stage 9 (D) are shown. Images are deconvolved. (Top panels) Cross
sections (side) showing basal enrichment (red arrow) at cellularization (A), even
distribution along the lateral membrane (bracket) at stage 6 (B), apical
accumulation (white arrows) at stage 7 (C) and 9 (D). (Middle panels) Single X-Y
plane images at the apical surface, apicolateral, subapical, and basolateral
sections. GFP::dASAP localizes to the cell circumference (red brackets) and
apical surface puncta (green arrows) at stage 6, 7 and 9. Portion of embryos with
the observed localization is indicated along the bottom. Scale bar: 5 μm.
57
Figure 8. GFP::dASAP is gradually enriched at the apical domain from cellularization to gastrulation.
58
circumference (Figure 8C, red bracket) and to the surface puncta (Figure 8C,
green arrow), and by stage 9 showed strong apical enrichment (Figure 8D, white
arrow) to the cell circumference (Figure 8D, red bracket) and surface puncta
(Figure 8D, green arrow).
2.3 GFP::dASAP colocalizes with F-actin at apical domain during dorsal closure.
To see if GFP::dASAP continues to colocalize with F-actin at late
embryogenesis, I analyzed the localization of both proteins in lateral epidermal
cells during dorsal closure. GFP::dASAP colocalized with F-actin at the apical
circumference (Figure 9A-C, brackets) and partially at the apical surface
patch/puncta (Figure 9A-C, arrows), but showed minimal cortical localization just
1.2 µm below (Figure 9A-C at -1.2 µm).
2.4 GFP::dASAP generally overlaps with Crumbs and DE-cadherin at the apical
domain during dorsal closure.
To determine whether GFP::dASAP colocalizes with other polarity proteins at
the apical domain, I examined the localization of the apical polarity protein Crb
and the AJ protein DE-cad relative to GFP::dASAP. Although not fully colocalized,
GFP::dASAP generally overlapped with Crb and DE-cad at the apical
circumference (Figure 10A-D at -0.3 µm), and the level of each protein was
reduced more basally at -0.9 µm (Figure 10A-D at -0.9 µm).
59
Figure 9. GFP::dASAP colocalizes with F-actin at apical domain during
dorsal closure.
(A-C) GFP::dASAP (green) (A) and F-actin (red) (B) in epidermal cells at dorsal
closure are shown. Images are deconvolved. Single X-Y plane images at 0 μm, -
0.6 μm, and -1.2 μm with 0 μm being the most apical. GFP::dASAP colocalizes
with F-actin at the apical circumference (brackets) and partially at the apical
surface puncta (arrows). Merged images shown in (C). Scale bar: 5 μm.
60
Figure 9. GFP::dASAP colocalizes with F-actin at apical domain during dorsal closure.
61
Figure 10. GFP::dASAP generally overlaps with Crumbs and DE-cadherin
during dorsal closure.
(A-D) GFP::dASAP (green) (A), Crumbs (blue) (B), and DE-cad (red) (C) in
epidermal cells at dorsal closure are shown. Images are deconvolved. Single X-Y
plane images at 0 μm, -0.3 μm, and -0.9 μm with 0 μm being the most apical.
Merged images shown in (D). Scale bar: 5 μm.
62
Figure 10. GFP::dASAP generally overlaps with Crumbs and DE-cadherin during dorsal closure.
63
2.5 GFP::dASAP colocalizes with ectopic F-actin after cytochalasin D treatment
at gastrulation.
Since GFP::dASAP highly colocalized with F-actin throughout development,
it raised the possibility that the localization of GFP::dASAP may be dependent on
the actin cytoskeleton. To assess this issue, I treated GFP::dASAP transgenic
embryos with the actin polymerization inhibitor cytochalasin D. I chose to
examine embryos at early gastrulation, as the cells in the embryos still retain
relatively normal morphology with substantial disruption of the actin cytoskeleton.
Cytochalasin D treatment resulted in ectopic cytoplasmic puncta of F-actin
(Figure 11B, arrows). GFP::dASAP was found to colocalize with these puncta
(Figure 11A-C, arrows) while remaining along the plasma membrane (Figure 11A,
bracket). These ectopic puncta were not due to loss of membrane integrity, for
Dlg staining was still intact (Figure 11D). The mislocalization of GFP::dASAP was
specific to cytochalasin D treatment, as the DMSO control did not show any
ectopic GFP::dASAP or F-actin puncta (Figure 11E-G). The retention of
GFP::dASAP at the cell circumference may be attributed to F-actin remnants at
the same place (Figure 11B and C, brackets). Thus, the localization of
GFP::dASAP is partially dependent on actin.
64
Figure 11. GFP::dASAP colocalizes with ectopic cytoplasmic F-actin puncta
after Cytochalasin D treatment of embryos at early gastrulation.
All images are deconvolved. (A-H) GFP::dASAP (green) (A and E), Actin (Red)
(B and F), and Dlg (white) (D and H) at early gastrulation with cytochalasin D
treatment (A-D) and DMSO control (E-H) are shown. Single X-Y plane images at
apicolateral sections. GFP::dASAP colocalizes with F-actin at cytoplasmic puncta
(arrows) and the circumferential membrane (brackets) after cytochalasin D
treatment. Cellular membrane integrity is indicated by Dlg staining. Merged
images shown in (C and G). Scale bar: 5 μm.
65
Figure 11. GFP::dASAP colocalizes with ectopic cytoplasmic F-actin puncta after Cytochalasin D treatment of embryos at early
gastrulation.
66
2.6 GFP::dASAP and dASAP::GFP share similar localizations during
embryogenesis.
Since GFP tags at either the N-terminus or the C-terminus is close to a protein
domain of dASAP, it raised the concern about whether the GFP tag may disrupt
the correct targeting of dASAP protein. To examine this possibility, I compared
the subcellular localization of GFP::dASAP and dASAP::GFP. At cellularization,
both proteins were localized to and enriched at furrow canals (Figure 12A and B,
white arrows). At dorsal closure, both proteins share their localization at the
apical circumference (Figure 12C and D, red brackets) and surface puncta
(Figure 12C and D, red arrows). Therefore, GFP::dASAP and dASAP::GFP
showed similar subcellular localizations throughout embryogenesis.
67
Figure 12. dASAP::GFP has similar subcellular localizations as
GFP::dASAP at both early and late embryogenesis.
All images are deconvolved. (A-B) Live images of GFP::dASAP (A) and dASAP::
GFP (B) at cellularization are shown. (Top panels) Single X-Y plane images at
basal sections. Both GFP::dASAP and dASAP::GFP localize to furrow canals
(white brackets). (Bottom panels) Cross sections (side) showing invaginating
membranes. Both GFP::dASAP and dASAP::GFP are enriched at furrow canals
(white arrows). (C-D) Live images of GFP::dASAP (C) and dASAP::GFP (D) in
epidermal cells at dorsal closure are shown. Single X-Y plane images at apical
and mid-lateral sections. Both GFP::dASAP and dASAP::GFP localize to the
apical circumference (red brackets) and surface puncta (red arrows). Scale bar: 5
μm.
68
Figure 12. dASAP::GFP has similar subcellular localizations as GFP::dASAP at both early
and late embryogenesis.
69
3. Probing the subcellular localization of dASAP with anti-dASAP
antibodies
To assess the localization of endogenous dASAP by immunofluorescence, I
generated anti-dASAP antibodies.
3.1 Production of anti-dASAP antibody.
To determine which region of dASAP was a suitable immunogen, I
performed sequence comparisons of each protein domain versus the Drosophila
proteome (Figure 13A). The BAR domain was found to have the least sequence
similarity with other Drosophila proteins. However, BAR domains have a high
membrane binding affinity and therefore may make the BAR domain insoluble.
Therefore, the PH domain with the second least similarity was chosen to produce
the antigen. The PH domain was fused with GST, expressed in E. coli, and
purified using glutathione resin. SDS-PAGE analysis confirmed a strong
expression of GST-PH fusion protein with the expected size of 39 kDa without
detectable degradation (Figure 13B).
After injecting two rabbits and two guinea pigs with GST-PH, four antisera
(Rb3, Rb4, GP1 and GP2) were recovered and tested for their use in
immunofluorescence. Preimmune sera of the four animals showed no specific
staining in WT embryos at either cellularization (Figure 14A-D) or dorsal closure
(Figure 14I-L). Immunostaining of embryos at cellularization and dorsal closure
revealed that Rb4 (Figure 14F and N), GP1 (Figure 14G and O), and GP2
(Figure 14H and P) produced specific immunofluorescence signals with similar
70
Figure 13. Purification of GST-PH fusion protein for generation of anti-
dASAP antibodies.
(A) Sequence similarity of each domain of dASAP against other Drosophila
proteins. The similarity of best match for each domain indicated as positive
residue/total residue and the corresponding percentage. Both identical residues
and residues of conservative substitution are considered as positive. (B)
Production of GST tagged PH domain as the immunogen. The single band of
GST-PH is shown on the full lane of a 12% SDS-PAGE gel marked with
molecular weights of a protein ladder.
71
Figure 13. Purification of GST-PH fusion protein for generation of anti-dASAP antibodies.
72
Figure 14. Comparison of immunofluorescence signals from different anti-
dASAP antibodies at both early and late embryogenesis.
Images are not deconvolved and have undergone the same level adjustment.
The immunofluorescence in wild type embryos with preimmune sera or
antibodies is shown. (A-D) The immunofluorescence with preimmune sera of Rb3
(A), Rb4 (B), GP1 (C) and GP2 (D) animals at cellularization are shown. Single
X-Y plane images at apicolateral sections. (E-H) The immunofluorescence with
Rb3 (E), Rb4 (F), GP1 (G) and GP2 (H) antibodies at cellularization is shown.
Single X-Y plane images at apicolateral and basal sections. (I-L) The
immunofluorescence with preimmune serums of Rb3 (I), Rb4 (J), GP1 (K) and
GP2 (L) animals in epidermal cells at dorsal closure are shown. Single X-Y plane
images at apical section. (M-P) The immunofluorescence with Rb3 (M), Rb4 (N),
GP1 (O) and GP2 (P) antibodies in epidermal cells at dorsal closure is shown.
Single X-Y plane images at apical and mid-lateral sections. Scale bar: 5 μm.
73
Figure 14. Comparison of immunofluorescence signals from different anti-dASAP antibodies at both early and late
embryogenesis.
74
patterns. During cellularization, the signals were spotty around the apicolateral
circumference (Figure 14F-H, apicolateral sections) with residual signals at basal
sections (Figure 14F-H, basal sections), unlike GFP::dASAP (as discussed in
section 3.3). At dorsal closure, the signals were smoother and enriched at the
apical circumference (Figure 14N-P, apical sections versus mid-lateral sections).
In contrast, Rb3 did not exhibit specific signals (Figure 14E and M). Among the 3
working antibodies, Rb4 had the weakest signal at cellularization (Figure 14F)
and the highest background fluorescence at dorsal closure (Figure 14N). GP1
and GP2 had similar signal strength at cellularization (Figure 14G and H), but
GP2 had a lower background fluorescence (Figure 14P) at dorsal closure
compared to GP1 (Figure 14O). Consequently, GP2 antibody was chosen for
subsequent analysis.
3.2 The immunofluorescence of anti-dASAP antibody colocalizes with Bazooka
and DE-cadherin during embryogenesis.
Since the immunofluorescence pattern of anti-dASAP antibody was spotty
around the apicolateral circumference at cellularization, it resembled the
localization of Baz and DE-cad at the same stage. To determine whether the
immunofluorescence of anti-dASAP antibody colocalizes with Baz or DE-cad, I
co-immunostained wild type embryos with dASAP, Baz and DE-cad. The
immunofluorescence of anti-dASAP antibody was confirmed to colocalize with
Baz (Figure 15A-C, white arrows) as well as with DE-cad (Figure 15D, red arrow)
in spot adherens junctions (SAJs). However, the immunofluorescence of anti-
75
dASAP antibody and Baz (Figure 15A-C, green arrows) did not extend to the
basal junctions highlighted by DE-cad (Figure 15D, green arrow). To see whether
the colocalization between the immunofluorescence of anti-dASAP antibody and
Baz holds true at later developmental stages, I examined embryos at dorsal
closure. dASAP colocalized with Baz (Figure 15E-G, white arrows) and was
enriched at the apical circumference (Figure 15E, apical section versus mid-
lateral section). The immunofluorescence pattern of anti-dASAP antibody and
Baz were less smooth than that of DE-cad at this stage (Figure 15E-G white
arrows versus Figure 15H, red arrow). Therefore, these data suggest that the
immunofluorescence of anti-dASAP antibody colocalized with the
immunofluorescence of Baz throughout embryogenesis.
3.3 Overexpression of GFP::dASAP alters the immunofluorescence pattern of
anti-dASAP antibody.
The localization of GFP tagged dASAP was different from
immunofluorescence of dASAP. Specifically, both mark the apicolateral
circumference but only the GFP::dASAP constructs localized to the furrow canals
at cellularization and to the apical surface at dorsal closure. Thus, it is important
to test whether the antibody is reliable in detecting dASAP. To determine whether
the antibody can bind to dASAP protein, I stained GFP::dASAP transgenic
embryos with the antibody. In addition to the localization at apicolateral SAJs
(Figure 16B, white arrows), the antibody signal was enriched at the basal furrow
canals labeled by GFP::dASAP (Figure 16A-C, green arrows). At early
76
Figure 15. The immunofluorescence of anti-dASAP antibody colocalizes
with Baz and DE-cad at both early and late embryogenesis.
All images are deconvolved. The immunofluorescence in wild type embryos is
shown. (A-D) dASAP (green) (A), Baz (red) (B), and DE-cad (white) (D) at
cellularization are shown. (Top panels) Single X-Y plane images at apicolateral
and basal sections. The immunofluorescence of anti-dASAP antibody colocalizes
with Baz (white arrows) and DE-cad (red arrow) in spot adherens junctions.
(Bottom panels) Cross sections (side) showing invaginating membranes. The
immunofluorescence of anti-dASAP antibody and Baz are residual in basal
junctions (green arrows). (E-H) dASAP (green) (E), Baz (red) (F), and DE-cad
(white) (H) in epidermal cells at dorsal closure are shown. Single X-Y plane
images at apical and mid-lateral sections. The immunofluorescence of anti-
dASAP antibody colocalizes with Baz (white arrows) and overlaps with DE-cad
(red arrow) at the apical circumference. Merged images shown in (C and G).
Scale bar: 5 μm.
77
Figure 15. The immunofluorescence of dASAP colocalizes with Baz and DE-cad at both early and late embryogenesis.
78
Figure 16. Overexpression of GFP::dASAP alters the subcellular
localization of the immunofluorescence of anti-dASAP antibody at early
embryogenesis.
Images are deconvolved. The immunofluorescence in GFP::dASAP expressing
embryos is shown. (A-D) GFP::dASAP (green) (A), dASAP (red) (B), and DE-cad
(white) (D) at cellularization are shown. (Top panels) Single X-Y plane images at
apicolateral and basal sections. The immunofluorescence of anti-dASAP
antibody colocalizes with DE-cad (white arrows) in spot adherens junctions.
(Bottom panels) Cross sections (side) showing invaginating membranes. The
immunofluorescence of anti-dASAP antibody colocalizes with GFP::dASAP and
is enriched at the furrow canals (green arrows). (E-H) GFP::dASAP (green) (E),
dASAP (red) (F), and DE-cad (white) (H) at early gastrulation are shown. The
immunofluorescence of anti-dASAP antibody colocalizes with GFP::dASAP in
some puncta (red arrows), but not in others (white arrows). Note the
immunofluorescence of anti-dASAP antibody colocalizes with DE-cad in both
cases (red arrows and white arrows). (I-L) GFP::dASAP (green) (I), dASAP (red)
(J), and DE-cad (white) (L) in epidermal cells at dorsal closure are shown. Single
X-Y plane images at apical and mid-lateral sections. The immunofluorescence of
anti-dASAP antibody was not clearly detected in GFP::dASAP-positive puncta at
the apical surface (red arrows). Merged images shown in (C, G and K). Scale bar:
5 μm.
79
Figure 16. Overexpression of GFP::dASAP alters the subcellular localization of the immunofluorescence of anti-dASAP antibody
at early embryogenesis.
80
gastrulation, the immunofluorescence of anti-dASAP antibody colocalized with
GFP::dASAP to some extent around the apicolateral circumference (Figure 16E-
G, red arrows), however the immunofluorescence pattern of anti-dASAP antibody
(Figure 16F, white arrow and red arrow) was more similar to that of DE-cad
(Figure 16H, white arrow and red arrow) than GFP::dASAP (Figure 16E, white
arrow only). At dorsal closure, the immunofluorescence of anti-dASAP antibody
was not clearly detected in GFP::dASAP-positive puncta (Figure 16I-K, red
arrows) at the apical surface in the transgenic embryo. This suggests the
antibody could only bind to GFP::dASAP to some extent.
3.4 Heat fixation changes the immunofluorescence pattern of anti-dASAP
antibody at cellularization.
Another possibility to explain the difference in dASAP localization between
the antibody and GFP results is that the antibodies may not be able to detect all
forms of dASAP due to intramolecular interactions masking the epitope (Jian et
al., 2008; Luo et al., 2008). To attempt to expose all the epitope sites of dASAP, I
used heat fixation before staining wild type embryos with the antibody.
Interestingly, rather than being restricted at apicolateral SAJs (Figure 15A-D,
green arrows), the immunofluorescence of anti-dASAP antibody extended to
basal junctions marked by Arm (Figure 17A-C, white brackets). However, it
seems that the immunofluorescence of anti-dASAP antibody did not extend its
signal to the furrow canals. This was not due to loss of intact furrow canals after
heat fixation, as GFP::dASAP-marked furrow canals were still preserved after
81
Figure 17. Heat fixation alters the subcellular localization of the
immunofluorescence of anti-dASAP antibody at cellularization.
All images are deconvolved. The immunofluorescence in wild type embryos is
shown. (A-C) dASAP (green) (A) and Arm (red) (B) at cellularization are shown.
(Top panels) Single X-Y plane images at apicolateral and basal sections. (Bottom
panels) Cross sections (side) showing invaginating membranes. The
immunofluorescence of anti-dASAP antibody extended to basal junctions and
partially colocalizes with Arm (white brackets). (D-F) GFP::dASAP (green) (D)
and Arm (red) (E) at cellularization are shown. (Top panels) Single X-Y plane
images at basal junctions and furrow canals. (Bottom panels) Cross sections
(side) showing invaginating membranes. Note furrow canals (white arrows)
marked by GFP::dASAP is still intact below basal junctions after heat fixation. (G-
I) GFP::dASAP (green) (G) and Arm (red) (H) in epidermal cells at dorsal closure
are shown. Single X-Y plane images at apical and mid-lateral sections. Note the
immunofluorescence of anti-dASAP antibody is substantially diminished along
the A-P axis (red brackets) after heat fixation. Merged images shown in (C, F and
I). Scale bar: 5 μm.
82
Figure 17. Heat fixation alters the subcellular localization of the immunofluorescence of anti-dASAP antibody at
cellularization.
83
heat fixation (Figure 17D-F, white arrows). The antibody did not detect the apical
surface puncta after heat fixation at dorsal closure (Figure 17G-I). Instead, the
immunofluorescence of anti-dASAP antibody was dramatically reduced along the
anterior-posterior axis in epidermal cells (Figure 17G-I, red brackets versus
Figure 15E-H at apical section). The heat fixation experiments suggest differently
folded forms of dASAP could not fully account for the difference between
GFP::dASAP and the immunofluorescence of anti-dASAP antibody.
3.5 The immunofluorescence of anti-dASAP antibody is not decreased in zygotic
dASAP deletion mutant embryos at dorsal closure.
A third possibility for the discrepancy of localization patterns is that the anti-
dASAP antibody may not be specific for dASAP. To test the specificity of anti-
dASAP antibody, I mixed late embryos from GFP-histone (as wild type) and
Df(2R)Exel7094/CyOTwiGFP lines for immunostaining on the same slide.
Df(2R)Exel7094 is a chromosomal deficiency removing the dASAP gene and
neighboring genes. GFP-negative embryos (no CyOTwiGFP balancer or GFP-
histone) were the zygotic deficiency mutants (Df(2R)Exel7094/ Df(2R)Exel7094),
while GFP-histone positive embryos were wild type. These mutant embryos only
have half the maternal supply and no zygotic expression of dASAP compared to
wild type. Following immunostaining of the embryos, I could not detect any visible
difference between wild type and the zygotic deficiency mutant embryos at either
early (Figure 18A versus B) or late dorsal closure (Figure 18C versus D). This
84
could be explained by two possible reasons: the antibody is not specific enough
for dASAP, or that the maternal supply of dASAP is in excess.
3.6 The immunofluorescence of anti-dASAP antibody is lost in zygotic baz
mutant embryos at dorsal closure.
Since the immunofluorescence of anti-dASAP antibody colocalized with Baz
throughout embryogenesis (see section 3.2), I wondered whether the
immunofluorescence of anti-dASAP antibody was affected in the absence of Baz.
Hence I used a bazXi106/FM7, TwiGFP line (a zygotic baz mutant line) to examine
the immunofluorescence pattern of dASAP at dorsal closure where the maternal
supply of Baz is undetectable by dorsal closure (Tanentzapf and Tepass, 2003).
In wild type like embryos (FM7, TwiGFP/FM7, TwiGFP, FM7, TwiGFP/Y, or
bazXi106/FM7, TwiGFP), the signal of dASAP was strong at the apical
circumference (Figure 19A). In contrast, the immunofluorescence of anti-dASAP
antibody was lost in zygotic baz mutant embryos at dorsal closure (Figure 19B).
This suggests Baz may be responsible for recruiting dASAP to the apical
circumference. However, one concern is that an antibody against Baz was raised
at the same time as the ones for dASAP and regenerated glutathione resin
exposed to Baz fusion proteins was used to purify the GST-PH fusion protein. As
a result, the anti-dASAP antibodies may be contaminated by anti-Baz antibodies.
85
Figure 18. Comparison of the immunofluorescence of anti-dASAP antibody
between wild type embryos and zygotic dASAP deficiency embryos at
dorsal closure.
Images are not deconvolved and have undergone the same level adjustment in
each group (A and B, C and D). (A-B) The immunofluorescence of anti-dASAP
antibody in epidermal cells of wild type (GFP-histone) (A) and zygotic deficiency
mutant (Df(2R)Exel7094/ Df(2R)Exel7094) (B) embryos at early dorsal closure
are shown. Single X-Y plane images at apical sections. (C-D) The
immunofluorescence of anti-dASAP antibody in epidermal cells of wild type
(GFP-histone) (C) and zygotic deficiency (D) embryos at late dorsal closure are
shown. Single X-Y plane images at apical sections. Scale bar: 5 μm.
86
Figure 18. Comparison of the immunofluorescence of anti-dASAP antibody between wild type embryos
and zygotic dASAP deficiency embryos at dorsal closure.
87
Figure 19. The immunofluorescence of anti-dASAP antibody is absent in
zygotic baz mutant embryos at dorsal closure.
Images are not deconvolved and have undergone the same level adjustment. (A-
B) dASAP (green) and Arm (red) in epidermal cells of wild-type like (A) and
zygotic baz mutant (B) embryos at dorsal closure are shown. Single X-Y plane
images at apical sections. Cellular membrane integrity is indicated by Arm
staining. Merged images shown in the panels on the right. Scale bar: 5 μm.
88
Figure 19. The immunofluorescence of anti-dASAP antibody is absent in zygotic baz mutant embryos at dorsal closure.
89
4. Generation of a new mutant allele of dASAP
To assess how dASAP affects epithelial cell polarity, I pursued a loss-of-
function approach. However, since the original P-element mutant line used in the
baz genetic interaction screen was adult viable, I decided to generate a new
mutant allele, hoping for a stronger phenotype.
In the original mutant line the P element (KG03963) is inserted just upstream
of the start codon of the dASAP gene (Figure 20A). Therefore I employed
imprecise P element excision to delete the downstream flanking sequence to
generate a new mutant allele. To do this, I introduced the transposase source to
the original mutant line in order to mobilize the P element. Then I established 400
lines from white-eyed male offspring in the F2 generation (Figure 20B). Using a
three-primer PCR genotyping strategy (adapted from Tepass lab, University of
Toronto) (Figure 20C), I recovered 18 lines with downstream deletions and 23
lines with deletions on both sides. The lines with upstream deletions were
excluded as they affect the upstream neighboring gene.
After further mapping, the allele of dasap908WB was found to have a
downstream deletion of 1.75 kb (Figure 21A). The deletion includes the latter half
of the first exon and the first half of the first intron. The deleted portion of the first
exon contains the last 33 bps of the 5’ UTR (Untranslated region) and 129 bps of
the coding region with the start codon. In addition, a partial inverted repeat
sequence was present at the junction of the upstream sequence and
downstream sequence after deletion (Figure 21B). This new line is adult viable,
but may have fertility defects (see the discussion and future directions section).
90
Figure 20. Using imprecise P-element excision to screen for new dASAP
mutant alleles.
(A) Genomic architecture of dASAP gene. 5’ and 3’ UTR labeled as white box.
Coding region labeled as black box. The P element “KG03963” is inserted 40 bps
upstream of the start codon in the first exon. Scale bar: 1 kb. (B) The mating
scheme to establish lines with P element excision. Deletion marked by “-()-“. (C)
PCR genotyping to identify the nature of P element excisions. Single male fly of
F3 or F4 generation is genotyped. Three primers are used. The forward primer
(FR) binds to the sequence upstream of the P element insertion site. The reverse
primer (RP) binds to the sequence downstream of the P element insertion site.
The universal primer (UniP) binds to the inverted repeat (IR) at each border of P
element. Please refer to Appendix I for the information of primers. The upstream
amplicon is 0.56 kb and the downstream amplicon is 0.98 kb. When P element is
absent in wild type or precisely excised, the whole amplicon is 1.54 kb. P
element excision events are classified into five categories with examples of PCR
results. Deletion marked by brackets. Depending on the extent of the deletion,
not all possible PCR results are shown in internal deletion, upstream deletion,
downstream deletion and deletion on both sides. The flies used in all examples
were -()-/CyO so the1.54 kb product was always amplified from the balancer
chromosome.
91
Figure 20. Using imprecise P-element excision to screen for new dASAP mutant alleles.
92
Figure 21. dasap908WB has a 1.75 kb downstream deletion including the start
codon.
(A) The position and length of the deletion in the dasap908WB allele. PCR
genotyping mapped the deletion in candidate lines with either downstream
deletion or deletion on both sides. The forward primer (FP) is either paired with
the reverse primer 1 (RP1) to map the deletion within 2.57 kb or the reverse
primer 2 (RP2) to map the deletion between 2.57 kb and 5.76 kb (please refer to
Appendix I for the information of primers). Scale bar: 1 kb. (B) Sequence analysis
of the junction between the upstream and downstream sequence after deletion.
The upstream and downstream sequences are marked by black-lined boxes.
Partial sequence of the inverted repeat is present between the upstream and
downstream sequence.
93
Figure 21. dasap908WB
has a 1.75 kb downstream deletion including the start codon.
94
5. Subcellular localization of deletion constructs of dASAP
To determine how each protein domain of dASAP contributes to its localization
and functions, I made six N-terminal GFP-tagged deletion constructs which lack
each of the six domains/regions.
5.1 All six deletion constructs have similar localizatons to the full length
GFP::dASAP at cellularization and dorsal closure.
To assess whether any protein domain is essential to localize dASAP, I
analyzed the subcellular localizations of all six deletion constructs at
cellularization and dorsal closure. At cellularization, all six deletion constructs
retained the localizations similar to the full length GFP::dASAP (Figure 12A): the
localization to (Figure 22A-F, green brackets) and being enriched (Figure 22A-F,
white arrows) at the furrow canals. In addition, GFP::dASAPΔGAP was
mislocalized in tubular structures below furrow canals (Figure 22C, red arrow).
GFP::dASAPΔSH3 appeared weakly at the basolateral membrane with
substantial cytosolic fluorescence (Figure 22F). At dorsal closure similar to the
full-length GFP::dASAP (Figure 12C), all deletion constructs highlighted the
apical circumference (Figure 22G-L, red brackets) and apical surface puncta
(Figure 22G-L, green arrows). The difference of localization between
cellularization and dorsal closure suggests early embryogenesis may be more
sensitive to reveal roles for the protein domains of dASAP.
95
Figure 22. Subcellular localization of GFP-tagged dASAP deletion protein at
both early and late embryogenesis.
All images are deconvolved. (A-F) Live images of GFP::dASAPΔBAR (A),
GFP::dASAPΔPH (B), GFP::dASAPΔGAP (C), GFP::dASAPΔAKR (D),
GFP::dASAPΔProR (E), and GFP::dASAPΔSH3 (F) at cellularization are shown.
(Top panels) Single X-Y plane images at basal sections. All deletion constructs
have similar localizations at furrow canals (green brackets), however
GFP::dASAPΔSH3 also seems to have relatively higher cytosolic fluorescence.
(Bottom panels) Cross sections (side) showing invaginating membranes. All
deletion constructs are enriched at furrow canals (white arrows), but
GFP::dASAPΔGAP is present in tubules underneath the furrow canals (red
arrow). (G-L) Live images of GFP::dASAPΔBAR (G), GFP::dASAPΔPH (H),
GFP::dASAPΔGAP (I), GFP::dASAPΔAKR (J), GFP::dASAPΔProR (K), and
GFP::dASAPΔSH3 (L) in epidermal cells at dorsal closure are shown. Single X-Y
plane images at apical and mid-lateral sections. All deletion constructs localize to
the apical circumference (red brackets) and surface puncta (green arrows). Scale
bar: 5 μm.
96
Figure 22. Subcellular localization of GFP-tagged dASAP deletion protein at both early and late
embryogenesis.
97
5.2 GFP::dASAPΔGAP mislocalizes during early embryogenesis
To characterize the mislocalization of GFP::dASAPΔGAP at cellularization, I
used live imaging to analyze its subcellular localization from late syncytial cell
divisions to early gastrulation. Compared to full-length GFP::dASAP (Figure 23D-
F), GFP::dASAPΔGAP was strongly associated with invaginating membranes
(Figure 23A-C, side views) and mislocalized to tubules as early as late syncytial
divisions (Figure 23A at basal section and side view, white arrows). These
tubular structures were present at early to mid cellularization (Figure 23B, white
arrows). At early gastrulation, large puncta formed along the circumferential
membrane at apical and subapical sections (Figure 23C at the subapical section
and side view, red arrows), in contrast to the full-length GFP::dASAP at the same
stage (Figure 23F).
The tubular structures present at late syncytial divisions and cellularization
were strikingly similar to the Amphiphysin-positive endocytic tubular intermediate
structure described previously by Sokac and Wieschaus (2007) at the same
developmental stages. Therefore, to determine whether these
GFP::dASAPΔGAP-positive tubules are Amphiphysin-positive, I immunostained
GFP::dASAPΔGAP transgenic embryos with Amphiphysin and F-actin. In spite of
the similarity in localizations, GFP::dASAPΔGAP did not colocalize with
Amphiphysin at the subapical circumference (Figure 23G-J, brackets), but did at
some basal tubules (Figure 23G-J insets, blue arrows). These tubules were F-
actin negative (Figure 23G-J insets, blue arrows, and side view, green arrows). In
some of the tubules, GFP::dASAPΔGAP did not completely overlap with
98
Amphiphysin (Figure 23G-J, the green arrow on the left versus the one on the
right in each side view), indicating GFP::dASAPΔGAP may not decorate the
tubular structure in the same way as Amphiphysin.
99
Figure 23. GFP::dASAPΔGAP mislocalizes to special cellular structures
throughout early embryogenesis.
All images are deconvolved. (A-C) Live images of GFP::dASAPΔGAP at late
syncytial cell divisions (A), cellularization (B), and early gastrulation (C) are
shown. (Top panels) Single X-Y plane images at basal sections (A and B) or the
subapical section (C). Compared to GFP::dASAP, GFP::dASAPΔGAP
mislocalizes to tubules (white arrows) below furrow canals from late syncytial cell
divisions to cellularization, and to large puncta along the cell circumference (red
arrow) at early gastrulation. (Bottom panels) Cross sections (side) showing
lateral membranes. Compared to GFP::dASAP, GFP::dASAPΔGAP localizes to
tubule (A and B, white arrows) below invaginating membranes, and to large
puncta along the lateral membrane (C, red arrow). (D-F) Live images of
GFP::dASAP at late syncytial cell divisions (D), cellularization (E), and early
gastrulation (F) are shown. (Top panels) Single X-Y plane images at basal
sections (D and E) or subapical section (F). (Bottom panels) Cross sections (side)
showing lateral membranes. (G-J) GFP::dASAPΔGAP (green) (G), Amphiphysin
(red) (H) and F-actin (white) (I) at late syncytial cell divisions are shown. (Top
panels) Single X-Y plane images at subapical and basal sections.
GFP::dASAPΔGAP does not colocalize with Amphiphysin (brackets) at subapical
sections, however GFP::dASAPΔGAP colocalizes with Amphiphysin in some
tubules (insets, blue arrows) below the basal membranes. Note F-actin is absent
in these tubules (inset, blue arrow). (Bottom panels) Cross sections (side)
showing lateral membranes. Both GFP::dASAPΔGAP and Amphiphysin decorate
the tubules (green arrows) below the basal membranes. Merged image shown in
(J). Abbreviation: GFP::ΔGAP (GFP::dASAPΔGAP). Scale bar: 2.5 μm (inset), 5
μm (others).
100
Figure 23. GFP::dASAPΔGAP mislocalizes to special cellular structures throughout early embryogenesis.
101
DISCUSSION AND FUTURE DIRECTIONS
1. Our screen suggests connections between membrane trafficking and
epithelial cell polarity
The localization of GFP-tagged candidate proteins encoded by baz-
interacting genes suggests that proteins of diverse localization and function work
with Baz to regulate ECP. Some of the candidates have been confirmed to be
involved in ECP. For example, the protein phosphatase Sds22 was recently
shown to regulate cell polarity and morphology in Drosophila epithelia of imaginal
discs and follicles (Grusche et al., 2009).
Many of the GFP-tagged candidate proteins localized to membrane
structures, such as the plasma membrane (dASAP, Arf79F, CG11210, Sds22,
and Septin5), the Golgi apparatus (Fj) (Ishikawa et al., 2008), the ER (Alt,
CG8523, CG10702), and possibly clathrin-coated vesicles (CG1951) (Conner
and Schmid, 2005). This may reflect the extensive connections between
membrane trafficking and epithelial cell polarity.
2. Polarized localizations of Arf GTPases and their regulators suggest a
general involvement in epithelial cell polarity in Drosophila
Based on the localization of GFP tagged constructs, both dArf1 and dASAP
localize to the apical circumference in Drosophila embryonic epithelia. dArf6 was
previously shown to localize to the basolateral membrane (Huang et al., 2009).
Hence the polarized localization of Arf GTPases and their regulators suggest
they may be involved in epithelial cell polarity in Drosophila. The presence of
102
both dASAP (Arf1 GAP) and dArf1 at the apical domain is somewhat surprising
since the GAP activity of dASAP activity would be expected to inactivate and
dissociate dArf1 from the apical circumference. Rather, another mechanism
(possibly involving an Arf GEF) may recruit dArf1 to the apical circumference,
and dASAP may regulate the association of dArf1 with the membrane locally in
the apical domain. Intriguingly, I detected no evidence for the association of
dASAP with the ER or Golgi apparatus, suggesting that it may regulate dArf1 at
the plasma membrane. Alternatively, dASAP might play a role in segregating
dArf6 from the apical domain.
Although Arf1 is thought to function mainly at the Golgi apparatus, increasing
evidence suggests Arf1 may also regulate endocytosis at the plasma membrane
in addition to effects at the Golgi apparatus (Luo et al., 2005; Kumari and Mayor,
2008). Since both dArf1 and dASAP localize to the apical circumference in
Drosophila embryonic epithelia, it suggests a possible interaction between dArf1
and dASAP at the plasma membrane here as well. I hypothesize the interaction
may regulate endocytosis at the apical domain (Figure 24). Future work will
analyze the genetic, physical and functional interaction between dArf1 and
dASAP.
To test for genetic interactions between dArf1 and dASAP, the darf1 mutant
will be crossed to the dasap mutant in order to check whether the cuticle
phenotype is enhanced compared to single mutant lines. If they do interact, this
would be followed up with analysis of defects in polarity complex localization.
103
Figure 24. The model of the role of dASAP in endocytosis at the apical
domain of epithelial cells.
dASAP may regulate the endocytosis at the apical domain of epithelial cells by
coordinating the actin cytoskeleton and dArf1. Upon recruitment by the actin
cytoskeleton at the site of endocytosis, dASAP may remodel the actin
cytoskeleton. Meanwhile, dASAP may regulate the timing of dArf1 activity. The
BAR domain of dASAP may also facilitate the endocytosis by inducing
membrane curvature. Abbreviation: dArf1 (Drosophila Arf1), dASAP (Drosophila
ASAP).
104
Figure 24. The model of the role of dASAP in endocytosis at the apical domain of epithelial cells.
105
Specifically, the apical polarity proteins (e.g. Crb and Baz) and AJ components
(e.g. DE-cad) could be stained during late embryogenesis.
To evaluate a physical interaction between dArf1 and dASAP, the
colocalization between the immunofluorescence of anti-dASAP antibody and
dArf1::GFP will be examined. The physical interaction between dASAP and dArf1
will be confirmed by co-immunoprecipitation experiments. Specifically,
endogenous dASAP could be immunoprecipitated from wild type embryo lysates
with the anti-dASAP antibody, and then the samples could be probed for
endogenous dArf1 by anti-dArf1 antibody (Kametaka et al., 2010) after western
blotting. This could also be done in the reciprocal way. If such
immunoprecipitations failed, overexpressed GFP::dASAP could be
immunoprecipitated from transgenic embryo lysates with anti-GFP antibody and
then the sample could be probed for endogenous dArf1 with anti-dArf1 antibody
or vice versa. To determine whether the GAP domain of dASAP is important for
this interaction, overexpressed GFP::dASAPΔGAP could be immunoprecipitated
by anti-GFP antibody, and then the samples could be probed for dArf1. To
confirm dASAP is a dArf1-specific GAP, the GAP activity of dASAP against dArf1
could be compared versus other Drosophila Arf GTPases. Specifically, the in
vitro GTP hydrolysis rates of Arf GTPase with and without the presence of the
dASAP GAP domain could be measured respectively and compared.
To analyze the functional interaction between dArf1 and dASAP, the
localization of dArf1 will be examined in the dasap mutant and vice versa. In
particular, the localization of dArf1::GFP in the dasap mutant and the localization
106
of dASAP::GFP in the darf1 mutant will be examined. These experiments will
show how dArf1 and/or dASAP may affect the positioning of the other protein.
Since dASAP may regulate the membrane association of dArf1, dArf1::GFP may
be expected to mislocalize in the dasap mutant with stronger plasma membrane
localization, whereas dASAP::GFP may localize normally in the darf1 mutant.
However, if dASAP functions as a dArf1 effector than just dArf1 GAP (Nie et al.,
2006), it is possible that dASAP::GFP may show weaker plasma membrane
localization in the darf1 mutant.
3. Interaction with the actin cytoskeleton may be important for the
localization and function of dASAP.
I have shown that dASAP colocalizes with the actin cytoskeleton and its
localization partially depends on the actin cytoskeleton. Such dependence on the
actin cytoskeleton is also present in Arf GEFs (Macia et al., 2008). Therefore, I
propose that the actin cytoskeleton may serve as a scaffold to localize Arf GAPs
and Arf GEFs. On the other hand, many Arf GAPs (including ASAP1) and Arf
GEFs are well known regulators of the actin cytoskeleton (Randazzo et al., 2007;
Gillingham and Munro, 2007). To test whether dASAP regulates the actin
cytoskeleton, the localization of the actin cytoskeleton could be assessed upon
the disruption of dASAP function in the dasap mutant. Specifically, phalloidin
staining of actin in the dasap mutant could examine whether there is
mislocalization/disruption of the actin cytoskeleton in the mutant. Live imaging
107
with a GFP-tagged protein probe for actin could assess whether the actin
dynamics are altered in the mutant.
Therefore, it is possible that the actin cytoskeleton may recruit dASAP
which then reorganizes the actin cytoskeleton. The actin cytoskeleton and
dASAP may work in concert to regulate cellular processes such as endocytosis
(Figure 24). It will be interesting to see whether disruption of F-actin by mild
treatment with cytochalasin D in early embryos may mislocalize the GFP-tagged
full-length dASAP proteins to similar tubular structures seen in
GFP::dASAPΔGAP early embryos.
4. A loss of function approach to analyze the role of dASAP in epithelial
cell polarity.
To use a loss of function approach to study the role of dASAP in ECP, the
new mutant allele dasap908WB was constructed. However, the fly line carrying this
allele needs to be further characterized.
I have noticed some flies in the original homozygous viable mutant line
KG03963 still retain the balancer chromosome. My attempts at crossing
homozygous mutants to each other failed, suggesting that the homozygous
mutant flies have a fertility problem. This may also be the case in the new mutant
line 908WB. To test the fertility phenotype, homozygous male or female flies from
both mutant lines will be crossed to the opposite sex of wild type flies. To
measure the fertility, the total number of eggs and the number of unfertilized
eggs will be counted and compared between the mutant lines and wild type. If
108
the homozygous male flies are sterile, the dasap phenotype will be analyzed in
maternal/zygotic mutant embryos by crossing heterozygous male to homozygous
female. If the homozygous female flies are sterile, phenotypic analyses will be
performed in oogenesis.
To determine whether this sterility is a null phenotype, the dasap908WB allele
has to be confirmed as a null allele. The start codon is removed in this allele,
which may abolish the translation of dASAP protein. To test whether the
expression of dASAP gene is diminished, immunostaining with anti-dASAP
antibody will be used to assess the protein level in mutant tissues including testis
(male sterility) or ovary (female sterility). Alternatively, Real-time PCR will be
used to assess the transcript level from the same mutant tissue. To test whether
the allele causes the null phenotype, the allele will be crossed to the deficiency
line Df(2R)Exel7094 in order to see whether the phenotype of dasap908WB/
Df(2R)Exel7094 flies will be stronger than dasap908WB alone. If the phenotype is
similar, then it is likely a null allele.
To test if the allele affects the dASAP gene only, real-time PCR will be
performed to assess the expression of neighboring genes. In addition, the
specificity of the allele will be confirmed by seeing whether its phenotype can be
rescued by GFP-tagged full-length and/or deletion constructs of dASAP.
5. dASAP’s domains may be redundant in localizing the protein.
The localizations of six GFP-tagged deletion constructs removing the
individual protein domains of dASAP are similar to that of the full-length dASAP
109
construct, suggesting that multiple domains may function redundantly to recruit
dASAP protein to the apical domain. For example, the PH domain may bind to
PIP2 while the proline-rich region may mediate the interaction of dASAP with the
actin cytoskeleton through binding to actin associated proteins. Deletion of
multiple domains in dASAP is required to further elucidate its localization
mechanism.
The function of each domain may not be redundant. For instance, the BAR
domain probably functions in membrane deformation while the SH3 domain may
convey downstream signaling. This possibility will be tested by examining the
ability of each deletion construct to rescue the dasap mutant phenotype. Roles
for the domains in the recruitment or exclusion of other proteins from the apical
domain could also be tested by overexpressing each deletion construct and
looking for distinct effects.
6. The mislocalization of GFP::dASAPΔGAP at early embryogenesis
suggests a role for the GAP domain in regulating plasma membrane
association
The mislocalization of GFP::dASAPΔGAP (which has the GAP domain
removed) at early embryogenesis suggests an enhanced interaction between
dASAP protein and the plasma membrane. Compared to the full-length and other
deletion constructs of dASAP, GFP::dASAPΔGAP seems to be strongly
associated with the membrane with extremely low cytosolic fluorescence. It is
possible that the interaction between the GAP domain and Arf GTPase(s) affects
110
the membrane association of dASAP. The binding of GAP domain to Arf
GTPase(s) may signal the release of dASAP from the membrane, and in the
absence of the GAP domain, dASAP would be retained along the membrane
(Figure 25, model 1). Such a relationship should be apparent when analyzing
dASAP localization in the darf1 mutant. Also, to test if the GAP activity is required
for the dissociation, the localization of GFP-tagged dASAP with a single point
mutation in the GAP domain that abolishes the GAP activity could be examined.
The enhanced plasma membrane localization of GFP::dASAPΔGAP may
also be due to the loss of interactions between dASAP’s protein domains (Figure
25, model 2). A previous study suggests the BAR domain may bind to and inhibit
the GAP domain through intramolecular interactions (Jian et al., 2008). It is also
possible that the GAP domain normally inhibits the BAR domain. The absence of
the GAP domain may lead to the hyperactivity of the BAR domain which
subsequently induces stronger membrane association and membrane tubulation.
Deleting the BAR domain in addition to the GAP domain
(GFP::dASAPΔBARΔGAP) could assess whether the interaction between the
GAP domain and the BAR domain regulates membrane localization of dASAP.
The tubular structure at the furrow canals may naturally exist or be induced
by GFP::dASAPΔGAP. To determine whether GFP::dASAPΔGAP induces or just
mislocalizes to the tubular structures, the tubular structures will be compared
between wild type embryos and GFP::dASAPΔGAP embryos with anti-
Amphiphysin antibody from late syncytial division to late cellularization. A third
111
Figure 25. Models of the role of the GAP domain in the plasma membrane
association of dASAP.
Two models are shown to explain the role of the GAP domain in the plasma
membrane association of dASAP. In the first model, the GAP activity may
regulate the activity of Arf GTPases, which in turn modulate membrane
association and tubulation through downstream signaling. The absence of the
GAP domain may deregulate Arf GTPases, which eventually causes the
mislocalization of the deletion protein to the tubular structure. In the second
model, the BAR domain binds to and inhibit the activity of the GAP domain.
Meanwhile, this intramolecular interaction allows the GAP domain to sequester
the BAR domain. Once the interaction is relieved, the BAR domain can then bind
to the membrane and induced membrane curvature. Therefore, the absence of
the GAP domain in GFP::dASAPΔGAP may lead to hyperactivity of the BAR
domain, which results in mislocalization of the deletion protein to the tubular
structures. Abbreviation: AKR (Ankyrin repeat), Arf (ADP ribosylation factor),
BAR (Bin/Amphiphysin/Rvs domain), GAP (GTPase-activating protein domain),
PH (Pleckstrin homology domain), SH3 (Src homology 3 domain).
112
Figure 25. Models of the role of the GAP domain in the plasma membrane association of dASAP.
113
possibility is that GFP::dASAPΔGAP mislocalizes to pre-existing tubules and
induces new tubules. This is supported by the fact that some tubules are marked
by both GFP::dASAPΔGAP and Amphiphysin with other tubules by
GFP::dASAPΔGAP or Amphiphysin alone. Another marker may be needed to
stain for these tubular structures. If it appears to induce tubules, this may be
attributed to the overactive BAR domain. Alternatively, the absence of the GAP
domain could lead to dArf1 misregulation and thus endocytic vesicle scission
defects.
In addition to the tubular structures at earlier stages of embryogenesis, the
large puncta along the plasma membrane at early gastrulation may be another
good place to analyze the function of dASAP. First, long-term live imaging may
be performed to determine whether these large puncta appear de novo or
originate from the tubular structures at earlier stages. To see if any polarity
players mislocalize in these puncta, polarity (e.g. Baz, Crumbs, and aPKC) and
junctional (e.g. DE-cad) proteins will be stained. Since GFP::dASAP normally
colocalizes with the actin cytoskeleton, F-actin will also be stained to see if it
abnormally accumulates in these puncta. Finally, to test if those puncta could be
attributed to endocytic defects, one could stain for endocytic markers, such as
dynamin.
114
7. Solving the discrepancy between GFP-tagged dASAP and the
immunofluorescence of the anti-dASAP antibody
To solve the discrepancy between the localization of dASAP using GFP-
tagged dASAP and the immunofluorescence of the anti-dASAP antibody, the
following experiments will be done.
Although the dASAP proteins with the N-terminal and C-terminal GFP tag
have similar localizations, GFP-tagged dASAP may not be fully functional and
thus may mislocalize to ectopic sites. To test whether GFP-tagged dASAP is
functional or not, the ability of GFP tagged full-length dASAP constructs to
rescue the phenotype of the dasap mutant line will be tested.
To address the possible technical issue in generating the antigen for dASAP
antibody, the anti-dASAP antibodies of Rb4, GP1 and GP2 will be affinity purified
to remove any possible contamination of anti-Baz antibodies or other antibodies.
The immunofluorescence localization of the purified antibodies will be determined
to see if it becomes more similar to the localization of GFP-tagged dASAP. The
specificity of the purified antibody will also be assessed in dasap mutant tissues
where there are no dASAP proteins.
8. Summary
My work shows an association between dASAP and actin at the apical
domain of epithelial cells. The six domains of dASAP appear to act redundantly
to localize dASAP to the apical domain. Interactions of the GAP domain however
with other domain(s)/protein(s) affecting membrane association and tubulation
115
are apparent. This indicates dASAP may interact with the actin cytoskeleton and
regulate the trafficking at the plasma membrane in Drosophila epithelia. Future
work is required to determine the role of dASAP in epithelial cell polarity.
116
REFERENCES
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2008).
Molecular Biology of the Cell. 5th edition, New York, Garland Science.
Apodaca, G. (2001). Endocytic traffic in polarized epithelial cells: role of the actin
and microtubule cytoskeleton. Traffic. 2: 149-159.
Bayraktar, J., Zygmunt, D., Carthew, R.W. (2006). Par-1 kinase establishes cell
polarity and functions in Notch signaling in the Drosophila embryo. Journal of Cell
Science. 119: 711–721.
Benton, R. and St Johnston, D. (2003A). A conserved domain in Drosophila
Bazooka/PAR-3 is important for apical localization and epithelial polarity. Current
Biology. 13: 1330-1334.
Benton, R., and St Johnston, D. (2003B). Drosophila PAR-1 and 14-3-3 inihibit
Bazooka/PAR-3 to establish complementary cortical domain in polarized cells.
Cell. 115: 691-704.
Bertet, C., Sulak, L., and Lecuit, T. (2004). Myosin –dependent junction
remodeling controls planar cell intercalation and axis elongation. Nature. 429:
667-671.
Bilder, D., Schober, M., and Perrimon, N. (2002). Integrated activity of PDZ
protein complexes regulates epithelial polarity. Nature Cell Biology. 5: 53-58.
Blankenship, J.T., Backovic, S.T., Sanny, J.S.P., Weitz, O., and Zallen, J.A.
(2006). Multicellular rosette formation links planar cell polarity to tissue
morphogenesis. Developmental Cell. 11: 459-470.
117
Blankenship, J.T., Fuller, M.T., and Zallen, J.A. (2007). The Drosophila homolog
of the Exo84 exocyst subunit promotes apical epithelial identity. Journal of Cell
Science. 120: 3099-3110.
Bonifacino, J.S. (2004). The GGA proteins: adaptors on the move. Nature
Reviews Molecular Cell Biology. 5: 23-32.
Bonifacino, J. S., and Glick, B. S. (2004).The mechanisms of vesicle budding and
fusion. Cell. 116: 153–166.
Brown, H.A., Gutowski, S., Moomaw, C.R., Slaughter, C., and Sternweis, P.C.
(1993). ADP-ribosylation factor, a small GTPase-dependent regulatory protein,
stimulates phospholipase D activity. Cell. 75: 1137-1144.
Brown, M.T., Andrade, J., Radhakrishna, H., Donaldson, J.G., Cooper, J.A., and
Randazzo, P.A. (1998). ASAP1, a phospholipid-dependent Arf GTPase-
activating protein that associates with and is phosphorylated by Src. Molecular
and Cellular Biology. 18: 7038-7051.
Chen, L., Wang, Z., Zhu, J., and Zhan, X. (2006). Roles of cortactin, an actin
polymerization mediator, in cell endocytosis. Acta Biochimica et Biophysica
Sinica. 38: 95-103.
Conner, S.D., and Schmid, S.L.(2005). CVAK104 is a novel poly-L-lysine-
stimulated kinase that targets the β2-subunit of AP2. Journal of Biological
Chemistry. 280: 21539-21544.
Cox, R., Kirkpatrick, C., and Peifer, M. (1996). Armadillo is required for adherens
junction assembly, cell polarity and morphogenesis during Drosophila
embryogenesis. Journal of Cell Biology. 134: 133-148
118
David, D.J., Tishkina, A., and Harris, T.J. (2010). The PAR complex regulates
pulsed actomyosin contractions during amnioserosa apical constriction in
Drosophila. Development. 137: 1645-1655.
D’Souza-Schorey, C., and Chavrier, P. (2006). Arf proteins: roles in membrane
traffic and beyond. Nature Reviews Molecular Cell Biology. 7: 347-358.
Ehlers, J.P., Worley, L., Onken, M.D., and Harbour, J.W. (2005). DDEF1 is
located in an amplified region of chromosome 8q and is overexpressed in uveal
melanoma. Human Cancer Biology. 11: 3609-3613.
El Annan, J., Brown, D., Breton, S., Bourgoin, S., Ausiello, D.A., and Marshansky,
V. (2004). Differential expression and targeting of endogenous Arf1 and Arf6
small GTPases in kidney epithelial cells in situ. American Journal of Physiology-
Cell Physiology. 286:768-778.
Fehrenbacher, K., Huckaba, T., Yang , H., Boldogh, I., and Pon, L. (2006). Actin
comet tails, endosomes and endocytosis. The Journal of Experimental Biology.
206: 1977-1984.
Folsch, H. (2008). Regulation of membrane trafficking in polarized epithelial cells.
Current Opinion in Cell Biology. 20: 208-213.
Fox, D.T., Homem, C.C., Myster, S.H., Wang, F., Bain, E.E., and Peifer,
M. (2005). Rho1 regulates Drosophila adherens junctions independently of
p120ctn. Development. 132: 4819–4831.
Fricke, R., Gohl, C., Dharmalingam, E., Grevelhorster, A., Zahedi, B., Harden, N.,
Kessels, M., Qualmann, B., and Bogdan, S. (2009). Drosophila Cip4/Toca-1
119
integrates membrane trafficking and actin dynamics through WASP and
SCAR/WAVE. Current Biology. 19: 1429-1437.
Frost, A., Unger, V.M., and Camilli, P.D.(2009). The BAR domain superfamily:
membrane-molding macromolecules. Cell. 137: 191-196
Gaidos, G., Soni, S., Oswald, D.J.,Toselli, P.A., and Kirsch, K.H. (2007).
Structure and function analysis of the CM5/CIN85 protein family identifies actin-
bundling properties and heterotypic-complex formation. Journal of Cell Science.
120: 2366-2377.
Georglou, M., Marinari, E., Burden, J., and Baum, B. (2008). Cdc42, PAR-6, and
aPKC regulate Arp2/3-mediated endocytosis to control local adherens junction
stability. Current Biology. 18: 1631-1638.
Gillingham, A.K., and Munro, S. (2007). The small G proteins of the Arf Family
and their regulators. Annual Reviews of Cell and Developmental Biology. 23:579-
611.
Grant, B.D., and Donaldson, J.G. (2009). Pathways and mechanisms of
endocytic recycling. Nature Reviews Molecular Cell Biology. 10: 597-608.
Grusche, F.A., Hidalgo, C., Fletcher, G., Sung, H., Sahai, E., and Thompson, B.J.
(2009). Sds22, a PPI phosphatase regulatory subunit, regulates epithelial cell
polarity and shape. BMC Developmental Biology. 9:14.
Harris, K.P., and Tepass, U. (2008). Cdc42 and PAR proteins stabilize dynamic
adherens junctions in the Drosophila neuroectoderm through regulation of apical
endocytosis. Journal of Cell Biology.183:1129-1143.
120
Harris, T.J., and Peifer, M. (2004). Adherens junction-dependent and –
independent steps in the establishment of epithelial cell polarity in Drosophila.
Journal of Cell Biology. 167: 135-147.
Harris, T.J., and Peifer, M. (2005). The positioning and segregation of apical
cues during epithelial polarity establishment in Drosophila. Journal of Cell Biology.
170: 813-823.
Harris, T.J., and Tepass, U. (2010). Adherens junctions: from molecules to
morphogenesis. Nature Reviews Molecular Cell Biology. 11: 502-514.
Hashimoto, S., Onodera, Y., Hashimoto, A., Tanaka, M., Hamaguchi, M.,
Yamada, A., and Sabe, H. (2003). Requirement for Arf6 in breast cancer invasive
activities. Proceedings of National Academy of Science USA. 101: 6647-6652.
Honda, A., Nogami, M., Yokozeki, T., Yamazaki, M., Nakamura, H., Watanabe,
H., Kawamoto, K., Morris, A.J., Frohman, M.A., and Kanaho, Y.(1999).
Phosphatidylinositol 4-phosphate 5-kinase α is a downstream effector of the
small G protein Arf6 in membrane ruffle formation. Cell. 99: 521-632.
Huang, J., Zhou, W., Dong, W., Watson, A.M., and Hong, Y. (2009). Directed,
efficient, and versatile modifications of the Drosophila genome by genomic
engineering. Proceedings of National Academy of Science USA. 106: 8284-8289.
Ikenouchi, J., and Umeda, M. (2010). FRMD4A regulates epithelial polarity by
connecting Arf6 activation with the PAR complex. Proceedings of National
Academy of Science USA. 107: 748–753.
Inoue, H., Ha, V.L, Prekeris, R., and Randazzo, P.A. (2008). Arf GTPase-
activating protein ASAP1 interacts with Rab11 effector FIP3 and regulates
121
pericentrosomal localization of transferring receptor-positive recycling endosome.
Molecular Biology of the Cell. 19: 4224-4237.
Ishikawa, H.O., Takeuchi, H., Haltiwanger, R.S., and Irvine, K.D. (2008). Four-
jointed is a Golgi kinase that phosphorylates a subset of cadherin domains.
Science. 321: 401-404.
Jian, X., Brown, P., Schuck, P., Gruschus, J.M., Balbo, A., Hinshaw, J.E., and
Randazzo, P.A. (2008). Autoinhibition of Arf GAP activity by the BAR domain in
ASAP1. Journal of Biological Chemistry. 284: 1652-1663.
Jovanovic, O.A., Brown, F.D., and Donaldson, J.G. (2006). An effector domain
mutant of Arf6 implicates phospholipase D in endosomal membrane recycling.
Molecular Biology of the Cell. 17: 327-335.
Kahn, R.A., Bruford, E., Inoue, H., Logsdon Jr., J.M., Nie, Z., Premont, R.T.,
Randazzo, P.A, Satake, M., Theibert, A.B., Zapp, M.L., and Cassel, D. (2008).
Consensus nomenclature for the human ArfGAP domain-containing proteins.
Journal of Cell Biology. 182: 1039-1044.
Kaieda, S., Matsui, C., Mimori-Kiyosue, Y., and Ikegami, T. (2010). Structural
basis of the recognition of the SAMP motif of Adenomatous Polyposis Coli by the
Src-homology 3 domain. Biochemistry. 49: 5143-5153.
Kaksonen, M., Toret, C.P., and Drubin, D.G. (2006). Harnessing actin dynamics
for clathrin-mediated endocytosis. Nature Reviews Molecular Cell Biology. 7:
404-414.
Kam, J.L., Miura, K., Jackson, T.R., Gruschus, J., Roller, P., Stauffer, S., Clark,
J., Aneja, R., Randazzo, P.A. (2000). Phosphoinositide-dependent activation of
122
the ADP-ribosylation factor GTPase-activating protein ASAP1. Journal of
Biological Chemistry. 275: 9653-9663.
Kametaka, S., Sawada, N., Bonifacino, J.S., and Waguri, S. (2010). Functional
characterization of protein-sorting machineries at the trans-Golgi network in
Drosophila melanogaster. Journal of Cell Science. 123: 460-471.
Karki, S., Ligon, L. A., DeSantis, J., Tokito, M., and Holzbaur, E. L. (2002).
PLAC-24 is a cytoplasmic dynein binding protein that is recruited to sites of cell–
cell contact. Molecular. Biology of the Cell. 13: 1722–1734 .
Kirchhausen, T. (2000). Three ways to make a vesicle. Nature Reviews
Molecular Cell Biology. 1: 187-198.
Kowanetz, K., Husnjak, K., Holler, D., Kowanetz, M., Soubeyran, P., Hirsch, D.,
Schmidt, M.H.H., Pavelic, K., Camilli, P.D., Randazzo, P.A., and Dikic, I. (2004).
CIN85 associates with multiple effectors controlling intracellular trafficking of
epidermal growth factor receptors. Molecular Biology of the Cell. 15: 3155-3166.
Krahn, M.P., Klopfenstein, D.R., Fischer, N., and Wodarz, A. (2010). Membrane
targeting of Bazooka/PAR-3 is mediated by direct binding to phosphoinositide
lipids. Current Biology. 20: 636-642.
Kramer, H., and Phistry, M. (1996). Mutations in Drosophila hook gene inhibit
endocytosis of the Boss transmembrane ligand into multivesicular bodies.
Journal of Cell Biology. 133: 1205-1215.
Kruljac-Letunic, A., Moelleken, J., Kallin, A., Wieland, F., and Blaukat, A. (2003).
The tyrosine kinase Pyk2 regulates Arf1 activity by phosphorylation and inhibition
123
of the Arf-GTPase-activating protein ASAP1. Journal of Biological Chemistry. 278:
29560-29570.
Kumari, S., and Mayor, S. (2007). Arf1 is directly involved in dynamin-
independent endocytosis. Nature Cell Biology. 10: 30-41
Lanzetti, L. (2007). Actin in membrane trafficking. Current Opinion in Cell
Biology.19: 453-458.
Laprise, P., Lau, K.M., Harris, K.P., Silva-Gagliardi, N.F., Paul, S.M., Beronja, S.,
Beitel, G.J., McGlade, C.J., and Tepass, U. (2009). Yurt, Coracle, Neurexin IV
and the Na+, K+-ATPase form a novel group of epithelial polarity proteins. Nature.
459:1141-1145.
Lecuit, T., and Lenne, P. (2007). Cell surface mechanics and the control of cell
shape, tissue patterns and morphogenesis. Nature Reviews Molecular Cell
Biology. 8: 633-644.
Lee, M. C. S., Miller, E. A., Goldberg, J., Orci, L., and Schekman, R. (2004). Bi-
directional protein transport between the ER and Golgi. Annual Reviews of Cell
and Developmental Biology. 20: 87–123.
Leibfried, A., Fricke, R., Morgan, M.J., Bogdan, S., and Bellaiche, Y. (2008).
Drosophila Cip4 and WASp define a branch of the Cdc42-PAR-6-aPKC pathway
regulating E-cadherin endocytosis. Current Biology. 18: 1639-1648.
Li, R., and Gundersen, G.G. (2008). Beyond polymer polarity: how the
cytoskeleton builds a polarized cell. Nature Reviews Molecular Cell Biology. 9:
860-873.
124
Ligon, L. A., Karki, S., Tokito, M., and Holzbaur, E. L. (2001). Dynein binds to β-
catenin and may tether microtubules at adherens junctions. Nature Cell Biology.
3: 913–917.
Lin, D., Watahiki, A., Bayani, J., Zhang, F., Liu, L., Ling, V., Sadar, M.D., English,
J., Fazli, L., So, A., Gout, P.W., Gleave, M., Squire, J.A., and Wang, Y. (2008).
ASAP1, a gene at 8q24, is associated with prostate cancer metastasis. Cancer
Research. 68: 4352-4359.
Liu, Y., Loijens, J.C., Martin, K.H., Karginov, A.V., and Parsons, J.T. (2002). The
association of ASAP1, an ADP ribosylation factor-GTPase activating protein, with
Focal adhesion kinase contributes to the process of focal adhesion assembly.
Molecular Biology of the Cell. 13: 2147-2156.
Liu, Y., Yerushalmi, G.M., Grigera, P.R., Parsons, J.T. (2005). Mislocalization or
reduced expression of Arf GTPase-activating protein ASAP1inhibits cell
spreading and migration by influencing Arf1GTPase cycling. Journal of Biological
Chemistry. 280: 8884-8892.
Luo, R., Jacuqes, K., Ahvazi, B., Stauffer, S., Premont, R.T., and Randazzo, P.A.
(2005). Mutational analysis of the Arf1-GTP/Arf GAP interface reveals an Arf1
mutant that selectively affects the Arf GAP ASAP1. Current Biology. 15: 2164-
2169.
Luo, R., Jenkins, L.M.M., Randazzo, P.A., and Gruschus, J. (2008). Dynamic
interaction between Arf GAP and PH domains of ASAP1 in the regulation of GAP
activity. Cellular Signaling. 20: 1968-1977.
125
Macia, E., Partisani, M., Favard, C., Mortier, E., Zimmermann, P., Carlier, M.,
Gounon, P., Luton, F., and Franco, M. (2008). The pleckstrin homology domain
of the Arf6-specific exchange factor EFA6 localizes to the plasma membrane by
interacting with phosphatidylinositol 4,5-bisphosphate and F-actin. Journal of
Biological Chemistry. 283: 19836-19844.
Magie, C.R., Pinto-Santini, D., Parkhurst, S.M. (2002). Rho1 interacts with
p120ctn and alpha-catenin, and regulates cadherin-based adherens junction
components in Drosophila. Development. 129: 3771–3782.
Martin, A.C., Kaschube, M., and Wieschaus, E.F. (2009). Pulsed actin-myosin
network contractions drive apical constriction. Nature. 495-499.
Martin, A.C., Gelbart, M., Wieschaus, E.F. (2010). Integration of contractile
forces during tissue invagination. Journal of Cell Biology. 188: 735-749.
Martin, R.K., and Jackson, T.R. (2005). Centaurin β4 in cancer. Biochemical
Society Transactions. 33: 1282-1284.
McNeill, H., Ryan, T. A., Smith, S. J., and Nelson, W. J. (1993). Spatial and
temporal dissection of immediate and early events following cadherin-mediated
epithelial cell adhesion. Journal of Cell Biology. 120: 1217–1226.
Mellman, I., and Nelson, W.J. (2008). Coordinated protein sorting, targeting and
distribution in polarized cells. Nature Reviews Molecular Cell Biology. 9: 833-845.
Meng, W., Mushika, Y., Ichii, T., and Takeichi, M. (2008). Anchorage of
microtubule minus ends to adherens junctions regulates epithelial cell–cell
contacts. Cell. 135: 948–959.
126
Merrifield, C.J., Perrais, D., and Zenisek, D. (2005). Coupling between clathrin-
coated-pit invagination, cortactin recruitment, and membrane scission observed
in live cells. Cell. 121:593-606.
Morais-de-Sa, E., Mirouse, V., and St Johnston, D. (2010). aPKC
phosphorylation of Bazooka defines the apical/lateral border in Drosophila
epithelial cells. Cell. 141: 509-523.
Muller, T., Stein, U., Poletti, A., Garzia, L., Rothley, M., Plaumann, D., Thiele, W.,
Bauer, M., Galasso, A., Schlag, P., Pankratz, M., Zollo, M., and Sleeman, J.P.
(2010). ASAP1 promotes tumor cell motility and invasiveness, stimulates
metastasis formation in vivo, and correlates with poor survival in colorectal
cancer patients. Oncogene. 29: 2393-2403.
Muller, H.A., and Wieschaus, E. (1996). Armadillo, Bazooka, and Stardust are
critical for early stages in formation of the zonula adherens and maintenance of
the polarized blastoderm epithelium in Drosophila. Journal of Cell Biology. 134:
149-163.
Murthy, M., Teodoro, R.O., Miller, T.P., and Schwarz, T.L. (2010). Sec5, a
member of the exocyst complex, mediates Drosophila embryo cellularization.
Development. 137: 2773-2783.
Musch, A., Cohen, D.,Yeaman, C., Nelson, W.J., Rodriguez-Boulan, E., and
Brennwald, P.J.(2002). Mammalian homolog of Drosophila tumor suppressor
Lethal (2) Giant Larvae Interacts with basolateral exocytic machinery in Madin-
Darby Canine Kidney Cells. Molecular Biology of the Cell. 13: 158-168.
127
Pilot, F., Philippe, J., Lemmers, C., and Lecuit, T. (2006). Spatial control of actin
organization at adherens junctions by a synaptotagmin-like protein. Nature. 442:
580-584.
Nejsum, L. N., and Nelson, W. J. (2007). A molecular mechanism directly linking
E-cadherin adhesion to initiation of epithelial cell surface polarity. Journal of Cell
Biology. 178: 323–335.
Nie, Z., Hirsch, D.S., Luo, R., Jian, X., Stauffer, S., Cremesti, A., Andrade, J.,
Lebowitz, J., Marino, M., Ahvazi, B., Hinshaw, J.E., and Randazzo, P.A. (2006).
A BAR domain in the N terminus of Arf GAP ASAP1 affects membrane structure
and trafficking of epidermal growth factor receptor. Current Biology. 16: 130-139.
Oda, A., Wada, I., Miura, K., Okawa, K., Kadoya, T., Kato, T., Nishihara, H.,
Maeda, M., Tanaka, S., Nagashima, K.,Nishitani, C., Matsuno, K., Ishino, M.,
Machesky, L.M., Fujita, H., and Randazzo, P.(2002). CrkL directs ASAP1 to
peripheral focal adhesion. Journal of Biological Chemistry. 278: 6456-6460.
Onodera, Y., Hashimoto, S., Hashimoto, A., Morishige, M., Mazaki, Y., Yamada,
A., Ogawa, E., Adachi, M., Sakurai, T., Manabe, T., Wada, H., Matsuura, N., and
Sabe, H. (2005). Expression of AMAP1, an ArfGAP, provides novel targets to
inhibit breast cancer invasive activities. EMBO Journal. 24: 963-973.
Palacios, F., Price, L., Schweitzer, J., Collard, J.G. and D’Souza-Schorey, C.
(2001). An essential role for Arf6-regulated membrane traffic in adherens junction
turnover and epithelial cell migration. EMBO Journal. 20: 4973-4986.
128
Palacios, F., Schweitzer, J. K., Boshans, R. L., and D’Souza-Schorey, C. (2002).
ARF6-GTP recruits Nm23-H1 to facilitate dynamin-mediated endocytosis during
adherens junctions disassembly. Nature Cell Biology. 4: 929–936
Paleotti, O., Macia, E., Luton, F., Klein, S., Partisani, M., Chardin, P.,
Kirchhausen, T., and Franco, M. (2005). The small G-protein Arf6GTP recruits
the AP-2 adaptor complex to membranes. Journal of Biological Chemistry. 280:
21661-21666.
Pelissier, A., Chauvin, J., and Lecuit, T. (2003). Trafficking through Rab11
endosomes is required for cellularization during Drosophila embryogenesis.
Current Biology. 13: 1848-1857.
Petronczki, M., Knoblich, J.A. (2001). DmPAR-6 directs epithelial polarity and
asymmetric cell division of neuroblasts in Drosophila. Nature Cell Biology. 3: 43-
49.
Radhakrishna, H., Klausner, R.D. and Donaldson, J.G. (1996). Aluminum fluoride
stimulates surface protrusions in cells overexpressing the Arf6 GTPase. Journal
of Cell Biology. 134: 935-947.
Raghu, P., Coessens, E., Manifava, M., Georgiev, P., Pettitt, T., Wood, E.,
Garcia-Murillas, I., Okkenhaug, H., Trivedi, D., Zhang, Q., Razzaq, A., Zaid, O.,
Wakelam, M., O’Kane, C.J., and Ktistakis, N. (2008). Rhabdomere biogenesis in
Drosophila photoreceptors is acutely sensitive to phosphatidic acid levels.
Journal of Cell Biology.185: 129-145.
Randazzo, P.A., Andrade, J., Miura, K., Brown, M.T., Long, Y., Stauffer, S.,
Roller, P., and Cooper, J.A. (2000). The Arf GTPase-activating protein ASAP1
129
regulates actin cytoskeleton. Proceedings of National Academy of Science USA.
97: 4011-4016.
Randazzo, P.A., Inoue, H., and Bharti, S. (2007). Arf GAPs as regulators of the
actin cytoskeleton. Biology of the Cell. 99: 583-600.
Riento, K., and Ridley, A.J. (2003). ROCKs: multifunctional kinases in cell
behavior. Nature Reviews Molecular Cell Biology. 4: 446-456.
Rodriguez-Boulan, E., Kreitzer, G., and Musch, A. (2005). Organization of
vesicular trafficking in epithelia. Nature Reviews Molecular Cell Biology. 6: 233-
247.
Roeth, J.F., Sawyer, J.K., Wilner, D.A., and Peifer, M. (2009). Rab11 helps
maintain apical Crumbs and adherens junctions in the Drosophila embryonic
ectoderm. Public Library of Science One. 4: e7634
Romer, W., Pontani, L., Sorre, B., Rentero, C., Berland, L., Chambon, V.,
Lamaze, C., Bassereau, P., Sykes, C., Gaus, K., and Johannes, L. (2010). Actin
dynamics drive membrane reorganization and scission in clathrin-independent
endocytosis. Cell. 140: 540-553.
Sechi, A.S., and Wehland, J. (2000). The actin cytoskeleton and plasma
membrane connection: PtdIns(4,5)P2 influences cytoskeletal protein activity at
the plasma membrane. Journal of Cell Science. 113: 3685-3695.
Shao, W., Wu, J., Chen, J., Lee, D.M., Tishkina, A., and Harris, T.J.C. (2010). A
modifier screen for Bazooka/PAR-3 interacting genes in the Drosophila embryo
epithelium. Public Library of Science One. 5: e9938.
130
Shaw, R. M., Fay, A.J., Puthenveedu, M.A., von Zastrow, M., Jan, Y., and Jan,
L.Y. (2007). Microtubule plus-end-tracking proteins target gap junctions directly
from the cell interior to adherens junctions. Cell. 128: 547–560
Sokac, A.M., and Wieschaus, E. (2008A). Zygotically controlled F-actin
establishes cortical compartments to stabilize furrows during Drosophila
cellularization. Journal of Cell Science. 121: 1815-1824.
Sokac, A.M., and Wieschaus, E. (2008B). Local actin-dependent endocytosis is
zygotically controlled to initiate Drosophila cellularization. Developmental Cell. 14:
775-786.
Solon, J., Kaya-Copur, A., Colombelli, J., and Brunner, D. (2009). Pulsed forces
timed by a ratchet-like mechanism drive directed tissue movement during dorsal
closure. Cell. 137: 1331-1342.
Steyer, J.A., and Almer, W. (2001). A real-time view of life within 100 nm of the
plasma membrane. Nature Reviews Molecular Cell Biology. 2: 268-275.
St Johnston, D. and Ahringer, J. (2010). Cell polarity in eggs and epithelia:
parallels and diversity. Cell. 141: 757-774.
Takenawa, T., and Miki, H. (2001). WASP and WAVE family proteins: key
molecules for rapid rearrangement of cortical actin filaments and cell movement.
Journal of Cell Science. 114: 1801-1809.
Tanentzapf, G., and Tepass, U.(2002). Interactions between the crumbs, lethal
giant larvae and bazooka pathways in epithelial polarization. Nature Cell Biology.
5: 46-52.
131
Tepass, U., Tanentzapf, G., Ward, R., and Fehon, R.(2001). Epithelial cell
polarity and cell junction in Drosophila. Annual Review of Genetics. 35:747-784.
Vitale, N., Chasserot-Golaz, S., Bailly, Y., Morinaga, N., Frohman, M.A., and
Bader, M. (2002). Calcium-regulated Exocytosis of dense-core vesicles requires
the activation of ADP-ribosylation factor Arf6 by Arf nucleotide binding site
opener at the plasma membrane. Journal of Cell Biology. 159: 79-89.
von Stein, W., Ramrath, A., Grimm, A., Muller-Borg, M. and Wodarz, A. (2005).
Direct association of Bazooka/Par-3 with the lipid phosphatase PTEN reveals a
link between the PAR/aPKC complex and phosphoinositide signaling.
Development. 132: 1675-1686.
Wei, S.Y., Escudero, L.M., Yu, F., Chang, L.H., Chen, L.Y., Ho, Y.H., Lin, C.M.,
Chou, C.S., Chia, W., Modolell, J., and Hsu, J.C. (2005). Echinoid is a
component of adherens junctions that cooperates with DE-Cadherin to mediate
cell adhesion. Developmental. Cell. 8: 493–504.
Wu, H., Feng, W., Chen, J., Chan, L.N., Huang, S.Y., and Zhang M.J. (2007).
PDZ domains of Par-3 as potential phosphoinositide signaling integrators.
Molecular Cell. 28: 886-898.
Yarar, D., Waterman-Storer, C.M., and Schmid, S.L.(2005). A dynamic actin
cytoskeleton functions at multiple stages of clathrin-mediated endocytosis.
Molecular Biology of the Cell. 16: 964-975.
Yeaman, C., Grindstaff, K.K., and Nelson, W.J. (1999). New perspectives on
mechanisms involved in generating epithelial cell polarity. Physiological Reviews.
70: 73-98.
132
Zhang, Q., Cox, D., Tseng, C.C., Donaldson, J.G. and Greenberg, S.A. (1998). A
requirement for Arf6 in Fcγ receptor-mediated phagocytosis in macrophages.
Journal of Biological Chemistry. 273: 19977-19981.
Zimmerberg, J., and Kozlov, M.M. (2006). How proteins produce cellular
membrane curvature. Nature Reviews Molecular Cell Biology. 7: 9-19.
Zuo, X., Zhang, J., Zhang, Y., Hsu, S., Zhou, D., and Guo W. (2006). Exo70
interacts with the Arp2/3 complex and regulates cell migration. Nature Cell
Biology. 8: 1383-1388.
133
APPENDIX
Appendix I. List of primers
Gene/Construct Primer Primer sequence (5’ to 3’) Purpose
Alt Forward gatatgcaaatgtcgacatggacttccacatactgatc Cloning
Reverse gggtctagatatctcgagccttctccgtttgaggcatgctg Cloning
Arf79F Forward gggtctagatatgtcgactttggcagcatag Cloning
Reverse taattttagtgttctcgagcgattagcgttcttc Cloning
Asp Forward atgagtgtcgactcgctgtgttaatggaccac Cloning
Reverse atgagtctcgagaacatgtcgatctgcagcttg Cloning
CG1951 Forward gggtctagatatgtcgacgcactaacttgtggg Cloning
Reverse ctacggctgctcgagcggttcaaaaagttaag Cloning
CG5823 Forward gatccggtaccgaattcactttcgcacacgg Cloning
Reverse gaggctgtgtcgggcggccgctcctgattcagg Cloning
CG10702
Forward atgagtggatccatcagatggacgctggagag Cloning
Reverse atgagtctcgagcccatgggataatcgtccgc Cloning
CG11210 Forward atgagtggatcctcatggtcatgtcggaaaac Cloning
Reverse atgagtctcgaggcctcaacactgttgacgc Cloning
dASAPforNGFP Forward atgagtggtacctatcctgagcagcaaaatgc Cloning
Reverse atgagtgcggccgcgcgcagccacacactatcac Cloning
dASAPforCGFP Forward ggatccggtaccggtacccgagtaccagtccgagtg Cloning
Reverse caaacagggggcggccgcccatcaggcagcatatgcacg Cloning
Cul5 Forward gatccggtaccgaattc attattaccgcggctgggc Cloning
Reverse gttcatttacgtggcgcggccgcgccacgtaaatgaacatgttg Cloning
Fj
Forward atgagtgtcgacgccagtctgtcagcgaatc Cloning
Reverse atgagtctcgagctgccctggcacttc Cloning
hk
Forward gatccggtaccgaattcatgtccgcgcccaagaac Cloning
Reverse gtctagatatctcgagccctttgatttcattgcacttagg Cloning
Musk Forward ggatccggtaccgaattcatgtcctcctcctcg Cloning
Reverse gtctagatatctcgagcccatgaccacaaagtcgc Cloning
Roc2 Forward gatccggtaccgaattccccttgttttggtg Cloning
Reverse caggtggagactcgagtttcccatgcgc Cloning
Sds22 Forward gatccggtaccgaattccaagtcaagtcagcg Cloning
Reverse ggtttacagtggtgcggccgcgtaccgggcacc Cloning
Sep5 Forward ggatccggtaccggatccccgcatttaaaatcg Cloning
Reverse cattctaaactctcgagtttttcttgcccctg Cloning
dASAPΔBAR Forward atgagtgccggcctcagcgagaagctgcatg Cloning
Reverse atgagtgccggcgggcgagctgtaatcggag Cloning
dASAPΔPH Forward atgagtgccggcgtgaactgcaaggagaaggcacttac Cloning
Reverse atgagtgccggcggtgacgccgtggtgtttg Cloning
dASAPΔGAP Forward atgagtgccggcatgcgcacgtgctcggatg Cloning
Reverse atgagtgccggcttgcagctccaccagacttgg Cloning
dASAPΔAKR Forward atgagtgccggcgaatgtgccattaagcgggagaag Cloning
Reverse atgagtgccggcatccgagcacgtgcgcatg Cloning
134
dASAPΔProR Forward atgagtgccggccgtaagctggttaatcagtcg Cloning
Reverse atgagtgccggcggctgtacgcttcttcagag Cloning
dASAPΔSH3 Forward atgagtgccggcatgctgcctgattaatcaatc Cloning
Reverse atgagtgccggcacgctgaccattatagtggaac Cloning
The PH domain of dASAP
Forward atgagtgaattcctccaccagttgcaaggtg Cloning
Reverse atgagtctcgagttaggcgtgctggaaggccttg Cloning
Aspmut1 Forward catcgtgagaagacgctttccctgctctg Mutagenesis
Reverse cagagcagggaaagcgtcttctcacgatg Mutagenesis
pENTR2B Forward acaaactcttcctgttagttag Sequencing
Reverse catcagagattttgagacacg Sequencing
Alt Forward gaaccagaggaagccgaag Sequencing
Forward cagcagcagaatggctcac Sequencing
Forward cttgagcgtcaacagcttac Sequencing
Forward ctgagtgctcttcgctcgc Sequencing
Forward taagctgcggcagaagctc Sequencing
Asp Forward agacgctgcagctaatagac Sequencing
Forward tgtgctaatgatatgcggcc Sequencing
Forward attcaaccacagtgagatcc Sequencing
Forward aatgcccttgtctccatacc Sequencing
Forward tcctcgatcaagctaagcag Sequencing
Forward tgttatccagcgtcgcattc Sequencing
Forward gtggagtatgctggagcag Sequencing
Forward acccttgtagtccagaaacg Sequencing
Forward ctaccgaaggattcgactc Sequencing
Forward gagatgatggacctcatcc Sequencing
Forward actttgtgcaccctcatttg Sequencing
CG1951 Forward gagacaatcgtgatcaacaag Sequencing
Forward gtctaccgcagatcattcc Sequencing
Forward gtggcttgtgctagacgag Sequencing
Forward caataccatatcagctccgc Sequencing
CG5823 Forward cacgtcgctatcttatctgc Sequencing
Forward gctgagcttcatgctggag Sequencing
CG10702 Forward gttgttctgttgttctgccc Sequencing
Forward agaagctaaagaggataagcg Sequencing
Forward attgggatctgctgactctc Sequencing
Forward caacaaggtgaacgagac Sequencing
Forward gaagaaagtgaactggacgc Sequencing
Forward aggactctcgtttcattgcg Sequencing
Forward tttcgccagaaatcacagac Sequencing
CG11210 Forward tcaacagcaacggcagcaag Sequencing
Forward ctcgtagtgctcatcatgc Sequencing
Forward cttctgtgtgaatgcagtgc Sequencing
Forward acgccgtacattcgtaagg Sequencing
Reverse ttgggaggtggtacttggtc Sequencing
dASAP Forward gacatcgggatatcctgag Sequencing
135
Forward tgagaaggagaagaaagccc Sequencing
Forward tcttgacatcttccatgccg Sequencing
Forward agcatggaagagcgttac Sequencing
Forward tcagcgacgatgaaacagtc Sequencing
Forward gcaaaacttcgatgccagc Sequencing
Forward agtcctggcatacggatatg Sequencing
Forward gaagctgcatgagatcaagc Sequencing
Forward atctacgctgcacatagtcg Sequencing
Cul5 Forward ctgcagcaggacatcgttg Sequencing
Forward gccatgaagattgtgcacg Sequencing
Forward aaagtacgttgagcggctac Sequencing
Forward atactcaattccgcacctcg Sequencing
Forward caagaatggcaaatcccagc Sequencing
Reverse aggtagttggactgtgtaaag Sequencing
Fj Forward cctaggactttgtcctctc Sequencing
Forward gagcgatcaaggagctaaag Sequencing
Forward ccacatgactttgttgacgc Sequencing
Forward ttgaggaggacgtctattgg Sequencing
Forward ctccgctcatcaatcaaacg Sequencing
hk Forward agcagtcctacatcacagag Sequencing
Forward agcttaagatatgcgaggcc Sequencing
Forward tggacgatgccaataaacgc Sequencing
Muskelin Forward aatcgcatgtgtgcaacatc Sequencing
Forward acaagcacagctggcatatg Sequencing
Forward cacatagcaacgaacacctg Sequencing
Forward tcaccagctggtgtatgatg Sequencing
Sds22 Forward tggagctgtatgacaaccag Sequencing
Sep5 Forward tgcccaatgtgaagctgaag Sequencing
Forward tgttggcagtacggagtttg Sequencing
ΔdASAP
Forward2 tgctgctttcgatagcatatc Genotyping
Universal3 tgtgtgcttagctttatcagc Genotyping
Reverse accaccttatgttatttcatcat Genotyping
Reverse gatcgcttacattcctgctg Mapping4
Reverse cagtcagtgttgatgtggtc Mapping
1: the original cDNA clone of Asp had a point mutation from T C at 3007th bp in
the coding region.
2: This forward primer is also used for the mapping of the deletion, mentioned as
“FP” in Figure 21A.
136
3: “Universal” refers to the universal primer which can bind to the inverted repeat
on each border of P element.
4: “Mapping” refers to the mapping of the deletion, the two reverse primers for
mapping are mentioned as “RP1” and “RP2” in Figure 21A.
137
Appendix II. Injection scheme of the immuogen GST-PH fusion protein
Pre-immune Test Bleed
Primary Injection Protein1 + CFA
Boost #1 Protein + IFA
Boost #2 Protein + IFA
Boost #3 Protein + IFA
Boost #4 Protein + IFA
Exsanguination
Date Day -7 Day 0 Day 28
Day 42
Day 56
Day 70
Day 84
Guinea Pig #1
200 µg 275 µl protein +275 µl CFA
50 µg 125 µl protein +125 µl IFA
25 µg 100 µl protein +100 µl IFA
25 µg 100 µl protein +100 µl IFA
25 µg 100 µl protein +100 µl IFA
Bleed out
Guinea Pig #2
200 µg 275 µl protein +275 µl CFA
50 µg 125 µl protein +125 µl IFA
25 µg 100 µl protein +100 µl IFA
25 µg 100 µl protein +100 µl IFA
25 µg 100 µl protein +100 µl IFA
Bleed out
Rabbit #3
200 µg 275 µl protein +275 µl CFA
100 µg 175 µl protein +175 µl IFA
50 µg 125 µl protein +125 µl IFA
50 µg 125 µl protein +125 µl IFA
50 µg 125 µl protein +125 µl IFA
Bleed out
Rabbit #4
200 µg 275 µl protein +275 µl CFA
100 µg 175 µl protein +175 µl IFA
50 µg 125 µl protein +125 µl IFA
50 µg 125 µl protein +125 µl IFA
50 µg 125 µl protein +125 µl IFA
Bleed out
1: Protein concentration: 1 mg/ml
CFA: Complete Freund’s Antigen
IFA: Incomplete Freund’s Antigen
138
Appendix III: My published article titled “A modifier screen for
Bazooka/PAR-3 interacting genes in the Drosophila embryo epithelium”
Author contribution: I generated the constructs, performed the experiments and
analyzed the data which is presented as Figure 6 in the results.
Please see the supplementary file.