tempel, et al iai

INFECTION AND IMMUNITY, Sept. 2006, p. 5095–5105 Vol. 74, No. 90019-9567/06/$08.00�0 doi:10.1128/IAI.00598-06Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Attenuated Francisella novicida Transposon Mutants Protect Miceagainst Wild-Type Challenge

Rebecca Tempel,†* Xin-He Lai,† Lidia Crosa, Briana Kozlowicz, and Fred HeffronDepartment of Molecular Microbiology and Immunology, Oregon Health & Science University, Portland, Oregon

Received 12 April 2006/Returned for modification 17 May 2006/Accepted 5 June 2006

Francisella tularensis is the bacterial pathogen that causes tularemia in humans and a number of animals.To date, there is no approved vaccine for this widespread and life-threatening disease. The goal of this studywas to identify F. tularensis mutants that can be used in the development of a live attenuated vaccine. Wescreened F. novicida transposon mutants to identify mutants that exhibited reduced growth in mouse macro-phages, as these cells are the preferred host cells of Francisella and an essential component of the innateimmune system. This approach yielded 16 F. novicida mutants that were 100-fold more attenuated for virulencein a mouse model than the wild-type parental strain. These mutants were then tested to determine theirabilities to protect mice against challenge with high doses of wild-type bacteria. Five of the 16 attenuatedmutants (with mutations corresponding to dsbB, FTT0742, pdpB, fumA, and carB in the F. tularensis SCHU S4strain) provided mice with protection against challenge with high doses (>8 � 105 CFU) of wild-type F.novicida. We believe that these findings will be of use in the design of a vaccine against tularemia.

Francisella tularensis is a gram-negative, facultative intracel-lular pathogen that causes tularemia, a debilitating and poten-tially fatal disease that affects humans and a wide range ofanimals. Infections can be acquired through bites from anarthropod vector, skin lesions, ingestion of contaminated foodor water, and, most dangerously, inhalation of as few as 10bacteria (10). The low dose required to cause tularemia by theaerosol route resulted in the development of F. tularensis foruse as a biological weapon by several national weapons pro-grams. This has led the U.S. Centers for Disease Control andPrevention to classify F. tularensis as a category A bioterrorismagent; members of this category are considered the organismsthat pose the most serious risk to national security (http://www.bt.cdc.gov/Agent/Agentlist.asp). There is currently no ap-proved vaccine available in the United States or Europe. Thus,the development of a vaccine against F. tularensis has becomean international research priority.

Although the molecular mechanisms of F. tularensis patho-genesis remain relatively obscure, it has been established thatreplication in human and animal macrophages is central to thisorganism’s ability to cause tularemia (14). Several F. tularensisgenes associated with intracellular growth have been identified,including iglB, iglC, mglA, pdpD, and a clpB homolog (2, 18, 20,31, 33). Additionally, it is thought that many of the genes in therecently described F. tularensis pathogenicity island (FPI) con-tribute to the survival and growth of this organism in macro-phages (32, 35). Of these, only iglC has been studied as thebasis for a potential vaccine strain. Pammit et al. recentlyreported that intranasal vaccination with an F. novicida straincarrying an iglC deletion resulted in �50% protection against

challenges with the wild-type organism (38). However, thecapacity of mutant derivative strains with mutations in otherFPI genes to confer protection against challenge with wild-typebacteria has not been studied.

Three main subspecies of F. tularensis are commonly recog-nized: F. tularensis subsp. tularensis (type A), F. tularensissubsp. holarctica (type B), and F. tularensis subsp. mediasiatica.All of these biotypes along with F. novicida exhibit more than95% DNA sequence identity (3). Although type A and type Bstrains are highly infectious, only type A strains cause signifi-cant mortality in humans. The current live vaccine strain (LVS)is an attenuated type B strain that provides different levels ofprotection against challenge with type A F. tularensis strainsdepending on the route of immunization, the route of chal-lenge, and the genetic background of the host (4–6, 21, 43, 49).Because the molecular basis for LVS attenuation is not known,this strain is not licensed as a tularemia vaccine.

F. novicida U112 provides an ideal model for studying Fran-cisella pathogenesis for several reasons. While F. novicida isnot considered a human pathogen, it exhibits a degree ofvirulence in mice similar to that of F. tularensis subspecies (27,42). Moreover, F. novicida is easier and less dangerous tomanipulate genetically than F. tularensis. In addition to theconsiderable genomic similarity (�95%), the close relationshipbetween F. novicida and F. tularensis is further highlighted bytheir nearly identical 16S rRNA gene sequences (13). Thedegree of genetic identity suggests that the two organismsutilize similar virulence genes and that F. novicida is thus anapt platform for the development of a tularemia vaccine.

In this study, we used transposon mutagenesis to identify F.novicida genes required for intracellular growth. The resultingmutant strains were screened for attenuation in macrophagesand mice and tested for the ability to provide protectionagainst a wild-type challenge in mice. Five F. novicida mutantstrains were found to protect mice against challenge with �8 �105 CFU of wild-type F. novicida. These results will be used inthe future for construction of a Francisella vaccine.

* Corresponding author. Mailing address: 6543 Basic Sciences Ad-dition/CROET Building, Department of Molecular Microbiology andImmunology, Oregon Health & Science University, 3181 SW SamJackson Park Rd., Portland, OR 97239. Phone: (503) 494-6841. Fax:(503) 494-6862. E-mail: [email protected].

† R.T. and X.-H.L. contributed equally to this work.

5095

MATERIALS AND METHODS

Bacterial strains and culture. F. novicida strain U112 was a kind gift from FranNano (University of Victoria). All Francisella strains were cultured at 37°C intryptic soy broth supplemented with 0.1% cysteine (TSBC) (Becton, Dickinsonand Company, Sparks, MD) or on cysteine heart agar (CHA) (Difco/Becton,Dickinson and Company) plates. Kanamycin was added to a final concentrationof 20 �g/ml to TSBC and to CHA (CHA/Kan20) for selection of U112 strainscarrying the transposon. Escherichia coli Genehogs (Invitrogen, Carlsbad, CA)that were used in subcloning for sequencing were transformed according to themanufacturer’s directions. Colonies containing the transposon were selected bygrowth at 37°C on Luria-Bertani (LB) agar plates containing 60 �g/ml kanamy-cin. The Salmonella strain used for Southern blotting was grown in LB broth andon LB agar plates at 37°C.

Generation of bacterial transposon mutant strains. A library of F. novicidatransposon insertion mutants was created by electroporating mini-Tn5 transposon-transposase complexes into appropriately prepared F. novicida. Although inde-pendently developed, our technique was similar to that of Kawula et al. (26, 45).The mini-Tn5 cycler transposon was constructed as previously described (17).The transposon-transposase complex was prepared as described by Goryshinet al. (19). F. novicida U112 was grown to confluence on CHA plates at 37°C andresuspended with 5 ml of ice-cold 10% glycerol–500 mM sucrose buffer. Aliquots(1 ml) were transferred to 1.5-ml microcentrifuge tubes, pelleted by centrifuga-tion at 12,000 � g for 5 min at 4°C, and resuspended in 1 ml of buffer. This washstep was repeated until a total of four washes had been performed. After the finalwash, each aliquot was resuspended in 100 �l buffer. One microliter of transposon-transposase complex was added to each tube, and the samples were electropo-rated in 1-mm-gap cuvettes at 1.5 to 1.7 kV, 200 �, and 25 �F. The bacteria wererecovered in 1 ml TSBC in glass tubes for 4 h in a 37°C rotator and plated onCHA/Kan20 plates. The frequency of isolation of transposon insertion mutantswas rather low (about 10 to 100 insertions per 109 cells following electropo-ration).

Culture and infection of cell lines and primary macrophages. The J774A.1 andRAW264.7 murine macrophage cell lines (American Type Culture Collection,Manassas, VA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)(Gibco-BRL, Rockville, MD) supplemented with 10% fetal bovine serum (FBS)(Gibco-BRL), 1 mM nonessential amino acids (Gibco-BRL), and 0.2 mM so-dium pyruvate (Gibco-BRL) at 37°C in the presence of 5% CO2. Bone marrow-derived macrophages (BMDM) were collected by flushing the femurs of BALB/cmice with serum-free DMEM and were cultured in DMEM supplemented with20% L929 and an antibiotic cocktail of penicillin (10,000 U/ml) and streptomycin(10,000 �g/ml). For infection, bacteria were added to 50% confluent cells in 24-or 96-well culture dishes (Corning, Corning, NY) or four-chamber microscopeplates (Nalge Nunc, Naperville, IL) at the multiplicities of infection (MOI)indicated below, and the cells were centrifuged at 1,000 � g for 5 min at roomtemperature and incubated at 37°C in the presence of 5% CO2. One hour afterinfection, the cells were washed twice with phosphate-buffered saline (PBS), andDMEM containing 100 �g/ml of gentamicin was added to prevent the growth ofany extracellular bacteria (29). Two hours after infection, the cells were washedtwice with PBS and either lysed or incubated in the presence of 10 �g/mlgentamicin for an additional 22 h. Cells were lysed with TSBC containing 0.5%saponin (Sigma) for 30 min at 37°C in the presence of 5% CO2.

Screening for reduced growth in macrophages. RAW macrophages wereseeded to obtain 50% confluence in 96-well tissue culture plates and infected(MOI of �1,000) with overnight cultures of F. novicida mutant strains that weregrown in stationary 96-well tissue culture plates, as described above. At 24 hpostinfection (p.i.), the macrophages were washed and lysed as described above.Three percent of each lysate was plated onto CHA/Kan20 plates and incubatedovernight at 37°C. Mutants that exhibited growth defects were identified visually.To eliminate false positives, the potentially attenuated mutants were subjected toanother round of selection by infecting RAW macrophages in 24-well plates, asdescribed above, using an input MOI of 100, which corresponded to about onebacterium per macrophage. After lysis, 50 �l of each lysate was plated onto CHAplates and incubated overnight at 37°C. F. novicida mutants compromised forgrowth in macrophages were identified visually by comparison to wild-type U112infection lysates; the attenuated mutants yielded individual colonies, while thewild-type bacteria grew to confluence.

Sequencing of mini-Tn5 insertion sites and sequence analysis. The methoddescribed by Geddes et al. was used for sequencing mini-Tn5 insertion sites andsequence analysis (17). Briefly, chromosomal DNA from F. novicida mutantsexhibiting reduced growth in macrophages was prepared (1), digested withEcoRI, and subcloned into pACYC184. Ligation reaction mixtures were elec-troporated into GeneHogs E. coli cells (Invitrogen) and selected for growth on

LB medium containing 60 �g/ml kanamycin. Plasmids from kanamycin-resistantcolonies were purified using a QIAprep Spin miniprep kit (QIAGEN, Valencia,CA) according to the manufacturer’s instructions. The DNA sequence of thefusion junction was obtained using a primer complementary to bp 166 to 190 ofthe 5� end of mini-Tn5 cycler (5� GTTGACCAGGCGGAACATCAATGTG 3�).Sequence analysis was performed using the MacVector 7.2.3 software and theNCBI BLAST server at http://www.ncbi.nlm.nih.gov/BLAST/.

Mouse studies. Six- to 8-week old female BALB/c mice were purchased fromthe Jackson Laboratory (Bar Harbor, ME). The animals were fed autoclavedfood and water ad libitum. All experiments were performed in accordance withAnimal Care and Use Committee guidelines. For vaccination and challengestudies, mice were inoculated intraperitoneally (i.p.) with bacteria in 150 �l (totalvolume) of PBS. Mice were vaccinated with the number of CFU indicated below.Surviving mice were challenged 28 days later with the doses indicated below.Dissemination and clearance of the bacteria were determined by harvesting thelungs, liver, and spleen on the days postinfection indicated below, homogenizingthe organs with a stomacher, and plating serial dilutions. The 50% lethal doses(LD50) were calculated by the method of Reed and Muench (39). Mice werechecked for signs of illness or death twice each day following infection.

Bacterial growth in liquid media. Overnight cultures of F. novicida werediluted into 10 ml of TSBC to obtain an optical density at 600 nm (OD600) of 0.1.Optical densities were then recorded at the times specified below. Note that thecultures were diluted 1:10 to obtain OD600 of �1 for accuracy. We previouslydetermined by plating that an OD600 of 1 was equivalent to approximately 4 �109 bacteria/ml.

Quantification of bacterial entry and growth in macrophages. J774 and RAWcells and BMDM were seeded in triplicate to obtain 50% confluence in 24-welltissue culture plates and were infected as described above with F. novicidamutant strains at an input MOI of 100. Cells were lysed at 2 or 24 h p.i. Serialdilutions of the lysates were plated onto CHA/Kan20 or CHA (wild-type andmock infection controls) plates. After overnight incubation at 37°C, the colonieson each plate were counted. Means and standard deviations were calculatedusing Microsoft Excel X for Mac. The 24-h data were statistically analyzed bypaired two-tailed t tests using Microsoft Excel X for Mac.

Southern blot analysis. F. novicida chromosomal DNA was prepared using thecetyltrimethylammonium bromide method (1), and 250 ng of each preparationwas digested to completion with HindIII. Digested DNA was electrophoresed ona 0.8% agarose gel for 2 h at 90 kV and then transferred to a positively chargednylon membrane (Roche) using a standard capillary transfer method (1). DNAwas cross-linked to the membrane at 120,000 �J/cm2 using a Stratalinker 1800UV cross-linker (Stratagene, La Jolla, CA). The digested bacterial DNA wasprobed with a digoxigenin-labeled probe using a DIG High Prime II DNAlabeling and detection starter kit (Roche, Indianapolis, IN), and the membranewas exposed to film (Kodak, Rochester, NY) for 2 or 8 min as described below.By using a DNA probe that spans a HindIII site in the transposon and hybridizesto two separate locations of the HindIII-digested chromosomal DNA, we wereable to determine the number of transposon inserts in each strain.

Cytotoxicity assay. A cytotoxicity assay was conducted as described by van derVelden et al. (48). Briefly, J774 cells seeded in 96-well culture plates wereinfected in triplicate with either the transposon mutants or wild-type F. novicidaU112 at an input MOI of 100. After 48 h, the supernatants were removed andassayed for released lactate dehydrogenase (LDH) using the CytoTox 96 non-radioactive cytotoxicity assay (Promega, Madison, WI). Cytotoxicity was deter-mined for each mutant strain by calculating the amount of LDH released as apercentage of the maximal amount released from macrophages infected withwild-type strain U112.

Microscopy. J774 cells were infected at an input MOI of 100, as previouslydescribed, in four-well chamber plates (Nalge Nunc). After 24 h, the cells werewashed twice with PBS, fixed for 1 h with 4% paraformaldehyde, and stored inPBS at 4°C. After three washes for 10 min in PBS, the cells were permeabilizedwith 0.5% Triton X-100 (Sigma Chemical) in PBS for 20 min at room temper-ature, blocked with 5% FBS in PBS for 30 min, and incubated for 1 h at 4°C witha polyclonal antibody against F. tularensis (Becton, Dickinson and Company).After three washes for 10 min in PBS, the cells were again blocked with 5% FBS.A goat anti-rabbit antibody conjugated to Alexa 488 (Molecular Probes, Eugene,OR) was applied to the cells overnight at 4°C. The cells were again washed threetimes for 10 min in PBS and incubated with a 1:1,000 dilution of FM 4-64membrane stain (Molecular Probes) and 1:1,000 dilution of Draq5 DNA stain inPBS (Alexis Biochemicals, San Diego, CA) for 10 min at room temperature. Thecells were washed twice with PBS and mounted in Fluormount-G antifade solu-tion (Southern Biotechnology, Birmingham, AL), and images were obtained withan Applied Precision DeltaVision deconvolution microscope system (AdvancedPrecision Instruments, Issaquah, WA). All images were taken obtained a �60

5096 TEMPEL ET AL. INFECT. IMMUN.

objective. Stacks of 10 z-plane images that were 1 �m apart were captured at1024 � 1024 pixels and deconvolved for seven iterations. Selected images weresaved in TIFF format and imported into Adobe Photoshop to be formatted.

Complementation of disrupted genes. Plasmid pKK202 (30) was modified toinclude unique NotI, SfiI, and XhoI restriction sites by digestion with ClaI andXbaI, followed by ligation with a DNA fragment. Oligonucleotides CGGCGGCCGCTTGGCCTCGAGGGCC and CTAGGGCCCTCGAGGCCAAGCGGCCGC were annealed to obtain a double-stranded product encoding the newrestriction sites. Using SCHU S4 DNA as a template, full-length genes wereamplified by PCR. The dsbB gene was cloned using primers GCGGCCGCCTTCTTAACGTCCACAGTTTTGTCC and GGCCCTCGAGGCCCTTTCTGATGGTTTGTCATTTCTCC, FTT0742 was cloned using primers GCGGCCGCGCAGCATTACCTGGAATTACAAG and GGCCCTCGAGGCCCAAACAGCAAATAAATATACAACACC, and fumA was cloned using primers GCGGCCGCTAGTGATAAAATTAGCGAGG and GGCCCTCGAGGCCATTAACTATAATGCCGAG. The modified pKK202 vector and the PCR products weredigested with NotI and XhoI and ligated. pKK202-dsbB was electroporated intothe dsbB mutant F. novicida strain and used to infect J774 and RAW cells,primary macrophages, and mice as indicated below. pKK202-FTT0742 andpKK202-fumA were similarly tested with RAW cells.

RESULTS

Transposon mutagenesis and identification of disruptedloci. An ongoing challenge to the establishment of a suitableset of genetic tools for F. tularensis is the difficulty of creatingstable mutations in the genome. To address this issue, wedeveloped a transposon mutagenesis technique independent ofphages and shuttle vectors that yielded as many as 150 trans-poson mutants from a single electroporation procedure (see

Materials and Methods). Our method, although independentlydeveloped, is quite similar to the technique used by the Kawulalaboratory with LVS (26, 45). The bacteria were electropo-rated with a transposase-transposon complex that completedthe transposition event once it was inside the bacteria. Thisapproach yielded the library of 779 Francisella transposon mu-tants used in this study.

Macrophages are the primary host cell type for Francisella inboth humans and animals (14). It follows that one approach fordeveloping a tularemia vaccine would be to discern whichFrancisella genes are necessary for growth in macrophages.Thus, we screened our F. novicida transposon mutant libraryfor mutants that had a reduced ability to grow in macrophages,as described in Materials and Methods. Of the more than 700F. novicida transposon mutants screened, 34 exhibited reducedgrowth in RAW macrophages. We obtained sequences for 28of these mutant strains and identified the disrupted open read-ing frames (ORFs) by comparison to the SCHU S4 sequence(Table 1).

Sixteen F. novicida mutants exhibited attenuation in mice.To narrow our study to the mutant strains that had an atten-uated phenotype in an animal model, we infected wild-typeBALB/c mice with the 28 F. novicida mutants that were atten-uated for growth in macrophages. Mice were inoculated intra-peritoneally with 6 � 103 bacteria in 150 �l of PBS, a dosewhich is about 100-fold greater than the wild-type F. novicida

TABLE 1. F. novicida transposon mutant strains generated in this study

Mutant Corresponding SCHUS4 FTT no.

Genedisrupted

% Identity toSCHU S4a

Nucleotide location oftranspson insertb % Survivalc

1 FTT0107c dsbB 100 114151 1002 FTT0145 rpoC 99 163108 03 FTT0203c purH 99 222340 1004 FTT0334 rpsQ 100 342324 05 FTT0356 htpG 95 356504 1006 FTT0504c sucC 97 524250 07 FTT0583 fopA 98 599781 08 FTT0742 Hypotheticald 89 765155 1009 FTT0893 purM 98 901556 10010 FTT0893 purM 97 901647 10011 FTT0893 purM 98 901848 10012 FTT0894 purCD 99 904045 10013 FTT0894 purCD 99 904160 10014 FTT0917 maeA 98 926193 3315 FTT1165c aspC2 99 1179264 016 FTT1222 dedA2 98 1240288 3317 FTT1241 glyA 97 11261475 6718 FTT1269c dnaK 100 1291446 10019 FTT1345/1700 pdpBe 98 1384141/1777485 10020 FTT1369c tktA 97 1416905 10021 FTT1535c ocd 99 1597434 022 FTT1535c ocd 97 1597841 023 FTT1600c fumA 98 1667516 10024 FTT1629c Hypotheticalf 99 1692570 025 FTT1664 carB 99 1730805 10026 FTT1720c purL 98 1804171 10027 FTT1720c purL 97 1805882 10028 FTT1769c clpB 96 1858564 0

a Level of identity when our fragment sequence was used.b Corresponding to SCHU S4 location.c Data for groups of three mice at 28 days after infection with 6 � 103 CFU.d Lipoprotein gene.e SCHU S4 contains two copies of pdpB.f Membrane protein gene.

VOL. 74, 2006 ATTENUATED AND PROTECTIVE FRANCISELLA MUTANTS 5097

LD50 for mice. At 28 days postinfection, the survival rate for 16of the 28 groups of mice was 100%, indicating that 16 of theinsertion mutants were highly attenuated in this animal infec-tion model (Table 1).

Five F. novicida mutants protected mice against challenge.The ideal living vaccine strain produces an asymptomatic in-fection that provides complete protection against subsequentexposure to the wild-type organism. To determine if any of our16 attenuated F. novicida transposon mutants could conferprotection against wild-type infection, we next challenged thesurviving vaccinated mice with the wild-type parental strain.Four weeks after infection with mutant F. novicida strains,surviving mice were intraperitoneally challenged with 8 � 105

CFU F. novicida U112. We considered this to be a very strin-gent challenge, as the dose was more than 10,000 times theLD50 observed for wild-type infection. At 28 days after thechallenge, 5 of the 16 mutants exhibited 100% protection aftera single vaccination; these mutants had mutations in dsbB, theORF corresponding to FTT0742 (referred to as FTT0742 be-low), pdpB, fumA, and carB (Table 2). In the same experi-ments, all wild-type control infections resulted in 0% survival.

LD50s for F. novicida mutants. Additional infections of micewith the F. novicida transposon mutants were conducted todetermine the LD50s of the five protective strains. In our ex-periments, the F. novicida U112 parental strain was observedto have an LD50 of 66.25 CFU (Table 3). Our carB mutantexhibited the least attenuation and had an LD50 of 6.75 � 103

CFU. The LD50s for our dsbB and fumA mutants were 6.625 �105 CFU and 6.17 � 105 CFU, respectively. The mutant strainswith the highest levels of attenuation in an animal infectionmodel were the FTT0742 and pdpB mutants, both of whichwere observed to have LD50s of �6 � 107 CFU. Taken to-gether, these results showed that our five F. novicida transpo-son mutants were significantly attenuated in a mouse infectionmodel compared to the wild-type parental strain.

F. novicida mutants were highly attenuated for growth inmouse macrophage cell lines. Wild-type strain F. novicidaU112 and the five mutants that conferred protection wereexamined in order to quantify entry and attenuation in mac-rophage cell lines and primary mouse macrophages (BMDM).

RAW and J774 macrophage-like cells and BMDM were in-fected in triplicate wells in duplicate plates with an input MOIof 100, as described in Materials and Methods. The contents ofone plate containing each cell type were lysed at 2 h afterinfection to determine the abilities of the transposon mutantsto enter host cells, and lysis of the contents of the second platesat 24 h allowed us to quantify the intracellular growth of themutant strains.

In J774 mouse macrophage-like cells, the levels of entrywere quite similar for the mutant and wild-type strains, exceptfor the pdpB mutant (Fig. 1A). The dsbB mutant exhibited thehighest level of attenuation in J774 cells, and for the FTT0742mutant derivative there was also a decrease in the number ofCFU after 24 h. Although fewer pdpB mutant bacteria thanbacteria of the other strains entered J774 cells, this mutant stilldisplayed an attenuation phenotype. For the fumA mutantthere was very little difference between the level of entry andthe level of replication at 24 h, indicating that there was nodeath, no replication, or a balance between the two. Interest-ingly, the carB mutant was able to replicate within J774 cells,albeit at a lower rate than the wild-type control. Each of themutants exhibited statistically significant attenuation in J774cells at 24 h p.i. (P � 0.005).

The levels of entry for the transposon mutants and the wild-type bacteria were similar when RAW mouse macrophage-likecells were used (Fig. 1B). Again, the dsbB and pdpB mutantderivatives exhibited the strongest attenuation phenotypes. In-triguingly, the FTT0742, fumA, and carB mutant strains allwere able to replicate in RAW cells, whereas only the wild typeand the carB mutant replicated in the J774 cell line. Comparedto the wild type, each of the mutants strains was significantlyimpaired for replication inside RAW cells at 24 h p.i. (P �0.05).

As observed for the J774 and RAW cells, the dsbB and pdpBmutants were the most attenuated strains in primary murineBMDM (Fig. 1C). Despite its high LD50 for mice, the ability ofthe FTT0742 mutant derivative to enter or replicate withinBMDM was not impaired, and both the fumA and carB strainsdisplayed only slight attenuation. This apparent disparity un-derlies the differences in infection among various cell popula-tions. It should also be noted that the BMDM were not stim-ulated prior to infection and were probably less microbicidalthan tissue-resident macrophages in the mouse model. InBMDM, only the dsbB, pdpB, and carB strains were signifi-cantly attenuated for growth at 24 h p.i. (P � 0.01).

To visually assess the replication of F. novicida transposonmutants in macrophages, fluorescence microscopy was per-formed. J774 macrophages were infected and prepared formicroscopy as described in Materials and Methods. As ex-

TABLE 2. F. novicida transposon mutants attenuated in mice

F. novicida mutant % Survivala

dsbB.............................................................................................100purH ............................................................................................ 0htpG ............................................................................................ 0FTT0742 .....................................................................................100purM ............................................................................................ 0purM ............................................................................................ 0purM ............................................................................................ 33purCD.......................................................................................... 0purCD.......................................................................................... 0dnaK ............................................................................................ 0pdpB ............................................................................................100tktA .............................................................................................. 66fumA ...........................................................................................100carB .............................................................................................100purL............................................................................................. 0purL............................................................................................. 33

a Levels of survival after challenge with 8 � 105 CFU of wild-type strain U112.Groups of three mice were inoculated intraperitoneally.

TABLE 3. LD50s for protective F. novicida mutants

Strain LD50 (CFU)a

Wild-type U112........................................................................ 66.25dsbB ...........................................................................................6.625 � 105

FTT0742 ................................................................................... �6 � 107

pdpB .......................................................................................... �6 � 107

fumA.......................................................................................... 6.17 � 105

carB ........................................................................................... 6.75 � 103

a LD50 when mice were inoculated intraperitoneally.


pected, macrophages infected with F. novicida U112 containedmore bacteria than cells infected with our mutants contained(Fig. 2). Although several bacteria were observed inside hostcells infected with the fumA mutant (Fig. 2F), infections withthe dsbB, FTT0742, pdpB, and carB mutant strains resulted inonly one or two intracellular bacteria at 24 h p.i. These findingscorroborated our finding that the F. novicida transposon mu-tants were defective for replication or survival inside macro-phages. Furthermore, although the macrophages were initially

seeded at the same concentration, fewer cells remained in thewells after infection with wild-type strain U112 than after in-fection with the mutants and in uninfected controls. This ob-servation indicated that host cell death occurred during thecourse of the wild-type infection but not during infection withattenuated mutant strains.

FIG. 1. Five F. novicida transposon mutants are attenuated forgrowth in macrophages. J774 (A) and RAW (B) cell lines and mouseBMDM (C) were infected with the five F. novicida mutants and wild-type strain U112 at an MOI of 100 for 2 h and 24 h. Cells were lysed,and serial dilutions of the lysates were plated onto CHA/Kan20 (mu-tants) or CHA (U112 and mock infection controls). Colonies werecounted, and the numbers of CFU/ml were calculated and converted toa log scale. Each column shows the average for three individual infec-tions. No bacteria were detected in J774 or RAW cells infected withthe pdpB mutant after 24 h. Asterisks indicate the statistically signifi-cant results for 24 h (J774 cells, P � 0.005; RAW cells, P � 0.05;BMDM, P � 0.01).

FIG. 2. Fluorescence microscopy of macrophage cell line infec-tions. J774 macrophages were infected in four-chamber microscopeplates for 24 h at an MOI of 100. The cells were fixed in 4% paraform-aldehyde, probed with a polyclonal antibody against Francisella (Alexa488) (green), and stained with FM 4-64 (membrane not shown) andDraq 5 (DNA) (blue). Cells were imaged with an Applied PrecisionDeltaVision deconvolution microscope system using a �60 objective.The arrows indicate individual bacteria. wt, wild type.


To address the possibility that the attenuation phenotypes ofour F. novicida mutant strains could have been due to overalldefects in replication, a simple growth curve was determinedfor each mutant. While the dsbB, FTT0742, and pdpB mutantsreplicated at levels similar to that of wild-type strain U112,both fumA and carB mutants exhibited defects in replicationafter 4 h of growth (data not shown). At 24-h after inoculation,the OD600 of cultures of these two strains were approximately1.5, and the OD600 of cultures of the other strains ranged from2.5 to 3.3. Interestingly, this phenotype was not rescued bysupplementing the media with malate (fumA) or arginine(carB) (data not shown). It is possible that the addition ofexogenous substrates could not complement the defects be-cause the enzymes are part of multienzyme complexes fromwhich additional intermediates are excluded. Nonetheless,the fumA and carB mutants remained potential vaccine can-didates because they protected mice against wild-type chal-lenge (Table 2).

Infection with F. novicida mutants did not reduce host cellintegrity. The observed attenuation phenotypes could havebeen a result of increased host cell killing, which would haveyielded fewer live infected macrophages and thus fewer bac-teria, as they would have been killed by the gentamicin in theextracellular media (29). One method for determining the de-gree of cytotoxicity that results from bacterial infection is tomeasure cell lysis by quantifying the release of the stable cy-tosolic enzyme LDH. J774 macrophages were infected witheither wild-type strain U112 bacteria or one of the five mutantstrains for 48 h at an input MOI of 100. The levels of LDH inthe supernatants were then recorded. As shown in Fig. 3, theabilities of the five mutant strains to cause cell lysis weresignificantly impaired compared with the ability of wild-type F.novicida. With the levels of LDH released during wild-typeinfection normalized to 100%, the amounts of LDH releasedduring infection with the five attenuated mutants ranged from9.75% (FTT0742) to 24.52% (fumA). These results indicatedthat the attenuation phenotypes were not due to increasedkilling of host cells by the transposon mutants and that theintracellular replication of these strains was indeed compro-mised.

Each F. novicida mutant harbored a single transposon in-sertion. Transposon mutagenesis has the potential to producestrains with more than one transposon insertion and thus mul-tiple causes for an observed phenotype. Each of our five pro-tective F. novicida transposon mutants was subjected to South-ern blot analysis to ensure that the attenuation phenotypes ofthe mutant strains were the result of a single transpositionevent. To determine the number of inserts, a DNA probe thatspanned a unique HindIII site in the transposon was designedso that digestion of chromosomal DNA harboring a singletransposon insert would yield two targets for this probe. Chro-mosomal DNA from each of the five protective mutant strains,as well as wild-type strain U112 and a Salmonella strain knownto contain a single copy of the transposon, was prepared andprobed as described in Materials and Methods. The presenceof two bands demonstrated that the F. novicida mutant strainseach harbored a single copy of the transposon insert, as shownin Fig. 4.

F. novicida mutants disseminated to the liver, spleen, andlungs and were subsequently cleared. Acceptable vaccine can-didates ideally infect mice transiently and are cleared beforechallenge with the parent strain. We inoculated groups of 15BALB/c mice i.p. with 0.1 LD50 of each mutant. Thus, for theseinfections, the vaccination dose varied from strain to strain.Three mice from each group were sacrificed at 1, 3, 5, 7, and 28days after vaccination, and their spleen, liver, and lungs wereharvested. As shown in Fig. 5, each mutant, with the possibleexception of the carB mutant, disseminated to all three organs(spleen, liver, and lungs) from the original site of inoculation.Two of the five strains, the dsbB and fumA mutants, werecompletely cleared by day 28 following infection. Althoughrelatively low numbers of bacteria remained in the spleen atday 28 after infection with the FTT0742 and pdpB mutants,it is possible that these organisms would have been clearedin the vaccination experiments because a lower dose (10-

FIG. 3. Infection with F. novicida mutants does not reduce host cellintegrity. J774 macrophages were infected with the five F. novicidamutants and wild-type strain U112 (wt U112) at an MOI of 100 for48 h. The levels of LDH in the extracellular medium were determined.The level of LDH release for the wild-type infection was defined as100%, and the levels of LDH release for the five mutant strains werenormalized to this level. Each column shows the average for threeindividual infections.

FIG. 4. Each F. novicida transposon mutant harbors a single trans-poson. Chromosomal DNA preparations from a Salmonella strainknown to carry the mini-Tn5 cycler transposon (lane 1), wild-typestrain U112 (lane 2), and the dsbB (lane3), FTT0742 (lane 4), pdpB(lane 5), fumA (lane 6), and carB (lane 7) mutant strains were digestedwith HindIII. The DNA was transferred to a membrane and probedwith a digoxigenin-labeled DNA probe that spanned a HindIII site inthe transposon. The membrane was exposed to film for 2 min (lanes 1,2, 3, 5, and 7) or 8 min (lanes 4 and 6). The presence of two bandsindicates a single transposon insertion event.


to 1,000-fold-fewer bacteria) was used for that procedure(Tables 2 and 4).

Expressing full-length genes in trans complemented the at-tenuation phenotype. While the Southern hybridization exper-iments strongly indicated that each mutant derivative con-tained only a single transposon insertion, we wished to determineif cloned copies of the genes could complement the observedvirulence defects. This would provide as additional evidence thatthe attenuation phenotype of each strain was a result of a singlemutation, marked by the transposon insertion.

The dsbB gene was amplified from SCHU S4 DNA by PCRand cloned into plasmid pKK202 (30). Following transforma-tion into the dsbB mutant, the abilities to replicate withinmacrophages and cause disease in mice were determined. Asshown in Fig. 6, in trans expression of the cloned dsbB geneprovided nearly complete complementation of the virulencedefect in three different cell types. Further analysis showedthat the LD50 was 60.25 CFU, which is comparable to thewild-type LD50 (66.25 CFU).

In a parallel experiment, in trans expression of the full-length FTT0742 gene in the corresponding mutant derivative

resulted in incomplete complementation. In RAW cells, intra-cellular replication of the complemented FTT0742 strain was10-fold greater than intracellular replication of the mutant, butthe value was still nearly 2 orders of magnitude less than thewild-type value (Fig. 6D).

Like complementation of the dsbB mutation, complementa-tion of the fumA mutation with the full-length gene restoredthe level of intracellular growth to the level of wild-type F.novicida (Fig. 6E). Taken together, these findings show thatthe observed attenuation phenotypes were due to mutations indsbB, FTT0742, and fumA.

Complementation of pdpB will be attempted in the future, asthe transposon insertion is located in the second gene of a12-gene operon and is undoubtedly polar on expression ofdownstream genes. Based on its in vitro growth defect, com-paratively low LD50, relative lack of intracellular attenuation,and questionable dissemination patterns, we felt that the carBmutant was not a strong enough candidate to include in furtherdevelopment of a vaccine against tularemia, and therefore wedid not attempt to complement the carB gene.

Mutant strains protected mice against very high doses ofwild-type bacteria. To further assess the level of protectionprovided by the F. novicida transposon insertion mutants, wechallenged vaccinated mice with higher doses of the wild-typeU112 parental strain. The dsbB, FTT0742, pdpB, and fumAmutant strains were used to infect groups of five mice, and thedoses used were 6 � 105, 6 � 106, and 6 � 107 CFU (Table 4).Mice infected with each of the three doses of our FTT0742 andpdpB mutants had a survival rate of 100%, as did the animalsinfected with the lowest doses of the dsbB and fumA mutants.Four weeks after vaccination, surviving animals were chal-lenged with 6 � 107 CFU of wild-type strain F. novicida U112,which is approximately 106 times the observed LD50 for wild-type infection. All of the mice challenged survived without anysymptoms of disease. These results demonstrated that four ofour F. novicida transposon mutants were capable of protectingmice against infection with very high levels of the wild-typeorganism. Overall, our findings indicate that Francisella strainscarrying mutations in these genes are candidates for a vaccineagainst tularemia.

FIG. 5. F. novicida mutants disseminate and are subsequentlycleared. The dsbB (A), FTT0742 (B), pdpB (C), fumA (D), and carB(E) mutant derivatives were injected i.p. into BALB/c mice, using 0.1LD50. The spleen (}), liver (■), and lungs (Œ) were harvested at 1, 3,5, 7, and 28 days p.i. Bacteria were liberated from the tissues andenumerated. Each point shows the results for three mice.

TABLE 4. Results of challenge studies after vaccinationwith F. novicida transposon mutants

Mutantstrain

Vaccine dose(CFU)

% Survival(n 5)

Challengedose (CFU) % Survival

dsbB 6 � 105 100 6 � 107 1006 � 106 20 6 � 107 1006 � 107 0 NDa ND

FTT0742 6 � 105 100 6 � 107 1006 � 106 100 6 � 107 1006 � 107 100 6 � 107 100

pdpB 6 � 105 100 6 � 107 1006 � 106 100 6 � 107 1006 � 107 100 6 � 107 100

fumA 6 � 105 100 6 � 107 1006 � 106 0 ND ND6 � 107 0 ND ND

a ND, not determined.


DISCUSSION

The classification of F. tularensis as a category A bioterror-ism agent by the Centers for Disease Control and Preventiondemonstrates that this organism is widely acknowledged to bea potential threat to national security. Thus, there is an imme-diate need for an approved tularemia vaccine. The lack ofgenetic tools with which to manipulate F. tularensis remains agreat barrier to the development of such a vaccine. Hence, wedeveloped a transposon mutagenesis technique to create ran-

dom insertions in the F. novicida genome and analyzed theresulting mutant strains for intracellular growth defects in mac-rophages, attenuation in mice, and the ability to provide pro-tection against wild-type infection. We identified 28 F. novicidatransposon mutants that have a defect in intracellular growthin macrophage cell lines, 16 of which exhibited 100% attenu-ation in mice at a dose that was more than 100 times thewild-type LD50. When mice were challenged with the wild-typeorganism, five transposon mutant strains were found to protect

FIG. 6. Expressing full-length genes in trans complements the attenuation defects in cells. The levels of entry (2 h) and replication (24 h) weredetermined for wild-type strain U112 (wt U112), the dsbB mutant, and the dsbB mutant complemented with pKK202-dsbB in the J774 (A) andRAW (B) cell lines and in primary BMDM (C). Entry and replication rates in RAW cells were determined for complementation of the FTT0742(D) and fumA (E) mutants. Each column shows the average for three separate infections.


the mice against infection with high doses of parental F. novi-cida strain U112. The disrupted genes in our five protective F.novicida mutants correspond to dsbB, FTT0742, pdpB, fumA,and carB in F. tularensis strain SCHU S4.

Disulfide bond formation protein B is encoded by dsbB. Thisintegral membrane protein is part of a pathway that leads todisulfide bond formation between cysteine residues in periplas-mic proteins in E. coli and other bacteria (23). The functionalfolded conformation of a protein often relies upon correctdisulfide pairing of the cysteine residues. Thus, one explana-tion for why our dsbB mutant strain is attenuated is that aprotein(s) required for replication inside host cells does notachieve its active conformation. It is also exciting to speculatethat, with its potential influence on periplasmic proteins, thedsbB gene product may be involved in the secretion of viru-lence factors, possibly to ensure correct folding of componentsof a secretion apparatus.

The FTT0742 ORF codes for a hypothetical lipoprotein thatis predicted to have transmembrane regions. Therefore, it ispossible that the gene product is a component of the F. novi-cida cell wall and/or may be involved in molecule transport.Because in vitro growth and entry into the host cell were notcompromised, we speculate that FTT0742 affects a functionnecessary for virulence and growth inside macrophages. Char-acterization of the FTT0742 protein should further clarify itsrole in virulence.

The product of the pdpB gene is an uncharacterized proteinencoded on the FPI that exhibits some similarity to the con-served bacterial protein IcmF (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). It has been shown that icmF is re-quired for Legionella pneumophila intracellular growth, so wehypothesized that pdpB plays a similar role in F. novicidaintracellular growth (50). Also of note, this gene exhibits somesimilarity to the genes encoding rhoptry proteins of the para-site Plasmodium, which mediate attachment to host red bloodcells (40). Although the pdpB mutant did not exhibit defectsduring in vitro growth, its ability to enter host cells was signif-icantly compromised and it displayed prominent intracellularattenuation since no CFU were detected in the lysates of RAWand J774 cells at 24 h p.i. Because pdpB is the second ORF ina 12-gene operon, it is likely that the transposon insert in thisgene has polar effects on downstream genes. These findingsindicate that pdpB or other genes in the pdp operon are neededfor both entry into and replication within host cells. So far, thefunctions of the genes in the pdp operon have not been eluci-dated.

Fumarate hydratase A, the component of the Kreb’s cycle(citric acid cycle) that converts fumarate to malate, is encodedby fumA (46). The citric acid cycle is one of the three metabolicpathways of cellular respiration and is necessary for fuel ca-tabolism and ATP production. Precursory molecules for com-pounds such as amino acids are also generated by the citricacid cycle. Thus, the observation that our fumA mutant exhib-ited lower levels of in vitro replication than wild-type strainU112 exhibited may have been a result of energy deficiency ora lack of molecules needed for replication.

The carB gene encodes the large subunit of the het-erodimeric enzyme carbamoyl phosphate synthase, which isrequired for pyrimidine biosynthesis (28). As pyrimidines arerequired for replication, it is clear that a mutation in this

biosynthesis pathway would lead to both in vitro and intracel-lular growth defects. Indeed, we observed an in vitro growthdefect with this mutant strain. Nevertheless, our carB mutantwas able to infect macrophages and protect mice against chal-lenge with the wild-type organism, which suggests that strainswith mutations in the pyrimidine pathways of F. novicida maybe useful as potential vaccine strains. However, compared tothe other F. novicida mutants used in this study, the carBmutant had a lower LD50 and less intracellular attenuation anddid not appear to disseminate from the initial site of infection.For these reasons, we decided not to pursue use of this mutantas a possible vaccine candidate.

Although we observed only partial complementation of theFTT0742 mutant phenotype, we still consider this strain to bea vaccine candidate. Complementation experiments similar tothose described in this paper carried out with Salmonella havealso resulted in mixed success because the copy number of theplasmid, as well as the regulation of the gene itself, can influ-ence complementation. In fact, the Forsberg group recentlydemonstrated the importance of correct gene regulation dur-ing complementation in Francisella with their studies of pilA;there was functional complementation in cis, but expression ofPilA was barely detectable in the strain complemented in trans(12). The problem was further compounded in our studiesbecause the F. novicida genome has not been published yet;therefore, the genes used for complementation were amplifiedfrom SCHU S4 DNA and may be incompatible with F. novi-cida due to variations between the subspecies.

Intriguingly, another finding of this study was the lack ofprotection conferred by pur mutants in a murine model. It hasbeen postulated previously that mutations affecting the F. tu-larensis purine synthesis pathway could be used to generate alive attenuated tularemia vaccine (25). In fact, defined allelicreplacement mutants with mutations that disrupt this pathwayhave been used to produce vaccine strains attenuated for rep-lication in host cells in a variety of other bacterial species (36).Our F. novicida transposon library contained eight unique purmutants, including mutants with mutations in purA, a purCDfusion (two strains), purL (two strains), and purM (threestrains). Each of these strains exhibited 100% attenuation inmice when 6 � 103 CFU was used, yet all of them failed toprotect mice against a wild-type parental challenge with 8 �105 CFU. Although these results do not necessarily eliminatepurine biosynthesis mutants as potential live vaccine strains, itwas noteworthy that these mutants did not protect againstchallenge with wild-type F. novicida strain U112.

As an alternative to live vaccines, the possibility of develop-ing a subunit vaccine must also be examined. Studies in whichthe efficacy of whole killed cells as a crude tularemia vaccina-tion was evaluated demonstrated the feasibility of a subunitvaccine and prompted research into identification of antigensthat induce protective immunity (8, 24). Although several poly-saccharide and protein components of F. tularensis have beenshown to react with convalescent-phase sera or T cells (22), theonly antigen that has exhibited the ability to induce a protec-tive immune response against tularemia is lipopolysaccharide(36). However, the protection was effective only against F.tularensis subsp. holarctica strains and was incomplete (7, 15,16). Protection against a highly virulent F. tularensis type Astrain likely depends on a Th1-mediated cellular immune re-


sponse (44). So far, there is no way to administer antigens orkilled bacteria that are as effective as a living attenuated vac-cine, a point that has been highlighted by work in the Pamerlaboratory showing that the immune system distinguishes be-tween living and dead bacteria (37).

In contrast, a live attenuated vaccine would be effective ininducing the appropriate cellular responses (36). In fact, thetype B LVS strain provides the only current means of tulare-mia vaccination. However, several limitations prevent the li-censing of this vaccine. Foremost among these constraints isthe fact that the genetic basis of LVS attenuation and protec-tion remains unknown. Second, culturing LVS under certainconditions can lead to poorly immunogenic colony variants,which demonstrates this organism’s inherent genetic instability(9, 11). Also, this vaccine does not provide protection to everyindividual vaccinated (34, 41). Finally, LVS protection againstaerosol challenge is variable and depends on the route ofimmunization, as well as the host (4–6, 43). The last point isespecially critical when F. tularensis is considered as a biolog-ical weapon, as aerosol dispersal is the most likely route ofdelivery. Taken together, these limitations clearly show thatthe development of an approved tularemia vaccine requiresthe development of a rationally attenuated, nonreverting livevaccine strain.

While the manuscript was in preparation, the Conlan Sjos-tedt groups published the first description of a defined genedeletion mutant of a type A strain that protected mice againstchallenge with the wild-type organism (47). Indeed, the ideallive vaccine strain would be derived from a virulent F. tularensisstrain; however, we used F. novicida as a model for preliminaryanalysis of potential tularemia vaccines because this taxon ismore amenable to genetic manipulation without the danger ofinfection. Furthermore, because all of the Francisella taxa areclosely related (3), genes necessary for intracellular growth inF. novicida are likely to have the same function in F. tularensis.Consequently, F. novicida strains provide relatively safe, ge-netically significant organisms with which to conduct explor-atory investigations prior to studies with the more virulent F.tularensis subspecies.

Here, we describe discovery of five F. novicida transposonmutants that exhibit attenuation in macrophages and are ca-pable of protecting mice against infection with the wild-typeparental strain at doses that are up to 106 times the observedwild-type LD50. An approved tularemia vaccine must be ahighly attenuated nonreverting derivative of a type A strain, assuch strains are most likely to be used in a bioterrorism attackand there is no certainty that one taxon will protect againstanother. Accordingly, we will now focus on extending this workto Francisella type A strains by creating deletions of each of thegenes identified here and assaying for virulence in a mousemodel.

ACKNOWLEDGMENTS

We thank the OHSU Core Facility and Aurelie Snyder for sequenc-ing and microscopy assistance. We also acknowledge Jeff Vandeheyand Chris Langford for technical assistance. We are grateful to FranNano for providing the F. novicida U112 strain. The mini-Tn5 cyclertransposon was a kind gift from Kaoru Geddes. We appreciate thehelpful comments of Jean Gustin during revision of the manuscript.

This work was supported by NIH R21 grant EB000985 to F.H., aswell as by a National Science Foundation Graduate Research Fellow-ship and a OHSU Tartar Trust Fellowship, both to R.T.

REFERENCES

1. Ausubel, F. M. 2002. Short protocols in molecular biology: a compendium ofmethods from Current Protocols in Molecular Biology, 5th ed. Wiley, NewYork, NY.

2. Baron, G. S., and F. E. Nano. 1998. MglA and MglB are required for theintramacrophage growth of Francisella novicida. Mol. Microbiol. 29:247–259.

3. Broekhuijsen, M., P. Larsson, A. Johansson, M. Bystrom, U. Eriksson, E.Larsson, R. G. Prior, A. Sjostedt, R. W. Titball, and M. Forsman. 2003.Genome-wide DNA microarray analysis of Francisella tularensis strains dem-onstrates extensive genetic conservation within the species but identifiesregions that are unique to the highly virulent F. tularensis subsp. tularensis.J. Clin. Microbiol. 41:2924–2931.

4. Chen, W., R. KuoLee, H. Shen, and J. W. Conlan. 2004. Susceptibility ofimmunodeficient mice to aerosol and systemic infection with virulent strainsof Francisella tularensis. Microb. Pathog. 36:311–318.

5. Chen, W., H. Shen, A. Webb, R. KuoLee, and J. W. Conlan. 2003. Tularemiain BALB/c and C57BL/6 mice vaccinated with Francisella tularensis LVS andchallenged intradermally or by aerosol with virulent isolates of the pathogen:protection varies depending on pathogen virulence, route of exposure, andhost genetic background. Vaccine 21:3690–3700.

6. Conlan, J. W., H. Shen, R. Kuolee, X. Zhao, and W. Chen. 2005. Aerosol- butnot intradermal-immunization with the live vaccine strain of Francisellatularensis protects mice against subsequent aerosol challenge with a highlyvirulent type A strain of the pathogen by an alphabeta T cell- and interferongamma-dependent mechanism. Vaccine 23:2477–2485.

7. Conlan, J. W., H. Shen, A. Webb, and M. B. Perry. 2002. Mice vaccinatedwith the O-antigen of Francisella tularensis LVS lipopolysaccharide conju-gated to bovine serum albumin develop varying degrees of protective immu-nity against systemic or aerosol challenge with virulent type A and type Bstrains of the pathogen. Vaccine 20:3465–3471.

8. Coriell, L. L., E. O. King, and M. G. Smith. 1948. Studies on tularemia IV.Observations on tularemia in control and vaccinated monkeys. J. Immunol.58:183–202.

9. Cowley, S. C., S. V. Myltseva, and F. E. Nano. 1996. Phase variation inFrancisella tularensis affecting intracellular growth, lipopolysaccharide anti-genicity and nitric oxide production. Mol. Microbiol. 20:867–874.

10. Dennis, D. T., T. V. Inglesby, D. A. Henderson, J. G. Bartlett, M. S. Ascher,E. Eitzen, A. D. Fine, A. M. Friedlander, J. Hauer, M. Layton, S. R.Lillibridge, J. E. McDade, M. T. Osterholm, T. O’Toole, G. Parker, T. M.Perl, P. K. Russell, and K. Tonat. 2001. Tularemia as a biological weapon:medical and public health management. JAMA 285:2763–2773.

11. Eigelsbach, H. T., and C. M. Downs. 1961. Prophylactic effectiveness of liveand killed tularemia vaccines. I. Production of vaccine and evaluation in thewhite mouse and guinea pig. J. Immunol. 87:415–425.

12. Forslund, A. L., K. Kuoppa, K. Svensson, E. Salomonsson, A. Johansson, M.Bystrom, P. C. Oyston, S. L. Michell, R. W. Titball, L. Noppa, E. Frithz-Lindsten, M. Forsman, and A. Forsberg. 2006. Direct repeat-mediated de-letion of a type IV pilin gene results in major virulence attenuation ofFrancisella tularensis. Mol. Microbiol. 59:1818–1830.

13. Forsman, M., G. Sandstrom, and A. Sjostedt. 1994. Analysis of 16S ribo-somal DNA sequences of Francisella strains and utilization for determina-tion of the phylogeny of the genus and for identification of strains by PCR.Int. J. Syst. Bacteriol. 44:38–46.

14. Fortier, A. H., S. J. Green, T. Polsinelli, T. R. Jones, R. M. Crawford, D. A.Leiby, K. L. Elkins, M. S. Meltzer, and C. A. Nacy. 1994. Life and death ofan intracellular pathogen: Francisella tularensis and the macrophage. Immu-nol. Ser. 60:349–361.

15. Fulop, M., R. Manchee, and R. Titball. 1995. Role of lipopolysaccharide anda major outer membrane protein from Francisella tularensis in the inductionof immunity against tularemia. Vaccine 13:1220–1225.

16. Fulop, M., P. Mastroeni, M. Green, and R. W. Titball. 2001. Role of anti-body to lipopolysaccharide in protection against low- and high-virulencestrains of Francisella tularensis. Vaccine 19:4465–4472.

17. Geddes, K., M. Worley, G. Niemann, and F. Heffron. 2005. Identification ofnew secreted effectors in Salmonella enterica serovar Typhimurium. Infect.Immun. 73:6260–6271.

18. Golovliov, I., A. Sjostedt, A. Mokrievich, and V. Pavlov. 2003. A method forallelic replacement in Francisella tularensis. FEMS Microbiol. Lett. 222:273–280.

19. Goryshin, I. Y., J. Jendrisak, L. M. Hoffman, R. Meis, and W. S. Reznikoff.2000. Insertional transposon mutagenesis by electroporation of released Tn5transposition complexes. Nat. Biotechnol. 18:97–100.

20. Gray, C. G., S. C. Cowley, K. K. Cheung, and F. E. Nano. 2002. Theidentification of five genetic loci of Francisella novicida associated with in-tracellular growth. FEMS Microbiol. Lett. 215:53–56.

21. Green, M., G. Choules, D. Rogers, and R. W. Titball. 2005. Efficacy of thelive attenuated Francisella tularensis vaccine (LVS) in a murine model ofdisease. Vaccine 23:2680–2686.


22. Isherwood, K. E., R. W. Titball, D. H. Davies, P. L. Felgner, and W. J.Morrow. 2005. Vaccination strategies for Francisella tularensis. Adv. DrugDeliv. Rev. 57:1403–1414.

23. Kadokura, H., F. Katzen, and J. Beckwith. 2003. Protein disulfide bondformation in prokaryotes. Annu. Rev. Biochem. 72:111–135.

24. Kadull, P. J., H. R. Reames, L. L.Coriell, and L. Foshay. 1950. Studies ontularemia. V. Immunization of man. J. Immunol. 65:425–435.

25. Karlsson, J., R. G. Prior, K. Williams, L. Lindler, K. A. Brown, N. Chatwell,K. Hjalmarsson, N. Loman, K. A. Mack, M. Pallen, M. Popek, G. Sandstrom,A. Sjostedt, T. Svensson, I. Tamas, S. G. Andersson, B. W. Wren, P. C. Oyston,and R. W. Titball. 2000. Sequencing of the Francisella tularensis strain Schu 4genome reveals the shikimate and purine metabolic pathways, targets for theconstruction of a rationally attenuated auxotrophic vaccine. Microb. Comp.Genomics 5:25–39.

26. Kawula, T. H., J. D. Hall, J. R. Fuller, and R. R. Craven. 2004. Use oftransposon-transposase complexes to create stable insertion mutant strainsof Francisella tularensis LVS. Appl. Environ. Microbiol. 70:6901–6904.

27. Kieffer, T. L., S. Cowley, F. E. Nano, and K. L. Elkins. 2003. Francisellanovicida LPS has greater immunobiological activity in mice than F. tularensisLPS, and contributes to F. novicida murine pathogenesis. Microbes Infect.5:397–403.

28. Koonin, E. V., and M. Y. Galperin. 2003. Sequence-evolution-function: com-putational approaches in comparative genomics. Kluwer Academic, Boston,MA.

29. Kudelina, R. I. 1978. Sensitivity of the causative agent of tularemia toantibiotics. Antibiotiki 23:710–714.

30. Kuoppa, K., A. Forsberg, and A. Norqvist. 2001. Construction of a reporterplasmid for screening in vivo promoter activity in Francisella tularensis.FEMS Microbiol. Lett. 205:77–81.

31. Lai, X. H., I. Golovliov, and A. Sjostedt. 2004. Expression of IglC is necessaryfor intracellular growth and induction of apoptosis in murine macrophagesby Francisella tularensis. Microb. Pathog. 37:225–230.

32. Larsson, P., P. C. Oyston, P. Chain, M. C. Chu, M. Duffield, H. H. Fuxelius,E. Garcia, G. Halltorp, D. Johansson, K. E. Isherwood, P. D. Karp, E.Larsson, Y. Liu, S. Michell, J. Prior, R. Prior, S. Malfatti, A. Sjostedt, K.Svensson, N. Thompson, L. Vergez, J. K. Wagg, B. W. Wren, L. E. Lindler,S. G. Andersson, M. Forsman, and R. W. Titball. 2005. The completegenome sequence of Francisella tularensis, the causative agent of tularemia.Nat. Genet. 37:153–159.

33. Lauriano, C. M., J. R. Barker, S. S. Yoon, F. E. Nano, B. P. Arulanandam,D. J. Hassett, and K. E. Klose. 2004. MglA regulates transcription of viru-lence factors necessary for Francisella tularensis intraamoebae and intram-acrophage survival. Proc. Natl. Acad. Sci. USA 101:4246–4249.

34. McCrumb, F. R. 1961. Aerosol infection of man with Pasteurella tularensis.Bacteriol. Rev. 25:262–267.

35. Nano, F. E., N. Zhang, S. C. Cowley, K. E. Klose, K. K. Cheung, M. J.Roberts, J. S. Ludu, G. W. Letendre, A. I. Meierovics, G. Stephens, and K. L.Elkins. 2004. A Francisella tularensis pathogenicity island required for intra-macrophage growth. J. Bacteriol. 186:6430–6436.

36. Oyston, P. C., and J. E. Quarry. 2005. Tularemia vaccine: past, present andfuture. Antonie Leeuwenhoek 87:277–281.

37. Pamer, E. G. 2004. Immune responses to Listeria monocytogenes. Nat. Rev.Immunol. 4:812–823.

38. Pammit, M. A., E. K. Raulie, C. M. Lauriano, K. E. Klose, and B. P.Arulanandam. 2006. Intranasal vaccination with a defined attenuated Fran-cisella novicida strain induces gamma interferon-dependent antibody-medi-ated protection against tularemia. Infect. Immun. 74:2063–2071.

39. Reed, L. J., and H. Muench. 1935. A simple method of estimating fiftypercent endpoints. Am. J. Hyg. 27:493–497.

40. Sam-Yellowe, T. Y. 1992. Molecular factors responsible for host cell recog-nition and invasion in Plasmodium falciparum. J. Protozool. 39:181–189.

41. Saslaw, S., H. T. Eigelsbach, J. A. Prior, H. E. Wilson, and S. Carhart. 1961.Tularemia vaccine study. II. Respiratory challenge. Arch. Intern. Med. 107:702–714.

42. Shen, H., W. Chen, and J. W. Conlan. 2004. Mice sublethally infected withFrancisella novicida U112 develop only marginal protective immunity againstsystemic or aerosol challenge with virulent type A or B strains of F. tularensis.Microb. Pathog. 37:107–110.

43. Shen, H., W. Chen, and J. W. Conlan. 2004. Susceptibility of various mousestrains to systemically- or aerosol-initiated tularemia by virulent type AFrancisella tularensis before and after immunization with the attenuated livevaccine strain of the pathogen. Vaccine 22:2116–2121.

44. Tarnvik, A. 1989. Nature of protective immunity to Francisella tularensis.Rev. Infect. Dis. 11:440–451.

45. Tempel, R., K. Geddes, and F. Heffron. 2003. Presented at the FourthInternational Conference on Tularemia, Bath, United Kingdom.

46. Tseng, C. P., C. C. Yu, H. H. Lin, C. Y. Chang, and J. T. Kuo. 2001. Oxygen-and growth rate-dependent regulation of Escherichia coli fumarase (FumA,FumB, and FumC) activity. J. Bacteriol. 183:461–467.

47. Twine, S., M. Bystrom, W. Chen, M. Forsman, I. Golovliov, A. Johansson, J.Kelly, H. Lindgren, K. Svensson, C. Zingmark, W. Conlan, and A. Sjostedt.2005. A mutant of Francisella tularensis strain SCHU S4 lacking the ability toexpress a 58-kilodalton protein is attenuated for virulence and is an effectivelive vaccine. Infect. Immun. 73:8345–8352.

48. van der Velden, A. W., S. W. Lindgren, M. J. Worley, and F. Heffron. 2000.Salmonella pathogenicity island 1-independent induction of apoptosis ininfected macrophages by Salmonella enterica serotype Typhimurium. Infect.Immun. 68:5702–5709.

49. Wu, T. H., J. A. Hutt, K. A. Garrison, L. S. Berliba, Y. Zhou, and C. R. Lyons.2005. Intranasal vaccination induces protective immunity against intranasalinfection with virulent Francisella tularensis biovar A. Infect. Immun. 73:2644–2654.

50. Zusman, T., M. Feldman, E. Halperin, and G. Segal. 2004. Characterizationof the icmH and icmF genes required for Legionella pneumophila intracel-lular growth, genes that are present in many bacteria associated with eu-karyotic cells. Infect. Immun. 72:3398–3409.

Editor: J. T. Barbieri


tempel, et al iai

Documents