spatio-temporal analysis of cellulose synthesis during cell plate formation in arabidopsis

Spatio-temporal analysis of cellulose synthesis during cellplate formation in Arabidopsis

Fabien Miart, Thierry Desprez, Eric Biot, Halima Morin, Katia Belcram, Herman Hofte, Martine Gonneau and Samantha

Vernhettes*1INRA, UMR1318, Institut Jean-Pierre Bourgin, Saclay Plant Sciences, AgroParisTech, RD10, F-78000 Versailles, France

Received 19 December 2012; revised 7 October 2013; accepted 18 October 2013; published online 22 October 2013.

*For correspondence (e-mail [email protected]).Present address: EA 3900-BIOPI, Universite de Picardie Jules Verne, Biologie des plantes et Innovation 33 rue Leu 80039, Amiens Cedex, France.

SUMMARY

During cytokinesis a new crosswall is rapidly laid down. This process involves the formation at the cell

equator of a tubulo-vesicular membrane network (TVN). This TVN evolves into a tubular network (TN) and a

planar fenestrated sheet, which extends at its periphery before fusing to the mother cell wall. The role of

cell wall polymers in cell plate assembly is poorly understood. We used specific stains and GFP-labelled cel-

lulose synthases (CESAs) to show that cellulose, as well as three distinct CESAs, accumulated in the cell

plate already at the TVN stage. This early presence suggests that cellulose is extruded into the tubular

membrane structures of the TVN. Co-localisation studies using GFPCESAs suggest the delivery of cellulose

synthase complexes (CSCs) to the cell plate via phragmoplast-associated vesicles. In the more mature TN

part of the cell plate, we observed delivery of GFPCESA from doughnut-shaped organelles, presumably

Golgi bodies. During the conversion of the TN into a planar fenestrated sheet, the GFPCESA density dimin-

ished, whereas GFPCESA levels remained high in the TVN zone at the periphery of the expanding cell

plate. We observed retrieval of GFPCESA in clathrin-containing structures from the central zone of the cell

plate and from the plasma membrane of the mother cell, which may contribute to the recycling of CESAs to

the peripheral growth zone of the cell plate. These observations, together with mutant phenotypes of cellu-

lose-deficient mutants and pharmacological experiments, suggest a key role for cellulose synthesis already

at early stages of cell plate assembly.

Keywords: cellulose synthase, cell wall, cytokinesis, cell plate, phragmoplast microtubule, membrane

trafficking, Arabidopsis thaliana.

INTRODUCTION

Cytokinesis, the partitioning of the daughter cytoplasm

after mitosis, involves in higher plants the de novo con-

struction of a cell wall (Moore and Staehelin, 1988; Samu-

els et al., 1995). This remarkable process is initiated during

late anaphase with the assembly of the phragmoplast, a

plant-specific cytoskeletal configuration, which consists of

a double array of dense, parallel-oriented microtubules,

actin filaments and a ribosome-excluding cell plate assem-

bly matrix. The phragmoplast provides a scaffold for the

transport of Golgi-derived cell plate-building vesicles to

the cell equator (Samuels et al., 1995; Segui-Simarro et al.,

2004). These vesicles undergo homotypic fusion within

the cell plate assembly matrix. The resulting membra-

nous compartments are constricted by dynamin-like

springs into dumbbell-shaped tubular structures, which

fuse with incoming vesicles thus forming a ~200-nm-thick

tubulo-vesicular network (TVN). This TVN subsequently

evolves into a tubular network (TN), and a fenestrated

sheet (FS), before turning into the new cell wall (Samuels

et al., 1995; Segui-Simarro et al., 2004). This succession of

events starts in the cell centre and then progresses centrifu-

gally towards the cell cortex. The TVN to TN transition

coincides with the concentric displacement of the phragmo-

plast, whereas the FS is initiated at the centre of the cell plate

after its fusion with the mother cell wall (Strompen et al.,

2002; Sasabe and Machida, 2006; Sasabe et al., 2006).

A large body of literature deals with membrane traffic

involved in cell plate formation. The number of Golgi stacks,

which deliver cell plate-building vesicles, doubles prior to

the formation of the phragmoplast (Segui-Simarro and

Staehelin, 2006). During cell plate maturation, about 70% of

the membrane surface is removed by clathrin-mediated

2013 The AuthorsThe Plant Journal 2013 John Wiley & Sons Ltd

71

The Plant Journal (2014) 77, 7184 doi: 10.1111/tpj.12362

vesicle retrieval (Otegui and Staehelin, 2004; Segui-Simar-

ro et al., 2004; Segui-Simarro and Staehelin, 2006). Such

vesicle retrieval as well as endocytosis from the plasma

membrane may contribute to the recycling of cell plate

components as suggested by the presence of endosomes

in a belt at the periphery of the growing cell plate (Vermeer

et al., 2006). The importance of endocytosis for cell plate

formation was questioned by the observation that pharma-

cological inhibition of endocytosis did not impair cytokine-

sis (Reichardt et al., 2007). The latter study suggested that

endocytosis is not essential for cell plate formation but

may contribute to speeding up the process.

The content of the membranous compartments also

plays a critical role in cell plate formation. Extensins and

matrix polysaccharides (pectin and hemicellulose) are

respectively synthesized in the endoplasmic reticulum (ER)

and Golgi apparatus and targeted to the cell plate (Moore

and Staehelin, 1988; Samuels et al., 1995; Cannon et al.,

2008). In addition, callose is produced from membrane-

bound callose synthases and transiently fills the lumen of

the tubules, thus presumably contributing to the formation

of the FS (Samuels et al., 1995). The essential role for cal-

lose in cell plate formation is shown by the incomplete cell

plates in a seedling-lethal, callose synthase mutant (Thiele

et al., 2009). In this study we focused on the role of cellu-

lose synthesis in cell plate formation. Cellulose synthesis

has been intensively studied in rapidly growing cells of

dark-grown Arabidopsis hypocotyls. In these cells, cellu-

lose is synthesized in the plasma membrane by large hexa-

meric CSC (for review see (Guerriero et al., 2010), which

contains three non-redundant classes of catalytic subunits

(CESA1, CESA3 and CESA6-like; Desprez et al., 2007; Pers-

son et al., 2007). Functional fluorescent protein-tagged

CSCs were shown to be secreted to the plasma membrane

via Golgi stacks and/or microtubule-associated compart-

ments (MASC or SmaCCs; Crowell et al., 2009; Gutierrez

et al., 2009) and to migrate along linear trajectories in the

plasma membrane propelled by the polymerisation of the

glucan chains (Paredez et al., 2006; Desprez et al., 2007).

Cellulose synthesis is essential for cell plate formation as

shown by the aborted cell plates in certain cellulose-defi-

cient mutants (Zuo et al., 2000; Beeckman et al., 2002).

Exactly at what stage of cell plate formation cellulose syn-

thesis plays a role remains to be determined. So far, cellu-

lose has been observed at later stages of cell plate

formation (from the TN stage on) and suggests a role in its

consolidation (Samuels et al., 1995). How cellulose is syn-

thesized in dividing cells is also not known. Indeed CSC

composition can vary in different cell types or in changing

environments (Bischoff et al., 2011; Mendu et al., 2011). In

addition, in certain cell types, members of the cellulose

synthase-like family D (ex. CSLD3) can substitute for

CESAs in the synthesis of cellulose (Park et al., 2011).

CESA1 plays a role in cell plate formation, given the

aborted cell plates in the strong allele cesa1rsw120. Instead,

mutant alleles for CESA3 and CESA6 did not show a cell

plate phenotype, shedding doubt on the implication of

these isoforms in cell plate assembly.

Here we used GFP-tagged proteins expressed from their

endogenous promoters to observe the presence of all three

CESA isoforms in the developing cell plate. The CSCs

appear to be active in the developing cell plate as shown

by the presence of cellulose as early as the TVN stage. We

also observed GFPCESAs associated with the phragmo-

plast, a finding that suggested that phragmoplast-associ-

ated vesicles are involved in the delivery of the CSCs to

the cell plate. Instead, in the more mature zone of the cell

plate we observed delivery of GFPCESAs from doughnut-

shaped organelles, presumably Golgi bodies. During matu-

ration of the cell plate, GFPCESA density decreased in the

central zone and remained high in the TVN at the periph-

eral growth zone. Clathrin-mediated CESA retrieval from

the central zone of the cell plate and from the plasma

membrane of the mother cell was observed and might

contribute to the recycling of the CSCs to the peripheral

growth zone. The spatio-temporal pattern of CESA accu-

mulation suggests a role for cellulose synthesis already

during the formation of the TVN.

RESULTS

Three distinct GFP-labelled cellulose synthases

accumulate in the developing cell plate

The cellulose synthase catalytic subunit CESA1 is required

for cytokinesis as shown by the presence of incomplete

cell plates in loss-of-function mutants (Beeckman et al.,

2002). To study the subcellular localisation of this protein

in dividing cells, we expressed a green fluorescent protein

(GFP)CESA1 fusion protein from its own promoter in a

cesa1 mutant background. This construct complemented

the mutant phenotype and hence is functional (Figure S1).

We studied the localisation of GFPCESA1 in cortical and

epidermal cells of 4-day-old roots using laser scanning

confocal microscopy (LSCM) after staining of the plasma

membrane and developing cell plate with the styryl dye

FM464. In interphase cells, GFPCESA1 was present in the

plasma membrane and in different subcellular compart-

ments. The doughnut-shaped GFPCESA1 organelles were

previously identified as Golgi stacks (Figure 1a; Crowell

et al., 2009; Gutierrez et al., 2009). In dividing cells, GFP-

CESA1 was strongly enriched in mature cell plates as com-

pared with the plasma membrane of the mother cells

(Figure 1a,b), indicating the existence of a mechanism that

selectively concentrates CSCs to the cell plate in dividing

cells. To further investigate this finding, we followed the

presence of GFPCESA1 during cell plate formation. Inter-

estingly, GFPCESA1 was already present at early stages

of cell plate formation and further accumulated at the

2013 The AuthorsThe Plant Journal 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 7184

72 Fabien Miart et al.

periphery of the growing cell plate (Figure 1ce). The com-

position of CSCs can change during development (Persson

et al., 2007; Bischoff et al., 2011) and it is not known

whether the two other primary cell wall cellulose synthases

CESA3 and CESA6 are also required in cell plate formation

since no cytokinesis defects were observed in the respec-

tive partial loss-of-function mutants. We therefore studied

the localisation of the respective GFP-fusion proteins

(Desprez et al., 2007). Interestingly both GFPCESA3 (Fig-

ure 1fh) and GFPCESA6 (Figure 1ik), expressed from

their own 5 upstream regions, showed accumulation pat-

terns similar to those of GFPCESA1, suggesting that the

cell plate-associated CSCs, like those present in interphase

cells, comprise all three subunits. To monitor cellulose

synthesis during cell plate formation, it is essential to pre-

cisely determine the stage of cell plate formation. The TVN

corresponds to the zone of the developing cell plate at the

equator of the phragmoplast. As soon as the phragmoplast

moves away centrifugally, the central phragmoplast-free

zone turns into the TN, which upon fusion of the cell plate

with the mother cell plasma membrane, turns into a FS

before turning into the mature cell plate. In Figure 2, we

labelled microtubules with anti-a-tubulin antibodies, theDNA with DAPI and the membrane networks that support

cell plate formation with anti-syntaxin KNOLLE antibodies

(Lauber et al., 1997). During the prophase and metaphase,

KNOLLE, GFPCESA3 and GFPCESA1 were present in

intracellular compartments surrounding the nucleus

(arrowheads in Figure 2a,b,f,g,k) and there was no label-

ling at the equatorial plane (Figure 2b,g,k). At the transition

anaphase/telophase, when the chromosomes were sepa-

rated and still condensed, KNOLLE labelled the cell

(a)

(c)

(d)

(e)

(f)

(g)

(h)

(i)

(j)

(k)

(b)

Figure 1. Three distinct cellulose synthases accumulate in the developing cell plate.

(a) Merge of confocal images from root cells expressing GFPCESA1 (green), labelled with FM464 (red). GFPCESA1 label is enriched in the cell plate. Also notethe presence of GFPCESA1-labelled Golgi stacks (arrow). (b) Fluorescence intensity profiles along the white line on image A. The fluorescence intensity ofGFPCESA1 is higher at the plasma membrane just after the formation of the cell plate (peak 3) than at parental plasma membranes (peaks 1, 2 and 4). (ce)GFPCESA1 (left panel), FM464 (middle panel) and merge (right panel) at successive stages of cell plate formation. (fh) Merge of GFPCESA3 (green) andFM464 (red). (ik) Merge of GFPCESA6 (green) and FM464 (red). Scale bar = 10 lm.


Cellulose synthase trafficking during cell plate formation 73

equator, corresponding to the phragmoplast-surrounded

TVN (Figure 2c). At this stage, GFPCESA3 was already

present in the developing cell plate (Figure 2h). As judged

from the still condensed chromosomes, GFPCESA1 also

colocalised with the FM464-labelled TVN (Figure 2l). Dur-

ing telophase, the nucleus had evolved into an ovoid shape

with partially decondensed DNA, the phragmoplast microtu-

bules had moved away centrifugally and KNOLLE was still

present throughout the cell plate (Figure 2d). At this stage

both GFPCESA3 (Figure 2i) and GFPCESA1 (Figure 2m)

were present in the phragmoplast-depleted TN but the label

was stronger at the peripheral, phragmoplast-surrounded,

TVN zone of the cell plate. At the late telophase, large nucle-

oli were visible in the nucleus (Figure 2e,n) and phragmo-

plast microtubules disappeared where the cell plate reached

the parental plasma membrane (arrowheads in Figure 2e,j).

At this stage GFPCESA3 and GFPCESA6 remained more

abundant at the cell plate periphery. In conclusion, both

GFPCESA1 and GFPCESA3 were present in the cell plate

at as early as at the TVN phase.

Cellulose deposition starts at the TVN stage

The presence of CSCs at the TVN stage precedes the previ-

ously reported observation of cellulose from the TN stage

on (Samuels et al., 1995). We therefore investigated

whether these CSCs also synthesize cellulose. To this end,

we used the cellulose-specific fluorescent dye Pontamine

Fast Scarlet 4B (S4B; Anderson et al., 2010) and the crystal-

line cellulose-binding module CBM3a (Blake et al., 2006) to

label whole-mount preparations of roots. S4B showed a

strong transverse fibrillar staining pattern, corresponding

to cellulose microfibrils, in all root cell walls (Figure 3a and

Movie S1). As expected, this staining was significantly

reduced in roots treated with the cellulose synthesis inhibi-

tor isoxaben or in roots of the cellulose-deficient mutant

kor12 (Zuo et al., 2000) (Figures 3gi and S2a,b), both of

which displayed radially expanded cells. Interestingly, in

dividing cells, S4B also stained the developing cell plate

even at stages as early as at the TVN stage as shown by

the flattened nucleus with still condensed chromosomes

(a) (b) (c) (d) (e)

(f) (g) (h) (i) (j)

(k) (l) (m) (n)

Figure 2. GFPCESA are present in the cell plate as early as at the TVN phase.Confocal (ae, kn) and spinning disk (fj) images of root cells. (ae) To observe specific mitotic stages, the nucleus cycle stained by DAPI (blue), the membrane net-works formation immunolabelled by an anti-KNOLLE antibody (green), microtubules immunolabelled by an anti-tubulin antibody (red in (aj)) were followed duringroot cell division. To more precisely stage the formation of the cell plate, stably transformed lines expressing both GFPCESA3 (green) and the microtubule markermCherry-MBD (red) were used (fj) as well as a line expressing GFPCESA1 (green) labelled with FM464 (red) and DAPI (blue) (kn). See text for a more detaileddescription. Scale bars = 5 lm. During the prophase and metaphase, GFP-CESA were present in intracellular compartments surrounding the nucleus (arrowheads ina, b, f, g, k). At late telophase, phragmoplast microtubules disappeared where the cell plate reached the parental plasma membrane (arrowheads in e, j).



(Figure 3a,b,d and Movie S1). This staining was not due to

autofluorescence as shown by the unlabelled control (Fig-

ure S2(c)). At the same stage, the staining was weaker in

the isoxaben-treated plants and at background levels in

kor12 roots (Figure 3gi) confirming the specificity of the

stain for cellulose. The presence of cellulose in developing

cell plates was confirmed by whole-mount immunolabel-

ling with CBM3a. Again, cellulose was detected at the tran-

sition anaphase/telophase (Figure S3c) and mature cell

plates (Figure S3d) with no labelling at the metaphase (Fig-

ure S3b). The labelling was weaker in the isoxaben-treated

plants compared with untreated seedlings (Figure S3eg).

Our data show that cellulose is present from the TVN stage

on, which is consistent with the early appearance of the

GFPCESAs in the developing cell plate.

GFPCESA is delivered to the cell plate via different routes

Cell plate formation is initiated by the formation of dense

phragmoplast microtubule arrays. Along these arrays

Golgi-derived membrane vesicles migrate to the equatorial

plane, where they form membranous compartments

through homotypic fusion inside the cell plate assembly

matrix (Segui-Simarro et al., 2004). These compartments

form tubular structures, which grow and coalesce, thus

forming the TVN (Samuels et al., 1995). Here we observed

that at the anaphase/telophase transition, GFPCESA-con-

taining compartments moved throughout the cell but were

excluded from the growing cell plate by the dense phrag-

moplast microtubule arrays (Figures 2h, 4a and Movie S2).

The exclusion from the cell plate of Golgi stacks and other

(a)

(c)

(d)

(e)

(f)

(b)

(g)

(h)

(i)

Figure 3. Cellulose is deposited already at the TVN stage.

Confocal images of root cells expressing GFPCESA1. (a) View of root cell stained by Pontamine Fast Scarlet 4B (S4B) (red) and DAPI (blue). Note that S4B labelsthe cell plate at the TVN stage (arrowhead). (b) Views from two angles of 3D reconstructions from a Z-stack of confocal images from a dividing cell stained with

S4B and DAPI. (cf) Detailed view of S4B staining of cellulose: DAPI (left panel) S4B (middle panel) and merge (right panel) at metaphase (c), at the transitionanaphase/telophase (d), telophase (e) and mature cell plate (f). (g,h) Confocal images of isoxaben-treated (g) and kor12 (h) root cells at the transition anaphase/telophase labelled by DAPI (left panel) and S4B (middle panel), merge (right panel). Note that there is a weak cell plate staining in isoxaben-treated cells (g)

(arrowhead) and nearly no staining in kor12 mutant (h). (i) Relative S4B signal intensity at the cell plate in unlabelled, untreated, isoxaben-treated and kor1-2root cells. The signal was significantly higher in Col0 than in Col0 + isoxaben (t-test, P-value = 105) and kor1-2 (P-value = 107). The unlabelled control signalwas lower than Col0 (P-value = 107) and Col0 + isoxaben (P-value = 105), but not significantly different from kor1-2. Scale bars = 10 lm.



organelles by phragmoplast microtubules has been

observed previously (Samuels et al., 1995; Nebenfuhr et al.,

2000). We investigated whether CSCs were associated with

the phragmoplast using transgenic lines expressing both

GFPCESA3 and mCherry-MBD. Using spinning disk micros-

copy and image processing, we detected a faint but repro-

ducible GFPCESA3 signal overlapping with the microtubule

signal at early and late telophase (Figure 4c,e, n > 50). Treat-ment with the microtubule-stabilising drug taxol further

enhanced the phragmoplast-associated GFPCESA3 signal

(Figure 4d,f, n > 50). Together, these results suggest thatCSCs are present in phragmoplast-associated vesicles,

which presumably are on their way to the cell plate.

During telophase, the phragmoplast-depleted central

zone becomes accessible to organelles (Segui-Simarro

et al., 2004). A 3D reconstruction of a late telophase

phragmoplast clearly shows the close proximity of GFP

CESA3-containing compartments to the central microtu-

bule-free zone (Figure 4b and Movie S3). Time-lapse

movies showed that in this zone, doughnut-shaped com-

partments (presumably Golgi stacks) frequently paused

(up to 30s, n > 30) and made contact with the cell plate. Insome cases we also observed the delivery of fluorescent

material from the compartment to the cell plate (Figure 4g

n = 10 and Movie S4). Finally, after fusion of the cell platewith the mother cell plasma membrane, GFPCESA1

punctae were shown to migrate directly from the plasma

membrane to the cell plate via the plasma membrane-cell

plate junction (Figure 4h,i and Movie S5). In conclusion,

GFP-labelled CSCs appeared to reach the cell plate at least

through three distinct pathways (Figure 7): via (1) phrag-

moplast-associated compartments; (2) direct or indirect

(via vesicles) delivery from mobile compartments (pre-

sumably Golgi stacks) to microtubule-free zones of the

growing cell plate; or (3) through plasma membrane-cell

plate junctions.

GFPCESA levels diminish during cell plate maturation

Time-lapse imaging of maturing cell plates showed that the

GFPCESA1 signal, which initially had a more or less uni-

form distribution throughout the cell plate, rapidly dimin-

ished in the central zone and increased in the peripheral

phragmoplast-covered zone (Figure 5a,b, n = 20 out of 60observed cell plates). We next investigated whether the

depletion of GFPCESA1 from the central zone was the

result of active vesicle retrieval, which is a process topo-

logically equivalent to endocytosis from the plasma mem-

brane. To this end, we studied the effect of the ARF-GEF

inhibitor brefeldin A (BFA) on cells coexpressing GFP

CESA1 and the early endosome marker mCherry-RabA1 g

(Geldner et al., 2009). BFA triggers in Arabidopsis the

aggregation of endosomal compartments and inhibits

recycling from endosome to plasma membrane (Geldner

et al., 2001, 2003; Baluska et al., 2002; Grebe et al., 2002,

2003; Samaj et al., 2004; Murphy et al., 2005; Paciorek

et al., 2005). In untreated seedlings, mCherry-RabA1 g

labelled intracellular punctae (early endosomes) as well as

the cell plate, as described before (Geldner et al., 2009).

GFPCESA1 partially overlapped with mCherry-RabA1 g in

the cell plate and endosomes (Figure 5c). Upon BFA treat-

ment for 30 min, GFPCESA1 was found in mCherry-

RabA1 g-containing endosomal aggregates, and in the

doughnut-shaped compartments that surrounded these

aggregates. These aggregates were present at both ends

of the early stage cell plate, presumably excluded from the

central zone by the phragmoplast microtubules (Figure 5d,

n = 22 out of 54 early cell plates). At later stages however,they were located primarily around the microtubule-free

central zone (Figure 5e, n = 54 out of 120 cell plates). Thisfinding suggests that the retrieval of CSCs occured

primarily in zones of the cell plate not covered by the

phragmoplast. To investigate whether CSC retrieval was

clathrin-mediated, we used a line that co-expressed GFP

CESA1 and the clathrin large subunit (CLC) fused to mOr-

ange. Both markers were present at the cell plate from late

anaphase to telophase. CLC-mOrange was present in the

central zone and less abundant in the peripheral zone (Fig-

ure 5f, n = 15 out of 35 cells plates) in line with a previousstudy, which showed increased numbers of clathrin-coated

vesicles (CCVs) in the microtubule-free area (Segui-Simar-

ro et al., 2004). GFPCESA1, in contrast, showed a stronger

signal at the periphery of the cell plate. Next, we used

time-lapse imaging to track the retrieval of clathrin-coated

GFPCSC-containing punctae. We indeed observed the

Figure 4. CSCs are delivered to the cell plate via distinct routes.

(a,b) 3D reconstructions from Z-stacks of confocal images from cells expressing GFPCESA1 labelled with FM464 (red) at the transition anaphase/telophase (a),and late telophase (b). Views from two angles (left and middle panels) and an overview of the areas delimited by white squares (right panel) are shown. The

putative positions of phragmoplasts at the division plane are drawn in blue, GFPCESA1 signal in organelles (yellow) and at the cell plate (green). GFPCESA1-labelled compartments cluster around the phragmoplasts, which exclude them from the cell plate at the transition anaphase/telophase (a). At late telophase,

GFPlabelled organelles reach the microtubule-free central zone of the cell plate (b). (cf) Spinning disk images from root cells expressing GFPCESA3 (leftpanel), mCherry-MBD (middle panel) and merge (right panel) treated with DMSO (c,e) or 8 lM taxol during 2 h (d,f). Detailed view at anaphase from DMSO (e)and taxol treated seedlings (f). Note the stronger phragmoplast-associated GFPCESA3-label in taxol treated cells (arrowhead), arrows in figure 4d compared tothe ones observed for the control [arrows in figure 4 C]. (g) Spinning disk images from a time series showing a GFPCESA1-labelled doughnut-shaped organ-elles (presumably Golgi stacks) approaching the cell plate and transferring fluorescent material (arrows) to the cell plate. (h) Spinning disk image of a cell plate

labelled by GFPCESA1, which has reached the mother cell plasma membrane. GFPCESA1 also labels the area of the mother cell plasma membrane surround-ing the attachment site. Overview of the area delimited by the white square in figure 4 h. (i) Images from a spinning disk time series showing a GFPCESA1puncta moving from the parental membrane to the cell plate (arrows). Scale bars = 10 lm (c,d) and 5 lm (ej).



(a)

(b)

(c)

(d)

(e) (f)

(g)

(h) (i)



(a)

(b)

(c)

(d)

(e)

(f)

(g)



retrieval of CLC-mOrange/GFPCESA1 punctae from the

cell plate with a corresponding decrease of fluorescence at

the cell plate (Figure 6a, Movie S6, n = 12). We alsoobserved retrieval of doubly labelled punctae from the

parental plasma membrane (Figure 6b, n = 10, Movie S7).At late telophase, many of the phragmoplast arrays were

surrounded by multiple doubly labelled punctae (Fig-

ure 6c,d), the presence of CLC-mOrange suggested that

these GFPCESA-containing compartments were generated

by clathrin-mediated retrieval from the cell plate center or

the parental plasma membrane (Figure 6c,d). It is possible

but not proven that these phragmoplast-associated com-

partments mediate the recycling of CSCs to the peripheral

growth zone of the cell plate (Figure 7).

The accumulation patterns of CESAs and the DRP1a in the

developing cell plate suggest a role for both cellulose

synthesis and dynamin in tubulo-vesicular network

formation

Dynamins form springs around membrane compartments

causing them to constrict (Otegui et al., 2001; Segui-Simar-

ro et al., 2004; Verma and Hong, 2005). They play a role in

clathrin-mediated endocytosis (Fujimoto et al., 2010) but

also in the formation of tubular structures of the TVN

(Segui-Simarro et al., 2004). One family member, DRP1a, is

essential for cell plate formation as shown by the ran-

domly oriented incomplete cell plates in a loss-of-function

mutant (Collings et al., 2008). To investigate the role of

DRP1a in cell plate formation, we generated an Arabidop-

sis line expressing both DRP1a-mOrange and GFPCESA1.

Both proteins accumulated in the cell plate and were relo-

calised from the center to the peripheral zone during cell

plate maturation (Figure 5g). As tubule formation takes

place in this peripheral zone and clathrin-mediated endocy-

tosis preferentially in the central zone, the DRP1a accumu-

lation pattern suggests a role primarily in TVN formation.

Similarly, the GFPCESA1 accumulation pattern also

suggests a role for cellulose synthesis during TVN forma-

tion and/or its transition into the TN, rather than in the

subsequent maturation into the FS.

DISCUSSION

We show here that three GFPlabelled CESAs accumulate

in the developing cell plate, suggesting that here, the

composition of the CSCs does not differ from those in

interphase cells (Desprez et al., 2007; Persson et al., 2007).

The cesa1rsw120 mutant phenotype with incomplete cell

plates indeed indicates an essential role for this isoform

(Beeckman et al., 2002), however, no aborted cell plates

have been observed in cesa3 and cesa6 mutants despite

the fact that they are severely dwarfed. This observation

presumably is due to the leakiness of the cesa3 alleles

studied and the partial redundancy of CESA6 with CESA2,

5 and 9 (Desprez et al., 2007; Persson et al., 2007). These

results suggest that smaller amounts of cellulose are

required for forming a cell plate as compared to the

amounts needed to sustain growth of interphase cells.

We also showed that CSC accumulation in developing

cell plates follows a precise spatio-temporal pattern, which

may involve several processes (Figure 7): (1) delivery to

the cell equator by phragmoplast-associated vesicles; (2)

direct or indirect (via vesicles) delivery from doughnut-

shaped organelles (presumably Golgi bodies) to phragmo-

plast-free areas of the cell plate; (3) direct transfer from the

plasma membrane after fusion to the cell plate; and (4)

clathrin-mediated retrieval primarily at the central zone of

the cell plate and the mother cell plasma membrane. The

life-time of the clathrin coat on GFPCESA-containing

structures varied from 20s to 90s, which is longer than that

expected for CCV-mediated endocytosis from the plasma

membrane, keeping in mind that the kinetics of CCV-medi-

ated endocytosis in plants still remains to be rigorously

calculated. The CLC1-mOrange/GFPCESA compartments

appeared much larger than CCVs and might correspond to

structures similar to the larger clathrin-coated buds and

tubules that are involved in synaptic membrane retrieval

(Takei et al., 1996). It remains to be shown whether endo-

cytosed CSCs are recycled back to the periphery of the cell

plate. The observation of compartments doubly labelled

with CLC-mCherry and GFPCESA1 in close proximity to

the phragmoplast microtubules suggests but does not

prove that this may be the case.

This report also suggests a role of cellulose synthesis in

the formation of the TVN. GFP-labelled CSCs were present

and active (as shown by the S4B and CBM3a staining) dur-

ing the formation of the TVN and gradually disappeared

during its maturation into a planar FS. These findings

extend observations by Samuels et al., 1995; who showed

Figure 5. Accumulation of GFPCESA1 to the peripheral growth zone during cell plate maturation.(a,b) Root cells expressing GFPCESA1 (green), labelled with FM464 (red). (a) Merge of a time series of confocal images showing the gradual accumulation ofGFPCESA1 at the periphery of the cell plate during telophase. The outer borders of the cell plate are delimited by the two set of arrows. (b) Views from twoangles of orthogonally projected Z-stacks showing the enrichment of GFPCESA1 signal at the periphery of the cell plate. (c,e) Confocal images of a root cell co-expressing GFPCESA1 (green, left panel) and mCherry-RabA1 g (red, middle panel), merge (right panel). (c) In untreated conditions. GFPCESA1 colocalised atthe cell plate and in intracellular compartments with RABA1 g-mCherry. (d,e) After BFA treatments, GFPCESA1 and RABA1 g-mCherry co-localize in BFA aggre-gates at both ends of the growing cell plate at early stages (d) and in the central zone of the division plane at telophase (e).

(f) Confocal images of a root cell coexpressing GFPCESA1 (green, left panel) and CLC-mOrange (red, middle panel), merge (the right panel).(g) Confocal images of a root cell: GFPCESA1 (green, left panel), DRP1A-mOrange (red, middle panel) and merge (right panel). Both labels preferentially accu-mulate at the periphery of the cell plate at telophase. Scale bars = 10 lm for (a, cg) and 6 lm for (b). In f and g white squares represent the peripheries of thecell plate.



(a) (b)

(c) (d)

Figure 6. GFPCESA endocytosis from cell plate and parental plasma membrane in clathrin-containing compartments.Time series of spinning disk images of a root cell: GFPCESA1 (green, left panel), CLC-mOrange (red, middle panel) and merge (right panel) showing the retrie-val of a doubly labelled puncta from the cell plate (a) (arrow) or from the parental plasma membrane (b) (arrowhead). (c) Doubly labelled compartments accu-

mulate around an area occupied by phragmoplast microtubule arrays as shown in (d). (d) GFPCESA3 (green, left panel), mCherry-MBD (red, middle panel) andmerge (right panel). GFPCESA3 compartments accumulate around mCherry-MBD-labelled microtubule arrays. Scale bars = 10 lm.



the accumulation of cellulose from the TN stage on. This

discrepancy may reflect differences in the sensitivity of

the detection methods used (S4B staining and confocal

microscopy on living cells vs. TEM on fixed material).

CSCs are large complexes with a diameter of around

25 nm observable in the plasma membrane (Kimura et al.,

1999). These CSCs are delivered by 25 nm or 50 nm secre-

tory vesicles, which fuse into a membranous compart-

ment (Giddings et al., 1980). Dynamin constricts this

compartment into a dumbbell shape, which is expected to

chase the large CSCs into the bulbous zone of the dumb-

bell. These CSCs produce crystalline microfibrils, as

detected by S4B and CBM3a. Microfibrils are rigid rods

and upon extrusion, they are expected to orient preferen-

tially parallel to the long axis of the tubules. It will be

interesting to see whether the presence of cellulose some-

how can contribute to the maintenance of the tubular

shape after removal of the dynamin springs, perhaps

through interaction with callose, which is also present at

this stage (Samuels et al., 1995), and explain the compara-

ble aborted cell plate phenotype both in the dynamin

(drp1a rsw13) and cellulose-deficient mutants (kor12 and

cesa1rsw120).

EXPERIMENTAL PROCEDURES

Plant material and in vitro growth conditions

Seeds of Arabidopsis thaliana ecotype Columbia (Col0) were pro-vided by K. Feldman (University of Arizona, Tucson, AZ, USA),and GFPCESA6 and GFPCESA3 line and their complementationtests were described previously (Desprez et al., 2007). DRP1A-mOrange and CLC-mOrange were kindly provided by Steven Back-ues and Sebastian Bednarek (Konopka and Bednarek, 2008),mCherry-RabA1 g by N. Geldner (Geldner et al., 2009), kor12 byN Chua (Zuo et al., 2000). For imaging, seedlings were cultured onvertical petri dishes on MS medium (Murashige and Skoog, 1962).Seeds were cold-treated at 4C for 48 h and at 23C with a 8 h darkper 16 h light cycle for 3 to 4 days. The lengths of hypocotyls fixedwith 0.2% formaldehyde were measured in IMAGEJ.

Generation of transgenic lines

Pollen from GFPCESA1-expressing plants in cesa1rsw110 back-ground (Desprez et al., 2007) was used to fertilise plants express-ing CLC-mOrange or DRP1A-mOrange or mCherry-RABA1 g.Pollen from GFPCESA3-expressing plants in cesa3je5 background(Desprez et al., 2007) was used to fertilise plants expressingmCherry-MBD. F1 seeds were collected and amplified. F2 seed-lings were screened by polymerase chain reaction (PCR) for thepresence of both markers and the respective mutations.F3-selected seedlings were used for imaging.

(a) (b)

Figure 7. Overview of the possible routes for CSC transport during cell plate formation.

At the TVN stage (a), the presence of the phragmoplast microtubules limits the access of Golgi and endosomal organelles to the cell plate (direct interactions

are only possible at the periphery of the cell plate) and CSCs appear to be delivered from the Golgi stacks to the cell plate primarily via phragmoplast-associated

vesicles. During late telophase (b), microtubules are cleared from the central zone of the cell plate. Here Golgi stacks and/or post-Golgi organelles can reach the

cell plate and deliver CSC-containing vesicles. CSCs are removed from the microtubule-free zone and from the mother cell plasma membrane through clathrin-

containing vesicles. This might contribute to the recycling of CSCs to the cell plate periphery via phragmoplast-associated vesicles. The preferential accumula-

tion of CSCs at the TVN stage suggests a role for cellulose synthesis in TVN assembly.



Plant expression vectors

Standard molecular cloning techniques were performed essen-tially as described (Sambrook and Russel, 2001). Constructswere made by using Gateway cloning technology (Invitrogen,Carlsbad, CA, USA, http://www.lifetechnologies.com). A 1.16-kbfragment of the CESA1 promoter upstream of the initiationcodon was amplified by PCR with specific primers that con-tained HindIII and XbaI restriction sites (Table 1) and cloned intothe HindIII-blunted XbaI site of the pGWB6 vector after theremoval of the 35S promoter. The cDNA of CESA1 was ampli-fied used specific primers (Table 1) and Gateway reactions wereperformed to obtain the promoter CESA1GFPCESA1 construct(GFPCESA1). The cDNA of MBD kindly provided by M. Pastu-glia was introduced into the Gateway vector p35S-mCherry fromClontech.

Each final expression vector was electroporated in Agrobacte-rium tumefaciens. GFPCESA1 and mCherry-MBD constructswere introduced, respectively, into cesa1rsw110mutant (Desprezet al., 2007) and Col0 using A. tumefaciens-mediated transforma-tion. Primary transformants were selected on kanamycin, and F2progenies were used for the visualization of the fluorescentprotein.

Drugs and staining treatments

Incubation of Arabidopsis seedlings with various chemicals wascarried out in 6-well cell culture plates in liquid Arabidopsismedium (Duchefa Biochimie, Haarlem, the Netherlands, http://www.duchefa-biochimie.nl). The initial stocks of isoxaben, taxoland BFA were in dimethyl sulphoxide (DMSO), and to obtain theappropriate concentration in the culture medium, the stocks werediluted at least 1000-fold. Treatments were performed with 8 lMTaxol for 2 h or 50 lM BFA for 30 min. The products are fromSigma Aldrich Corporation, St Louis MO, USA, http://www.sigmaalrich.com. For the isoxaben treatment, seedlings weregrown on 10 nM isoxaben during 4 days.

Cells in living roots were stained with 50 lM FM464 (MolecularProbes). For visualizing nuclei in living Arabidopsis cells, theseedlings were incubated with one drop of anti-fading solution(Vectashield, Vector Laboratories, Burlingame, CA, USA, http://www.vectorlabs.com) with 4,6-diamidino-2-phenylindole (DAPI)solution (100 lM; Roche Applied Science, Penzberg, Germany,http://www.roche-applied-science.com). For Pontamine Fast Scar-let 4B staining, 5 day-old Arabidopsis seedlings were fixed undervacuum in 4% paraformaldehyde, 0.5 9 MTSB buffer (25 mMPIPES, 2.5 mM EGTA, 2.5 mM MgSO4, adjusted to pH 7 with KOH)and 0.1% Triton for 1 h. Samples were then washed with 1 9 PBS,0.1% Triton for 10 min. Samples were incubated for 60 h with S4Bat room temperature (not done for the unlabelled cells). The initialstock of S4B was 0.1% in 1 9 PBS and it was diluted at 33-fold.After staining, samples were washed for 10 min with 1 9 PBS.Samples were mounted in Citifluor/DAPI 20 lg mL1.

Immunolocalization using indirect immunofluorescence

analysis

For the CBM3a immunolabelling, seedlings were incubated with95% pentane during 10 min to remove the cuticle and washedwith MTSBT buffer (50 mM PIPES, 2 mM EGTA, 2 mM MgSO4,0.05% Triton). Seedlings were fixed in 1.5% formaldehyde (v/v),0.5% glutaraldehyde (v/v) in MTSBT overnight followed by a 1 hvacuum treatment. After three washes with MTSBT, the tissueswere digested by pectolyase 0.05% and cellulase 0.05% inMTSBT that contained 0.4 M of mannitol for 1 h at 30C. Afterthree washes in MTSB, they were digested by driselase 2.5%(resuspended in water) for 45 min at 37C under agitation. Afterthree washes in MTSB, seedlings were incubated in methanolfor 10 min at 20C followed by 1 9 PBS for 10 min and1 9 PBS with 1% BSA and 50 mM glycine (solution 1) for30 min. After three washes with 1 9 PBS with 50 mM glycine(solution 2) they were incubated in 1 9 PBS with 50 mM glycineand Triton X100 0.5% during 1 h. After a wash in solution 2,CBM3a antibody diluted at 1:100 was added in 1 9 PBS with50 mM glycine and 1% BSA overnight at 4C (Plant Probes) (notdone for the unlabelled cells). After three washes in solution 2,monoclonal antibody polyhistidine (Sigma) produced in mousediluted at 1:100 was added in solution 1 for 3 h at room temper-ature and after three washes in solution 2, goat anti-mouse IgGconjugated with Alexa 488 (Fisher, Illkirsch, France, http://www.fr;fisherscience) was added in solution 1. After threewashes, samples were mounted in Citifluor/DAPI 20 lg mL1.For the Figure 2, seedlings were fixed under vacuum in 4%

paraformaldehyde, 0.5 9 MTSB buffer (25 mM PIPES, 2.5 mMEGTA, 2.5 mM MgSO4, adjusted to pH 7 with KOH) and 0.1% Tri-ton X100 for 1 h. Samples were then washed with 0.5 9 MTSB,0.1% Triton X100 for 10 min. For cell wall permeabilization, sam-ples were treated for 10 min with 80% methanol, washed with1 9 PBS and then digested (MES 25 mM pH 5.5, CaCl2 8 mM, man-nitol 600 mM, pectolyase 0.02%, macerozyme 0.1%) for 30 min at37C. Samples were incubated with primary antibody (the B-51-2monoclonal anti-a-tubulin 1:1000 (SigmaAldrich) and the anti-KNOLLE antibody 1:500 (kind gift of G. Jurgens)) overnight at 4Cand for 1 h at 37C with the secondary antibody (Alexa 488 goatanti-mouse for the anti-a-tubulin, 1:1000; Molecular Probes,A21432 and Alexa 555 goat anti-rabbit for the anti-knolle, 1:1000;Molecular Probes (Invitrogen, Carlsbad, CA, USA, http://www.lifetechnologies.com), A21428). After each antibody treatment,samples were washed for 10 min with glycine 50 mM/1 9 PBS.Samples were mounted in Citifluor/DAPI 20 lg mL1.

Microscopy and image analysis

Spinning disk microscopy. Imaging of 3- or 4-day-old, livingseedlings was performed on an Axiovert 200M microscope (Zeiss)equipped with an Axio Observer Z1 Zeiss microscope (Zeiss,Oberkochen, Germany, http://www.zeiss.com) equipped with a

Table 1 Primers used for pCESA1:GFPCESA1 construct

Primers Sequence 5 ? 3

CESA1 promoter amplification GCTCTAGACGCAGCCACCGACACACACCAAGCTTATGAATAATGATTACCCTTA

cDNA1 CESA1 amplification GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGAGGCCAGTGCCGGCTTGGGGACCACTTTGTACAAGAAAGCTGGGTCCATGGAAAAGACACCTCCTTTGCCAT



Yokogawa CSU-X1 spinning disk, Zeiss 3100/1.4 numerical aper-ture oil objective, and Roper EMCCD Quantum 512C. A 488-nmdiode-pumped solid-state laser was used for excitation of GFP,and emission was collected using a band-pass 500/550 nm(Semrock, Rochester, NY, USA, http://www.semrock.com). A 561-nm diode-pumped solid-state laser was use for excitation ofmCherry and emission was collected using a band-pass 598660 nm. Z-stacks were acquired with an interval of 0.3 lm. Timeseries were acquired with a maximal time interval. Time exposurewas 500 msec. The intensity of the laser was modulated accordingto the experiments.

Confocal scanning laser microscopy and image analy-

sis. Root-tip cells were imaged with a Zeiss LSM710 confocalmicroscope using a 405 nm diode laser line exciting DAPI, a488 nm argon laser line exciting Alexa Fluor 488 and GFP, FM464, a 561 nm diode laser line exciting mOrange and Alexa Fluor555 and a 514 nm diode laser line exciting Scarlet 4B. Fluores-cence emission was detected between 410 and 480 nm for DAPI,aniline blue, 495530 nm for Alexa Fluor 488, GFP, 650700 nmfor FM464, and 565600 nm for mOrange, Alexa Fluor 555, 605640 nm for S4B. In multi-labelling studies, detection was per-formed in a sequential line-scanning mode with a line average ofeight. The quality of the images were improved by subtracting thenoise using IMAGEJ software (F. Cordelieres, Curie; W. Rasban,National Institutes of Health, Bethesda, MD, USA). Kymographanalysis was also carried out with a plug-in made by F. Cordel-ieres. From the Z-stacks, orthogonal view or 3D reconstructionwere used in IMAGEJ. For the 3D reconstruction, cell envelopeswere delineated using a semi-automatic method whereby a user-provided coarse initial contour automatically adjusts to the cellwall. Cell surfaces are reconstructed from the piling-up of 2D con-tours. The GFPCESA1 punctae were manually segmented.Finally, graphical models displaying the spatial distribution ofobjects of interest within individual cells are generated and inter-actively visualized. Algorithm development and 3D model visuali-zation rely on the C++ image and shape libraries and on the FREE-Dreconstruction software (Andrey and Maurin, 2005). For all thequantifications, three independent experiments were realised. TheS4B or CBM3a signal at the cell plate was quantified (n = 10) usingIMAGEJ. The relative signal intensity was measured and divided bythe background relative signal intensity.

ACKNOWLEDGEMENTS

Part of the work was financed by ANR projects IMACEL andMECHASTEM and EU FP7 project Agronomics.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the online ver-sion of this article.Figure S1. Complementation of the short hypocotyl phenotype ofcesa1rsw110 by GFP-CESA1 expressed from its endogenous pro-moter.

Figure S2. S4B staining is reduced upon chemical or genetic inhi-bition of cellulose synthesis.

Figure S3. CBM3a labeling of cellulose in the developing cellplate.

Movie S1. A Z-stack of root cell labeled by Pontamine Fast Scarlet4B.

Movie S2. 3D reconstruction of a dividing cell expressing GFP-CESA1 and labeled with FM464 at the transition anaphase/telo-phase.

Movie S3. 3D reconstruction of a dividing cell expressing GFP-CESA1 and labeled with FM464 at the late telophase.

Movie S4. GFP-CESA1-labeled Golgi stack directly or indirectly(via vesicle) secretes fluorescent material to the cell plate.

Movie S5. GFP-CESA1 punctae directly migrate through theplasma membrane-cell plate junction.

Movie S6. Retrieval of doubly GFP-CESA1/CLC-mOrange-labeledvesicles from the cell plate.

Movie S7. Retrieval of doubly GFP-CESA1/CLC-mOrange-labeledfrom the parental plasma membrane adjacent to the phragmoplast.

REFERENCES

Anderson, C.T., Carroll, A., Akhmetova, L. and Somerville, C. (2010)

Real-time imaging of cellulose reorientation during cell wall expansion

in Arabidopsis roots. Plant Physiol. 152, 787796.Andrey, P. and Maurin, Y. (2005) Free-D: an integrated environment for

three-dimensional reconstruction from serial sections. J. Neurosci. Meth-

ods 145, 233244.Baluska, F., Hlavacka, A., Samaj, J., Palme, K., Robinson, D.G., Matoh, T.,

McCurdy, D.W., Menzel, D. and Volkmann, D. (2002) F-actin-dependent

endocytosis of cell wall pectins in meristematic root cells. Insights from

brefeldin A-induced compartments. Plant Physiol. 130, 422431.Beeckman, T., Przemeck, G.K., Stamatiou, G., Lau, R., Terryn, N., De Rycke,

R., Inze, D. and Berleth, T. (2002) Genetic complexity of cellulose syn-

thase a gene function in Arabidopsis embryogenesis. Plant Physiol. 130,

18831893.Bischoff, V., Desprez, T., Mouille, G., Vernhettes, S., Gonneau, M. and

Hofte, H. (2011) Phytochrome regulation of cellulose synthesis in Arabid-

opsis. Curr. Biol. 21, 18221827.Blake, A.W., McCartney, L., Flint, J.E., Bolam, D.N., Boraston, A.B., Gilbert,

H.J. and Knox, J.P. (2006) Understanding the biological rationale for the

diversity of cellulose-directed carbohydrate-binding modules in prokary-

otic enzymes. J. Biol. Chem. 281, 2932129329.Cannon, M.C., Terneus, K., Hall, Q., Tan, L., Wang, Y., Wegenhart, B.L.,

Chen, L., Lamport, D.T., Chen, Y. and Kieliszewski, M.J. (2008)

Self-assembly of the plant cell wall requires an extensin scaffold. Proc.

Natl. Acad. Sci. U.S.A. 105, 22262231.Collings, D.A., Gebbie, L.K., Howles, P.A., Hurley, U.A., Birch, R.J., Cork,

A.H., Hocart, C.H., Arioli, T. and Williamson, R.E. (2008) Arabidopsis dyn-

amin-like protein DRP1A: a null mutant with widespread defects in endo-

cytosis, cellulose synthesis, cytokinesis, and cell expansion. J. Exp. Bot.

59, 361376.Crowell, E.F., Bischoff, V., Desprez, T., Rolland, A., Stierhof, Y.D., Schum-

acher, K., Gonneau, M., Hofte, H. and Vernhettes, S. (2009) Pausing of

Golgi bodies on microtubules regulates secretion of cellulose synthase

complexes in Arabidopsis. Plant Cell, 21, 11411154.Desprez, T., Juraniec, M., Crowell, E.F., Jouy, H., Pochylova, Z., Parcy, F.,

Hofte, H., Gonneau, M. and Vernhettes, S. (2007) Organization of cellu-

lose synthase complexes involved in primary cell wall synthesis in Ara-

bidopsis thaliana. Proc. Natl. Acad. Sci. U.S.A., 104, 1557215577.Fujimoto, M., Arimura, S., Ueda, T., Takanashi, H., Hayashi, Y., Nakano, A.

and Tsutsumi, N. (2010) Arabidopsis dynamin-related proteins DRP2B

and DRP1A participate together in clathrin-coated vesicle formation dur-

ing endocytosis. Proc. Natl. Acad. Sci. U.S.A. 107, 60946099.Geldner, N., Friml, J., Stierhof, Y.D., Jurgens, G. and Palme, K. (2001) Auxin

transport inhibitors block PIN1 cycling and vesicle trafficking. Nature,

413, 425428.Geldner, N., Anders, N., Wolters, H., Keicher, J., Kornberger, W., Muller, P.,

Delbarre, A., Ueda, T., Nakano, A. and Jurgens, G. (2003) The Arabidop-

sis GNOM ARF-GEF mediates endosomal recycling, auxin transport, and

auxin-dependent plant growth. Cell, 112, 219230.Geldner, N., Denervaud-Tendon, V., Hyman, D.L., Mayer, U., Stierhof, Y.D.

and Chory, J. (2009) Rapid, combinatorial analysis of membrane compart-

ments in intact plants with a multicolor marker set. Plant J. 59, 169178.



Giddings, T.H. Jr, Brower, D.L. and Staehelin, L.A. (1980) Visualization of

particle complexes in the plasma membrane of Micrasterias denticulata

associated with the formation of cellulose fibrils in primary and second-

ary cell walls. J. Cell Biol. 84, 327339.Grebe,M., Friml, J., Swarup, R., Ljung, K., Sandberg, G., Terlou, M., Palme, K.,

Bennett, M.J. and Scheres, B. (2002) Cell polarity signaling in Arabidopsis

involves a BFA-sensitive auxin influx pathway.Curr. Biol. 12, 329334.Grebe, M., Xu, J., Mobius, W., Ueda, T., Nakano, A., Geuze, H.J., Rook,

M.B. and Scheres, B. (2003) Arabidopsis sterol endocytosis involves

actin-mediated trafficking via ARA6-positive early endosomes. Curr. Biol.

13, 13781387.Guerriero, G., Fugelstad, J. and Bulone, V. (2010) What do we really know

about cellulose biosynthesis in higher plants? J. Integr. Plant Biol. 52,

161175.Gutierrez, R., Lindeboom, J.J., Paredez, A.R., Emons, A.M. and Ehrhardt,

D.W. (2009) Arabidopsis cortical microtubules position cellulose

synthase delivery to the plasma membrane and interact with cellulose

synthase trafficking compartments. Nat. Cell Biol. 11, 797806.Kimura, S., Laosinchai, W., Itoh, T., Cui, X., Linder, C.R. and Brown, R.M. Jr

(1999) Immunogold labeling of rosette terminal cellulose-synthesizing

complexes in the vascular plant vigna angularis. Plant Cell, 11, 20752086.

Konopka, C.A. and Bednarek, S.Y. (2008) Comparison of the dynamics and

functional redundancy of the Arabidopsis dynamin-related isoforms

DRP1A and DRP1C during plant development. Plant Physiol. 147, 15901602.

Lauber, M.H., Waizenegger, I., Steinmann, T., Schwarz, H., Mayer, U.,

Hwang, I., Lukowitz, W. and Jurgens, G. (1997) The Arabidopsis

KNOLLE protein is a cytokinesis-specific syntaxin. J. Cell Biol. 139,

14851493.Mendu, V., Griffiths, J.S., Persson, S., Stork, J., Downie, A.B., Voiniciuc, C.,

Haughn, G.W. and DeBolt, S. (2011) Subfunctionalization of cellulose

synthases in seed coat epidermal cells mediates secondary radial wall

synthesis and mucilage attachment. Plant Physiol. 157, 441453.Moore, P.J. and Staehelin, L.A. (1988) Immunogold localization of the cell--

wall-matrix polysaccharides rhamnogalacturonan I and xyloglucan dur-

ing cell expansion and cytokinesis in Trifolium pratense L.; implication

for secretory pathways. Planta, 174, 433445.Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and

bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473497.Murphy, A.S., Bandyopadhyay, A., Holstein, S.E. and Peer, W.A. (2005)

Endocytotic cycling of PM proteins. Annu. Rev. Plant Biol. 56, 221251.Nebenfuhr, A., Frohlick, J.A. and Staehelin, L.A. (2000) Redistribution of

Golgi stacks and other organelles during mitosis and cytokinesis in plant

cells. Plant Physiol. 124, 135151.Otegui, M.S. and Staehelin, L.A. (2004) Electron tomographic analysis of

post-meiotic cytokinesis during pollen development in Arabidopsis thali-

ana. Planta, 218, 501515.Otegui, M.S., Mastronarde, D.N., Kang, B.H., Bednarek, S.Y. and Staehelin,

L.A. (2001) Three-dimensional analysis of syncytial-type cell plates dur-

ing endosperm cellularization visualized by high resolution electron

tomography. Plant Cell, 13, 20332051.Paciorek, T., Zazimalova, E., Ruthardt, N. et al. (2005) Auxin inhibits

endocytosis and promotes its own efflux from cells. Nature, 435, 12511256.

Paredez, A.R., Somerville, C.R. and Ehrhardt, D.W. (2006) Visualization of

cellulose synthase demonstrates functional association with microtu-

bules. Science, 312, 14911495.Park, S., Szumlanski, A.L., Gu, F., Guo, F. and Nielsen, E. (2011) A role for

CSLD3 during cell-wall synthesis in apical plasma membranes of

tip-growing root-hair cells. Nat. Cell Biol. 13, 973980.Persson, S., Paredez, A., Carroll, A., Palsdottir, H., Doblin, M., Poindexter,

P., Khitrov, N., Auer, M. and Somerville, C.R. (2007) Genetic evidence for

three unique components in primary cell-wall cellulose synthase com-

plexes in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A., 104, 1556615571.Reichardt, I., Stierhof, Y.D., Mayer, U., Richter, S., Schwarz, H., Schumach-

er, K. and Jurgens, G. (2007) Plant cytokinesis requires de novo secretory

trafficking but not endocytosis. Curr. Biol. 17, 20472053.Samaj, J., Baluska, F., Voigt, B., Schlicht, M., Volkmann, D. and Menzel, D.

(2004) Endocytosis, actin cytoskeleton, and signaling. Plant Physiol. 135,

11501161.Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory

Manual. E.C.S.H.L. Press: Cold Spring Harbor, NY.

Samuels, A.L., Giddings, T.H. Jr and Staehelin, L.A. (1995) Cytokinesis in

tobacco BY-2 and root tip cells: a new model of cell plate formation in

higher plants. J. Cell Biol. 130, 13451357.Sasabe, M. and Machida, Y. (2006) MAP65: a bridge linking a MAP kinase to

microtubule turnover. Curr. Opin. Plant Biol. 9, 563570.Sasabe, M., Soyano, T., Takahashi, Y., Sonobe, S., Igarashi, H., Itoh, T.J.,

Hidaka, M. and Machida, Y. (2006) Phosphorylation of NtMAP651 by aMAP kinase down-regulates its activity of microtubule bundling and

stimulates progression of cytokinesis of tobacco cells. Genes Dev. 20,

10041014.Segui-Simarro, J.M. and Staehelin, L.A. (2006) Cell cycle-dependent

changes in Golgi stacks, vacuoles, clathrin-coated vesicles and multive-

sicular bodies in meristematic cells of Arabidopsis thaliana: a quantita-

tive and spatial analysis. Planta, 223, 223236.Segui-Simarro, J.M., Austin, J.R. 2nd, White, E.A. and Staehelin, L.A. (2004)

Electron tomographic analysis of somatic cell plate formation in meriste-

matic cells of Arabidopsis preserved by high-pressure freezing. Plant

Cell, 16, 836856.Strompen, G., El Kasmi, F., Richter, S., Lukowitz, W., Assaad, F.F., Jurgens,

G. and Mayer, U. (2002) The Arabidopsis HINKEL gene encodes a kine-

sin-related protein involved in cytokinesis and is expressed in a cell

cycle-dependent manner. Curr. Biol. 12, 153158.Takei, K., Mundigl, O., Daniell, L. and De Camilli, P. (1996) The synaptic vesi-

cle cycle: a single vesicle budding step involving clathrin and dynamin.

J. Cell Biol. 133, 12371250.Thiele, K., Wanner, G., Kindzierski, V., Jurgens, G., Mayer, U., Pachl, F. and

Assaad, F.F. (2009) The timely deposition of callose is essential for cyto-

kinesis in Arabidopsis. Plant J. 58, 1326.Verma, D.P. and Hong, Z. (2005) The ins and outs in membrane dynamics:

tubulation and vesiculation. Trends Plant Sci. 10, 159165.Vermeer, J.E., van Leeuwen, W., Tobena-Santamaria, R., Laxalt, A.M.,

Jones, D.R., Divecha, N., Gadella, T.W. Jr and Munnik, T. (2006) Visuali-

zation of PtdIns3P dynamics in living plant cells. Plant J. 47, 687700.Zuo, J., Niu, Q.W., Nishizawa, N., Wu, Y., Kost, B. and Chua, N.H. (2000)

KORRIGAN, an Arabidopsis endo-1,4-beta-glucanase, localizes to the cell

plate by polarized targeting and is essential for cytokinesis. Plant Cell,

12, 11371152.



spatio-temporal analysis of cellulose synthesis during cell plate formation in arabidopsis

Documents

derived cell plate

mother cell wall

cell wall moore

cell plate assembly

tvn zone

cellulose synthase

delivery of gfpcesa

cellplate formation