SURVEY FOR THE PRESENCE OF PHYTOPHTHORA CINNAMOMI ON

RECLAIMED MINED LANDS IN OHIO CHOSEN FOR RESTORATION OF THE

AMERICAN CHESTNUT

Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman

Burnham 1988

*7/8

*15/16* Advanced 15/16

Chestnut in Ohio Coal Mine Reclamation:

• Fast growth rate

• Compliment native range

• Provides a venue for assessment

Early Reports: C. dentata mortality

Phytophthora species are causal agents of “ink disease”

Its presence in the Appalachian region, has been noticed on chestnut seedlings (Rhoades et al., 2003, 2009; James 2012).

Backcrossed chestnuts are not breed for resistance to chestnut ink disease.

Jeffers 2009

History of Chestnut Ink Disease

Prior to chestnut blight, several Phytophthoras were introduced to the U.S. (1700-1800s, Jeffers et al. 2009).

Castanea spp. reported dying of unknown causes as early as 1824 (Crandall et al. 1945)

Not reported until 1932 (Milburn and Gravatt 1932)

Found in all throughout N. America including 28 States of the U.S.

Crandall et al. 1945

Phytophthora: “Plant Destroyer”

• Crown Rot• Fruit Rot of Pumpkin• Rhododendron

Dieback (shoot rot)• Bleeding cankers• Citrus rot• Port-Orchard-Cedar

Root Rot

Phytophthora lateralis

Phytophthora capsici

Phytophthora citricola

Phytophthora cactorum

Phytophthora parasitica

Phytophthora palmivora

Infamous Phytophthoras…

P. ramorumP. infestans

Phytophthora cinnamomi

• Symptoms:

- Rot of fine feeder roots

- Wilts, stem cankers, collar rot

- decline in yield and decreased fruit size

• Host plants: 3000 species

Examples: Eucalyptus, Avocados, Pineapples, Rhododendron, Beech, Walnut, Oak, Chestnut

• Taxonomic Class: Oomycetes

• Stramenopiles = flagella hairs

• Geographic Origin:Southeast Asia Southern Africa

• First Described: Portugal in 1838

• Global Distribution

Phytophthora cinnamomi Rands

Hardham 2005

Infective Structures

• Sporangia

• Zoospores

• OosporesBar = 25m

Disease Cycle

Infection Mechanism

Zoospore finds host Encysts Direct Penetration

Balci et al. 2007

Range of Phytophthora in N. America

•A 2004-05 survey of soils associated with oak species for the occurrence of Phytophthora

• Soils sampled from bases of healthy and declining oak trees

• P. cinnamomi was the most frequently isolated species (69.4%) of the Phytophthoras

• The absence of P. cinnamomi above the 40ºN latitude

Range of P. cinnamomi in Ohio• Survey of Phytophthora

species in white oak decline in southern Ohio

• The most common species was P. cinnamomi

• P. cinnamomi was more commonly isolated with wet soils

• The population densities of P. cinnamomi were significantly with declining oaks

Balci et al. 2010

Study Objective:

• Survey reclaimed mine sites in southern Ohio for presence of P. cinnamomi

• Compared sites that were reclaimed under 5 years to those reclaimed 25 years prior

• Compared two Phytophthora sampling techniques: direct plating and leaf baiting

Study Sites

YEAR LOCATION SITES METHOD

2008 Greendale, Ohio, Ora Anderson Park 8 Direct platingIronton District, WNF 6 Direct plating

2009 The Wilds, International Road 4 Direct platingThe Wilds, Lake Trail 4 Direct platingThe Wilds, Site 2 4 Direct platingNelsonville, Ohio 5 Direct plating

2011 The Wilds, Site 1 7 Leaf baitingThe Wilds, Forest Site C07 2 Leaf baiting

  New Straitsville, OH 10 Leaf baiting

Ironton District, WNF

Nelsonville, Ohio

The Wilds, International Road

The Wilds, Lake Trail

Methods: Direct PlatingSoil was collected at a depth of 4-5 inches

Ten grams of soil were diluted in 100 ml dH2O and plated onto PAR(PH)-V8 (Johnson and Curl 1972)

Plates were incubated in the dark at 22 oC and examined under a dissecting microscope for the presence hyphae

Subcultures were made on the same selective medium to obtain a pure culture.

The fungus was allowed to grow for 3 weeks and harvested

Methods: Leaf Baiting

http://www.forestryimages.org/browse/detail.cfm?imgnum=5408716

250 g of soil from each site was mixed with 1.25 L deionized water

American chestnut leaves were floated on the surface of the water

After 3-5 days, necrotic areas were examined for sporangia

These areas were plated onto PAR(PH)-V8 plates as described above to obtain a pure culture (Balci et al. 2007)

Methods: Molecular Identification

Primer SequenceYph1F 5’CGACCATKGGTGTGGACTTT3’Yph2R 5’ACGTTCTCMCAGGCGTATCT3’Ycin3F 5’GTCCTATTCGCCTGTTGGAA3’

Ycin4R5’GGTTTTCTCTACATAACCATCCTATAA3’

Phytophthora genus-specific(470bp)

P. cinnamomi –specific(243bp)

• Final identification of the fungus was made by sequencing the internal transcribed spacer region of the ribosomal DNA

• PCR reactions were analyzed on a 0.7% agarose gel

• Bands produced from the primer pair were isolated from the gel using the Geneclean (MP Biochemicals)

• Sequences were analyzed in the GENBANK using BLAST

Methods: Resulting Gels

M Neg OA-1

OA-6-1

OA-6-2

Pos 1

Pos 2

Neg OA-1

OA-6-1

OA-6-2

Pos 1

Pos 2

Kbp

1.00.6

0.2

Yph1F + Yph2R Ycin3F + Ycin4RPhytophthora genus-specific P. cinnamomi –specific

Results: Wayne National Forest

Year Location P. cinnamomi Phytophthora

2008 Ora Anderson Park 0 % 0 %Ironton District 0 % 0 %

2009 Nelsonville, Ohio 0 % 0 %

2011 New Straitsville, OH 0 % 10 %

P. cinnamomi was not detected. We found another species, P. citricola. In addition to Phytophthora, we also detected another plant pathogen belonging to the genus Pythium at one of the sites (Ironton District).

Results: The Wilds

Year Location P. cinnamomi Phytophthora

2009 The Wilds, Grassland 0 % 0 %The Wilds, Lake Trail 0 % 0 % The Wilds, Site 2 0 % 0 %

2011 The Wilds, Site 1 0 % 0 %The Wilds, Forest 0 % 50 %

We also found P. citricola in the forested site. This indicates that at least some of the Phytophthora species are present in these reclaimed lands. However, their presence was not common or widespread.

SummaryNorthern tip of the distribution of P. cinnamomi and the pathogen may have not be able to survive the freezing conditions.

Since these were reclaimed lands, fresh top soil layer would have been added and pathogen may not have had time to relocate to these soils.

It is not known how conducive the harsh soil conditions (low nutrients, pH extremes, toxic metals) are for the establishment of the pathogen.

If this pathogen cannot survive in the mined lands, they would make highly suitable locations for the American chestnut restoration (Barton, et al, 2010).

Future Studies:Continue to evaluate hybrid seedlings for resistance to P. cinnamomi.

Identify backcrossed lines with high levels of resistance

Difficulty is that resistance appears to be incompletely dominant and regulated by more than one gene (Jeffers et al. 2010).

Pre-screening for soils that do not harbor P. cinnamomi.

Proper site selection of areas that have proper drainage

Continue experimental plantings that identify methods that improve establishment and long-term survival of chestnut.