Semidwarf gene sdk has pleiotropic effects on rice (Oryza sativa L.) plantarchitectureX I A OM I N G Y A N G

1, L I N G J I A N G1, C H A O Y A N G

1, H U I L I1, L I N G L O N G L I U

1 and J I A N M I N W A N1,2,3

1State Key Laboratory for Crop Genetics and Germplasm Enhancement, Research Center of Jiangsu Plant Gene Engineering, NanjingAgricultural University, Nanjing, 210095,China; 2National Key Facility for Crop Gene Resources and Genetic Improvement, Instituteof Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China; 3Corresponding author, E-mails: rice@njau.edu.cn, wanjm@njau.edu.cn, wanjianmin@caas.cn.

With 6 figures and 2 tables

Received July 2, 2013/Accepted December 2, 2013Communicated by Z.-K. Li

AbstractIdeal plant architecture has become a significant objective in high-yieldrice breeding. In this study, a new semidwarf gene in sdk, a spontaneousdwarf mutant of ‘Kasalath’, was characterized and genetically mapped.The mutant has smaller panicles and seeds, reduced awns, and is6–8 days earlier in heading than ‘Kasalath’. There was no significant dif-ference in number (No.) of seeds and fertile seeds per panicle. Geneticanalysis indicated that the dwarf character of sdk is controlled by a reces-sive gene, semidwarf k (sdk). From a segregating population of about65 000 individuals, 4987 sdk-type individuals were sampled. Gene sdkwas located in a genomic region of 2622 kb flanked by markers R-12and R-43 in the centromeric region of chromosome 2. The results pro-vide an opportunity for gaining an understanding of the molecular mech-anisms underlying sdk and opening possibilities for its use in ricebreeding programmes.

Key words: plant height — semidwarf — genetic mapping

Ideal plant architecture is the basis of super high-yielding rice.Plant height is one of the most important agronomic traits forproducing high yields. Excessive plant height results in lodgingand reduced yield. Rice yields are greatly increased by the useof the semidwarf1 (sd1) gene in the initial Green Revolution(Khush 2001). Since the 1960s, sd1 has been the predominantsemidwarf gene used in rice cultivars (Spielmeyer et al. 2002),but the widespread use of one gene presents a source of geneticvulnerability. It is therefore very important to find alternativesemidwarf resources and to identify the genes involved andmake them available to breeders.In rice (Oryza sativa), such as many other grasses, internode

elongation is inhibited during the vegetative stage and promotedin the ensuing reproductive stage. Elongation of the penultimateinternode is essential to avoid enclosure of the panicle withinthe leaf sheath (Zhu et al. 2006). In the early reproductivephase, intercalary meristem cells in the internode rapidly divideto form longitudinal cell columns that result in internode elonga-tion (Wang and Li 2008). Hormones such as indoleacetic acid(IAA), gibberellins (GA), cytokinins (CK), abscisic acid (ABA),brassinosteroids (BR), ethylene (ETH) and strigolactones (SL)are involved in the induction and control of these changes inarchitecture, especially GA and BR. Mutation in the genes forsynthesis of the hormones, or in related signal transduction path-ways, may lead to hormone deficiency or signal transductiondefects that prevent or reduce internode cell elongation, resulting

in a dwarf phenotype. Many such mutants have been reported inrice. For example, slr1-d (slender rice 1-dwarf), d1 (dwarf 1),gid1 (GA-insensitive dwarf 1) and gid2 (GA-insensitive dwarf 2)are expressed as GA-insensitive mutants, and these genes areinvolved in the GA signal transduction pathway. An applicationof exogenous GA does not, or only partially, rescue the dwarfphenotypes (Ashikari et al. 1999, Sasaki et al. 2003, Ueguchi-Tanaka et al. 2005, Asano et al. 2009). sd1 encodes GA20oxwhich is involved in GA synthesis and the sd1 mutation resultsin a semidwarf phenotype that can be rescued by application ofexogenous GA (Sasaki et al. 2002). Genes OsDWARF4L, D11,D4, OsCPD1, OsCPD2, OsDWARF/BRD1 and D2/CYP90D2are reported to participate in BR synthesis (Hong et al. 2002,2005, Mori et al. 2002, Sakamoto et al. 2005, Tanabe et al.2005, Sakamoto and Matsuoka 2006). OsBRI1 was the first geneinvolved in the BR signalling pathway to be cloned in rice(Yamamuro et al. 2000). OsBRL1, OsBRL2 and OsBRL3 maybe involved in the root BR signalling response pathway (Na-kamura et al. 2006). Dwarf and low tillering (DLT) and Brassi-nosteroid unregulated 1 (BU1) are positive regulatory factors inthe BR signalling pathway (Tanaka et al. 2009, Tong et al.2012).In this study, we report a spontaneous semidwarf mutant in

indica rice cultivar (cv.) ‘Kasalath’. Genetic analysis showed thatthe dwarf stature is controlled by recessive gene sdk located inan approximate 2600 kb interval of chromosome 2. We alsolisted and classified genes located in the region of sdk. Thepotential importance of sdk in rice breeding is discussed.

Materials and MethodsPlant materials and construction of mapping populations: Thespontaneous semidwarf mutation in cv. ‘Kasalath’ exhibited pleiotropiceffects on most visible morphological traits. We named the mutant sdk.The initial F2 mapping populations were from crosses between sdk andindica cv. ‘Dular’ and japonica cv. ‘KetanNanga’ and ‘KuiDao’. Thepopulation derived from sdk/‘KetanNanga’ showed clear separation ofphenotypes and molecular marker polymorphisms. For further phenotypicanalysis, we selected all tall F2 individuals in this population and usedsdk as the recurrent parent to build a small sdk/‘KetanNanga’//sdk BC1F1population, and large BC1F2 populations were obtained by selfing thoseplants. A population for genetic analysis was also built from a reciprocalcross between ‘Kasalath’ and sdk. All the populations were grown in thefield at two sites, viz. Nanjing, Jiangsu Province, and Sanya, HainanProvince, in years 2007–2012.

Plant Breeding doi:10.1111/pbr.12154© 2014 Blackwell Verlag GmbH

Measurement of agronomic traits: The lengths of each internode weremeasured when the first panicle was completely emerged from the leafsheath. Numbers of effective tillers per plant were recorded at the timeof harvest. Harvested seeds were air-dried and stored at roomtemperature for at least 3 months, after which fully developed grainswere measured for grain length, width, thickness and weight. Tenrandomly chosen grains from each plant were lined up lengthwise alonga vernier caliper to measure grain length and then arranged by breadth tomeasure grain width. Grain thickness was determined for each grainindividually, and the values were averaged and used as the measuredvalue for the plant. One thousand-grain weights were calculated based onsamples of 1000 grains of ‘Kasalath’ and sdk.

DNA extraction, PCR and molecular marker development: DNA wasextracted from fresh leaves of each individual using a previouslyreported method (Lin et al. 2002) with minor modifications. PCR wereperformed in 10 ll reaction volumes containing 25 ng of template DNA,1.0 ll 109 PCR buffer, 0.1 mM dNTP, 0.1 lM primer pairs and 0.1 llTaqDNA polymerase. The amplification protocol included initialdenaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 30 s,30 s annealing at 55°C, a 40 s extension at 72°C and a final extensionstep at 72°C for 5 min in a DNA Engine Thermal Cycler. PCR productswere separated on 0.06 g/ml polyacrylamide gels, and amplifiedfragments were silver-stained for visualization. New In-Del markers wereidentified in the region covering the target gene by alignment with thegenome sequences of ‘93–11’ and ‘Nipponbare’ (http://www.gramene.org/, http://www.ncbi.nlm.nih.gov/). Information on these markers ispresented in Table 2.

Scanning electron microscopic observation: Fresh culms of ‘Kasalath’and sdk were collected when the first panicles were just emerged fromleaf sheaths and fixed in FAA solution (50 ml absolute ethanol, 5 mlglacial acetic acid, 10 ml 37% methanal and 35 ml dd H2O) for at least24 h. Samples were then dehydrated through a gradient of ethanolsolutions, infiltrated and embedded in butyl methyl methacrylate. Aftersectioning, samples were stained with uranyl acetate and observed usinga scanning electron microscope (S-2460, Hitachi, Tokyo, Japan).

GA induction based on leaf sheath elongation: Seeds of ‘Kasalath’and sdk were sterilized with 10% NaClO for 30 min, washed five timesin sterile distilled water and incubated at 30°C for 2 days. They werethen placed on 0.8% agar plates. Ethanol (1 ll) containing 0, 10, 100 or1000 ng of GA3 was spotted onto the coleoptiles when the second leaftip was exposed and grown at 30°C, in 8 h of darkness and 16 h oflight. After 5 days, the length of the second leaf sheath on each plantwas measured.

ResultsCharacterization of sdk

Mutant sdk exhibits pleiotropic effects on most visible traits. Atheading, sdk shows an obvious dwarf phenotype (reduction by~37.3%) compared with ‘Kasalath’ (Fig. 1a, Table 1). The pani-cle and grain size of sdk are much smaller than ‘Kasalath’(Fig. 2a–c, Table 1), but there was no significant difference inNo. of seeds per panicle and No. of fertile seeds per paniclecompared with ‘Kasalath’ (Table 1). In contrast to ‘Kasalath’,sdk is awnless (Fig. 2a–c). To support our visual observations

(a) (b)

Fig. 1: Whole plant architecture. (a) Phenotype of Kasalath (left) andsdk (right) at the heading stage. Scale bar = 30 cm. (b) Panicles and in-ternodes of Kasalath (left) and sdk (right). P, panicle. Internodes arelabelled I to VI. Scale bar = 10 cm.

Table 1: Descriptive statistics of the agronomic traits of Kasalath and sdk

Kasalath sdk Radio (sdk/Kasalath) P-value

Plant height (cm) 155.9 � 4.73 97.7 � 2.23*** 0.627 4.751 9 10�18

No. of days to heading 90.9 � 1.52 85.2 � 1.32*** 0.937 4.780 9 10�8

No. of tillerings per plant 16.8 � 1.93 14.9 � 1.37* 0.887 0.021No. of seeds per panicle 174.5 � 10.61 161.3 � 7.67 0.924 0.327No. of fertile seeds per panicle 148.7 � 7.93 128.3 � 6.20 0.863 0.058Seed setting rate (%) 85.75 � 7.59 79.60 � 3.70* 0.929 0.033Grain length (mm) 8.27 � 0.33 6.49 � 0.23*** 0.785 3.901 9 10�11

Grain width (mm) 2.45 � 0.13 2.32 � 0.05*** 0.947 0.001Grain thickness (mm) 1.93 � 0.09 1.68 � 0.05*** 0.871 1.602 9 10�7

1000-grain weight (g) 17.70 � 0.40 12.66 � 0.02*** 0.715 2.634 9 10�5

*,***Significance level at 0.05 and 0.001 levels by t-test, respectively.Data presented are mean values � SD (n = 10).

(a) (b)

(c)

Fig. 2: Phenotype of panicle and seed. (a) Panicles of Kasalath (left)and sdk (right). Scale bar = 5 cm. (b) and (c) Seed phenotypes of Kasa-lath (left) and sdk (right). Scale bar = 5 mm.

2 X. YANG , L . J IANG , C. YANG e t a l .

on grain size, we measured grain length, width, thickness and1000-grain weight (Table 1). The grain of sdk had ~22.5%,~5.3%, ~12.9% and ~28.5% reduction in seed length, width,thickness and 1000-grain weight, respectively. All internodeswere shorter than those of ‘Kasalath’ (Figs 1b and 3a), but theratio of internode lengths was almost the same as for ‘Kasalath’(Fig. 3b). Electron microscopy of third internodes showed thatlongitudinal sections of internode cells in sdk were smaller,tightly packed and irregular (Fig. 4a,b), explaining the reducedheight of sdk relative to ‘Kasalath’. Cross sections also showeddefects in the organization of secondary vascular bundles in sdk(Fig. 4c–f).

Genetic analysis and mapping

We planted sdk in winter 2007 at Sanya, Hainan Province, andin summer 2008 at Nanjing, Jiangsu Province; it showed a stablephenotype at both sites indicating little environmental influence.

The plant heights of F1 individuals from the reciprocal crossbetween ‘Kasalath’ and sdk were almost the same as ‘Kasalath’,indicating that sdk is recessive and no cytoplasmic effects. Weinvestigated the distribution of plant height in F2 populationsderived from the reciprocal crosses, grain size and panicle lengthalso taken into consideration as sdk has pleiotropic effects onrice plant architecture and the pooled segregation of 112 tall(Kasalath-type) : 32 dwarf (sdk-type) accorded with a 3 : 1 ratio(v20.05 = 1.26 < 3.84) (Fig. 5a), indicative of a single gene.Three F2 populations were used for mapping sdk, viz. sdk/’Dular’, sdk/‘KuiDao’ and sdk/‘KetanNanga’, and the populationsizes were about 2000, 15 000 and 23 000, respectively. Toimprove the accuracy of phenotyping, a sdk/‘KetanNanga’//sdkBC1F2 population comprising about 25 000 individuals wasused. Finally, total 4987 phenotypically sdk-type individualswere found in all the separate populations. The primary geneticmapping result showed that sdk was located in a 4.3 cM regionbetween markers R-5 and YK-3 in the centromeric region of

(a)

(b)

Fig. 3: Internode comparison. (a) Comparison of the length of the panicles and internodes of Kasalath (left) and sdk (right). Error bars indicate � SD(n = 10). (B) Schematic representation of internode elongation patterns of Kasalath (left) and sdk (right).

(a) (b) (c) (e)

(f)(d)

Fig. 4: Scanning electron microscopic observations. (a) and (b) Longitudinal sections of the third internodes of Kasalath and sdk plants, respectively,9100. Scale bar = 100 lm. (c) and (d) Cross sections of the third internodes of Kasalath and sdk, respectively, 970. Scale bar = 200 lm. (e) and (f)Magnifications of red squared regions in c (e) and d (f), respectively, 9300. Scale bar = 25 lm.

Semidwarf gene sdk has pleiotropic effects 3

chromosome 2 (Fig. 5b). To map the position of sdk moreprecisely, 12 new In-Del markers were developed (Table 2). Thesdk locus was finally limited to a 2622-kb interval betweenmarkers R-12 and R-43 in the centromeric region of chromo-some 2 (Fig. 5b), and there was no recombinant individual inthis interval. The extremely low genetic recombination frequencymade it very difficult to further reduce the interval containingsdk, and because there are 412 genes (Table S1) in the region, itwas very difficult to predict a candidate sdk gene.

GA-sensitivity test

Dwarf or semidwarf mutations in plants are often caused bydefects in the biosynthesis and perception of plant hormones

such as GA or BRs. Generally, rice BR mutants exhibit erectleave phenotype. However, sdk mutant does not exhibit suchphenotype (Fig. 1). This is a good evidence that sdk mutant maybe not related to BR. To determine whether sdk is GA deficientor insensitive, we treated the sdk mutant with GA3. When treatedwith GA3, the length of the second leaf sheaths of ‘Kasalath’and sdk both elongated (Fig. 6a,b), indicating that the sdkmutant, like ‘Kasalath’, was sensitive to GA.

DiscussionFrom this study, we report a novel gene sdk. The mutant hassmaller panicles and seeds, reduced awns, and is 6–8 daysearlier in heading than ‘Kasalath’ (Fig. 2b,c, Table 1). There

Table 2: Markers designed and used for mapping the sdk locus

Marker Marker type Size in Nipponbare (bp) Forward primer (5′–3′) Reverse primer (5′–3′)

R-5 Indel 157 CGATTCCCATTCAAACCAAGAC TGCCTTCCTCCGTGATGCTY-7 Indel 112 TTGCGTTTGGTTCATCATCG GCAACGTAAGTGCATAGCGATCRL-3 Indel 192 GTTGTCTTTGATAAGTGTTCGATGAT AGCTTACCAACCGTCAATGATTATR-10 Indel 163 GCCTCCGTATGCCTCCCTC TGGAACACCAGTGACCCTTTATAGY-13 Indel 103 AAAAATGAGTGATGCCATGACG CAATGTACCTTTGGTCAAATCTTCTR-12 Indel 117 GGTTGCAAATGACTGCTTTTAGAA CATCCAACTTTCCAACACCCAY-14 Indel 180 GCCAAATGTGCTAAATCAAGGT GGTAGAAGCGTAGAAGGAATCGYB-4 Indel 140 CTCGTCTGAGGACGCTGATT GGTTGATGCTGCCCCTATTAR-43 Indel 178 CAATAGTAATACATCGGCTTTCAAGA TCTCTCTCGCCATTCTAACTTCACR-39 Indel 146 CCAACCTTCTCCAGTGCATGA AACCCACCAGGCAACAAACAYL-9 Indel 113 AAATAGCACAAGGTTTACGC CACAAGTATCACGAAGCAAGYL-6 Indel 138 TGTTACCCAAACTGATTCGG CTGGTCACACCTTGGCTTCYL-4 Indel 117 TATCCTCCCACTAAACTGAA TAACGAGACTACCCACTTGCYK-3 Indel 137 TCTGTCTGAAAGGCAATGTC TGCTTCTACGCTTAACAAAA

(a)

(b)

Fig. 5: Genetic analysis and mapping. (a) Distribution of plant height in F2 population from sdk/Kasalath. (b) Genetic and physical maps of the sdkregion on rice chromosome 2. Numerals above the bar represent genetic (cM) or physical (kb) distance between the adjacent markers. Numerals belowthe bar represent recombinants.

4 X. YANG , L . J IANG , C. YANG e t a l .

was no significant difference in No. of seeds per panicle andNo. of fertile seeds per panicle (Table 1). An interesting pheno-type is the loss of awning (Fig. 2a,b). Degradation of awns wasan important step in domestication from wild rice to cultivatedforms, so sdk may have played a significant role during ricedomestication. Genetic analysis and mapping showed that sdk islocated in a 2622-kb interval at the centromere region of chro-mosome 2. Despite the considerable effort, we failed to obtain ahigh resolution of the genetic map in the region of sdk presum-ably due to low exchange frequencies near the centromere.According to the Gramene database (http://www.gramene.org/),

there are 412 genes (Table S1) in the region of sdk; including 38expressed proteins, 93 hypothetical/conserved proteins, 201transposon/retrotransposon proteins and 80 genes with functionaldescriptions. Among them, only 25 genes were reported to beassociated with semidwarf phenotypes, and these could bedivided into 14 groups by function (Table S2). For example,LOC_Os02 g22380, which was named OsGT61-1 or XAX1, wasreported as a glycosyltransferase protein (Chiniquy et al. 2012).In recent years, many plant height genes have been cloned

from plants including maize, peas, wheat, Arabidopsis and rice.Cloning of these genes not only revealed various physiologicalfactors associated with the development of plant architecture, butalso provided information on haplotype (or allelic) diversity ofthe genes in modern rice cultivars (Asano et al. 2007, 2011).

Modern rice cultivars have a narrow genetic base for mostof the agronomically important traits (Marri et al. 2005), espe-cially plant height. Although more than 60 different dwarf orsemidwarf genes have been reported in landraces and mutants,sd1 is the most widely used gene. The semidwarf mutant, sdk,may be useful for both theoretical research and breeding appli-cations because of its ability to reduce plant height to a desir-able level, and its No. of seeds per panicle, No. of fertile seedsper panicle and tillering capacity do not reduce too much(Table 1). Grain number, panicle number and grain weight areimportant components of grain yield in rice (Zhang 2007);unfortunately, grain number per panicle and grain weight areboth decreased in sdk, compared with wild-type ‘Kasalath’,thus resulting in a much lower yield. Using a molecular mar-ker-assisted selection strategy, sdk and positive regulatory grainsize/number alleles could be pyramided (Wang et al. 2012) todevelop a variety with ideal plant height and high grain yield.We believe that sdk has a good prospect of being used in mod-ern rice breeding.

Acknowledgements

This research was supported by the grants from the High TechnologyProgram from NDRC([2012]1961), National Science and TechnologySupport Program (2013BAD01B02-16), Jiangsu Science and Technology

(a)

(b)

Fig. 6: GA-sensitivity test. (a) Seedling phenotype of GA-sensitivity test. Ethanol (1 ll) containing 0, 102, 103 and 104 ng GA3 was spotted onto thecoleoptiles when the second leaf tip was emerging. Scale bar = 5 cm. (b) Kasalath and sdk plants after treatment with GA3 at different concentrationafter 5 days. Error bars indicate � SD (n = 3).

Semidwarf gene sdk has pleiotropic effects 5

Development Program (BE2011302,BE2013301), Jiangsu Province Self-innovation Program (CX(10)131, CX(12)1003) and Qing Lan Project.

ReferencesAsano, K., T. Takashi, K. Miura, Q. Qian, H. Kitano, M. Matsuoka, andM. Ashikari, 2007: Genetic and molecular analysis of utility of sd1alleles in rice breeding. Breeding Sci. 57, 53—58.

Asano, K., K. Hirano, M. Ueguchi-Tanaka, R. B. Angeles-Shim, T.Komura, H. Satoh, H. Kitano, M. Matsuoka, and M. Ashikari, 2009:Isolation and characterization of dominant dwarf mutants, Slr1-d, inrice. Mol. Genet. Genomics 281, 223—231.

Asano, K., M. Yamasaki, S. Takuno, K. Miura, S. Katagiri, T. Ito, K.Doie, J. Wu, K. Ebana, T. Matsumoto, H. Innan, H. Kitano, M.Ashikari, and M. Matsuoka, 2011: Artificial selection for a green revo-lution gene during japonica rice domestication. Proc. Natl Acad. Sci.U S A 108, 11034—11039.

Ashikari, M., J. Wu, M. Yano, T. Sasaki, and A. Yoshimura, 1999:Rice gibberellin-insensitive dwarf mutant gene Dwarf 1 encodes thea-subunit of GTP-binding protein. Proc. Natl Acad. Sci. U S A 96,10284—10289.

Chiniquy, D., V. Sharm, A. Schultink, E. E. Baidoo, C. Rautengarten, K.Cheng, A. Carroll, P. Ulvskov, J. Harholt, J. D. Keasling, M. Pauly,H. V. Scheller, and P. C. Ronald, 2012: XAX1 from glycosyltransfer-ase family 61 mediates xylosyl transfer to rice xylan. Proc. Natl Acad.Sci. U S A 109, 17117—17122.

Hong, Z., M. Ueguchi-Tanaka, S. Shimizu-Sato, Y. Inukai, S. Fujioka,Y. Shimada, S. Takatsuto, M. Agetsuma, S. Yoshida, Y. Watanabe, S.Uozu, H. Kitano, M. Ashikari, and M. Matsuoka, 2002: Loss-of-func-tion of a rice brassinosteroid biosynthetic enzyme, C-6 oxidase, pre-vents the organized arrangement and polar elongation of cells in theleaves and stem. Plant J. 32, 495—508.

Hong, Z., M. Ueguchi-Tanaka, S. Fujioka, S. Takatsuto, S. Yoshida, Y.Hasegawa, M. Ashikari, H. Kitano, and M. Matsuoka, 2005: The Ricebrassinosteroid-deficient dwarf2 mutant, defective in the rice homologof Arabidopsis DIMINUTO/DWARF1, is rescued by the endogenouslyaccumulated alternative bioactive brassinosteroid, dolichosterone. PlantCell 17, 2243—2254.

Khush, G. S., 2001: Green revolution: the way forward. Nat. Rev. Genet.2, 815—822.

Lin, H., M. Ashikari, U. Yamanouch, T. Sasaki, and M. Yano, 2002:Identification and characterization of a quantitative trait locus, Hd9,controlling heading date in rice. Breeding Sci. 52, 35—41.

Marri, P. R., N. Sarla, L. V. Reddy, and E. A. Siddiq, 2005: Identifica-tion and mapping of yield and yield related QTLs from an Indianaccession of Oryza rufipogon. BMC Genet. 6, 33.

Mori, M., T. Nomura, H. Ooka, M. Ishizaka, T. Yokota, K. Sugimoto,K. Okabe, H. Kajiwara, K. Satoh, K. Yamamoto, H. Hirochika, andS. Kikuchi, 2002: Isolation and characterization of a rice dwarfmutant with a defect in brassinosteroid biosynthesis. Plant Physiol.130, 1152—1161.

Nakamura, A., S. Fujioka, H. Sunohara, N. Kamiya, Z. Hong, Y. Inukai,K. Miura, S. Takatsuto, S. Yoshida, M. Ueguchi-Tanaka, Y. Hasega-wa, H. Kitano, and M. Matsuoka, 2006: The role of OsBRI1 and itshomologous genes, OsBRL1 and OsBRL3, in rice. Plant Physiol. 140,580—590.

Sakamoto, T., and M. Matsuoka, 2006: Characterization of CONSTITU-TIVE PHOTOMORPHOGENESIS AND DWARFISM homologs in rice(Oryza sativa L.). J. Plant Growth Regul. 25, 245—251.

Sakamoto, T., Y. Morinaka, T. Ohnishi, H. Sunohara, S. Fujioka, M.Ueguchi-Tanaka, M. Mizutani, K. Sakata, S. Takatsuto, S. Yoshida, H.Tanaka, H. Kitano, and M. Matsuoka, 2005: Erect leaves caused bybrassinosteroid deficiency increase biomass production and grain yieldin rice. Nat. Biotechnol. 24, 105—109.

Sasaki, A., M. Ashikari, M. Ueguchi-Tanaka, H. Itoh, A. Nishimura, D.Swapan, K. Ishiyama, T. Saito, M. Kobayashi, G. S. Khush, H. Kit-ano, and M. Matsuoka, 2002: Green revolution: a mutant gibberellinsynthesis gene in rice. Nature 416, 701—702.

Sasaki, A., H. Itoh, K. Gomi, M. Ueguchi-Tanaka, K. Ishiyama, M.Kobayashi, D. Jeong, G. An, H. Kitano, M. Ashikari, and M. Mats-uoka, 2003: Accumulation of the phosphorylated repressor for gibber-ellin signaling in an F-box mutant. Sci. Signal. 299, 1896—1898.

Spielmeyer, W., M. H. Ellis, and P. M. Chandler, 2002: Semidwarf(sd-1), “green revolution” rice, contains a defective gibberellin 20-oxidase gene. Proc. Natl Acad. Sci. U S A 99, 9043—9048.

Tanabe, S., M. Ashikari, S. Fujioka, S. Takatsuto, S. Yoshida, M. Yano,A. Yoshimura, H. Kitano, M. Matsuoka, Y. Fujisawa, H. Kato, and Y.Iwasaki, 2005: A novel cytochrome P450 is implicated in brassinoster-oid biosynthesis via the characterization of a rice dwarf mutant,dwarf11, with reduced seed length. Plant Cell 17, 776—790.

Tanaka, A., H. Nakagawa, C. Tomita, Z. Shimatani, M. Ohtake, T. Nom-ura, C. Jiang, J. G. Dubouzet, S. Kikuchi, H. Sekimoto, T. Yokota, T.Asami, T. Kamakura, and M. Mori, 2009: BRASSINOSTEROID UP-REGULATED1, encoding a helix-loop-helix protein, is a novel geneinvolved in brassinosteroid signaling and controls bending of the lam-ina joint in rice. Plant Physiol. 151, 669—680.

Tong, H., L. Liu, Y. Jin, L. Du, Y. Yin, Q. Qian, L. Zhu, and C. Chu,2012: DWARF AND LOW-TILLERING acts as a direct downstreamtarget of a GSK3/SHAGGY-like kinase to mediate brassinosteroidresponses in rice. Plant Cell 24, 2562—2577.

Ueguchi-Tanaka, M., M. Ashikari, M. Nakajima, H. Itoh, E. Katoh, M.Kobayashi, T. Chow, Y. C. Hsing, H. Kitano, I. Yamaguchi, and M.Matsuoka, 2005: GIBBERELLIN INSENSITIVE DWARF1 encodes asoluble receptor for gibberellin. Nature 437, 693—698.

Wang, Y., and J. Li, 2008: Molecular basis of plant architecture. Annu.Rev. Plant Biol. 59, 253—279.

Wang, S., K. Wu, Q. Yuan, X. Liu, Z. Liu, X. Lin, R. Zeng, H. Zhu, G.Dong, Q. Qian, G. Zhang, and X. Fu, 2012: Control of grain size,shape and quality by OsSPL16 in rice. Nat. Genet. 44, 950—954.

Yamamuro, C., Y. Ihara, X. Wu, T. Noguchi, S. Fujioka, S. Takatsuto,M. Ashikari, H. Kitano, and M. Matsuoka, 2000: Loss of function ofa rice brassinosteroid insensitive1 homolog prevents internode elonga-tion and bending of the lamina joint. Plant Cell 12, 1591—1606.

Zhang, Q., 2007: Strategies for developing green super rice. Proc. NatlAcad. Sci. U S A 104, 16402—16409.

Zhu, Y., T. Nomura, Y. Xu, Y. Zhang, Y. Peng, B. Mao, A. Hanada, H.Zhou, R. Wang, P. Li, X. Zhu, L. N. Mander, Y. Kamiya, S. Yamagu-chi, and Z. He, 2006: ELONGATED UPPERMOST INTERNODEencodes a cytochrome P450 monooxygenase that epoxidizes gibberel-lins in a novel deactivation reaction in rice. Plant Cell 18, 442—456.

Supporting InformationAdditional Supporting Information may be found in the online version ofthis article:Table S1. Genes located in the region of sdk.Table S2. Genes located in the region of sdk with similar functionaldescriptions to other reported genes.

6 X. YANG , L . J IANG , C. YANG e t a l .