saint cecilia church · 2020-06-14 · saint cecilia school a special note of thanks we are so...
TRANSCRIPT
Saint Cecilia Church
2020 June 14
Saint Cecilia Church
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Marcia Mason School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Jane Mary Carr, IHM
VICE PRINCIPAL Sister Joan Felicia O’Reilly, IHM
SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm (at front altar ~ confessionals will not be used)
Homebound Visitation Please contact the Rectory.
The church has been cleaned and sanitized for your protection. We welcome you back to church this Saturday and Sunday. If you still feel uncomfortable returning to church, we will con-tinue live-streaming Mass every Sunday at 10:00am. Visit the Facebook page to participate in the Mass.
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
Please note our NEW SUNDAY MASS SCHEDULE. Daily Masses remain the same as well as the 5:00pm Vigil on Satur-day.
GUIDELINES WHILE IN CHURCH
Parishioners must wear masks while in church. Social distancing is encouraged (6 ft. apart) No missalettes or music issues will be in pews. You are welcome to bring a prayer book or your device to follow along with the readings. Two doors will remain open to enter church. Ushers will help with seating, communion and exiting. The Crying Room and Restroom will be closed until fur-ther notice.
NEW MASS SCHEDULE Sunday
Vigil 5:00pm (Saturday) 6:30 and 10:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
Mass Schedule for Weekend ~ June 20-21 Saturday (Vigil) Celebrant: Fr. Lucas 5:00pm Lector: Ed Sharp 6:30am Celebrant: Fr. Lucas Lector: Celine Severino 10:00am Celebrant: Fr. Bonner Lector: Paula Potts
#179 3
Statement from the Archbishop The hearts of Americans across the country are joined together in collective mourning following the tragic, disturbing, and unnecessary death of George Floyd. In the name of the people of the Archdiocese of Philadelphia, I express my prayerful condolences and join with all who are strug-gling to cope with this heavy burden of sorrow and grief. Recent events in Minneapolis are a stark reminder that the vile evil of racism has not been stamped out in this country. Rather, it has been resur-gent in communities throughout our land for the last several years with old wounds being painfully ripped open time and again. Racial hatred has no place in our world, including here in the U.S. or in the hearts of people. Every life is a precious gift form God. Racism is a mortal sin and an attack on that gift. All of us share a responsibility to bring an end to this evil and to do so in a way that seeks justice and peace. The perpetual cycle of pain and anguish must end. May God give all of us courage and solace as we work together for social justice and to preserve our land as one of equality and opportunity for every citizen. May He bring peace to Minneapolis and to our Philadelphia region and may He rekindle within each of our hearts true love and re-spect for our fellow human beings. Most Reverend Nelson J. Perez Archbishop of Philadelphia
Solemnity of The Most Holy Body and Blood of Christ
June 14, 2020
FOCUS: Through the Eucharist, Jesus gives us the strength we need on our journey through life to heaven.
Today we celebrate the Most Holy Body and Blood of Christ and honor Jesus as the Bread of Life. Just as God led Moses and the Israelites out of Egypt and through 40 years of hardship and danger in the desert so Jesus gives us the strength we need as we follow him through the spir-itual dangers of this life. LITURGY OF THE WORD: In Deuteronomy, Moses reminds the people of how God brought them out of Egypt and through 40 years in the desert. St. Paul writes of our unity as Christians, for we all partake of the one loaf. Jesus tells the Jewish crowds that he is the living bread that came down from heaven so that eternal life may be found through him. REFLECTION: At communion, when the Eucharistic ministers hold the sacred food and drink before us, they will say, "the Body of Christ; the Blood of Christ." They are not only naming what they are offering us, they are also naming each one of us. In other words, the real pres-ence is not only to be found in church, but in each bap-tized Christian nourished by the Eucharist and becoming the real presence of Christ to the world. So we ask ourselves:
Does receiving the Eucharist make me more con-scious of my union with those believers around me in church?
Have I ever thought of being a Eucharistic minister at liturgy, or for the homebound?
The Liturgy of the Word First Reading Book of Deuteronomy Moses said to the people: “Remember how for forty years now the Lord, your God, has directed all your journeying in the desert, so as to test you by affliction and find out whether or not it was your intention to keep his commandments. He therefore let you be afflicted with hunger and then fed you with manna, a food unknown to you and your fathers, in order to show you that not by bread alone does one live, but by every word that comes forth from the mouth of the Lord. “Do not forget the Lord, your God, who brought you out of the land of Egypt, that place of slavery; who guided you through the vast and terrible desert with its saraph serpents and scor-pions, its parched and waterless ground; who brought forth water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.” The word of the Lord. Thanks be to God.
Responsorial Psalm Praise the Lord, Jerusalem.
Second Reading First Letter of St. Paul to the Corinthians Brothers and sisters: The cup of blessing that we bless, is it not a participation in the blood of Christ? The bread that we break, is it not a participation in the body of Christ? Because the loaf of bread is one, we, though many, are one body, for we all partake of the one loaf. The word of the Lord. Thanks be to God.
Gospel The holy Gospel according to John Jesus said to the Jewish crowds: “I am the living bread that came down from heaven; whoever eats this bread will live forever; and the bread that I will give is my flesh for the life of the world.” The Jews quarreled among themselves, saying, “How can this man give us his flesh to eat?” Jesus said to them, “Amen, amen, I say to you, unless you eat the flesh of the Son of Man and drink his blood, you do not have life within you. Whoever eats my flesh and drinks my blood has eternal life, and I will raise him on the last day. For my flesh is true food, and my blood is true drink. Whoever eats my flesh and drinks my blood remains in me and I in him. Just as the living Fa-ther sent me and I have life because of the Father, so also the one who feeds on me will have life because of me. This is the bread that came down from heaven. Unlike your ances-tors who ate and still died, whoever eats this bread will live forever.” The Gospel of the Lord. Praise to you, Lord Jesus Christ.
#179 4
Pray For Our Troops Jason Showmaker (Navy) Mark Strecker (Navy) Michael D’Antonio (Air Force) Sean Lay (Army) Brian A. Mason (Army) Christopher J. Starrett (USMC) Brandan Beaudet (USMC) Michael Molz (Army) Patrick Breslin (Army) Erin Bartholomew (Navy) Nick Marteney (Navy) Martin P. O’Donnell (Trauma Nurse-Air Force)
Sean Abarca Odina Achike Christian Adams Isabella Antoninich Daniel Barr Jaire Barlett Joseph Boberskyj Daniel Brady Luke Brandi Meghan Brennan Jaila Brown Michael Browning Erin Burns Kaitlin Carey Nicholas Carey Andrea Castillo Giovany Castro Brennan Dillenbeck Zaylee Dixon Keva Duggan Brady Finn Dylan Fitzgibbon Michael Gallagher Sean Gallagher Kevin Gereaghty Joan Gramlich Charisse Griswold Laiah Hampton Brynn Henry Clare Hvorecky Gina Jacoby Joseph Kirchner Elizabeth Klepesky Nickolas Klepesky Olivia Klepesky Spencer Lavelle Jason Lidovitch Kalie Lopes Aditya Lynch Dennis Lyons Zachary Masterson Julia Mazzella Ryan McCabe Julia McCoy Charlotte McGonigle Tatum McHugh Ava McNamara Aidan Murray Sean Musial Shawn Nguyen Ryan O’Neill Shalini Persad Cierra Piedra Alexa Price Jaden Randall Brian Raskauskas Vincent Riccobono Gianna Rivera Gianna Roesner Daniel Rogers Ryan Rue Joseph Sheridan Brianna Skinner Colin Smith Matthew Smith Mikaela Trajano Makayla Vogt Joseph Wade Niomi Trumbauer-Cross Regan Welsh Aidan White Emily White Madison Willard Jacob Wranovsky Mia Yege Owen Zidow
We extend our prayer and best wishes to our eighth grade students as they begin their journey into high school. We acknowledge that the school spirit and generosity of this class has been outstanding throughout the years. We will miss them at Saint Cecilia School. We congratulate the parents of these students for their commitment to Catholic education and we thank them for their support of Saint Cecilia School. May God continue to bless you and your family in the days ahead!
Saint Cecilia School
AA Special Note of Thanks We are so grateful to our faculty and staff who delivered the lawn signs to the homes of our graduates and who worked tire-lessly to plan for our virtual graduation ceremony. Special thanks to Sister Elizabeth Anne (Sister Beth) for live streaming our Virtual Graduation Ceremony and for the beauti-ful video of our graduates.
Dear God,
We pray for our graduates today. We thank you for these we love and for the work you are continuing to do in their lives. They are a gift to us and to many others. And during this season of new beginnings, we ask that you would make their way clear. We ask that you would keep their footsteps firm and remind them that you are with them, always. May they sense the freshness of your Spirit over their lives in amaz-ing ways, may they be strengthened, instilled with hope, for the new roads you have in store.
We ask that you would remind them every day how very much you love them, that they would find secu-rity and confidence fully in you.
We ask that you would teach them your ways and fill them with an unquenchable desire to learn your Word. We ask for your peace to cover them.
We ask that you would raise up greatness in their lives, greatness in this generation, willing to stand strong and true, passionate for you, believing that you have designed them for purpose and good works, which you have planned and prepared in advance for them to do.
Bless them with your favor and peace. In Jesus’ Name, Amen.
#179 5
Outstanding Achievement The 2020 Graduation Class has been awarded $886,120.00 in scholarships. We congratulate the following students for this outstanding achievement and wish them well in their future endeavors:
Sean Abarca Academic Scholarship—Father Judge HS
Presidential Scholarship—Archbishop Ryan President’s Scholarship—Roman Catholic HS Odina Achike Presidential Scholarship—St. Hubert HS Instrumental Scholarship—St. Hubert HS President’s Scholarship—Mount Saint Joseph Academy Principal’s Scholarship—Nazareth Academy Daniel Brady Neumann Scholar Xaverian Scholarship—St. Joseph Prep Presidential Scholarship—LaSalle College HS Presidential Scholarship—Holy Ghost Prep Academic Achievement Scholarship—Father Judge HS Founder’s Scholarship—Roman Catholic HS Meghan Brennan Academic Scholarship—Little Flower HS Michael Browning Father Judge Salesian Gentleman Scholarship Kaitlin Carey Budding Artist Scholarship—Little Flower HS Giovanny Castro Academic Scholarship—Father Judge HS Brennan Dillenbeck Neumann Scholar Xaverian Scholarship—St. Joseph Prep Academic Achievement Scholarship—Father Judge HS Brynn Henry Coronam Fidelitas Merebit—Archbishop Wood Clare Hvorecky Fine Arts Scholarship—Nazareth Academy Elizabeth Klepesky St. Therese Scholarship—Little Flower HS Josephine C. Connelly Achievement Award Olivia Klepesky Josephine C. Connelly Achievement Award
Dennis Lyons Performing Arts Scholarship—Archbishop Wood HS Next Generation Ballet—Tampa, Florida Performing Arts Scholarship—Colorado Ballet, Charlotte Ballet, Central Florida Ballet Julia Mazzella Art Scholarship—St. Hubert HS Ryan McCabe Academic Scholarship—LaSalle College HS Charlotte MsGonigle Presidential Scholarship—St. Hubert HS Tatum McHugh Academic Scholarship—Little Flower HS Maguire Scholarship Ryan O’Neill Cahillite Scholarship—Roman Catholic HS Academic Scholarship—Father Judge HS Maguire Scholarship Ciera Piedra Josephine C. Connelly Achievement Award Alexis Price Academic Scholarship—St. Hubert HS Brian Raskauskas
Presidential Scholarship—Father Judge HS Trustee Scholarship—Holy Ghost Prep Gianna Rivera Josephine C. Connelly Achievement Award Joseph Sheridan Academic Scholarship—Father Judge HS Cahillite Scholarship—Roman Catholic HS Makayla Vogt Academic Scholarship—Little Flower HS Regan Welsh Academic Scholarship—Little Flower HS
Mother Marie Service Scholarship—St. Basil Emily White Academic Scholarship—Little Flower HS Fund A Dream Scholarship—Nazareth Academy
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
www.RENTAGRANDSON.org
Office: 215-606-3550cell: 215-990-6770
Ma GiesFounder
RENT A GRANDSON PROPERTY SERVICES
ROOFINGROOFINGSERVICING YOUR PARISH
FOR OVER 20 YEARSA+ Rating/BBB Cert. • 24/7 Emer. Svc.
Financing AvailableCall today for your FREE ESTIMATE
215215--726726--17701770www.libertyroofi ngpa.com
Archdiocesan Member
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
MASSES FOR THE WEEK OF June 15
MONDAY, June 15 6:30am – Richard Findley 8:30am – Ann B. Coll & Sadie Getz TUESDAY, June 16 6:30am – 8:30am – Dolores Palizzi and Herb & Marie Taylor WEDNESDAY, June 17 6:30am – James & Patricia Roache 8:30am – Wolbert Family
THURSDAY, June 18 6:30am – Tracy O’Rourke 8:30am – Kyle Peahota FRIDAY, June 19 6:30am – William MacNeal 8:30am – Willam Padden
SATURDAY, June 20 8:30am – Vincent Sands 5:00pm – John Rowley
Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Rita Kravitz Maki Turner Kirsten Hosack-Edling Helen Flood Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Linda Reinboth Gregory Farrell Ed MacNew Timothy Martin John Smykal Roseanne Gallagher Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Amanda Gleason Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Frank Basil Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Kathleen Hogan
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
Christenings, Weddings & Parties
ROCKLEDGE FIRE HOUSE505 HUNTINGDON PIKE
215-379-8373215-379-8373
Hall RentalsHall Rentals
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-
To all those essential workers keeping us safe, your
service is invaluable &
appreciated.
grte
& Logitrtststtsttttsttttt uctur
nformatioCommunity- Critical Man
ical al Services - Defens
e - Commercial Facis - Residential & Shelte
& Facilities - Hygiene Prod
yourmunity munity cal Mancal Ma
service is& Hazardou& Hazardou
invaluable &Commercial FaciCommercial Faci
appreciatedesidential & Shelte& Shelteies - Hygiene Prodies - Hygiene Prod
esrvic
overnmacturateteee
ivate & Public Healthcanforcement, Public Safe
ponders -lture - Energy Se
Waterwaste - Trans - Public WoCommunic
y
To all thoseivate & Publicivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
eepings - PublicuCommunCommun
s safe,chnologychnolog
Lacare - L- -- - - - --- - -- - afety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficecececececececececececececece
- Fooooooooooood & d &d &d &d &d &d &d &d &d & d &d & d & d & d & AAAAAAAAAAgrAAAAASector r rrrr rr rr rrrr r - Wa- Wa- Wa WW WaWaWa WaWaWa- Wa- WaWWasstes
ansportattattattatattattattattattattattattattattation ion ionion onon on onononon on ion on on & L&&&&&&Wooooooorks & - Infrffffffffff astststtsttstastastststtstststicatatatatatttttatattatattioionionionsionsionionionionionionioionsionion & I&&&&&&&&&& nf
y Workeorkerkekekekekekekeorkekeorkekekeorkers -rs -rs -rs -rs -rsrs -rs -rs -rs -rs rs -rs -rs -s - Coment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkers -
uring -g ----g ---g -g ---g -- CheCheCheCheCheheCheCheCheCheheCheCheChehemicteteteteteeeeeeeeeeerialrrrrrrr s FiFFiFiFiFFFiFiFiFFiFiFiFinancanaaanannanannancancaan ial
dustristristristristritrtritristristristristristristrtrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Basase asa -esssssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkekkkkkekerskekkkekekkk -
cesicescescescescescesicesicesicescesicesicescesces & F
e,gygy
thank
you
yg&&&& S&&&&& SS&& SS&& S& SS& SServierervvvivieerervivvrvvrrr ir iee ces - Private & Pu
tthcacattt aat aat aaacat at at ct re -re re -reree -erere -rerrerrerr LLLawLaLawLawLawLawawwLL wL wLaaLaawwLLaLLLLLLLLLL ww EnfEnfEEnfEnEnfnfEnfEnfnffEnfEEnfEnE fffEnfEnE orceorceorceorceorceorceorceoo cecorceo eorceeementmmmmmmmmm , Puy yyy -yyy -yyyy OffiOOOfOfOffOffiOOOOOOOOOOOO fifificcererccccccc s &&&&&&&&&&&&&& FirsFirsFiriiFirsirsirsiii t Ret Ret Rt RRRRRRRRRtt Rtt R sponsponsponpsppp ddddd
ygS
Local, trusted, proven, effective, supportive, referrrals, relationships, affordable, repetitous, versatile, lasting. This describes the power of...
ve, supuuuu portive, refefefefefefefferrrals, relationshipsppppppp ,,,, affordable, rererererepetitous, versatile, last
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
THOMAS A. CUNNINGHAM, ESQ.Attorney At Law
AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE
109 Huntingdon Pike • Rockledge, PA 19046215-722-6230
Traveling Hair DresserServicing Men, Women & Children
Parishioner for 48 years
215-806-8187
Krissy Tamaro
Reichwein
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
We Care and It Shows
10400 Roosevelt Blvd., Philadelphia215-698-5600 • www.stnrehab.org
Physical, Occupational & Speech Th erapy • Short & Long Term Care • Dementia Unit (IMC) • Memory Care (SJN) • Adult Daycare (SJN)
We Acknowledge -We Appreciate
Occupational & Speech Th erapy • Short & Long Term Care • Dementia Unit (IMC) • Memory Care (SJN) • Adult DayBeautiful On-Site Chapel with Daily Mass Respite Stay Available
2990 Holme Ave., Philadelphia215-335-2100 • www.imrehab.org
Over “105 Years” in Real Estate SalesOver “105 Years” in Real Estate Sales4½% Sales Commission*Free Home Analysis*Multiple Listing Broker*No Sale Sign Required*No Franchise Fees*Free Notary Service
Contact JOE FASY 215-745-85007219 Rising Sun Avenue • Philadelphia, PA 19111
JOSEPH F.X. FASYBroker of Record
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
Independent LivingPersonal CareSkilled Nursing
Short-Term Rehabilitation9896 Bustleton Ave. • Philadelphia, PA • 215.934.3009 • www.paulsrun.org
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
A Heavenly Hair Salon215-379-1880
Angel Cuts
See You Soon!930 Fox Chase Road, Rockledge
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org