Report

of the

Tomato Genetics Cooperative Number 54 – September 2004

University of Florida Gulf Coast Research and Education Center

5007 60th Street East Bradenton, FL 34203 USA

Foreword The Tomato Genetics Cooperative, initiated in 1951, is a group of researchers who share an interest in tomato genetics, and who have organized informally for the purpose of exchanging information, germplasm, and genetic stocks. The Report of the Tomato Genetics Cooperative is published annually and contains reports of work in progress by members, announcements and updates on linkage maps and materials available. The research reports include work on diverse topics such as new traits or mutants isolated, new cultivars or germplasm developed, interspecific transfer of traits, studies of gene function or control or tissue culture. Relevant work on other Solanaceous species is encouraged as well. Paid memberships currently stand at approximately 145 from 25 countries. Requests for membership (per year) US$15 to addresses in the US and US $20 if shipped to addresses outside of the United States--should be sent to Dr. J.W. Scott, jwsc@ifas.ufl.edu (see address information in Announcements section.) Please send only checks or money orders. Make checks payable to the University of Florida. We are sorry but we are NOT able to accept cash, wire transfers or credit cards. Cover photo of Heinz 1706. Heinz 1706 is the tomato variety being sequenced in the worldwide tomato genome project. For further information see report by Rich Ozminkowski on p. 26 who provided the photo. Photo editing by John Petti. - J.W. Scott

THIS PAGE IS BLANK IN THE ORIGINAL DOCUMENT

Table of Contents Foreward........................................................................................................................................... 1Announcements............................................................................................................................... 5 Research Reports Effect of three anthocyaninless genes on seed aging in tomato (Lycopersicon esculentum Mill.)

Balacheva, E. and Atanassova, B.............................................................................................. 9Use of SNP markers to genotype commercial hybrids and Spanish local cultivars of tomato

García-Gusano, M., García-Martínez, S., and Ruiz, J.J........................................................... 12Mitochondrial-specific RAPD analysis in the Lycopersicon CMS system

Gianniny, Christine, Stoeva-Popova, Pravda, and Dimaculangan, Dwight .............................. 16Tomato lines resistant to the South American tomato pinworm, Tuta absoluta Meyr. (Lepidoptera:Gelechiidae)

Gilardón, E., Hernández, C., Pocoví, M., Collavino, G., Gray, L., Gorustovich, M., Olsen, A., Bonomo, C. and Broglia, V ................................................................................................. 19

A recombinant inbred line mapping population derived from a Lycopersicon esculentum x L. pimpinellifolium cross

Graham, E.B., Frary, A., Kang, J.J., Jones, C.M., and Gardner, R.G ...................................... 22Pedigree of variety Heinz 1706

Ozminkowski, R ....................................................................................................................... 26The study of T1 generation of transgenic tomato (Lycopersicon esculentum Mill.) with introduced genes of ugt/iaglu from Zea mays L. and acb from Arabidopsis thaliana L.

Rekoslavskaya, N.I., Salyaev, R.K., Mapelli, S., Truchin, A.A., and Pacovski, R..................... 27Yellow shoulder disorder in tomatoes under natural and controlled conditions

Romero-Aranda, R., Fernández-Muñoz, R., López-Casado, G., and Cuartero, J.................... 34The obtaining of transgenic potato Solanum tuberosum L. with high productivity by the transfer of the gene ugt/iaglu from Zea mays L.

Salyaev, R.K., Rekoslavskaya, N.I., Mapelli, S., Korneva, A.V., Stepanova, E.G., Chepinoga, A.V., and Truchin, A.A .......................................................................................... 36

Observations indicate epistasis of nipple tip gene n-2 over n-4 Scott, J.W ................................................................................................................................ 41

Identification of GSK-3/SHAGGY-like protein kinase homologue from Lycopersicon peruvianum

Wilson, Kimberly, S., Stoeva-Popova, Pravda, and Dimaculangan, Dwight ........................... 43

Varietal Pedigrees Eliana

Alvarez, M., Lara, M., Rodríguez, J., Fernández-Muñoz, R., and Cuartero, J ......................... 48Ohio 9834 and Ohio 9816: processing tomato breeding lines with partial resistance to race T1 of bacterial spot

Francis, David M., and Miller, Sally.......................................................................................... 49Fla. 7514 hybrid tomato tolerant to bacterial wilt

Scott, J.W., Olson, S.M., Jones, J.B., Stofella, P.J., Bartz, J.A., and Somodi, G.C ................. 50Fla. 7964 hybrid tomato resistant to tomato spotted wilt virus

Scott, J.W., Olson, S.M., Bartz, J.A., Maynard D.N., and Stofella, P.J .................................... 51 Stock Lists Revised list of wild species stocks

Chetelat, R.T............................................................................................................................ 52 Membership List ............................................................................................................................ 77Author Index................................................................................................................................... 82Obituary (Oscar H. Pearson) ......................................................................................................... 84

From the editor Greetings to the TGC membership from your veteran editor and his highly capable staff. Gail Somodi continues to do most of the work keeping the TGC operation organized. John Petti is our webmaster who has been very busy with one of our major goals, getting all the reports on the web and searchable by keyword using the Google search engine. Our policy will be to have all reports available in electronic format with the exception of the latest report, it will not appear online until one year after the publication date. If you have not visited the website lately you may want to check it out as it is changing frequently (http://gcrec.ifas.ufl.edu/tgc). Let us know (see my e-mail address below) of any problems you encounter so we can get them fixed. There is a lot of interesting information in the reports and we hope to make this information easy to extract. Since this project is very labor intensive TGC funds are being used to accomplish this. One other major change is taking place and that is that our research center is scheduled to move in January 2005. My email (jwsc@ifas.ufl.edu) and the TGC website will not be affected but our mailing address will change: From: To: 2004 address 2005 addressJay W. Scott Jay W. Scott Gulf Coast Research & Education Center Gulf Coast Research & Education Center 5007 60th Street East 14625 Balm Road Bradenton, FL 34203 Wimauma, FL 33598 USA USA 941-751-7636 ext. 241 I hope I can get my office cleaned out by January! I’m going to miss the leaky roof and some other things but our ability to facilitate the Tomato Genetics Cooperative should not be affected. Keep the research reports and varietal pedigrees coming in 2005! Oscar Pearson, one of the great vegetable breeders of the 20th century, died this year. You will find his obituary on pages 84 and 85. Take a moment to find out about one set of shoulders that modern day tomato breeders stand upon. His son, Dr. Robert Pearson, wrote me that he was unable to evaluate his father’s plant breeding accomplishments but he said, “I can assure you that his genetic and moral contributions to the human gene pool are important to us, his children.” Jay W. Scott Managing Editor

UPCOMING MEETINGS Tomato Breeders Roundtable, October 17-20, 2004 in Annapolis, MD For registration information please contact: John Stommel stommelj@ba.ars.usda.gov USDA, Agricultural Research Service Vegetable Laboratory Bldg. 010A, BARC-West 10300 Baltimore Avenue Beltsville, MD 20705 XVth Eucarpia Tomato Working Group Meeting 20-23 September 2005, in Bari, Italy Please visit www.eucarpia.org to view the first announcement and registration details GRANT OPPORTUNITY USDA Funding for Tomato Germplasm Evaluation Funding will again be available from the USDA, ARS in FY 2004 for evaluation of tomato germplasm. Evaluation funding will be used on germplasm maintained in or destined for the National Plant Germplasm System (NPGS). Relevant NPGS germplasm includes the tomato collection maintained by USDA's Plant Genetic Resources Unit in Geneva, New York and the collection at the University of California, C.M. Rick Tomato Genetics Resource Center, Davis, California. Proposal guidelines are noted below. All proposals will be evaluated on the need for evaluation data, national and/or regional interest in the problem, scientific soundness and feasibility of the proposal, the likelihood of success, germplasm to be screened, and the likelihood that data will be entered into NPGS databases and freely shared with the user community. Proposals will be reviewed by the Tomato Crop Germplasm Committee (CGC) and applicable ad hoc reviewers and ranked in priority order for funding. Funding for successful proposals has ranged from $5,000 to $30,000. However, this year’s letter indicated a cap at $15,000 to $18,000, so please plan accordingly. The letter I received concerning this call stated, "All proposals will be evaluated according to the national need for evaluation data, the likelihood of success, and the likelihood that the data will be entered into GRIN and shared with the user community." Including this consideration should strengthen a proposal. The letter also suggested, "This process also represents a convenient opportunity for each CGC to assess its current list of needs, priorities and criteria for evaluation and, if needed, to update that list." This may well be the situation for the tomato CGC.

All proposals and CGC prioritization are forwarded to USDA for a final decision on funding. Multiple year projects are welcomed, but funding must be applied for each year and is subject to a progress review. STANDARD EVALUATION PROPOSAL FORMAT FOR THE NPGS

I. Project title, name, title, and e-mail address of evaluators. II. Significance of the proposal to U.S. agriculture. III. Outline of specific research to be conducted including the time frame involved—include the

number of accessions to be evaluated IV. Funding requested, broken down item by item (no overhead charges are permitted). V. Personnel:

A. What type of personnel will be used to perform the research (e.g. ARS, state, industry scientist; postdoc; grad student, or other temporary help).

B. Where will the personnel work and under whose supervision. VI. Approximate resources contributed to the project by the cooperating institution (e.g. facilities,

equipment, and funds for salaries). Evaluation funding will be used on germplasm maintained in or destined for the National Plant Germplasm System (NPGS).

Evaluation proposals must be submitted through the Crop Germplasm Committee (CGC) for their approval. If more than one proposal is submitted, please rank them by priority. All proposals should follow the evaluation priorities established by the CGC. Evaluation data obtained will be according to CGC descriptors and codes and will be entered into GRIN by the crop curator. Funding for data entry into GRIN should be considered when developing proposals. Evaluation proposals covering several descriptors, such as several diseases, should give the cost and time frame for each descriptor along with the combined cost. Funding may only be available to cover one of the traits to be evaluated. PLEASE NOTE: Submission deadline: October 15, 2004. Electronic submission of proposals is encouraged. I can handle most word processing packages, at least through conversion. Please submit electronic files (MS Word or WordPerfect) to mam13@cornell.edu. Or send 10 copies of your proposals to: Martha Mutschler 303 Bradfield Hall Cornell University Ithaca, NY 14853

THIS PAGE IS BLANK IN THE ORIGINAL DOCUMENT

Effect of three anthocyaninless genes on seed aging in tomato (Lycopersicon esculentum Mill.) Balacheva, E. and Atanassova, B. Institute of Genetics, Bulgarian Academy of Sciences, Sofia 1113, Bulgaria

In our previous studies it was found that three anthocyaninless mutants of tomato, anthocyaninless of Hoffmann (ah), anthocyanin without (aw) and baby lea syndrome (bls), germinated more rapidly than the wild type lines under both, optimal and a relatively large scale of stress conditions (Atanassova et al., 1997 a, b). In order to establish whether the effect of the three genes concern other seed characteristics, (other than velocity of germination) we designed experiments aimed at studying the longevity of the mutant and wild type seeds.

The investigation was performed on isogenic/near isogenic lines (IL/NIL) (NIL) described by Maxon-Smith and Ritchie (1982) and Philouze (1991), on seed dry-stored under laboratory temperature and humidity.

As it can be seen from the results presented in Table 1, the initial quality of the seed, examined a few months after seed production was high. Mutant seeds germinated more rapidly than the wild type ones and the differences in the time to 50% germination between them varied depending on the genotype. The same applied to seed stored for one, two or three years (data for the first and second year of storage not presented as no significant differences in germination responses between the seed produced throughout these three years had occurred).

Germination responses after four and five years of seed storage clearly demonstrated difference in tolerance to storage between the wild type and mutant seeds. After four years of seed storage the time to 50% germination in the anthocyaninless IL/NILs was equal or longer than that in the wild type ones, and after five years of storage all wild type genotypes germinated more rapidly than the mutant ones. Aging in the mutant seeds resulted also in significant decrease in seed viability expressed as percentage of germination, while in Porphyre and Ailsa Craig after four years of storage and in Apedice and Ailsa Craig after five years of storage differences in the percentage of germination between aged and non-aged seeds were not significant.

Study of seed coat morphology and histochemistry provided evidence that the three mutant alleles ah, aw and bls not only completely inhibited anthocyanin biosynthesis, but were also associated with alterations in seed morphology and testa histochemistry (Atanassova et al., 2004). It was found that wild type seeds possessed longer hairs than ah and bls mutant seeds. The aw seeds were a dark yellowish-beige color, while wild type ones were light beige. The inner epidermal testa layer of the three wild type genotypes contained condensed tannins while in the anthocyaninless genotypes this compound was absent. Condensed tannins contribute to the rigidification of cell structure (Haslam, 1993). Therefore their absence in seed coats could contribute to its increased permeability that subsequently could lead to the more rapid water uptake and germination observed in the mutant seeds (Atanassova et al., 1997 a, 2004). On the other hand, according to Hedin and Waage (1986), Oigiangbe and Onigbinde (1996) condensed tannins are important in plant tissue because they probably inhibit microbial invasion and growth of pathogens and contribute to the resistance to infestation by insects. As the results presented in Table 1 showed that the mutant seeds possessed lower tolerance to storage than the wild type ones, it might be assumed that the absence of condensed tannins in the mutant seed coat is the main seed characteristic contributing to the reduced vigor and viability of aged mutant seeds. Table 1.Germination responses of aged seeds of tomato IL/NILs differing in genes ah, aw and bls Genotype Time to 50% Germination(%) Time to 50% Germination

germination (hours)

10 days after imbibition

germination (hours)

(%) 10 days after imbibition

3 months after seed production After three years of seed storage A. Craig 73 ± 3 94 ± 2 71 ± 5 90 ± 2 A. Craig ah 38 ± 3 96 ± 1 40 ± 3 93 ± 2 A. Craig bls 43 ± 2 96 ± 4 42 ± 2 95 ± 2 Apedice 48 ± 2 96 ± 1 47 ± 3 89 ± 3 Apedice aw 32 ± 1 94 ± 1 36 ± 2 87 ± 4 Apedice bls 36 ± 2 95 ± 2 35 ± 1 91 ± 1 Porphyre 57 ± 4 93 ± 3 55 ± 4 92 ± 1 Porphyre ah 46 ± 2 93 ± 1 44 ± 1 88 ± 4 3 months after seed production After four years of seed storage A. Craig 66 ± 3 95 ± 4 69 ± 2 89 ± 1 A. Craig ah 45 ± 4 94 ± 4 75 ± 4 70 ± 2 A. Craig bls 46 ± 4 96 ± 2 70 ± 3 78 ± 3 Apedice 44 ± 2 99 ± 3 46 ± 3 85 ± 1 Apedice aw 33 ± 1 92 ± 2 52 ± 2 80 ± 3 Apedice bls 33 ± 2 97 ± 4 58 ± 3 72 ± 4 Porphyre 62 ± 3 95 ± 5 60 ± 2 91 ± 2 Porphyre ah 49 ± 3 97 ± 4 61 ± 3 62 ± 3 3 months after seed production After five years of seed storage A. Craig 67 ± 1 98 ± 3 70 ± 3 91 ± 1 A. Craig ah 47 ± 3 95 ± 3 79 ± 3 70 ± 2 A. Craig bls 44 ± 2 96 ± 2 90 ± 5 59 ± 2 Apedice 42 ± 1 96 ± 3 45 ± 4 90 ± 5 Apedice aw 32 ± 2 97 ± 2 62 ± 2 77 ± 3 Apedice bls 36 ± 1 98 ± 1 67 ± 5 63 ± 2 Porphyre 59 ± 3 96 ± 3 67 ± 1 63 ± 3 Porphyre ah 46 ± 2 93 ± 2 81 ± 2 52 ± 2

Significant at P < 0.05

References Atanassova, B., Shtereva, L. and E. Molle. (1997 a). Effect of three anthocyaninless genes on

germination in tomato (Lycopersicon esculentum Mill.) I. Seed germination under optimal conditions. Euphytica, 95, 89-98.

Atanassova, B., Shtereva, L. and E. Molle. (1997 b). Effect of three anthocyaninless genes on germination in tomato (Lycopersicon esculentum Mill.) II. Seed germination under stress conditions. Euphytica, 97, 31-38.

Atanassova, B., Shtereva, L., Georgieva Y. and E. Balatcheva. 2004. Study on seed coat morphology and histochemistry in three anthocyaninless mutants in tomato (Lycopersicon esculentum Mill.) in relation to their enhanced germination. Seed Sci. Technol. (in press)

Haslam, E. (1993). Polyphenolic phenomena. pp. 23-31 in Scalbert, A. (Ed) Polyphenol complexation. Paris: INRA.

Hedin, P.A. and S.K. Waage. (1986). Roles of flavonoids in plant resistance to insects. pp. 87-100 in Cody, V., Middleton, E. and Harborne, J.B. (Eds) Plant flavonoids in biology and medicine: biochemical, pharmacological and structure-activity relationships. New York: Alan R. Liss.

Maxon-Smith, J.W. and D.B. Ritchie. (1982). A collection of near isogenic lines of tomato. Research tool of the future? Plant Molecular Biology Newsletter, 3, 20-25.

Oigiangbe, N.O. and A.O. Onigbinde. (1996). The association between some physico-chemical characteristics and susceptibility in cowpea (Vigna unguiculata (L.) Walp.) to Callosobruchus maculatus (F.). Journal of Stored Products Research, 32, 7-11.

Philouze, J. 1991. Description of isogenic lines, except for one, or two, monogenically controlled morphological traits in tomato, Lycopersicon esculentum Mill. Euphytica 56, 121-131.

Use of SNP markers to genotype commercial hybrids and Spanish local cultivers of tomato García-Gusano, M.; García-Martínez, S.; and Ruiz, J.J. Escuela Politécnica Superior de Orihuela. Universidad Miguel Hernández Carretera de Beniel, km 3,2. -03312- Orihuela (Alicante)

The low diversity of tomato cultivars is reflected by a poor level of polymorphisms for

proteins, isoenzymes, and most types of DNA markers (Bredemeijer et al., 1998). Several systems such as RFLPs, AFLPs, CAPSs, SSRs, have been used in tomato to study its level of polymorphism. In order to facilitate the conservation and management of tomato germplasm, we have studied the genetic variability of some traditional tomato cultivars from Spain, using both simple sequence repeats (SSRs) and sequence related amplified polymorphisms (SRAPs) markers (Ruiz et al., in press). Both types of markers resolved the cultivars from different groups, but failed to distinguish some of those classified under the same group. It seems that these markers systems are unable to completely differentiate closely related cultivars. One of the most common forms of genomic variation is single nucleotide polymorphisms, or SNP. Its utility in genetic variability studies has already been demonstrated (Rafalski, 2002). In crops such as maize, wheat, soybean or melon (Bhattramakki et al., 2002; Cregan et al., 2002; Morales et al., 2004), collections of SNPs have already been identified. However, there are scarce studies published about SNPs in tomato. Yang et al. (2003) detected 43 SNPs by electronic searching using collections of EST sequences of the cultivars ‘Rio Grande’ and ‘TA496’, and they have confirmed these SNPs in other L. esculentum cultivars. Also, Baldo et al. (2004) recently reported the electronic discovery of 2,527 potential SNPs, and they are in the process of verifying these polymorphisms in the laboratory.

We have used 20 SNPs in order to try to find differences between 47 accessions of Lycopersicon (Table 1 and 2). Most accessions are different cultivars of the main traditional types of tomato cultivated in southeastern Spain. Most SNPs have been selected from those already identified by Yang et al. (2003).

Table 1. Cultivars and accessions studied. Local Spanish cultivars

Cultivar type Cultivars De la pera Per1, Per7, Per16, Per19, Per21, Per22, Per25, Per43,

Per44 Muchamiel Much4, Much11, Much18, Much29, Much30, Much128,

Much198, BN4, BN5 Morunos Mor207, Mor208, Mor209, Mor231, Mor234 Other types Valenciano, Teticabra, Flor de Baladre, CA13, CA16,

CA17, Raf Commercial cultivars

Hybrids F1 Bond, Anastasia, Odisea, Royesta, Tirade, Evita, Vision Other cultivars Malpica, Roma, Ch89 (Cherry), Sali, Zapotec,

Moneymaker, EPSO42 Wild species

L. pimpinellifolium LA2853 and LA1610; L.e. var cerasiforme LA2617

SNPs were analyzed as cleaved amplified polymorphic sequence markers. The fragments

amplified were digested with restriction enzymes, obtaining different band patterns for each one of the accessions. In some cases the fragment amplified by the same couple of primers had more than

one SNP, so several restriction enzymes were used. TA496 and Rio Grande were used as references. Table 2. SNP patterns for the 47 tomato accessions. (a) Pattern of TA496; (b) Pattern of Río Grande.

SNP Amplicon size (bp)

Size of fragments amplified after digestion

(bp) Accessions

208 (b) The rest of accessions LEOH8 208 128, 80 (a) Anastasia, Odisea, Royesta,

LA2853, LA1610 216 (a) Evita, Anastasia, LA1610 LEOH9 216 156, 87 (b) The rest of accessions 117, 87 (b) Evita and LA1610 LEOH10 204 87, 60, 57 (a) The rest of accessions

195 (a) Odisea, Zapotec, Bond, Vision, Ch89. LEOH13 195

113, 82 (b) The rest of accessions 200 (b) The rest of accessions LEOH15 200 135,65 (a) LA2853, LA1610 120, 86 (a) All the accessions LEOH16a 206 87, 86, 33 (b) --- 146, 36, 24 (a) -- LEOH16b 206 146, 30, 24, 6(b) All the accessions 120,118,36,18,8 (a) LA1610 LEOH17 300 118,69,51,36,18,8 (b) The rest of accessions. 246 (a) LA1610 LEOH20 246 137,109 (b) The rest of accessions 192 (a) The rest of accessions LEOH

23a

192 131, 61 (b) LA1610, Moneymaker 155 (b) LA1610 LEOH

23b 155 127,28 (a) The rest of accessions 500,80,60,60 (a) Anastasia and Royesta LEOH25a 700 500,140,60 (b) The rest of accessions 700 (a) Royesta, Zapotec LEOH25b 700 610,90 (b) The rest of accessions 700 (b) The rest of accessions

LEOH25c 700 620,80 (a) Anastasia, Royesta, Odisea, Bond, Zapotec

174 (a) -- LEOH 26 174 119, 55 (b) All the accessions 355,225,220,180,150,120 (a) Malpica (heterozygous)

LEOH29 1250 350,225,220,180,155,120 (b) The rest of accessions

700, 670 (b) The rest of accessions LEOH35a 1370 670, 360,340 (a) Anastasia, Bond, Royesta

1370 (a) The rest of accessions LEOH35b 1370 500, 370,200,180, 120

(b) Anastasia, Royesta, Vision, BN4, Zapotec, Bond

1300 (b)

Anastasia, Ch89, Malpica, Royesta, Odisea, Zapotec, LA2617, Flor de Baladre, Much30, Teticabra, Vision, Bond, Much128, Mor207, EPSO42, Raf

LEOH36 1300

1120, 180 (a) The rest of accessions 224 (a) The rest of accessions LEOR B 224 160, 64(b) LA1610

The size of the fragments amplified by PCR in 4 SNPs was bigger than expected (probably due to the presence of introns). Results indicated that electronic searching is a sound approach, but showed the need to validate the candidate polymorphisms.

All the commercial F1 hybrids could be easily distinguished by just one SNP or a combination of few SNPs, but the variability detected between and within traditional cultivars was extremely low. Only the LEOH36 marker (Fig. 1) was able to distinguish between some traditional cultivars of the Muchamiel type and other local cultivars, like Flor de Baladre and Teticabra. The higher variability found for commercial hybrids may be due to their introgressions of resistance genes from wild species.

Yang et al. (2003) reported that SNPs discovered in the EST database had a high probability (53.5%) of detecting SNPs between 19 varieties. Accordingly, in the cultivated accessions that we have analyzed, 60% of the studied SNPs detected polymorphisms, but almost all the Spanish traditional cultivars remained undifferentiated. Therefore, in silico discovery of SNPs using non-selected EST data is not enough efficient for this purpose. We are presently following two approaches, electronic search of SNPs using available sequence data from genes putatively involved in plant domestication, and sequencing SRAP bands that have shown as polymorphic between tomato cultivars. Figure 1. Electrophoretic patterns for 17 tomato local cultivars using SNP LEOH36.

1300 bp 1120 bp

Acknowledgements

This research was supported by the CICYT, project AGL2002-03329. M. García-Gusano is a fellow of the Ministerio de Ciencia y Tecnología of Spain. S. García-Martínez is a fellow of the Ministerio de Educación, Cultura y Deporte of Spain. We thank also TGRC and S.D Tanksley for providing seeds of Rio Grande and TA496, respectively, and to Paul Arens for providing seeds of Vision and Evita. Literature cited Baldo, A.M., Labate, J., and L.D. Robertson. (2004). A search for molecular diversity in tomato. p.

147. In Final Abstracts Guide, Plant and Animal Genome XII, San Diego, CA. Bhattramakki, D., Dolan M., Hanafey, M., Wineland, R., Vaske, D., Register, J.C., Tingey S.V., and

A. Rafalski. (2002). Insertion-deletion polymorphisms in 3’ regions of maize genes occur frequently and can be used as highly informative genetic markers. Plant Molecular Biology (5-6):539-547.

Bredemeijer, G.M., Arens, P., Wouters, D., Visser, D., and B. Vosman. (1998). The use of semi-automated fluorescent microsatellite analysis for tomato cultivar identification. Theor. Appl. Genet. 97:584-590.

Cregan, P.B., Zhu, Y., and Q. Song. (2002). SNP detection and mapping in soybean and related glycine species. Plant, Animal & Microbe Genomes X Conference. San Diego, CA.

Morales, N., Roig, E., Monforte, A.J., Arús, P., and J. Garcia-Mas. 2004. Single-nucleotide polymorphisms detected in expressed sequence tags of melon (Cucumis melo L.). Genome 47(2):352-360.

Rafalski, A. (2002). Applications of single nucleotide polymorphisms in crop genetics. Current Opinion in Plant Biology 5:94-100.

Ruiz, J.J., García-Martínez, S., Picó, B., Gao, M., and C.F. Quiros. Genetic variability and relationship of closely related Spanish traditional cultivars of tomato as detected by SRAP and SSR markers. Journal of the American Society for Horticultural Science (in press).

Yang, W., Bai, X., Eaton, C., Kamoun, S., Van der Knaap, E., and D. Francis. (2003). Discovery, mapping, and application of single nucleotide polymorphisms in Lycopersicon esculentum. Plant & Animal Genomes XI Conference. San Diego, CA.

Mitochondrial-specific RAPD analysis in the Lycopersicon CMS system 1Gianniny, Christine, 2Stoeva-Popova, Pravda, and 1Dimaculangan, Dwight 1Department of Biology, Winthrop University, Rock Hill, SC 29733, E-mail: dimaculangad@winthrop.edu 2AgroBio Institute, Blvd. Dragan Tsankov No 8, Sofia 1164, Bulgaria, E-mail: pravda_stoeva@abi.bg Cytoplasmic male sterility (CMS) plant systems are desirable in agriculturally important species because they allow for efficient production of hybrid seeds without the need for flower hand emasculation. In all systems characterized thus far, CMS results from incompatibility between nuclear and cytoplasmic cellular components emerging as a consequence of interspecific/intraspecific hybridization or mutations. In CMS systems, pollen development is affected by as yet unknown mechanisms due to recombination events in the mitochondrial genome. In spite of species specific differences, the general mechanisms common to all of the CMS systems are the altered expression of mitochondrial genes and/or novel gene products that lead to pollen sterility, and the regulation of nuclear genes that mask the mitochondrial CMS-related changes to restore fertility (Hanson, 1991; Kempken and Pring, 1999). The Lycopersicon CMS system had been produced in BC3-P2 (L. peruvianum x L. pennellii) (Vulkova-Achkova, 1980). The CMS phenotype is maintained over many generations through pollination with L. pennellii. The restoration of fertility takes place when nuclear genes from the cultivated tomato are incorporated, as observed in complex hybrids F2-F3 [CMS-pennellii x (F1 L. esculentum x L. pennellii)] (Petrova et al., 1998; 1999 and our unpublished data). We hypothesize that as a result of the interaction between the cytoplasm of L. peruvianum and the nuclear genome of L. pennellii, similar phenomena, involving the recombination of the mitochondrial genome structure and the altered expression of mitochondrial RNA, as well as the regulation of nuclear restoration genes, are responsible for sterility and fertility restoration in the developed Lycopersicon CMS system.

To characterize the mtDNA rearrangements that occurred in the CMS plants we developed a mitochondrial-specific randomly amplified polymorphic DNA analysis (mitochondrial-specific RAPD) that is free of the nuclear DNA derived artifacts (Gianniny et. al. 2004).

With this technique we can generate unique RAPD banding patterns among several Lycoperiscon species that are highly reproducible throughout multiple preparations from the same species (Gianniny et. al. 2004). Using different primers, this method generates unique banding patterns in CMS-pennellii when compared to the original donor of the mitochondrial genome L. peruvianum (Figure 1 A, B and C). The CMS-pennellii specific bands confirm that as a result of nuclear cytoplasm interactions mitochondrial DNA rearrangements had taken place. Their further characterization will allow identification of specific CMS-related structural changes to the mitochondrial genome.

The developed mtRAPD technique is suitable for general genetic comparisons among related plant species as well as for analysis of mitochondrial genome rearrangements associated with CMS. Acknowledgements This work was supported in part by seed grant no. 2001-01500 for the U.S. Department of Agriculture (USDA). Literature Cited

Gianniny, C., Stoeva, P., Cheely, A., and D.D. Dimaculangan. 2004. RAPD analysis of mt DNA from tomato flowers free of nuclear DNA artifacts. Biotechniques 36:772-776. Hanson, M.R. 1991. Plant mitochondria mutations and male sterility. Annual Review of Genetics 25: 461-486. Kempken, F. and D.R. Pring. 1999. Male sterility in higher plants – fundamentals and applications. Progress in Botany 60:139-166. Petrova, M., Vulkova, Z., Atanassov, A., and P. Stoeva. 1998. Morphological, cytological, biochemical and molecular analysis of cytoplasmic male sterile form in genus Lycopersicon. Report of the Tomato Genetics Cooperative 48: 36. Petrova, M., Vulkova, Z., Gorinova, Izhar S., Firon, N. Jacquemin, J.M., Atanassov, A., and P. Stoeva. 1999. Characterization of a cytoplasmic male sterile hybrid line between Lycopersicon peruvianum Mill. x Lycopersicon. pennellii Corr. and its crosses with cultivated tomato. Theoretical and Appied Genetics 98:825-830. Vulkova-Achkova, Z. 1980. L. peruvianum a source of CMS. Report of the Tomato Genetics Cooperative 32:50.

Figure 1 Mitochondrial specific RAPD analysis of L. peruvianum and CMS-pennellii with four different 10-mer oligonucleotides (Operon Techonologies). Each RAPD profile was replicated using independent mtDNA isolations. Lane 1 of each gel contains a 1 kb DNA ladder (Promega). A) OPF-primer 14, B) OPF primer 4, and C) OPF primers 10 and 12.

Tomato lines resistant to the South American tomato pinworm, Tuta absoluta Meyr. (Lepidoptera:Gelechiidae) Gilardón E., Hernández C., Pocoví M., Collavino G., Gray L., Gorustovich M., Olsen A., Bonomo C. and Broglia, V. Facultad de Ciencias Naturales. Universidad Nacional de Salta. Buenos Aires 177. (4400) Salta. Argentina. E-mail: gilardon@unsa.edu.ar Tuta absoluta is the main pest of tomato crops in Argentina. The newborn larvae enter into the mesophyl forming galleries that extend as long as the larvae grow. They also mine stems, flowers and fruits. The wild accession PI 134417 (Lycopersicon hirsutum f. glabratum) is highly resistant to the tomato pinworm (Gilardón et al, 1998). In this line larvae die in the first larval stages (antibiosis). The introgression of the resistance began with the crossing between the cultivar Uco Plata INTA (L. esculentum) with the line 3-5 selected from PI 134417 for its high resistance to the tomato pinworm. Genealogical selection was made through nine generations, with special intensity in the selection for insect resistance and fertility. Natural and artificial infestation tests were made with first stage larvae in all the generations, and the infestation degree (GI) was assessed using a scale from 0 to 4. (Gilardón et al, 1998). 0: no galleries; 1: small galleries less than 1 mm length; 2: small galleries more than 1 mm length but without ramifications; 3: long galleries in a few leaves; 4: long galleries in many leaves. The results showed that the F1 plants had an intermediate GI with respect to the parents, and the F2 plants had a mean GI similar to the F1, with a slightly higher variance, showing a mean additive genic effect (Pocoví et al, 1998). The fruit number per plant, mean fruit weight, and GI heritability were estimated in the F6 populations. The genotypic correlations between variables were also estimated (Table 1 and 2) (Gray et al, 1999).

After the selection process, the F10 lines were stable enough for assessing them in a comparative field trial. It was conducted on Spring 2003, in the field of the Facultad de Ciencias Naturales, Universidad Nacional de Salta, in the NW of Argentina. It was planted with a randomized complete block design with three replications. The GI and mean fruit weight were compared by means of ANOVA and Tukey tests (Table 3). The data were analyzed by means of the software Infostat (Infostat, 2003).

The most resistant line was 3-5, the wild parent. Even if the breeding lines did not achieve such low GI values, we consider that plants with GI < 2 resistant to the tomato pinworm. Plants with GI=2 have small, narrow galleries without ramifications, which is evidence that the larvae stopped eating. This level of resistance can be useful in a pest integrated management program, because it allows reduction in the number of pesticide treatments and the size of the insect population (Gilardón et al, 2002). Because of the strong genotypic correlation between the GI and the fruit weight, during the selection process it was very difficult to break the strong linkage between both traits. The lines with higher resistance levels had small fruit weights. The fruit quality characteristics, like color and soluble solids contents, were similar to those from the cultivated control. The lines described here also show a good level of resistance to the spider mite Tetranychus urticae Koch. Actually we have a group of breeding lines with high resistance to Tuta absoluta, and good commercial and agronomic quality.

Table 1: Heritability values estimated in F6 (Gray et al, 1999) Trait Heritability %

GI 84 + 17

Fruit mean weight 93 + 12

Fruits number 77 + 19

Table 2: Genotypic correlations estimated in F6 (Gray et al, 1999)

Fruit mean weight Fruits number GI 0.82 - 0.93

Probability 0.01 0.01

Table 3: GI and Mean Fruit Weight values of F10 lines.

Line GI Mean Fruit Weight (g)

3-5 (resistant control) 0.24 a -

93-6 0.90 ab 44.01 a

30-4 1.50 abc 87.73 bc

144-2 1.73 bcd 37.76 a

21-191-1-1 1.83 bcd 58.59 ab

31-8 2.00 bcd 54.68 ab

19-154-4 2.00 bcd 62.65 abc

20-2 2.17 bcde 61.75 abc

13-1-6 2.17 bcde 46.75 a

5 2.17 bcde 48.90 ab

144 2.33 bcde 50.52 ab

85-8 2.33 bcde 51.43 ab

11 2.33 bcde 31.28 a

142-1 2.43 cde 45.25 a

19-3 LV 2.47 cde 65.90 abc

11-1 2.50 cde 68.55 abc

133-1 2.67 cde 44.07 a

J25-3 3.00 de 101.93 c

19-3 3.17 de 51.15 ab

Uco Plata INTA (susceptible control) 3.50 e 143.95 d

F 7.13 11.87

Probability <0.0001 <0.0001

Variation Coefficient % 21.88 21.58 Data followed by the same letter do not differ at 0.05 level.

References Gilardón, E., Gorustovich, M., Petrinich, C., Olsen, A., Hernández, C., Collavino, G., and L. Gray (1998): Evaluación del nivel de resistencia de plantas de tomate a la polilla del tomate (Tuta absoluta Meyrick) mediante un bioensayo simple. Revista de la Facultad de Agronomía, La Plata 103 (2): 173-176. Gilardón, E., Gorustovich, M., Collavino, G., Hernández, C., Pocoví, M., Bonomo, M.L.C., and A. Olsen (2002): Resistencia de líneas de tomate a la polilla del tomate (Tuta absoluta Meyr.) en laboratorio y a campo. Investigación Agraria: Producción y Protección Vegetal (INIA España) vol 17(1): 35-42. Gray, L., Collavino, G., Gilardón, E., Simón, G., and C. Hernández. (1999): Heredabilidad de la resistencia a la polilla del tomate (Tuta absoluta, Meyrick) y su correlación genética con caracteres de calidad en descendencias de cruzas interespecíficas del género Lycopersicon. Investigación Agraria: Producción y Protección Vegetal (INIA España) 14 (3): 445-451. Infostat (2003). Infostat version 1.5. Grupo Infostat, FCA, Universidad Nacional de Córdoba, Argentina. Pocoví, M.; Gilardón, E., Gorustovich, M., Petrinich, C., Olsen, A., Hernández, C., Collavino, G., and L. Gray. (1998): 2-tridecanona y su asociación con la resistencia a la polilla del tomate (Tuta absoluta, Meyrick) y a la arañuela roja (Tetranychus urticae, Koch). Revista de la Facultad de Agronomía, La Plata 103 (2): 165-171.

A recombinant inbred line mapping population derived from a Lycopersicon esculentum x L. pimpinellifolium cross Graham, EB1,2, Frary, A3, Kang, JJ2, Jones, CM2, and Gardner, RG4

1AVRDC, PO Box 42, Shanhua, Tainan 741, Taiwan, email: graham@avrdc.org 2Department of Vegetable Crops, UC Davis, Davis, CA 95616 3Department of Biology, Izmir Institute of Technology, Gulbahce Campus Urla Izmir, 35430 Turkey 4MHCREC, NC State University, 455 Research Drive, Fletcher, NC 28732

The availability of permanent, improved germplasm resources has greatly enhanced both basic and applied tomato research in recent years. Recently developed introgression line libraries for Lycopersicon pennellii (Eshed and Zamir 1994) and L. hirsutum (Monforte and Tanskley 2000), and inbred backcross lines for L. pimpinellifolium (Doganlar et al. 2002), provide genetic tools for mapping, quantitative trait loci (QTL) analysis, gene discovery and cloning, expression analyses, comparative genomics and a plethora of other research activities. These populations have many advantages (Zamir 2001) but may be limited in their range of phenotypic variation, the amount of recombination represented in the populations, the ability to test epistatic effects, and the ability to confirm allelic contributions to phenotypes within a species. Here we report on the development of a set of 77 recombinant inbred lines (RILs) from L. esculentum x L. pimpinellifolium which may be complementary to existing resources.

North Carolina L. esculentum inbred NC 23E-2(93) (Le) was crossed as the pistillate parent to L. pimpinellifolium LA1269 (Lp) to create an F2 mapping population, which was used for QTL analysis of resistance to late blight, Phytophthora infestans (Frary et al. 1998). LA1269, also known in the literature as L3708, was chosen because it was described as being resistant to multiple strains of P. infestans (Black et al. 1996). RIL lines were created by harvesting seed from individual F2 plants and using a single seed descent breeding program for subsequent generations. All plants were grown in the greenhouse, and were manually pollinated, as needed, to insure self pollination. From 82 F2 plants chosen at random for advance to further generations, 77 F7 lines were obtained for which both marker data and adequate seed for inclusion in the RIL population were collected. Genotyping of F7 lines was done with the RFLP markers used in the F2 population. Six plants per line in the F8 generation were grown in two replications in the field at UC Davis in 2003 for phenotyping and bulk seed harvest.

Three morphological and 104 RFLP markers were used to genotype the F7 RILs, an average of 9 markers per chromosome (Figure 1). Several chromosomes require additional markers to resolve multiple linkage groups into a complete group. These areas may represent significant map expansion which is expected for RILs. Residual heterozygosity was measured at 6.3% (34% of the lines had significantly higher than expected heterozygosity). This value is more than the expected 1.5% for this generation, yet less than the 15% reported for a RIL population derived from a L. esculentum x L. cheesmanii (Le/Lc) cross (Paran et al. 1995). The Le/Lp allele ratio was 1.07 and the proportion of markers showing significantly skewed segregation was 9%. In contrast, 73% of the markers in the Le/Lc population showed significant deviation from the expected 1:1 segregation.

Many quantitative traits are segregating in the population, including fruit color, shape and size, maturity, inflorescence structure, carpel size and degree of reflection, plant architecture,

and leaf shape, size and color. Several traits were measured on a subset of the lines to demonstrate phenotypic variability: total phenolics, pollen fertility, and fruit size (Table 1).

The accession used for development of the L. pimpinellifolium inbred backcross lines (IBLs) was LA1589 (Doganlar et al. 2002), collected from the Viru valley in Department La Libertad, Peru (8º23’24” S, 78º44’24” W). LA1269 was collected from Pisiquillo in Department Lima, Peru (11º28’30” S, 77º6’30” W). The substantial physical distance between these collection sites, over 380 km, and evidence of genetic variation correlated with geographic location (Rick et al. 1977, Caicedo and Schaal 2004), suggests the LA1269 and LA1589 populations might be genetically distinct. If so, the LA1269 RIL population and the LA1589 IBL population might be complementary, and present some interesting opportunities to compare experimental results and contrast allelic contributions to phenotypes using both populations. The genotype data, linkage map, and seed of the lines described here is available by contacting the first author. This work was supported by a grant from the California Tomato Commission. We would like to thank Roger Chetelat for helpful suggestions and generous assistance. Table 1. Phenotypic variation for three selected traits. Phenolics measured as Quercetin equivalent (Q Eq) in umol/gram fresh weight; Fruit size is average weight in grams for at least 20 fruit; Pollen stainability is the percentage of stainable pollen grains observed for at least 4 flowers/genotype. P value for ANOVA by genotype for at least 18 randomly selected RILs.

Trait L. esculentum value RIL range RIL average

p value Phenolics (Q Eq) 1.1 0.5 – 1.6 0.95 p < 0.000 Fruit size (grams) 218 1.0 – 11.9 5.8 p < 0.008 Pollen stainability (%) 81 22 - 96 76 p < 0.010

Figure 1. Molecular linkage map of LA1269 RILs. Markers next to tick marks ordered with LOD >3, those in parenthesis ordered with LOD < 3. Markers separated by commas cosegregate. Shaded areas on the chromosome represent >50cM map distance. Linkage analyses performed using Mapmaker/EXP 3.0 (Kosambi mapping function).

Literature Cited Black, L.L., Wang, T.C., Hanson, P.M., and J.T. Chen. 1996. Late blight resistance in four wild

tomato accessions: effectiveness in diverse locations and inheritance of resistance. Phytopathology 86:S24.

Caicedo, A.L., and B.A. Schaal. 2004. Population structure and phylogeography of Solanum pimpinellifolium inferred from a nuclear gene. Molecular Ecology 13:1871-1882.

Doganlar, S., Frary, A., Ku, H.-M. and S.D. Tanksley. 2002. Mapping quantitative trait loci in inbred backcross lines of Lycopersicon pimpinellifolium (LA1589). Genome 45:1189-1202.

Eshed, Y., and D. Zamir. 1994. A genomic library of Lycopersicon pennellii in L esculentum: A tool for fine mapping of genes. Euphytica 79:175-179.

Frary, A., Graham, E., Jacobs, J., Chetelat, R., and S.D. Tanksley. 1998. Identification of QTL for late blight resistance from L. pimpinellifolium L3708. Report of the Tomato Genetics Cooperative 48.

Monforte, A.J., and S.D. Tanksley. 2000. Development of a set of near isogenic and backcross recombinant inbred lines containing most of the Lycopersicon hirsutum genome in a L. esculentum genetic background: a tool for gene mapping and gene discovery. Genome 43:803-813.

Paran, I., Goldman, I., Tanksley, S.D., and D. Zamir. 1995. Recombinant inbred lines for genetic mapping in tomato. Theoretical and Applied Genetics 90:542-548.

Rick, C.M., Robes, J.F., and M. Holle. 1977. Genetic variation in Lycopersicon piminellifolium: evidence of evolutionary change in mating systems. Plant Systematics & Evolution 127:139-170.

Zamir, D. 2001. Improving plant breeding with exotic genetic libraries. Nature reviews, Genetics 2:983-989.

Pedigree of variety Heinz 1706 Ozminkowski, R., HeinzSeed, P.O. Box 57, Stockton, CA 95201 In 2003, it was determined that the tomato variety H1706 would be part of the worldwide tomato genome project. Since then, there have been numerous requests for seed and for a history of the variety. This note is intended to provide a current review of our records on the development of the variety H1706. ‘H1706’ was developed by Charlie John in the mid 1960s at Heinz’s Bowling Green, OH research facility. It was commercialized as a processing tomato about 1967 for use in Ontario, Canada and in the midwestern United States. Contemporary varieties were ‘ES24’, ‘H1350’, ‘VF145’, ‘Fireball’, and ‘Roma VF’. Disease resistance of ‘H1706’ is VF, carrying the I and Ve genes. Plants are vigorous with good yield potential. Maturity is well concentrated and considered fairly early. Fruit are medium-sized oval to pear-shaped and the fruit tend to drop easily. It was developed as a processing tomato for machine harvesting; pedicles are jointed (J). Relative to its contemporary varieties ‘H1706’ had strong crack resistance and firm fruit. Crack resistance was a primary objective for varieties developed in our Ohio program and ‘H1706’ contains some of the best sources available at the time. The background of ‘H1706’ is primarily from recombinations of commercial tomato varieties. Grandparents include ‘Fireball’ and ‘Roma’ (obtained from Harris Seeds, Rochester, NY) and ‘VR Moscow’; pedigree records indicate that ‘VR Moscow’ is the likely maternal (cytoplasm) contributor. The fourth grandparent is a selection from a recombination of ‘Burgess Crackproof’ and an Eastern States line (‘ES 25’). ‘ES 25’ was selected from a variable population developed by O. Pearson in the 1950’s. The ES population is reported to have a background of ‘Andrus’ 2153’, ‘Firesteel’, Yeager’s high vitamin line and Hanna’s L. pimpinellifolium hybrid 17-5 (which was made around 1944). As with many heirloom open-pollinated varieties, seed may be available from various sources. In this case, different selections of ‘H1706’ were used at different times in various commercial production programs. We are unable to confirm sources of old lots of ‘H1706’ in various germplasm banks. The seed Dr. Rod Wing (then of Texas A&M) used for the production of the BAC library was obtained directly from our Ohio breeding program. It was this lot of seed that has been used for subsequent increases for this research project. Thus, any differences between various sources of this variety can be avoided if this current lineage is used (referred to as ‘H1706-BG’). Because of the sensitivity of genome evaluation, HeinzSeed will maintain this lineage and is providing seed to the USDA to update their collection. In addition to other major collections, seed can obtained from Heinz at the above address or by e-mail (rich.ozminkowski@husa.com). The seed is distributed for research use only. Please provide any necessary importation permits for international shipments.

The study of T1 generation of transgenic tomato (Lycopersicon esculentum Mill.) with introduced genes of ugt/iaglu from Zea mays L. and acb from Arabidopsis thaliana L. 1Rekoslavskaya N.I., 1Salyaev R.K., 2Mapelli S., 1Truchin A.A. , Pacovski R.31Siberian Institute of Plant Physiology and Biochemistry, Siberian Branch of RAS, PO Box 1243, Irkutsk, Russia, e-mail: phytolab@sifibr.irk.ru 2Istituto Biologia Biotecnologia Agraria, C.N.R., via Bassini 15, Milan, Italy, e-mail mapo@ibv.mi.cnr.it 3School of Agriculture, University of Sao Paulo, 13400-900 Piracicaba, S.P. Brazil Introduction The gene ugt/iaglu was isolated from cDNA of seedlings of Zea mays L. (hybrid Silver Queen) and used for transformation of Solanum species and poplar (Rekoslavskaya et al., 1999;Salyaev et al., 1999). This gene encodes UDPG-transferase (IAA-glucose synthase) which accomodates the content of indole acetic acid (IAA) to physiological levels in developing corn endosperm. Due to this alkali labile, stored indolic compound, the pool of bound IAA is created in corn endosperm. After hydrolysis released free IAA activates both division and enlargement of cells and facilitates the growth of seedlings during germination and heterotrophic growth before protruding the earth and beginning of photosynthesis.

UDPG-transferase used several compounds as a substrate, for example, 2,4- dichlorophenoxyacetic acid (2,4-D). The treatment with 50 – 100 mg/l of 2,4-D of transgenic plants of Solanum (Solanum demissum L., Solanum tuberosum L.) with introduced ugt/iaglu gene did not reveal any herbicide action but stimulated their growth, root formation, flowering and increased productivity (Rekoslavskaya et al. 1999).

The gene acb and its expressed protein ACBP (acyl-binding protein) were mostly studied on animals as a diasepam binding inhibitor (DBI) which was isolated from rat brain. At first it was found that DBI modulated the activity of neurotransmitters such as γ amino butyric acid replacing them from receptor cites (Guidotti et al.,1983). Later it was found that the polypeptide of 10 kD ACBP was able to participate in the synthesis acyl-Co A esters and in its transport to microsomes and lyposomes in oder to donate the transportable acyl CoAs for the β-oxidation for the synthesis of glycerolipids (Kolmer et al., 1994). Therefore ACBP might be used for stabilizing of membrane structures in cells. The function of ACBP in plants was unknown.

The cumulative effect of two transgenes ugt/iaglu and acb was found in transgenic poplar (Populus tremula L.) (Salyaev et al., 1999). Transgenic poplar plants acclimatized easier and their growth was faster if both transgenes were present when poplar plants were transfered from in vitro conditions to open air. It was supposed that there was a synergic action of these transgenes in growth promotion, cell division activity and sustenance to environmental conditions.

The goal of this work was to introduce the genes ugt(iaglu) and acb into tomato plants (Lycopersicon esculentum Mill. cv. Ventura) and to evaluate their positive effect on transgenic plants in harboring new features useful in agriculture. Materials and Methods

The obtaining of transgenic plants of tomato cv. Ventura was described earlier (Rekoslavskaya et al 1999). For transformation of plants a transconjugant of triparental mating of Agrobacterium tumefaciens 699 (chromosomal base C58)

with plasmid pCNL68 (acb, nptII, gus under napin, nos and 35S promoters, correspondingly), Escherichia coli DH5α with pBluescript harboring the gene ugt under pT3 and Escherichia coli K802 with pRT104 (Kozack sequence for improving eucaryotic translation and gus under p35). PCR and Southern blot hybridization were used for determination of the presence of the genes ugt and acb in transconjugant and in tomato plants. Activities of GUS and UDPG-transferase were estimated as described earlier (Rekoslavskaya et al., 1999, 2002).

In the 2001 vegetation period the transgenic plant T0 was obtained via infection of tomato seedlings with the transconjugant cells. One plant of choice was distinguished by its fast growth and good productivity during growth in greenhouse earth beds. The harvest of this particular plant was 14,7 kg against 4 kg in nontransformed control plants. From fruits of this plant, 308 seeds were harvested and the growth and development of T1 seedlings were studied. To study germination, the seeds were placed in water between two disks of filter paper in Petri dishes. The dynamics of germination and growth of seedlings were monitored for two weeks. In order to study the expression of marker gene nptII, six drops of 200 g/l kanamycin per leaf were put on nontransformed and transgenic plants at the four leaf stage of growth in greenhouse soil boxes. Results and Discussion

The germination in water of seeds isolated from fruits of transgenic tomato plant (T1 generation) began two days earlier, their growth was more energetic than that of control nontransgenic ones (Table 1). Transgenic T1 seedlings have had more root formation, longer hypocotyls, and as a whole larger seedling mass. Table 1. The dynamics of germination and growth of nontransformed and transgenic seedlings of T1 generation of tomato cv. Ventura

Length of

hypoco- tyl (cm)

Length of roots

(cm)

Mass of one

seedling (g)

Length of

hypoco- tyl (cm)

Length of roots

(cm)

Mass/ seedling

(g)

Variant

7 days old seedlings 15 days old seedlings Nontrans- formed

3.21±2.83

≤0-2

0.05±0.02

7.44±4.10

6.44±5.66

0.10±0.04

Transgenic 8.57±1.60 8.50±2.59 0.18±0.02 18.60±5.08 15.55±5.13 0.22±0.04

In separate experiments the germination of tomato was conducted in boxes with soil in a greenhouse and plants were monitored for height and leaf area. When tomato seedlings formed 4 true leaves, the treatment with kanamycin was done placing 6 drops of 200 g/l of kanamycin solution per leaf. As shown in Table 3, transgenic tomato were more tolerant to such treatment with kanamycin. The size and leaf formation were better in transgenic T1 generation during the growth in soil. Nontransformed seedlings exposed to kanamycin solution revealed more sensitivity to antibiotic in comparison to transgenic plants one week after treatment. After 2-3 weeks nontransformed plants treated with kanamycin mostly died. The survival of transgenic plants was 75-80% under the same conditions. This means that the expression of the marker enzyme neomycinphosphotranferase occurs in transgenic tomato T1 plants.

Table 2. The effect of 200 g/l of kanamycin on the growth of T1 tomato seedlings cv. Ventura in soil Variants before treatment with kanamycin Height (cm) Mean leaf area

(cm2) Nontransformed 4.27±1.76 2.01±0.11 Transgenic 6.50±1.13 5.97±0.29 Variants after one week of kanamycin treatment Nontransformed 5.51±1.51 3.21±1.89 Transgenic 8.48±1.71 7.84±2.33 The transgenic nature of T1 tomato plants was confirmed by the expression of the marker gene gus that encodes the enzyme β-glucuronidase (GUS). GUS was found only in leaves of transgenic plants especially in the fractions enriched with chloroplasts: Supernatant from transgenic tomato plants - 1.31 imp .s-1 . mg-equivalent -1 of GUS ; Chloroplasts fraction from transgenic plant – 198.18 imp .s-1 . mg-equivalent -1 of GUS ; Supernatant from nontransformed plants – 0.0 imp .s-1 . mg-equivalent -1 of GUS ; Chloroplast faction from nontransformed plants - 0.0 imp .s-1 . mg-equivalent -1 of GUS .

According to the data obtained for expression of marker enzymes, it was concluded that integration of the genes was inherited in T1 generation of tomato seedlings var. Ventura after infection of T0 tomato seedlings with the transconjugant of triparental mating.

In order to prove the expression of target gene ugt, the activity of UDPG-transferase was tested both in nontransformed and transgenic plants of T1 generation. As was shown in Table 3, the conversion activity of IAA to IAA-glucose was about 4 times more active in cytosol of transgenic plants and 2 times more active in chloroplasts fractions of transgenic plants compared to nontransformed plants.

Table 3. Activity of UDPG-transferase in nontransformed and transgenic T1 plants of tomato cv. Ventura

Variant UDPG-transferase, nmol of IAA-

glucose/mg of protein/h Nontransformed cytosol 32.07±15.14 chloroplasts 66.95±25.50 Transgenic cytosol 132.50±50.48 chloroplasts 114.70±9.10

The PCR analyses had shown the integrity of the genes ugt and acb in genomic DNA of transgenic tomato (Figure 1, A, B, C and E). The Southern blot revealed more homology to the probe (made from PCR product with primers to the gene ugt from cloned pBluescript) in DNA from roots of transgenic tomato (Figure 1, D).

Higher activity of UDPG-transferase in transgenic plants was perhaps the reason for the increased level of free IAA and alkali labile bound IAA. The free content of IAA was about two times higher in transgenic plants compared to

nontransformed plants. The amount of IAA released after mild alkali hydrolysis was 4.4 times greater in T1 transgenic than in nontransformed seedlings. However, the amount of IAA released after strong hydrolysis was about the same in both types of seedlings. Neverthless the total IAA content was 1.4 times higher in transgenic T1 seedlings compared to nontransformed T1 seedlings. Table 4. The contents of free and bound IAA in nontransformed and transgenic seedlings T1 of tomato cv. Ventura (ng per g fr wt) Variant Free IAA After hydrolysis

in 1 N NaOH After hydrolysis

In 7N NaOH Total content

of IAA Nontransformed 15.74±1.89 14.99±1.10 138.28±2.17 168.98±4.51 Transgenic plant 31.40±7.06 65.08±6.15 147.01±17.54 243.49±10.25

A morphometric analysis of adult plants grown in the greenhouse is presented in Table 5. Both types of plants were grown in conditions adjusted to agricultural production with four plants per square meter of earth. Transgenic T1 tomatoes were larger and taller with many stems covered with broader leaves of about 3 times size of nontransgenic ones. The yield per square meter was 33% higher from transgenic T1 plants compared to nontransformed plants under conditions close to industrial agriculture. Table 5. A morphometric analysis of nontransformed and transgenic tomatoes T1 cv. Ventura Variant Mass of

plant (kg) Stem

number Stem

length, (cm) Mass of one leaf

(g)

Mean leaf area (cm2)

Yield (kg/m2)

Nontransformed 1,38±0,76 5,50±1,50 77,25±10,13 8,71±3,69 240,79±97,37 8,89 Transgenic 2,91±0,98 11,33±0,47 125,00±5,35 29,27±7,80 772,37±89,37 11,86

It was observed during the growth in the greenhouse that transgenic T1 plants were more resistant to high temperature and drought. For example, the amount of nonpollinated sterile ovaries was about 30 per transgenic plant and about 80 per nontransformed plant. The nonpollinated ovaries formed undeveloped small fruits that then died. The size of the leaves was about 3 times more on transgenic plants compared to nontransformed plants. It was decided to make a model experiment in vitro in order to check the osmotic resistance of both types of tomatoes.

Tomato seeds were germinated on agar medium with mineral salts according to Murashige and Skoog (MS) (1962). After two weeks of growth, cuttings without roots were placed on the same MS medium containing 0.05 M, or 0.1 M or 0.25 M mannitol, as well 0.6 M indolebutyric acid and 8 mg/l thiamine as hormonal and nutritional additives. After 1 month of maintaining of cuttings on this medium, the root number and total root length were estimated (Table 6). Without mannitol the root formation of transgenic cuttings was 2.7 times more active according to root number and 1.9 times larger in total root length compared to nontransformed roots . At 0.05 M and 0.1 M mannitol, root formation was more effective in the case of transgenic tomato. At the highest concentration (0.25 M mannitol) the formation of many thick and short roots was observed in the case of transgenic T1 plants. There was no root formation in nontransgenic cuttings at 0.25 M mannitol in medium.

Table 6. The effect of mannitol on the root formation of tomato seedlings growing in vitro on MS salt medium Variant Root number Total root length

(mm) Nontransformed 15.3±2.6 333.7±101.5 Transgenic 41.5±14.5 641.0±245.0 + 0.05 М mannitol Nontransformed 10.5±1.5 134.5±7.5 Transgenic 27.0±7.0 263.0±59.0 + 0.1 М mannitol Nontransformed 3.0±0 23.5±5.5 Transgenic 20.5±10.5 108.0±61.0 + 0.25 М mannitol Nontransformed 0±0 0±0 Transgenic 41.3±14.9 216.8±101.0

UDPG-transferase in its native environment in developing corn endosperm is stable working under high osmotic pressure created by the increased sugar content. Perhaps this property of the target enzyme, of the transgenic T1 tomato allowed for better survival at high osmotic conditions and drought. ACBP might be stabilized the membranes, renewing the delivering of acyl CoA esters docking them close to fatty acid synthetase complexes.

In conclusion, it might be deduced that T1 generation of transgenic tomato with the ugt and acb transgenes were valuable from economical point of view because of higher productivity and sustenance to environmental conditions. Literature cited: Guidotti, A., Forchetti, C.M., Corda, M.G., Konkel, D., Bennett, C.D., and E. Costa. 1983. Isolation,

characterization, and purification to homogeneity of an endogenous polypeptide with antagonistic action on benzodiazepine receptors. Proc.Natl.Acad.Sci. 80: 3531-3535.

Kolmer, M., Roos, C., Tirronen, M., Myohanen, S., and H. Alho. 1994. Tissue-specific expression of the diazepam-binding inhibitor in Drosophila melanogaster : cloning, structure, and localization of the gene. Molecular and Cell. Biol. 14: 6983-6995.

Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol. Plant. 15:473-497.

Rekoslavskaya, N.I., Salyaev, R.K., Mapelli, S., Truchin, A.A., and L.V. Gamanetz. 2002. A rise in productivity of transgenic tomato (Lycopersicon esculentum Mill.) by transfer of the gene iaglu from corn. TGC Report 52: 27-30.

Rekoslavskaya, N.I., Zhukova, V.M., Chekanova, E.G., Salyaev, R.K., Mapelli, S., and L.V. Gamanetz. 1999. Auxin status of transformed Solanum plants in relation to their tolerance to 2.4-D and productivity. Russian J.Plant Physiol. 46: 609-619.

Salyaev, R.K., Rekoslavskaya, N.I., Chepinoga, A.V., Vysotskaya, E.F., Kuznetsova, E.V., Mapelli, S., Zhukova, V.M. and N.N. Sadochina. 1999. Creation of woody plants for the Lake Baikal region possessing the high energy of growth and increased sustenance to damage factors. Siberian Ecological J. 6: 605-611.

Figure 1. PCR analysis (A, B, C and E) and Southern blot hybridization (D) of nontransformed and transgenic tomato T1 cv.Ventura. A - upper gel: 1,2,3 and 4 – DNA from leaves of 4 individual transgenic tomato T1 amplified with primers to the fragment of 234 bp from 567 to 801 nucleotides. 5 – Amplification on plasmid DNA pBluescript with cloned ugt. lower gel: 1,2,3 and 4 - DNA from leaves of 4 individual nontransformed tomato

amplified with the same primers. DNA standard – 100 bp liner. B - PCR with DNA isolated from axillary sprouts of individual transgenic tomato. C - PCR with DNA isolated from shoot (1), flower (2), 1st fruit (3), bud (4) and 2nd fruit (5). D - Southern blot hybridization of genomic DNA restricted with EcoR1 from nontransformed shoot (1) and root (2) of tomato, from transgenic shoot (3) and root (4) of T1 tomato. The probe was prepared with EcoR1 restrict of insert of the gene ugt from pBluescript labeled with 32P-CTP. E - PCR with primers to the gene acb;

-upper gel: 1-7 - DNA from leaves of individual transgenic plants with primers to the whole sequence of the gene acb 290 bp; -lower gel: 1-7 - DNA from leaves of individual nontransformed plants with the same primers.

Yellow shoulder disorder in tomatoes under natural and controlled conditions Romero-Aranda, R.1, Fernández-Muñoz, R., López-Casado, G., and J. Cuartero. Department of Plant Breeding, Estación Experimental La Mayora, Consejo Superior de Investigaciones Científicas, 29750 Algarrobo-Costa, Málaga, Spain. 1 E-mail: rromero@eelm.csic.es

Yellow shoulder disorder (YSD) of tomato fruit is a yellow or yellow-orange shoulder region

separated from the normal red surface color by a distinct line demarcation (Picha, 1987). Incidence of YSD is high in greenhouse tomato crop production at southeastern Spain, where marketable-yield losses caused by YSD can exceed 60 % (López-Casado, 2002). The purpose of the experiments described here was to clarify the role of high temperature and light as causal agents of YSD in tomato fruit.

Cultivars ‘Kalohi’, ‘Moneymaker’, and ‘Corbarese Severino’, and commercial F1’s ‘Rambo’, ‘Naomí’, and ‘Josefina’ were used in experiments carried out in a polyethylene greenhouse from January to June 2004.

In order to separate possible effects of high temperature from those of high solar radiation, two different artificial heating treatments were applied during wintertime. Firstly, immature green-fruits were daily applied a hot air flow with a hand-dryer during 2 h around midday until normal red matured stage was reached in the non-heated fruit area. Fruit surface temperature was measured with an infrared thermometer. It ranged from 39-48°C on treated fruits and 23-33°C on non-treated ones. Defective coloration was only observed in treated fruits but it was different from the typical YSD since it consisted of a clearly defined area of a gray-white color. Secondly, a few plants of the experiment were moved to a small glasshouse where air temperature at midday was increased to 40°C. Surface temperature of fruits of those plants were similar to that of hand-dryer treated fruits. Under these low-radiation, high temperature conditions, the ripening process was accelerated but no YSD or any other color injury was observed.

Experiments were also carried out under natural conditions. At different times of the growing season, incidence of solar radiation on fruits was modified either by pruning leaves or by covering fruits with aluminum foil. These treatments were imposed at immature green-fruit stage. Also, the natural orientation of fruits in the plant was changed placing the style-end of the fruit facing upward. From end-January to mid-April, 80% of tomatoes from ‘Kalohi’ presented well-defined YSD symptoms. The YSD area was about 30% of the fruit surface and the border with the red fruit surface was well defined. At that time, no YSD was observed on fruits of the other five tomato genotypes. Later, as spring progressed to summer, incidence of YSD in ‘Kalohi’ decreased meanwhile a significant increase was recorded in most of remaining genotypes. YSD incidence for the fruit harvested in May was 70%, 58%, 40%, 30%, and 20% in ‘Naomí’, ‘Rambo’, ‘Kalohi’, ‘Corbarese Severino’, and Josefina, respectively. No YSD was recorded in May on ‘Moneymaker’ fruits.

From May to June, YSD incidence under natural greenhouse conditions was higher on fruits placed on south and west sides of plants rows. YSD was observed on fruits more directly exposed to solar radiation but also on fruits shaded by foliage. In contrast, no YSD was observed in the fruits covered with aluminum foil. As a reference, midday surface temperatures in late-June were ca. 46°C for fruits exposed directly to solar radiation and ca. 39°C for fruits both shaded by foliage and covered with aluminum foil. Fruits whose natural orientation in the plant was

changed placing the style-end facing upward also developed YSD. At the end of the growing period, the area of fruits with YSD was reduced and the border line between the yellow and red fruit areas became diffuse.

The above results clearly indicate that high temperature alone cannot explain incidence of YSD. Results of winter-time experiments and aluminum foil treatment strongly suggest that solar radiation and/or light quality may play an essential role in YSD.

Literature Cited López-Casado, G. 2002. Mancha solar en fruto de tomate: análisis de carotenoides y estudio

histológico. Tesis de Licenciatura, Universidad de Málaga, Spain, 77 pp. Picha, D.H. 1987. Physiological factors associated with yellow shoulder expression in tomato fruit.

J. Amer. Soc. Hort. Sci. 112: 798-801.

The obtaining of transgenic potato Solanum tubersosum L. with high productivity by the transfer of the gene ugt/iaglu for Zea mays L. Salyaev, R.K.1, Rekoslavskaya, N.I.1, Mapelli, S.2, Korneva, A.V.1, Stepanova, E.G.1, Chepinoga, A.V.1, and A.A. Truchin1

1Siberian Institute of Plant Physiology and Biochemistry, Siberian Branch of RAS, PO Box 1243, Irkutsk, 664033, Russia, e-mail: phytolab@sifibr.irk.ru2Istituto Biologia Biotecnologia Agraria, C.N.R., via Bassini 15, 20133 Milan, Italy, e-mail: mapelli@ibba.cnr.it Introduction

Potato is a very valuable food source for the Siberian region with short summer and continental climate. To obtain transgenic plants with enhanced productivity, the target gene with predictable significance such as ugt(iaglu) from Zea mays L. was used. The gene ugt is encoding the synthesis of UDPG-transferase (IAA-glucose synthase) from maturing corn endosperm thereby the stored form of the main phytohormone indoleacetic acid (IAA) accumulates in kernels and is employed in growth stimulation during germination and growth of seedlings.

The goal of transgenesis was to create transgenic potato plants with high energy of growth, enhanced productivity and new valuable features.

Materials and Methods

The gene ugt cloned under pT3 promoter in pBluescript of E. coli DH5α was introduced by the use of triparental mating with disarmed strain of A. tumefaciens 699 (EHA105 on the base C58) with pCNL30 (nptII, gus under nos and 35S promoters, respectively) and E. coli K802 with pRT104 (Kozak sequence for improving eukaryotic translation, gus under 35S promoter). The presence of marker gene nptII and target gene ugt in transconjugant cells was demonstrated by PCR with suitable primers (not shown). For conjugation, fresh cultures of bacteria were placed on YPD agar medium and kept for 3 days at 26° in an incubator. Then transconjugants were selected on the YPD medium with 50 mg/l of kanamycin and 50 mg/l of ampicillin. Selected colonies were used for transformation of potato by pricking of tubers with a needle coated with bacterial slurry.

Potato cv. Borodyanski was used for transformation in planta. Potato tubers infected in planta

were placed in greenhouse, phytotrone, or in field plot beds. The expression of the reporter gene

gus was confirmed by determination of specific activity of GUS (1). The integration and expression

of the selective gene nptII was determined by PCR (not shown) and by checking of chlorophyll after

treating of leaves with kanamycin solution (200 mg/l). To check the integration and expression of

target gene ugt, Southern blot hybridization, PCR and RT-PCR were employed. Southern blot

hybridization was carried out with ECL system Gene Image Random Prime Labeling Module and

Gene Images CDP-Star Detection Module (Amersham, UK)

Results and Discussion The integration and expression of marker genes gus and nptII in transgenic potato were

demonstrated by activities of marker enzymes GUS and NPTII (Table 1). Table 1. Activities of GUS and NPTII in nontransformed (control) and transgenic potato cv. Borodyanski Variant GUS NPTII (imp/s/mg-equiv.of enzyme) (chlorophyll content, mg/ml of acetone extract) Nontransformed 0.13±0.04 103.85±4.65 Transgenic 0.43±0.01 267.05±14.35

The influence of vector A. tumefaciens EHA105 was estimated in model experiments in which tubers infected with A. tumefaciens EHA105 were placed in a keramzit hydroponic bath and grown for 3 months. The prolonged life of transgenic potato with the gene ugt was noted, in comparison to potato transformed with A.t. EHA1005, but the most dramatic differences were in sizes of developed leaves from both types of plants (Table 2). Table 2. The comparison of leaves of potato transformed with vector A. tumefaciens EHA105 and transgenic potato with the ugt transgene grown in a keramzit bath Variant Mass of 1 leaf (g) Mean leaf area (сm2) Transformed with A.t.EHA105 3,93±1,01 163,16±26,32 Transgenic with the gene ugt 12,76±1,38 465,26±26,88 From the data presented in Table 2, it was clear that the mass and leaf area were 3.2 and 2.9 times larger, respectively, in transgenic potato with ugt than in transformed with “blank” vector A.t. EHA105.

The increase of growth of plants transformed with the gene ugt was observed according to morphometric analyses (Table 3). Table 3. Morphometric analyses of potato plants at the age of buds formation growing in field beds Variant Height Stems Mean leaf area Leaves number (сm) number (сm2) per plant Nontransformed 36.9±6.5 2.5±0.8 277.7±81.1 21.0±5.3 Transgenic 44.7±5.8 2.8±0.6 348.4±32.6 29.2±6.6 The activity of target enzyme UDPG-transferase, free and alkali-labile IAA contents are shown in Table 4. Table 4. Activity of UDPG-transferase, free and alkali-labile IAA contents in potato plants cv. Borodyanski Variant UDPG-transferase Free IAA Alkali-labile IAA a (nmol /mg of protein/h) (pmol/g.f.w.) ( pmol/ g.f.w. ) Nontransformed 259.6 5.1±0.6 0.0 Transgenic 1670.2 8.2±3.1 22.8±0.0 a IAA was liberated upon 1N NaOH hydrolysis during 1 h at room temperature.

The higher growth activity of transgenic plants was correlated with enhanced levels of free

and bound IAA. The specific activity of UDPG-transferase was higher in transgenic potato as well. The intensities of transpiration and photosynthesis were higher in leaves of transgenic potato

than in nontransformed control potato leaves (Table 5). Table 5. The transpiration, stomata conductivity and photosynthesis of nontransformed and transgenic potato cv. Borodyanski Variant Transpiration Gas conductivity Photosynthesis (mmol/m2 /s) (mol/m2 /s) (µmol/m2 /s) May 29 PAR = 1000 – 1200 µmol/m2/s To C 22-23 Nontransformed 7.75±0.45 0.79±0.15 11.09±4.66 Transgenic 8.73±0.28 0.99±0.14 16.67±0.32 June 1 PAR = 1000 – 1200 µmol/m2 /s To C 23-24 Nontransformed 5.72±0.30 0.35±0.02 10.00±0.43 Transgenic 8.47±0.50 1.13±0.35 15.40±0.66 July 1 PAR = 1000-1200 µmol/m2 /s To C 25-26 Nontransfomed 6.35±0.03 0.40±0.02 6.60±0.51 Transgenic 9.05±0.05 0.57±0.41 16.60±1.89 The yield of potato tubers in nontransformed and transgenic plants is presented in Table 6. Table 6. Masses of tuber harvest in nontransformed and transgenic potato (kg per plant) Variant Plants in row Average 1 2 3 4 5 6 Summer 2000 Nontransformed 1.6 1.5 1.4 1.3 1.3 1.2 1.4±0.2 Transgenic 4.2 3.6 3.2 2.5 2.4 2.3 3.0±0.8 Summer 2001 Nontransformed 4.0 3.9 3.9 3.3 3.2 3.0 3.6±0.4 Transgenic 7.1 6.0 5.8 4.3 3.4 3.0 4.9±1.5

In summer 2001 the field conditions for testing were improved and tubers were planted in squares 85x90 cm instead of 70x70 cm as in summer 2000. Plants in beds were better fertilized as well. Perhaps due to this agrotechnical improvement the yield in both transgenic and nontransformed plants was higher in 2001 than in 2000. However, the maximum harvest was significantly higher in transgenic potato in comparison to nontransformed ones.

The highest copy numbers of the gene ugt was found in sprouts grown up after transformation of potato tubers in comparison with nontransformed tubers and sprouts (Figure 1, A and B). But some homologous sequences were present in nontransformed potato which hybridized with primers to the gene ugt.

The expression of target gene ugt was studied via RT-PCR techniquess (Figure 1, C). There were distinct bands of about 1800 bp in transgenic sprouts at the same levels as in RNA from E. coli with pBluescript carrying the gene ugt. But there were no bands in nontransformed sprouts of potato or in variant with only

“blank” bacterial vector alone. PCR product of whole sequence of the gene ugt was about of 1800 bp (Figure 1, D).

Figure 1. PCR (A,D), Southern blot hybridization (B) and RT-PCR (C) of the gene ugt on potato genomic DNA and total RNA. A – 1 - standard DNA (100 bp), 2 – initial nontransformed tuber, 3 – nontransformed sprout, 4 – sprout from transformed tuber, 5 – pBluescript with the gene ugt (234 bp fragment from 567 to 801 nucleotides); B - 2 – initial nontransformed tuber, 3 – nontransformed sprout, 4 – sprout from transformed tuber, 5 – pBluescript with the gene ugt (234 bp fragment from 567 to 801 nucleotides); C - RT-PCR with primers to the whole sequence of the gene ugt (1800 bp), 1,2 and 3 - independent transgenic potato plants, 4 – nontransformed plant, 5 – transformed with blank A.t. vector C58; D – PCR on plasmid DNA of pBluescript harboring the gene ugt with primers to the whole sequence of 1800 bp of the gene ugt.

By using developed methods of plant infection with transconjugants created from triparental mating we obtained the transgenic potato with increased growth and increased productivity. The presence in transconjugant plasmid, the integration and the expression of marker and target genes in transgenic potato were confirmed by PCR, Southern blot hybridization and RT-PCR (Figure 1) and by measuring of the activity of GUS and NPTII (Table 1). Transgenic potato revealed high energy of growth because of elevated levels of free and bound IAA which was due to UDPG-transferase (IAA-glucose synthase) encoded by gene ugt transferred from corn (Table 4). Transgenic plants developed large total leaf surface (Tables 2 and 4) because of high level of IAA. Transpiration and photosynthesis were higher in transgenic plants (Table 5) which correlated with the harvest of transgenic potato, the highest per plant in most cases in comparison to nontransformed in 2000-2001 years (Tables 6).

This methodology applied to plant transgenesis may bring new plant genotypes useful to the

increase in their yield and give benefits to agricultural and food industries. REFERENCE

Jefferson, R.A., Kavanagh, T.A., and M.W. Bevan. (1987) Gus fusions: ß-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:3901-3907.

Observations indicate epistasis of nipple tip gene n-2 over n-4 Scott, J.W. University of Florida, IFAS, Gulf Coast Research & Education Center, Bradenton, FL 34203

One method to breed for smooth blossom scars in fresh market tomatoes is to use genes with pointed blossom-end morphology. These genes are recessive although heterozygotes often have increased frequencies of pointed fruit than wild types (Barten et al., 1994). In my breeding program two nipple tip genes are being used for this purpose, n-2 and n-4 (Barten et al., 1994). The n-2 gene has not been mapped. It is characterized by a rather subtle pinpoint blossom scar that rarely has persistent pointedness in mature fruit. The gene n-4 is likely the same gene as the n gene first described as being associated with adaxial leaf curl (Young and MacArthur, 1947; Gardner and Nash, 1987) and mapped to chromosome 5 (Mutschler et al., 1987). The n-4 designation is used because Barten et al. (1994) found LA 2353, which was supposed to have n, had no leaf curl and did not fit the original description of n. The leaf curl linked with the n-4 (or historical n) gene has been associated with increased early blight (Gardner and Nash, 1987) and bacterial spot (Scott, unpublished data) probably because more moisture from rains or dews is retained on the curled foliage. Thus, varieties with such foliage may be more prone to foliar diseases when grown in humid production regions. One also has to be careful in developing varieties that are homozygous for n-4 as they might have mature fruit that have pointed blossom ends under some environmental conditions and such fruit cause post harvest damage from bruising or puncturing of other fruit. One way to avoid such problems is to develop hybrids by crossing a parent that has n-4 with a parent that has n-2. The double heterozygotes are typically smooth without persistent nipples in mature fruit (Barten, et al., 1994).

Over the years I have crossed inbreds homozygous for n-2 with inbreds homozygous for n-4 and then made selections in generations segregating for both genes. Several times plants homozygous for n-4 have been selected that then segregate progeny with n-4 and n-2 phenotypes in 3:1 ratios (data not shown). This would indicate that the original selections were n-4/n-4,n-2/+ and when n-2/n-2 recombinants occurred the phenotype appears n-2 like. Thus, there is an epistatic relationship between the two loci with n-4 being hypostatic to n-2. Breeders should be aware of this in case one wanted to use such a selection as a hybrid parent for crosses with parents homozygous for n-4. The parent with the n-2 phenotype would be genotypically n-4/n-4, n-2/n-2 and the n-4 expression and its possible drawbacks will be evident in the hybrids (n-4/n-4,n-2/+). Literature Cited Barten, J.H.M., Scott, J.W., and R.G. Gardner. 1994. Characterization of blossom-end morphology genes in tomato and their usefulness in breeding for smooth blossom-end scars. J. Amer. Soc. Hort. Sci. 119(4):798-803. Gardner, R.G. and A.F. Nash. 1987. Observations on the nipple tip (n) trait and associated characteristics. Rpt. Tomato Genet. Coop. 37:45.

Mutschler, MA., Tanksley, S.D., and C.M. Rick. 1987. 1987 linkage maps of the tomato (Lycopersicon esculentum). Rpt. Tomato Genet. Coop. 37:5-34. Young, P.A. and J.W. MacArthur. 1947. Horticultural characters of tomato. Texas Agric. Expt. Sta. Bul. 698:1-61.

Identification of a GSK-3/SHAGGY-like protein kinase homologue from Lycopersicon peruvianum 1Wilson, Kimberly S., 2Stoeva-Popova, Pravda, and Dwight Dimaculangan1

1Department of Biology, Winthrop University, Rock Hill, SC 29733, E-mail: dimaculangad@winthrop.edu 2AgroBio Institute, Blvd. Dragan Tsankov No 8, Sofia 1164, Bulgaria, E-mail: pravda_stoeva@abi.bg The glycogen synthase kinase 3 (GSK-3)/SHAGGY-like kinases (GSKs) are known to be important regulators of animal and plant development (for reviews see Frame and Cohen, 2001; Jonak and Hirt, 2002). The identification of multiple GSKs in several plant species, Arabidopsis thaliana, Brassica napus, Medicago sativa, Nicotiana tabacum, Oryza sativa, and Petunia hybrida reveals they belong to a multigene family with diverse functions that include flower development, hormone signaling, and stress responses (Jonak and Hirt, 2002). In this work we report the isolation of a Lycopersicon peruvianum gene from the Lycopersicon cytoplasmic male sterility (CMS) system (Petrova et al., 1998; 1999; Vulkova-Achkova, 1980) that is homologous to the group III GSKs (Jonak and Hirt, 2002). Members belonging to group III of the plant GSK family contain a putative mitochondrial targeting sequence and are implicated in plant flower development (Decroocq-Ferrant et al., 1995; Tichtinsky et al., 1998). For example, in P. hybrida the PSK6 gene is expressed in both male and female reproductive phases, and is induced transiently during anther cell differentiation and microspore mother cell meiosis, and at pollen maturity. The investigators suggest PSK6 functions first in the tapetum and later in the mature pollen grain (Decroocq-Ferrant et al., 1995). Similarly, the N. tabacum ortholog NSK6 is primarily expressed in the anther and pollen; it is first detectable after mitosis I and then continues to accumulate until the mature pollen stage (Tichtinsky et al., 1998). We cloned a differential display band from a semi fertile hybrid plant (Figure 1). This band was absent in the lane containing anther cDNA from CMS plants, but present in the lanes of other species and hybrids in the Lycopersion CMS system (L. esculentum, L. peruvianum, L. pennellii, CMS-pennellii and the hybrid plants from the segregating generation F3 [CMS-pennellii x (F1 L. esculentum x L. pennellii)] (Petrova et al., 1998; 1999; Vulkova-Achkova, 1980). The 545 bp DNA sequence was highly homologous to the 3’ untranslated ends of several GSK genes: NSK6 (81%), PSK6 (79%), and NSK91 (79%). We amplified a cDNA containing the coding region from mature anther mRNA using an upstream primer derived from conserved sequences found in PSK6 and NSK91 (primer TSK 1: 5’GGGCGAAGCAGAGATGAATGTC 3’) and a downstream primer complementary to the isolated differential display clone (primer TSK 2: 5’ATTTCATGTCTTCTGGTTGTTC3’). The predicted 1800-1900 bp cDNA product was generated by RT-PCR in all species and hybrids of the studied CMS system (Figure 2). Cloning of the L. peruvianum product unveiled an 1865 bp sequence with an open reading frame coding for 475 amino acids (Figure 3). This gene, named Lycopersicon peruvianum SHAGGY related protein kinase 6 (LpSK6) (Genebank accession number AY575716) was found to be closely related to three of the known members of the Solanaceae subgroup of the group III GSKs based upon our phylogenetic analysis. Since LpSK6 shares 95.6 %, 95.4 %, 91.4% identity at the amino acid level with NSK6 NSK91, and PSK6 respectively it is most likely an ortholog of these N. tabacum and P. hybrida genes. Consistent with the other

members of group III (Tichtinsky et al., 1998), LpSK6 has an extended N-terminal region, which contains a potential mitochondrial localization signal with a putative cleavage site (Figure 3). The Lycopersicon CMS phenotype results from an incompatibility between the cytoplasm of L. peruvianum and the nuclear genome of L. pennellii and occurs after the tetrad stage (Petrova et al., 1998; 1999; Vulkova-Achkova, 1980). CMS in general involves the lack of pollen development due to inadequate mitochondrial function in male reproductive tissue (Hanson, 1991; Kempken and Pring, 1997). The identification of a GSK gene in the Lycopersicon CMS system, the expression of its homologues in male reproductive tissues and the conserved mitochondrial localization signal present in all homologues, indicate the possible involvement of LpSK6 in generating the CMS and/or fertility restored phenotype. Acknowledgements This work was supported in part by seed grant no. 2001-01500 for the U.S. Department of Agriculture (USDA). Figure Legends Figure 1. Differential display gel with amplified anther mRNAs with FHT11G and HAP-1 primers (GenHunter Co.). Lanes 1 - 5 contain PCR products from L. pennellii, L. peruvianum, L. esculentum, and CMS-pennellii. Lanes 6 - 8 contain PCR products from 3 hybrid (H) plants F3[CMS – pennellii x F1(L. esculentum x L. pennellii)] with varying percentage of pollen stainability. The products were separated on a 6% polyacrylamide denaturing gel and detected by fluorescence. The arrow indicates the band excised from the H1 lane. Figure 2. Quantitative RT-PCR of LpSK6 in the plants of the Lycopersicon CMS system: L. pennellii, L. peruvianum, CMS-pennellii, L. esculentum, and hybrid (H) plants 1, 2, 6 and 8. Lanes contained RT reactions with reverse transcriptase (+) or control samples without enzyme (-). Top image shows amplification using LpSK6 primers; bottom image shows amplification of the GADPH as an internal control. Figure 3. LpSK6 nucleotide (Genebank accession number AY575716) and amino acid sequences. The box indicates the putative cleavage site for the mitochondrial localization signal. The two arrows show the location of the LpSK6 primers used in the quantitative PCR reactions shown in Figure 2. References

Decroocq-Ferrant, V., Went, J., Bianchi, M.W., de Vires, S.C., and Kreis, M. 1995. Petunia hybrida

homologues of shaggy / zeste-white 3 expressed in female and male reproductive organs. The Plant Journal 7:897-911.

Frame, S. and P. Cohen. 2001. GSK3 takes center stage more than 20 years after its discovery. Biochemical Journal 359:1-16.

Hanson, M.R. 1991. Plant mitochondria mutations and male sterility. Annual Reviews of Genetics 25:461-486.

Jonak, C. and H. Hirt. 2002. Glycogen synthase kinase 3 / SHAGGY-like kinases in plants: an emerging family with novel functions. Trends in Plant Sciences 7:457-461.

Kempken, F. and D.R. Pring. 1999. Male sterility in higher plants - fundamentals and applications. Progress in Botany 60:139-166.

Petrova, M., Vulkova, Z., Atanassov, A., and P. Stoeva. 1998. Morphological, cytological, biochemical and molecular analysis of cytoplasmic male sterile form in genus Lycopersicon. Report of the Tomato Genetics Cooperative 48:36.

Petrova, M., Vulkova, Z., Gorinova, N., Izhar, S., Firon, N., Jacquemin, J-M., Atanassov, A., and P. Stoeva. 1999. Characterization of a cytoplasmic male-sterile hybrid line between Lycopersicon peruvianum Mill. x Lycopersicon pennellii Corr. and its crosses with cultivated tomato. Theoretical and Applied Genetics 98:825-830.

Tichtinsky, G., Tavares, R., Takvorian, A., Shcwebel-Dugué, N., Twell, D., and M. Kreis. 1998. An evolutionary conserved group of plant GSK-3/shaggy-like protein kinase preferentially expressed in developing pollen. Biochimica et Biophysica Acta 1442:261-273.

Vulkova-Achkova, Z. 1980. L. peruvianum a source of CMS. Report of the Tomato Genetics Cooperative 32:50.

Figure 1

Figure 2

Figure 3 M N V M R R L K S I A S G R S S V S D P · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1 GGCGAACGAG AGATGAATGT CATGCGTCGC CTTAAGAGCA TTGCTTCTGG ACGTTCTTCT GTTTCAGATC .. G G D S S I K R V K V E K E V D Q R V V G E T · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 71 CTGGTGGTGA TTCAAGCATA AAGAGGGTGA AGGTTGAGAA AGAAGTAGAT CAAAGAGTGG TTGGTGAAAC . Q M E E G C T T T T V P K E D M A S T S K E T ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 141 TCAAATGGAA GAGGGATGTA CAACTACTAC AGTTCCAAAG GAAGACATGG CTTCTACATC TAAGGAAACC T A G S T S T M D T R L E N S E L D E L P K E M · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 211 ACTGCTGGAA GTACCTCAAC AATGGATACT AGACTTGAAA ATTCTGAACT TGATGAGCTT CCTAAAGAAA .. H E M K I K G E K D D K A D S L D D N L K D M · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 281 TGCATGAGAT GAAAATTAAG GGTGAAAAAG ATGATAAAGC TGATAGTCTA GATGATAATT TGAAGGATAT . E P A V V S G N G T E T G Q I I V T T V S G R ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 351 GGAACCTGCT GTTGTTAGTG GGAATGGAAC AGAAACTGGT CAGATTATTG TGACTACTGT GAGTGGTAGG N G Q E K Q T L S Y M A E R V V G T G S F G V V · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 421 AATGGACAAG AGAAACAGAC ATTGTCTTAC ATGGCGGAGC GCGTGGTTGG CACTGGTTCA TTTGGAGTTG .. F Q A K C L E T G E S V A I K K V L Q D R R Y · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 491 TCTTTCAGGC TAAGTGCTTG GAAACTGGTG AATCTGTTGC AATAAAGAAG GTCTTACAGG ATAGGAGATA . K N R E L Q I M R T L D H P N V V K L R H C F ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 561 CAAGAACAGG GAACTTCAGA TTATGCGCAC ACTTGATCAT CCTAATGTTG TTAAACTACG ACACTGCTTC Y S T T E K N D V Y L N L V L E Y V S D T V Y R · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 631 TATTCTACTA CTGAGAAGAA TGACGTCTAC CTTAACCTTG TCCTGGAATA CGTGTCTGAC ACTGTTTACC .. V S R H Y S R L T Q H M P I I Y V Q L Y T Y Q · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 701 GAGTATCAAG GCACTACAGC AGACTGACCC AACACATGCC CATTATATAT GTGCAGCTAT ACACATACCA . I C R A L N Y M H G V L G V C H R D I K P Q N ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 771 GATATGCCGG GCTCTGAATT ACATGCATGG TGTTCTTGGT GTATGCCATC GTGATATTAA GCCACAGAAT L L V N P H S H Q L K L C D F G S A K M L V P G · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 841 CTTTTGGTTA ATCCCCACTC GCATCAGCTA AAGCTCTGTG ATTTTGGTAG TGCAAAGATG TTGGTGCCTG .. E P N I S Y I C S R Y Y R A P E L I F G A T E · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 911 GAGAGCCCAA CATATCGTAC ATTTGTTCCC GTTATTATCG GGCTCCTGAA TTGATCTTTG GTGCTACTGA . Y T T A I D M W S A G C V M A E L L L G Q P L ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 981 GTACACAACT GCAATTGACA TGTGGTCTGC TGGTTGCGTT ATGGCTGAGC TACTTTTGGG ACAACCTCTT F P G E S G V D Q L V E I I K I L G T P T R E E · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1051 TTCCCTGGAG AAAGTGGCGT TGATCAGCTG GTCGAAATCA TCAAGATATT GGGGACACCA ACAAGAGAGG .. I R C M N P N Y T E F K F P Q I K A H P W H K · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1121 AGATTAGGTG CATGAATCCG AATTACACAG AGTTCAAGTT TCCCCAGATC AAAGCTCACC CATGGCACAA . I F H K R M P P E A V D L V S R L L Q Y S P T ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1191 GATATTTCAT AAAAGAATGC CCCCTGAAGC AGTTGATTTG GTGTCGAGGC TTCTCCAATA TTCTCCAACT L R C T A L E A C A H P F F D S L R E P N A C L · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1261 CTACGCTGCA CTGCTTTGGA AGCATGTGCA CACCCTTTCT TTGATTCTTT AAGGGAACCA AATGCTTGCT .. P N G R P L P P L F N F S P Q E L S G V P A E · ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1331 TGCCAAATGG GCGACCTCTG CCTCCCCTAT TCAACTTTTC ACCTCAAGAG CTYTCTGGTG TGCCTGCTGA . L R K R L I P E H L R K ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1401 ACTGCGAAAG CGCCTTATTC CTGAACACTT GCGCAAGTGA ATTTTGTGAA CACAGTTGCT TAGGCTTTGT 1471 AAATGGGTTT TTCTTGAGAG GTGTAGTTGC CTAATCAGCG TTATGTTGCT CCAGCAAATG CAGCTGCTTT 1541 CTTGGCCTTA GTAATATTTG ATGGAATACA ACATCATAAC ATGGGAGCTA GTTACTTGCT AGTTGGTTTC 1611 GGATGATGGA TATGACAGTA AGATTTGCGG GTGATTTATC GCAGTGTCTC TCGTCTTTAT AAACATATTA 1681 TGTTCAGTAC CCCAGTAGTT TTAGATGAGA GTTTTCATCT GTTAATTTAT ACCTTTTAGC AAGCAATATC 1751 TAGTTTGAGG GGTATTCATA AGATTAATGA GTGCTCCCAA ACTTGGAGTT ATAGATGAAT GATTAGGAGT 1821 TTTATATTCA TTAAAGTATA ACATTTCATG TCTTCTGGTT GTCCG

Alvarez, M.1, M. Lara1, J. Rodríguez1, R. Fernández-Muñoz2, and J. Cuartero2. 2004. Eliana. 1Instituto Nacional de Ciencias Agrícolas (INCA), Havana, Cuba. 2Estación Experimental La Mayora, CSIC, Málaga, Spain. ‘Eliana’ is an improved line resulting from a tomato breeding program. The pedigree involves crosses between a cultivar widely adapted to tropical environments but susceptible to nematodes, ‘Mariela’ (TGC Report 52, 2002), and a resistant commercial hybrid, ‘Rambo’, followed by three successive backcrosses to ‘Mariela’ and then three selfing steps. Selection of Mi/mi or Mi/Mi genotypes during the process was made by the Aps-1 isozyme marker, and Mi phenotype of ‘Eliana’ was finally confirmed by nematode inoculation. Characteristics: Fruit: red, flattened globe, average weight 120 g. Plant: determinate (sp), good coverage of fruit by foliage, nematode resistant (Mi/Mi; Aps-1/Aps-1). Utility: Adequate for fresh market.

1Francis, D.M. and S. Miller. Ohio 9834 and Ohio 9816: processing tomato breeding lines with partial resistance to race T1 of bacterial spot. 1E-mail francis.77@osu.edu

Pedigree of Ohio 9816 and Ohio 9834 ___ Hawaii 7998 | ____ Ohio 88119 X F1 | | _____| |___ Ohio 88119 | |

9816 _______ | |____ Ohio 88119 |

9834 _______ | |__________ Ohio 88119

Characteristics

Fruit: Fruit of Ohio 9816 and Ohio 9834 average 2.0 oz with two to three locules. The shape is ovate. Fruit have a small stem scar and core, are uniform ripening (u), and are attached by a jointless pedicel (j2). Plant: The vines of Ohio 9834 are small to medium in size and the vines of Ohio 9816 are medium to large in size. Vines of both lines are prostrate and determinate (sp). Disease resistance. Both lines have partial resistance to race T1 of bacterial spot [Xanthomonas campestris pv. vesicatoria], resistance to race 1 (I) of Fusarium], and resistance to race 1 (Ve) of verticillium wilt. The source of partial resistance to bacterial spot is Hawaii 7998 and genetic studies indicate that both lines carry an introgression on chromosome 5. Utility. Ohio 9834 and Ohio 9816 are mid season lines adapted to high population transplant culture, machine harvest, and bulk handling under humid growing environments. They are suitable parental lines for the development of hybrids used in the production of peeled, whole-canned, and diced tomato products. Both lines have been tested in plot trials the mid-western U.S. Hybrids using these lines have performed well in plot trials and in commercial scale strip trials in the mid-western and eastern U.S., in Ontario, Canada, and in Victoria, Australia. Availability. Material transfer agreements are available from the Office for Technology Licensing, The Ohio State University, 1960 Kenny Road, Columbus, OH 43210-1063, Small samples of seed are available from the corresponding author.

Scott, J.W., S.M. Olson, J.B. Jones, P.J. Stofella, J.A. Bartz, and G.C. Somodi. 2003. Fla. 7514 hybrid tomato tolerant to bacterial wilt. Pedigree:

Suncoast

(648 X C-28)

648

Campbell 28 (C-28)

7236F7

7613F9

7060

Neptune

7156F3

Fla. 7514

F5

Characteristics: Fruit: Medium-large, flat round with some irregular shape, shoulders light green and slightly ribbed, irregular blossom scar. Plant: sp, I, I-2, Ve, Sm, medium vine. Utility and maturity: Fresh market hybrid with tolerance to bacterial wilt in SE USA, heat-tolerant (>32°C day/>21°C night), early season.

Scott, J.W., S.M. Olson, J.A. Bartz, D.N. Maynard, and P.J. Stofella. 2003. Fla. 7964 hybrid tomato resistant to tomato spotted wilt virus. Pedigree:

Suncoast

7324

Suncoast

Stevens

NC 140

Rodade

7777F9

8042F7

Fla. 7964

F4

7692

7324

7060

7324F3

F3F3

F5

F8

Characteristics: Fruit: Medium-large, flat round shape, smooth, firm, light-green shoulders. Plant: sp, I, I-2, Ve, Sm, Sw-5, moderate resistance to bacterial soft rot, medium-tall vine Utility and maturity: Fresh market, spotted wilt resistant hybrid with moderate heat-tolerance (>32°C day/>21°C night), mid-season under cool temperatures, early-midseason under high temperatures.

Revised List of Wild Species Stocks

Chetelat, R.T. C.M. Rick Tomato Genetics Resource Ctr., Dept. Vegetable Crops, Univ. of California, Davis, CA 95616 The following list of 1,160 accessions of wild Lycopersicon and related Solanum species is a revision of the previous one, published in TGC vol. 51 (2001). Other types of TGRC stocks are catalogued in TGC 52 (monogenic mutants) and TGC 53 (miscellaneous genetic stocks). Inactive accessions have been dropped and new collections added to the present list. The new material includes populations of L. chilense, L. peruvianum, S. lycopersicoides, and S. sitiens collected in N. Chile in 2001, L. hirsutum and L. pimpinellifolium accessions donated by Miguel Holle, and L. pimpinellifolium donated by Fernando Nuez. Seed samples of most accessions are available for distribution, upon request, for valid research purposes. Some accessions may be temporarily unavailable for distribution during regeneration. In general, only small quantities of seed can be provided – in most cases, 25 seed per accession for the self-pollinated species, 50 for the outcrossers, and 5-10 for the tomato-like Solanum spp. – and are intended to enable researchers to produce seed in larger quantities to satisfy their own needs. Accessions are grown for seed increase at UC-Davis, either in the field, for most of the selfing species, or in the greenhouse for the outcrossers. Accessions of the former are increased in small plots with as few as 6 plants, whereas the latter are regenerated from relatively large populations to maintain genetic variation. For lack of space, only summary information on the collection site of each is presented here. To facilitate choice of accessions, those comprising the core subsets for each species are identified with an asterisk. More detailed passport information is available for each accession at our website (http://tgrc.ucdavis.edu). Geographic coordinates (lat/lon) have been estimated for most accessions collected from mainland S. America, and can be downloaded in several formats. Additional information will be provided upon request. Acc. No. Collection Site Dept. / Prov. Country

L. cheesmanii (39 accessions) LA0166* Santa Cruz: Barranco, N of Punta Galapagos Islands Ecuador LA0421* San Cristobal: cliff E of Wreck Bay Galapagos Islands Ecuador LA0422 San Cristobal: Wreck Bay Galapagos Islands Ecuador LA0428 Santa Cruz: trail Bellavista to Miconia Zone Galapagos Islands Ecuador LA0429* Santa Cruz: crater in highlands Galapagos Islands Ecuador LA0434 Santa Cruz: Rambech Trail Galapagos Islands Ecuador LA0437 Isabela: ponds N of Villamil Galapagos Islands Ecuador LA0521 Fernandina: inside Crater Galapagos Islands Ecuador LA0522 Fernandina: outer slopes Galapagos Islands Ecuador LA0524 Isabela: Punta Essex Galapagos Islands Ecuador LA0528B Santa Cruz: Academy Bay Galapagos Islands Ecuador LA0529 Fernandina: crater Galapagos Islands Ecuador LA0531* Baltra: Barranco slope, N side Galapagos Islands Ecuador LA0746* Isabela: Punta Essex Galapagos Islands Ecuador LA0749* Fernandina: N side Galapagos Islands Ecuador LA0927 Santa Cruz: Academy Bay Galapagos Islands Ecuador LA0932 Isabela: Tagus Cove Galapagos Islands Ecuador

L. cheesmanii cont’d LA1035 Fernandina: low elevation Galapagos Islands Ecuador LA1036* Isabela: far N end Galapagos Islands Ecuador LA1037 Isabela: Alcedo E slope Galapagos Islands Ecuador LA1040 San Cristobal: Caleta Toruga Galapagos Islands Ecuador LA1041 Santa Cruz: El Cascajo Galapagos Islands Ecuador LA1042 Isabela: Cerro Santo Tomas Galapagos Islands Ecuador LA1043 Isabela: Cerro Santo Tomas Galapagos Islands Ecuador LA1138 Isabela: E of Cerro Azul Galapagos Islands Ecuador LA1139 Isabela: W of Cerro Azul Galapagos Islands Ecuador LA1402 Fernandina: W of Punta Espinoza Galapagos Islands Ecuador LA1404 Fernandina: W flank caldera Galapagos Islands Ecuador LA1406* Fernandina: SW rim caldera Galapagos Islands Ecuador LA1407 Fernandina: caldera, NW bench Galapagos Islands Ecuador LA1409 Isabela: Punta Albermarle Galapagos Islands Ecuador LA1412* San Cristobal: opposite Isla Lobos Galapagos Islands Ecuador LA1414 Isabela: Cerro Azul Galapagos Islands Ecuador LA1427 Fernandina: WSW rim of caldera Galapagos Islands Ecuador LA1447 Santa Cruz: Charles Darwin Station-Punta Galapagos Islands Ecuador LA1448 Santa Cruz: Puerto Ayora, Pelican Bay Galapagos Islands Ecuador LA1449 Santa Cruz: Charles Darwin Station, Galapagos Islands Ecuador LA1450* Isabela: Bahia San Pedro Galapagos Islands Ecuador LA3124 Santa Fe: near E landing Galapagos Islands Ecuador L. cheesmanii f. minor (30 accessions) LA0317* Bartolome Galapagos Islands Ecuador LA0426 Bartolome: E of landing Galapagos Islands Ecuador LA0436* Isabela: Villamil Galapagos Islands Ecuador LA0438 Isabela: coast at Villamil Galapagos Islands Ecuador LA0480A Isabela: Cowley Bay Galapagos Islands Ecuador LA0483 Fernandina: inside crater Galapagos Islands Ecuador LA0526* Pinta: W side Galapagos Islands Ecuador LA0527 Bartolome: W side, Tower Bay Galapagos Islands Ecuador LA0528 Santa Cruz: Academy Bay Galapagos Islands Ecuador LA0530 Fernandina: crater Galapagos Islands Ecuador LA0532 Pinzon: NW side Galapagos Islands Ecuador LA0747 Santiago: Cape Trenton Galapagos Islands Ecuador LA0748 Santiago: E Trenton Island Galapagos Islands Ecuador LA0929 Isabela: Punta Flores Galapagos Islands Ecuador LA0930 Isabela: Cabo Tortuga Galapagos Islands Ecuador LA1039 Isabela: Cape Berkeley Galapagos Islands Ecuador LA1044 Bartolome Galapagos Islands Ecuador LA1136* Gardner-near-Floreana Islet Galapagos Islands Ecuador LA1137* Rabida: N side Galapagos Islands Ecuador LA1141* Santiago: N crater Galapagos Islands Ecuador LA1400 Isabela: N of Punta Tortuga Galapagos Islands Ecuador LA1401* Isabela: N of Punta Tortuga Galapagos Islands Ecuador LA1403 Fernandina: W of Punta Espinoza Galapagos Islands Ecuador LA1408 Isabela: SW volcano, Cape Berkeley Galapagos Islands Ecuador

L. cheesmanii f. minor cont’d LA1410* Isabela: Punta Ecuador Galapagos Islands Ecuador LA1411 Santiago: N James Bay Galapagos Islands Ecuador LA1452 Isabela: E slope Volcan Alcedo Galapagos Islands Ecuador LA1508 Corona del Diablo (near Floreana) Galapagos Islands Ecuador LA1627 Isabela: Tagus Cove Galapagos Islands Ecuador LA3909 Bartolome: tourist landing Galapagos Islands Ecuador L. chilense (97 accessions) LA0130 Moquegua Moquegua Peru LA0294 Tacna Tacna Peru LA0456 Clemesi Moquegua Peru LA0458 Tacna Tacna Peru LA0460 Palca Tacna Peru LA0470 Taltal Antofagasta Chile LA1029 Moquegua Moquegua Peru LA1030 Tarata Rd. Tacna Peru LA1782 Quebrada de Acari Arequipa Peru LA1917 Llauta (4x) Ica Peru LA1930 Quebrada Calapampa Arequipa Peru LA1932* Minas de Acari Arequipa Peru LA1938* Quebrada Salsipuedes Arequipa Peru LA1958* Pampa de la Clemesi Arequipa Peru LA1959 Huaico Moquegua Moquegua Peru LA1960* Rio Osmore Moquegua Peru LA1961 Toquepala Tacna Peru LA1963* Rio Caplina Tacna Peru LA1965* Causiri Tacna Peru LA1967* Pachia, Rio Caplina Tacna Peru LA1968 Cause seco Tacna Peru LA1969* Estique Pampa Tacna Peru LA1970 Tarata Tacna Peru LA1971* Palquilla Tacna Peru LA1972 Rio Sama Tacna Peru LA2404 Arica to Tignamar Tarapaca Chile LA2405 Tignamar Tarapaca Chile LA2406 Arica to Putre Tarapaca Chile LA2731 Moquella Tarapaca Chile LA2737 Yala-yala Tarapaca Chile LA2739 Cruce Nama a Camina Tarapaca Chile LA2746 Asentamiento-18 Tarapaca Chile LA2747 Alta Azapa Tarapaca Chile LA2748* Soledad Antofagasta Chile LA2749 Punta Blanca Antofagasta Chile LA2750* Mina La Despreciada Antofagasta Chile LA2751 Pachica (Rio Tarapaca) Tarapaca Chile LA2753 Laonzana Tarapaca Chile LA2754 W of Chusmisa Tarapaca Chile

LA2755* Banos de Chusmisa Tarapaca Chile LA2757 W of Chusmisa Tarapaca Chile LA2759* N of Mamina Tarapaca Chile LA2762 Quebrada Mamina-Parca Tarapaca Chile LA2764 Codpa Tarapaca Chile LA2765 Timar Tarapaca Chile LA2767* Chitita Tarapaca Chile LA2768 Empalme Codpa Tarapaca Chile LA2771 Above Poconchile Tarapaca Chile LA2773* Zapahuira Tarapaca Chile LA2774 Socorama Tarapaca Chile LA2778* Chapiquina Tarapaca Chile LA2779 Cimentario Belen Tarapaca Chile LA2780 Belen to Lupica Tarapaca Chile LA2879* San Roque de Peine Antofagasta Chile LA2880 Quebrada Tilopozo Antofagasta Chile LA2882 Camar Antofagasta Chile LA2884* Ayaviri Antofagasta Chile LA2887 Quebrada Bandurria Antofagasta Chile LA2888 Loma Paposo Antofagasta Chile LA2891 Taltal Antofagasta Chile LA2930* Quebrada Taltal Antofagasta Chile LA2931* Guatacondo Tarapaca Chile LA2932 Quebrada Gatico, Mina Escalera Antofagasta Chile LA2946 Guatacondo Tarapaca Chile LA2949 Chusmisa Tarapaca Chile LA2952 Camiña Tarapaca Chile LA2955 Quistagama Tarapaca Chile LA2980 Yacango Moquegua Peru LA2981A Torata to Chilligua Moquegua Peru LA3111 Tarata outskirts Tacna Peru LA3112 Estique Pampa Tacna Peru LA3113 Apacheta Tacna Peru LA3114 Quilla Tacna Peru LA3115 W of Quilla Tacna Peru LA3153 Desvio Omate (Rio de Osmore) Moquegua Peru LA3155 Quinistaquillas Moquegua Peru LA3355 Cacique de Ara Tacna Peru LA3356 W of Tacna Tacna Peru LA3357 Irrigacion Magollo Tacna Peru LA3358 Rio Arunta, Cono Sur Tacna Peru LA3784 Rio Chaparra Arequipa Peru LA3785 Terras Blancas Arequipa Peru LA3786 Alta Chaparra Arequipa Peru LA4107 Catarata Taltal Antofagasta Chile LA4108 Caleta Punta Grande Antofagasta Chile LA4109 Quebrada Cañas Antofagasta Chile LA4117 San Pedro de Atacama to Paso Jama #1 Antofagasta Chile

LA4117B San Pedro de Atacama to Paso Jama #2 Antofagasta Chile LA4118 Toconao Antofagasta Chile LA4119 Socaire Antofagasta Chile LA4120 Cahuisa Tarapaca Chile LA4121 Pachica to Porosa Tarapaca Chile LA4122 Chiapa Tarapaca Chile LA4124 Camina Tarapaca Chile LA4127 Alto Umayani Tarapaca Chile LA4129 Pachica (Rio Camarones) Tarapaca Chile LA4132 Esquina Tarapaca Chile L. chmielewskii (27 accessions) LA1028* Casinchihua Apurimac Peru LA1306* Tambo Ayacucho Peru LA1316* Ocros Ayacucho Peru LA1317* Hacienda Pajonal Ayacucho Peru LA1318* Auquibamba Apurimac Peru LA1325* Puente Cunyac Apurimac Peru LA1327 Soracata Apurimac Peru LA1330 Hacienda Francisco Apurimac Peru LA2639B Puente Cunyac Apurimac Peru LA2663* Tujtohaiya Cusco Peru LA2677* Huayapacha #1 Cusco Peru LA2678 Huayapacha #2 Cusco Peru LA2679 Huayapacha #3 Cusco Peru LA2680* Puente Apurimac #1 Cusco Peru LA2681 Puente Apurimac #2 Cusco Peru LA2695* Chihuanpampa Cusco Peru LA3642 Ankukunka Cusco Peru LA3643 Colcha Cusco Peru LA3644 Puente Tincoj Cusco Peru LA3645 Boca del Rio Velille Cusco Peru LA3648 Huallapachaca Apurimac Peru LA3653 Matara Apurimac Peru LA3654 Casinchigua to Chacoche Apurimac Peru LA3656 Chalhuani Apurimac Peru LA3658 Occobamba Apurimac Peru LA3661 Pampotampa Apurimac Peru LA3662 Huancarpuquio Apurimac Peru L. esculentum var. cerasiforme (271 accessions) LA0168 New Caledonia Fr. Oceania LA0292* Santa Cruz Galapagos Islands Ecuador LA0349 (Unknown origin) LA0475 Sucua Morona-Santiago Ecuador LA0476 Sucua Morona-Santiago Ecuador LA1025* Oahu: Wahiawa Hawaii USA

L. esculentum var. cerasiforme cont’d LA1203 Ciudad Vieja Guatemala LA1204* Quetzaltenango Guatemala LA1205 Copan Honduras LA1206* Copan Ruins Honduras LA1207 Mexico LA1208 Sierra Nevada Colombia LA1209 Colombia LA1226 Sucua Morona-Santiago Ecuador LA1227 Sucua Morona-Santiago Ecuador LA1228* Macas, San Jacinto de los Monos Morona-Santiago Ecuador LA1229 Macas Plaza Morona-Santiago Ecuador LA1230 Macas Morona-Santiago Ecuador LA1231* Tena Napo Ecuador LA1247 La Toma Loja Ecuador LA1268* Chaclacayo Lima Peru LA1286* San Martin de Pangoa Junin Peru LA1287 Fundo Ileana #1 Junin Peru LA1289 Fundo Ileana #3 Junin Peru LA1290 Mazamari Junin Peru LA1291 Satipo Granja Junin Peru LA1307* Hotel Oasis, San Francisco Ayacucho Peru LA1308 San Francisco Ayacucho Peru LA1310 Hacienda Santa Rosa Ayacucho Peru LA1311 Santa Rosa Puebla (19 subunits) Ayacucho Peru LA1312* Paisanato (2 subunits) Cusco Peru LA1314* Granja Pichari Cusco Peru LA1320* Hacienda Carmen Apurimac Peru LA1323* Pfacchayoc Cusco Peru LA1324 Hacienda Potrero, Quillabamba Cusco Peru LA1328 Rio Pachachaca Apurimac Peru LA1334 Pescaderos Arequipa Peru LA1338* Puyo Napo Ecuador LA1372 Santa Eulalia Lima Peru LA1385* Quincemil Cusco Peru LA1386 Balsas Amazonas Peru LA1387 Quincemil Cusco Peru LA1388* San Ramon Junin Peru LA1420* Lago Agrio Napo Ecuador LA1421 Santa Cecilia Napo Ecuador LA1423 Near Santo Domingo Pichincha Ecuador LA1425* Villa Hermosa Cauca Colombia LA1426 Cali Cauca Colombia LA1428 La Estancilla Manabi Ecuador LA1429* La Estancilla Manabi Ecuador LA1453* Kauai: Poipu Hawaii USA LA1454 Mexico LA1455 Gral Teran Nuevo Leon Mexico LA1456* Papantla Vera Cruz Mexico

L. esculentum var. cerasiforme cont’d LA1457 Tehuacan Puebla Mexico LA1458 Huachinango Puebla Mexico LA1461* University Philippines, Los Banos Philippines LA1464* El Progreso, Yoro Honduras LA1465 Taladro, Comayagua Honduras LA1467 Cali Cauca Colombia LA1468 Fte. Casa, Cali Cauca Colombia LA1479 Sucua Morona-Santiago Ecuador LA1480 Sucua Morona-Santiago Ecuador LA1481 Sucua Morona-Santiago Ecuador LA1482* Segamat Malaysia LA1483* Trujillo Saipan LA1509* Tawan Sabah Borneo LA1510 Mexico LA1511* Siete Lagoas Minas Gerais Brazil LA1512 Lago de Llopango El Salvador LA1540 Cali to Popayan Cauca Colombia LA1542* Turrialba Costa Rica LA1543* Upper Parana Brazil LA1545 Becan Ruins Campeche Mexico LA1546 Papantla Vera Cruz Mexico LA1548 Fundo Liliana Junin Peru LA1549 Chontabamba Pasco Peru LA1569 Jalapa Vera Cruz Mexico LA1574 Nana Lima Peru LA1619 Pichanaki Junin Peru LA1620* Castro Alves Bahia Brazil LA1621 Rio Venados Hidalgo Mexico LA1622* Lusaka Zambia LA1623 Muna Yucatan Mexico LA1632 Puerto Maldonado Madre de Dios Peru LA1654 Tarapoto San Martin Peru LA1655 Tarapoto San Martin Peru LA1662 El Ejido Merida Venezuela LA1667 Cali Cauca Colombia LA1668 Acapulco Guerrero Mexico LA1673 Nana Lima Peru LA1701 Trujillo La Libertad Peru LA1703 Rio Tamesi Tamaulipas Mexico LA1704 Rio Tamesi Tamaulipas Mexico LA1705 Sinaloa Mexico LA1709 Desvio Yojoa Honduras LA1710 Cariare Limon Costa Rica LA1711 Zamorano Honduras LA1712 Pejibaye Costa Rica LA1713 CATIE, Turrialba Costa Rica LA1909 Quillabamba Cusco Peru LA1953 La Curva Arequipa Peru

L. esculentum var. cerasiforme cont’d LA2076 Naranjitos Bolivia LA2077 Paco, Coroica La Paz Bolivia LA2078* Mosardas Rio Grande de Sol Brazil LA2079 Maui: Kihei Hawaii USA LA2080 Maui: Kihei Hawaii USA LA2081 Maui: Kihei Hawaii USA LA2082 Arenal Valley Honduras LA2085 Kempton Park S. Africa LA2095* La Cidra Loja Ecuador LA2121 Yacuambi - Guadalupe Zamora-Chinchipe Ecuador LA2122 Yacuambi - Guadalupe (4 subunits) Zamora-Chinchipe Ecuador LA2123 La Saquea (2 subunits) Zamora-Chinchipe Ecuador LA2126 El Dorado (4 subunits) Zamora-Chinchipe Ecuador LA2127 Zumbi Zamora-Chinchipe Ecuador LA2129 San Roque Zamora-Chinchipe Ecuador LA2130 Gualaquiza Zamora-Chinchipe Ecuador LA2131* Bomboiza Zamora-Chinchipe Ecuador LA2132 Chuchumbetza Zamora-Chinchipe Ecuador LA2135 Limon Santiago-Morona Ecuador LA2136 Bella Union Santiago-Morona Ecuador LA2137* Tayusa Santiago-Morona Ecuador LA2138 Chinimpini (2 subunits) Santiago-Morona Ecuador LA2139 Logrono (2 subunits) Santiago-Morona Ecuador LA2140 Huambi (3 subunits) Santiago-Morona Ecuador LA2141 Rio Blanco Santiago-Morona Ecuador LA2142 Cambanaca Santiago-Morona Ecuador LA2143 Nuevo Rosario Santiago-Morona Ecuador LA2177 San Ignacio (5 subunits) Cajamarca Peru LA2205 Santa Rosa de Mirador (2 subunits) San Martin Peru LA2308* San Francisco San Martin Peru LA2312 Jumbilla #1 Amazonas Peru LA2313 Jumbilla #2 Amazonas Peru LA2392* Jakarta Indonesia LA2393 Mercedes Canton Hoja Ancha Guanacaste Costa Rica LA2394 San Rafael de Hoja Ancha Guanacaste Costa Rica LA2402* Florianopolis Santa Catarina Brazil LA2411 Yanamayo Puno Peru LA2616 Naranjillo Huanuco Peru LA2617 El Oropel Huanuco Peru LA2618 Santa Lucia, Tulumayo Huanuco Peru LA2619* Caseria San Augustin Loreto Peru LA2620 La Divisoria Loreto Peru LA2621 3 de Octubre Loreto Peru LA2624 Umashbamba Cusco Peru LA2625 Chilcachaca Cusco Peru LA2626 Santa Ana Cusco Peru LA2627 Pacchac, Chico Cusco Peru

L. esculentum var. cerasiforme cont’d LA2628 Echarate Cusco Peru LA2629 Echarate Cusco Peru LA2630 Calzana Cusco Peru LA2631 Chontachayoc Cusco Peru LA2632 Maranura Cusco Peru LA2633 Huayopata Cusco Peru LA2635 Huayopata Cusco Peru LA2636 Sicre Cusco Peru LA2637 Sicre Cusco Peru LA2640 Molinopata Apurimac Peru LA2642 Molinopata Apurimac Peru LA2643 Bellavista Apurimac Peru LA2660 San Ignacio de Moxos Beni Bolivia LA2664 Yanahuana Puno Peru LA2665 San Juan del Oro Puno Peru LA2666 San Juan del Oro Puno Peru LA2667 Pajchani Puno Peru LA2668 Cruz Playa Puno Peru LA2669 Huayvaruni #1 Puno Peru LA2670* Huayvaruni #2 Puno Peru LA2671 San Juan del Oro, Escuela Puno Peru LA2673 Chuntopata Puno Peru LA2674 Huairurune Puno Peru LA2675* Casahuiri Puno Peru LA2683 Consuelo Cusco Peru LA2684 Patria Cusco Peru LA2685 Gavitana Madre de Dios Peru LA2686 Yunguyo Madre de Dios Peru LA2687 Mansilla Madre de Dios Peru LA2688* Santa Cruz, near Shintuyo #1 Madre de Dios Peru LA2689 Santa Cruz, near Shintuyo #2 Madre de Dios Peru LA2690 Atalaya Cusco Peru LA2691 Rio Pilcopata Cusco Peru LA2692 Pilcopata #1 Cusco Peru LA2693 Pilcopata #2 Cusco Peru LA2694 Aguasantas Cusco Peru LA2696 El Paramillo, La Union Valle Colombia LA2697 Mata de Cana, El Dovio Valle Colombia LA2698 La Esperanza de Belgica Valle Colombia LA2700 Aoti, Satipo Junin Peru LA2702 Kandy #1 Sri Lanka LA2703* Kandy #2 Sri Lanka LA2709* Bidadi, Bangalore Karnataka India LA2710* Porto Firme Brazil LA2782 El Volcan #1 - Pajarito Antioquia Colombia LA2783* El Volcan #2 - Titiribi Antioquia Colombia LA2784 La Queronte Antioquia Colombia LA2785 El Bosque Antioquia Colombia

L. esculentum var. cerasiforme cont’d LA2786 Andes #1 Antioquia Colombia LA2787 Andes #2 Antioquia Colombia LA2789 Canaveral Antioquia Colombia LA2790 Buenos Aires Antioquia Colombia LA2791 Rio Frio Antioquia Colombia LA2792 Tamesis Antioquia Colombia LA2793 La Mesa Antioquia Colombia LA2794 El Libano Antioquia Colombia LA2795 Camilo Antioquia Colombia LA2807 Taypiplaya Yungas Bolivia LA2811 Cerro Huayrapampa Apurimac Peru LA2814 Ccascani, Sandia Puno Peru LA2841 Chinuna Amazonas Peru LA2842 Santa Rita San Martin Peru LA2843 Moyobamba San Martin Peru LA2844 Shanhoa San Martin Peru LA2845* Mercado Moyobamba San Martin Peru LA2871* Chamaca Sud Yungas Bolivia LA2873 Lote Pablo Luna #2 Sud Yungas Bolivia LA2874 Playa Ancha Sud Yungas Bolivia LA2933 Jipijapa Manabi Ecuador LA2977 Belen Beni Bolivia LA2978 Belen Beni Bolivia LA3123 Santa Cruz: summit Galapagos Islands Ecuador LA3135 Pinal del Jigue Holguin Cuba LA3136 Arroyo Rico Holguin Cuba LA3137 Pinares de Mayari Holguin Cuba LA3138 El Quemada Holguin Cuba LA3139 San Pedro de Cananova Holguin Cuba LA3140 Los Platanos Holguin Cuba LA3141 Guira de Melena La Habana Cuba LA3158 Los Mochis Sinaloa Mexico LA3159 Los Mochis Sinaloa Mexico LA3160 Los Mochis Sinaloa Mexico LA3161 Los Mochis Sinaloa Mexico LA3162 N of Copan Honduras LA3452 CATIE, Turrialba Turrialba Costa Rica LA3623 Tablones Manabi Ecuador LA3633 Ghana LA3652 Matara Apurimac Peru LA3842 El Limon Aragua Venezuela LA3844 Algarrobito Guarico Venezuela LA4133 Oahu: Makapuu Beach Hawaii U.S.A L. hirsutum (78 accessions) LA0094 Canta-Yangas Lima Peru LA0361* Canta Lima Peru LA0386 Cajamarca Cajamarca Peru

L. hirsutum cont’d LA0387 Santa Apolonia Cajamarca Peru LA1033 Hacienda Taulis Lambayeque Peru LA1295 Surco Lima Peru LA1298 Yaso Lima Peru LA1347* Empalme Otusco La Libertad Peru LA1352 Rupe Cajamarca Peru LA1353* Contumaza Cajamarca Peru LA1354 Contumaza to Cascas Cajamarca Peru LA1361* Pariacoto Ancash Peru LA1362 Chacchan Ancash Peru LA1363* Alta Fortaleza Ancash Peru LA1366 Cajacay Ancash Peru LA1378 Navan Lima Peru LA1391 Bagua to Olmos Cajamarca Peru LA1392 Huaraz to Casma Ancash Peru LA1393 Caraz Ancash Peru LA1557 Rio Huara Lima Peru LA1559 Desvio Huamantanga Lima Peru LA1560* Matucana Lima Peru LA1648 Above Yaso Lima Peru LA1681 Mushka Lima Peru LA1691 Yauyos Lima Peru LA1695 Cacachuhuasin, Canete Lima Peru LA1696 Huanchuy-Cacra Lima Peru LA1717 Sopalache Piura Peru LA1718 Huancabamba Piura Peru LA1721* Ticrapo Viejo Huancavelica Peru LA1731* Rio San Juan Huancavelica Peru LA1736 Pucutay Piura Peru LA1737 Cashacoto Piura Peru LA1738 Desfiladero Piura Peru LA1739 W of Canchaque Piura Peru LA1740* W of Huancabamba Piura Peru LA1741 Sondorillo Piura Peru LA1753 Surco Lima Peru LA1764 W of Canta Lima Peru LA1772 W of Canta Lima Peru LA1775 Rio Casma Ancash Peru LA1777* Rio Casma Ancash Peru LA1778 Rio Casma Ancash Peru LA1779 Rio Casma Ancash Peru LA1918* Llauta Ica Peru LA1927 Ocobamba Ica Peru LA1928* Ocana Ica Peru LA1978 Colca Ancash Peru LA1980 Desvio Huambo Ancash Peru LA2155* Maydasbamba Cajamarca Peru LA2156 Ingenio Montan Cajamarca Peru

L. hirsutum cont’d LA2158* Rio Chotano Cajamarca Peru LA2159 Atonpampa Cajamarca Peru LA2167* Cementerio Cajamarca Cajamarca Peru LA2171 El Molino Piura Peru LA2196 Caclic Amazonas Peru LA2204* Balsapata Amazonas Peru LA2314 San Francisco Amazonas Peru LA2321 Chirico Amazonas Peru LA2324 Leimebamba Amazonas Peru LA2329* Aricapampa La Libertad Peru LA2409* Miraflores Lima Peru LA2552 Las Flores Cajamarca Peru LA2556 Puente Moche La Libertad Peru LA2567 Quita Ancash Peru LA2574 Cullaspungro Ancash Peru LA2648 Santo Domingo Piura Peru LA2650* Ayabaca Piura Peru LA2651 Puente Tordopa Piura Peru LA2722 Puente Auca Lima Peru LA2812 Lambayeque Lambayeque Peru LA2975 Coltao Ancash Peru LA2976 Huangra Ancash Peru LA3794 Alta Fortaleza Ancash Peru LA3796 Anca, Marca Ancash Peru LA3854 Llaguen Chicama Peru LA4137 Barrio Delta, Cajamarca Cajamarca Peru L. hirsutum f. glabratum (41 accessions) LA0407* Mirador, Guayaquil Guayas Ecuador LA1223* Alausi Chimborazo Ecuador LA1252 Loja Loja Ecuador LA1253 Pueblo Nuevo-Landangue Loja Ecuador LA1255 Pedistal Loja Ecuador LA1264 Bucay Chimborazo Ecuador LA1265 Rio Chimbo Chimborazo Ecuador LA1266* Pallatanga Chimborazo Ecuador LA1624* Jipijapa Manabi Ecuador LA1625 S of Jipijapa Manabi Ecuador LA2092 Chinuko Chimborazo Ecuador LA2098* Sabianga Loja Ecuador LA2099 Sabianga to Sozorango Loja Ecuador LA2100 Sozorango Loja Ecuador LA2101 Cariamanga Loja Ecuador LA2103* Lansaca Loja Ecuador LA2104 Pena Negra Loja Ecuador LA2105 Jardin Botanico, Loja Loja Ecuador LA2106 Yambra Loja Ecuador L. hirsutum f. glabratum cont’d LA2107 Los Lirios Loja Ecuador LA2108 Anganumo Loja Ecuador LA2109* Yangana #1 Loja Ecuador LA2110 Yangana #2 Loja Ecuador LA2114 San Juan Loja Ecuador

LA2115 Pucala Loja Ecuador LA2116 Las Juntas Loja Ecuador LA2119* Saraguro Loja Ecuador LA2124 Cumbaratza Zamora-Chinchipe Ecuador LA2128* Zumbi Zamora-Chinchipe Ecuador LA2144 Chanchan Chimborazo Ecuador LA2174* Rio Chinchipe Cajamarca Peru LA2175 Timbaruca Cajamarca Peru LA2855 Mollinomuna Loja Ecuador LA2860* Cariamanga Loja Ecuador LA2861 Las Juntas Loja Ecuador LA2863 Macara Loja Ecuador LA2864 Sozorango Loja Ecuador LA2869 Matola-La Toma Loja Ecuador LA3862 Purunuma Loja Ecuador LA3863 Sozoranga Loja Ecuador LA3864 Yangana Loja Ecuador L. parviflorum (53 accessions) LA0247* Chavinillo Huanuco Peru LA0735 Huanuco-Cerro de Pasco Huanuco Peru LA1319 Abancay Apurimac Peru LA1321 Curahuasi Apurimac Peru LA1322* Limatambo Cusco Peru LA1326 Rio Pachachaca Apurimac Peru LA1329* Yaca Apurimac Peru LA1626A* Mouth of Rio Rupac Ancash Peru LA1716* Huancabamba Piura Peru LA2072 Huanuco Huanuco Peru LA2073 Huanuco, N of San Rafael Huanuco Peru LA2074 Huanuco Huanuco Peru LA2075 Huanuco Huanuco Peru LA2113* La Toma Loja Ecuador LA2133* Ona Azuay Ecuador LA2190* Tialango Amazonas Peru LA2191 Campamento Ingenio Amazonas Peru LA2192 Pedro Ruiz Amazonas Peru LA2193 Churuja Amazonas Peru LA2194 Chachapoyas West Amazonas Peru LA2195 Caclic Amazonas Peru LA2197 Luya Amazonas Peru LA2198 Chachapoyas East Amazonas Peru LA2200* Choipiaco Amazonas Peru

LA2201 Pipus Amazonas Peru LA2202 Tingobamba Amazonas Peru LA2315 Sargento Amazonas Peru LA2317 Zuta Amazonas Peru LA2318 Lima Tambo Amazonas Peru LA2319* Chirico Amazonas Peru LA2325* Above Balsas Amazonas Peru LA2403 Wandobamba Huanuco Peru LA2613 Matichico-San Rafael Huanuco Peru LA2614 San Rafael Huanuco Peru LA2615 Ayancocho Huanuco Peru LA2639A Cunyac-Curahuasi Apurimac Peru LA2641 Nacchera-Abancay Apurimac Peru LA2727 Ona Azuay Ecuador LA2847 Suyubamba Amazonas Peru LA2848 W of Pedro Ruiz Amazonas Peru LA2862 Saraguro-Cuenca Azuay Ecuador LA2865 Rio Leon Azuay Ecuador LA2913 Uchucyaco - Hujainillo Huanuco Peru LA2917* Chullchaca Ancash Peru LA3651 Matara Apurimac Peru LA3655 Casinchigua-Chacache Apurimac Peru LA3657 Casinchigua-Pichirhua Apurimac Peru LA3660 Murashaya Apurimac Peru LA3793 Huariaca to San Rafael Huanuco Peru LA4020 Gonozabal Loja Ecuador LA4021 Guancarcucho Azuay Ecuador LA4022 Pueblo Nuevo Azuay Ecuador LA4023 Paute Azuay Ecuador L. pennellii (40 accessions) LA0716* Atico Arequipa Peru LA0751 Sisacaya Lima Peru LA1272* Pisaquera Lima Peru LA1273 Cayan Lima Peru LA1275 Quilca road junction Lima Peru LA1277* Trapiche Lima Peru LA1282* Sisacaya Lima Peru LA1297 Pucara Lima Peru LA1299 Santa Rosa de Quives Lima Peru LA1303 Pampano Huancavelica Peru LA1340* Capillucas Lima Peru LA1356 Moro Ancash Peru LA1367* Santa Eulalia Lima Peru LA1376 Sayan Lima Peru LA1515 Sayan to Churin Lima Peru LA1522* Quintay Lima Peru LA1649 Molina (El Ingenio valley) Ica Peru

LA1656* Marca to Chincha Ica Peru LA1657 Buena Vista to Yautan Ancash Peru LA1674* Toparilla Canyon Lima Peru LA1693 Quebrada Machurango Lima Peru LA1724 La Quinga Ica Peru LA1732* Rio San Juan Huancavelica Peru LA1733 Rio Canete, Km 75 Lima Peru LA1734 Rio Canete, Km 85 Lima Peru LA1735 Rio Canete, Km 87 Lima Peru LA1809 El Horador Piura Peru LA1940 Rio Atico, Km 26 Arequipa Peru LA1941 Rio Atico, Km 41 Arequipa Peru LA1942 Rio Atico, Km 54 Arequipa Peru LA1943 Rio Atico, Km 61 Arequipa Peru LA1946* Caraveli Arequipa Peru LA2560* Santa-Huaraz Ancash Peru LA2580* Valle de Casma Ancash Peru LA2657 Bayovar Piura Peru LA2963* Acoy Arequipa Peru LA3635 Omas Lima Peru LA3788 Rio Atico, Km 10 Arequipa Peru LA3789 Rio Atico, Km 26 Arequipa Peru LA3791 Caraveli Arequipa Peru L. pennellii var. puberulum (8 accessions) LA0750 Ica to Nazca Ica Peru LA1302* Quita Sol Ica Peru LA1911 Locari Ica Peru LA1912 Cerro Locari Ica Peru LA1920* Cachiruma Ayacucho Peru LA1926 Agua Perdida Ica Peru LA3665 Rio Santa Cruz Ica Peru LA3778 Palpa to Nazca Ica Peru L. peruvianum (156 accessions) LA0098 Chilca Lima Peru LA0103* Cajamarquilla Lima Peru LA0107* Hacienda San Isidro Lima Peru LA0110 Cajacay Ancash Peru LA0111 Supe Lima Peru LA0153* Culebras Ancash Peru LA0370 Hacienda Huampani Lima Peru LA0371 Supe Lima Peru LA0372 Culebras #1 Ancash Peru LA0374 Culebras #2 Ancash Peru LA0378 Cascas Cajamarca Peru LA0392 Llallan Cajamarca Peru

L. peruvianum cont’d LA0441* Cerro Campana La Libertad Peru LA0444* Chincha #1 Ica Peru LA0445 Chincha #2 Ica Peru LA0446* Atiquipa Arequipa Peru LA0448 Chala Arequipa Peru LA0451 Arequipa Arequipa Peru LA0453 Yura Arequipa Peru LA0454 Tambo Arequipa Peru LA0455 Tambo Arequipa Peru LA0462 Sobraya Tarapaca Chile LA0464 Hacienda Rosario Tarapaca Chile LA0752* Sisacaya Lima Peru LA1027 Cajamarca Peru LA1031 Balsas Amazonas Peru LA1032 Aricapampa La Libertad Peru LA1133 Huachipa Lima Peru LA1161 Huachipa Lima Peru LA1270 Pisiquillo Lima Peru LA1271 Horcon Lima Peru LA1274* Pacaibamba Lima Peru LA1278 Trapiche Lima Peru LA1281 Sisacaya Lima Peru LA1300 Santa Rosa de Quives Lima Peru LA1304 Pampano Huancavelica Peru LA1305* Ticrapo Huancavelica Peru LA1331* Nazca Ica Peru LA1333 Loma Camana Arequipa Peru LA1336* Atico Arequipa Peru LA1337 Atiquipa Arequipa Peru LA1339* Capillucas Lima Peru LA1346* Casmiche La Libertad Peru LA1350 Chauna Cajamarca Peru LA1351 Rupe Cajamarca Peru LA1358 Yautan Ancash Peru LA1360* Pariacoto Ancash Peru LA1364* Alta Fortaleza Ancash Peru LA1365* Caranquilloc Ancash Peru LA1368 San Jose de Palla Lima Peru LA1369 San Geronimo Lima Peru LA1373 Asia Lima Peru LA1377 Navan Lima Peru LA1379 Caujul Lima Peru LA1394 Balsas Amazonas Peru LA1395 Chachapoyas Amazonas Peru LA1396 Balsas (Chachapoyas) Amazonas Peru LA1473 Callahuanca, Santa Eulalia Lima Peru LA1474* Lomas de Camana Arequipa Peru LA1475 Fundo 'Los Anitos' Lima Peru

L. peruvianum cont’d LA1513 Atiquipa Arequipa Peru LA1517 Irrigacion Santa Rosa Lima Peru LA1537 (self-fertile selection) LA1554 Huaral to Cerro de Pasco Lima Peru LA1556 Hacienda Higuereto Lima Peru LA1609 Asia - El Pinon Lima Peru LA1616 La Molina, La Rinconada Lima Peru LA1626* Mouth of Rio Rupac Ancash Peru LA1647* Huadquina, Topara Ica Peru LA1653 Uchumayo, Arequipa Arequipa Peru LA1675 Toparilla Canyon Lima Peru LA1677* Fundo Huadquina to Topara Lima Peru LA1692 Putinza Lima Peru LA1694 Cacachuhuasin Lima Peru LA1708* Chamaya to Jaen Cajamarca Peru LA1744 Putinza Lima Peru LA1910* Tambillo Huancavelica Peru LA1913 Tinguiayog Ica Peru LA1929 La Yapana Ica Peru LA1935 Lomas de Atiquipa Arequipa Peru LA1937* Quebrada Torrecillas Arequipa Peru LA1944 Rio Atico Arequipa Peru LA1945* Caraveli Arequipa Peru LA1947 Puerto Atico Arequipa Peru LA1949 Las Calaveritas Arequipa Peru LA1951 Ocona Arequipa Peru LA1954* Mollendo Arequipa Peru LA1955 Matarani Arequipa Peru LA1973* Yura Arequipa Peru LA1975 Desvio Santo Domingo Lima Peru LA1977 Orcocoto Lima Peru LA1981 Vocatoma Ancash Peru LA1982* Huallanca Ancash Peru LA1983 Rio Manta Ancash Peru LA1984* Otuzco La Libertad Peru LA1985 Casmiche La Libertad Peru LA1989 (self-fertile, bilaterally compat. with L. esculentum) LA2068 Chasquitambo Ancash Peru LA2157 Tunel Chotano Cajamarca Peru LA2163* Cochabamba to Yamaluc Cajamarca Peru LA2164 Yamaluc Cajamarca Peru LA2172* Cuyca Cajamarca Peru LA2185* Pongo de Rentema Amazonas Peru LA2326* Above Balsas Amazonas Peru LA2327 Aguas Calientes Cajamarca Peru LA2328* Aricapampa La Libertad Peru LA2330 Chagual La Libertad Peru LA2331 Agallapampa La Libertad Peru

L. peruvianum cont’d LA2333 Casmiche La Libertad Peru LA2388 Cochabamba to Huambos Cajamarca Peru LA2553* Balconcillo de San Marcos Cajamarca Peru LA2555 Mariscal Castilla La Libertad Peru LA2561 Huallanca Ancash Peru LA2562 Huallanca Ancash Peru LA2563 Canon del Pato Ancash Peru LA2565 Potrero de Pomacocha Ancash Peru LA2566 Pomacocha-Llamellin, Rio Poscha Ancash Peru LA2573 Valle de Casma Ancash Peru LA2575 Valle de Casma Ancash Peru LA2581 Chacarilla (4x) Tarapaca Chile LA2717 Chilca Lima Peru LA2721 Putinza Lima Peru LA2724 Huaynilla Lima Peru LA2732* Moquella Tarapaca Chile LA2742 Camarones-Guancarane Tarapaca Chile LA2744* Sobraya (Azapa) Tarapaca Chile LA2745 Pan de Azucar (Azapa) Tarapaca Chile LA2770 Lluta Tarapaca Chile LA2808* Huaylas Ancash Peru LA2809 Huaylas Ancash Peru LA2834 Hacienda Asiento Ica Peru LA2959 Chaca-Vitor Tarapaca Chile LA2962 Echancay Arequipa Peru LA2964 Quebrada de Burros Tacna Peru LA2981B Torata to Chilligua Moquegua Peru LA3154 Otora - Puente Jahuay Moquegua Peru LA3156 Omate Valley Moquegua Peru LA3218 Quebrada Guerrero Arequipa Peru LA3219 Catarindo Arequipa Peru LA3220 Cocachacra -Quebrada Cachendo Arequipa Peru LA3636 Coayllo Lima Peru LA3637 Coayllo Lima Peru LA3639 Ccatac Lima Peru LA3640 Mexico City Mexico LA3664 Nazca grade Ica Peru LA3666 La Yapa Ica Peru LA3781 Quebrada Oscollo Arequipa Peru LA3787 Alta Chaparra Arequipa Peru LA3790 Caraveli Arequipa Peru LA3795 Alta Fortaleza Ancash Peru LA3797 Anca, Marca Ancash Peru LA3799 Río Pativilca Ancash Peru LA3853 Mollepampa La Libertad Peru LA3858 Canta Lima Peru LA3900 (CMV tolerant selection) LA4125 Camina Tarapaca Chile

L. peruvianum f. glandulosum (13 accessions) LA0364 9 Km W of Canta Lima Peru LA0366 12 Km W of Canta Lima Peru LA1283 Santa Cruz de Laya Lima Peru LA1284 Espiritu Santo Lima Peru LA1292* San Mateo Lima Peru LA1293 Matucana Lima Peru LA1294 Surco Lima Peru LA1296 Tornamesa Lima Peru LA1551 Rimac Valley, Km 71 Lima Peru LA1552 Rimac Valley, Km 93 Lima Peru LA1646 Yaso Lima Peru LA1722 Ticrapo Viejo Huancavelica Peru LA1723 La Quinga Ica Peru L. peruvianum var. humifusum (11 accessions) LA0385 San Juan Cajamarca Peru LA0389 Abra Gavilan Cajamarca Peru LA2150 Puente Muyuno Cajamarca Peru LA2151 Morochupa Cajamarca Peru LA2152* San Juan #1 Cajamarca Peru LA2153 San Juan #2 Cajamarca Peru LA2334 San Juan Cajamarca Peru LA2548 La Muyuna Cajamarca Peru LA2550 El Tingo, Chorpampa Cajamarca Peru LA2582 San Juan (4x) Cajamarca Peru LA2583 (4x) L. pimpinellifolium (248 accessions) LA0100 La Cantuta Lima Peru LA0114 Pacasmayo La Libertad Peru LA0121 Trujillo La Libertad Peru LA0122 Poroto La Libertad Peru LA0369 La Cantuta Lima Peru LA0373* Culebras #1 Ancash Peru LA0375 Culebras #2 Ancash Peru LA0376 Chiclin La Libertad Peru LA0381 Pongo La Libertad Peru LA0384 Chilete Cajamarca Peru LA0391 Magdalena Cajamarca Peru LA0397 Hacienda Tuman Lambayeque Peru LA0398 Hacienda Carrizal Piura Peru LA0400* Hacienda Buenos Aires Piura Peru LA0411* Pichilingue Los Rios Ecuador LA0412 Pichilingue Los Rios Ecuador LA0413 Cerecita Guayas Ecuador LA0417* Puna Guayas Ecuador

L. pimpinellifolium cont’d LA0418 Daule Guayas Ecuador LA0420 El Empalme Guayas Ecuador LA0442* Sechin Ancash Peru LA0443 Pichilingue Los Rios Ecuador LA0480 Hacienda Santa Inez Ica Peru LA0722 Trujillo La Libertad Peru LA0753 Lurin Lima Peru LA1236 Tinelandia, Santo Domingo Pichincha Ecuador LA1237* Atacames Esmeraldas Ecuador LA1242 Los Sapos Guayas Ecuador LA1243 Co-op Carmela Guayas Ecuador LA1245* Santa Rosa El Oro Ecuador LA1246* La Toma Loja Ecuador LA1248 Hacienda Monterrey Loja Ecuador LA1256 Naranjal Guayas Ecuador LA1257 Las Mercedes Guayas Ecuador LA1258 Voluntario de Dios Guayas Ecuador LA1259 Catarama Los Rios Ecuador LA1260 Pueblo Viejo Los Rios Ecuador LA1261* Babahoyo Los Rios Ecuador LA1262 Milagro Empalme Guayas Ecuador LA1263 Barranco Chico Guayas Ecuador LA1269 Pisiquillo Lima Peru LA1279* Cieneguilla Lima Peru LA1280 Chontay Lima Peru LA1301* Hacienda San Ignacio Ica Peru LA1332 Nazca Ica Peru LA1335* Pescaderos Arequipa Peru LA1341 Huampani Lima Peru LA1342 Casma Ancash Peru LA1343 Puente Chao La Libertad Peru LA1344 Laredo La Libertad Peru LA1345 Samne La Libertad Peru LA1348 Pacasmayo La Libertad Peru LA1349 Cuculi Lambayeque Peru LA1355 Nepena Ancash Peru LA1357 Jimbe Ancash Peru LA1359 La Crau Ancash Peru LA1370 San Jose de Palla Lima Peru LA1371* Santa Eulalia Lima Peru LA1374 Ingenio Ica Peru LA1375* San Vicente de Canete Lima Peru LA1380 Chanchape Piura Peru LA1381 Naupe Piura Peru LA1382 Chachapoyas-Balsas Amazonas Peru LA1383 Chachapoyas-Bagua Amazonas Peru LA1384 Quebrada Parca (Chilca) Lima Peru LA1416 Las Delicias Pichincha Ecuador

L. pimpinellifolium cont’d LA1466 Chongoyape Lambayeque Peru LA1469 El Pilar, Olmos Lambayeque Peru LA1470 Motupe to Desvio Olmos - Bagua Lambayeque Peru LA1471 Motupe to Jayanca Lambayeque Peru LA1472 Quebrada Topara Lima Peru LA1478* Santo Tome (Pabur) Piura Peru LA1514 Huaura-Sayan-Churin Lima Peru LA1519 Vitarte Lima Peru LA1520 Huaura-Sayan-Churin Lima Peru LA1521* El Pinon, Asia Lima Peru LA1547* Chota to El Angel Carchi Ecuador LA1561 San Eusebio Lima Peru LA1562 Cieneguilla Lima Peru LA1571 San Jose de Palle Lima Peru LA1572 Hacienda Huampani Lima Peru LA1573 Nana Lima Peru LA1575 Huaycan Lima Peru LA1576* Manchay Alta Lima Peru LA1577 Cartavio La Libertad Peru LA1578* Santa Marta La Libertad Peru LA1579 Colegio Punto Cuatro #1 Lambayeque Peru LA1580 Colegio Punto Cuatro #2 Lambayeque Peru LA1581 Punto Cuatro Lambayeque Peru LA1582* Motupe Lambayeque Peru LA1583 Tierra de la Vieja Lambayeque Peru LA1584* Jayanca to La Vina Lambayeque Peru LA1585 Cuculi Lambayeque Peru LA1586* Zana, San Nicolas La Libertad Peru LA1587 San Pedro de Lloc La Libertad Peru LA1588 Laredo to Barraza La Libertad Peru LA1589 Viru to Galunga La Libertad Peru LA1590* Viru to Tomaval La Libertad Peru LA1591 Ascope La Libertad Peru LA1592 Moche La Libertad Peru LA1593* Puente Chao La Libertad Peru LA1594 Cerro Sechin Ancash Peru LA1595 Nepena to Samanco Ancash Peru LA1596 Santa to La Rinconada Ancash Peru LA1597 Rio Casma Ancash Peru LA1598 Culebras to La Victoria Ancash Peru LA1599* Huarmey Ancash Peru LA1600 Las Zorras Ancash Peru LA1601 La Providencia Ancash Peru LA1602* Rio Chillon to Punchauca Lima Peru LA1603 Quilca Lima Peru LA1604 Horcon Lima Peru LA1605 Canete - San Antonio Lima Peru LA1606* Tambo de Mora Ica Peru

L. pimpinellifolium cont’d LA1607 Canete - La Victoria Lima Peru LA1608 Canete - San Luis Lima Peru LA1610 Asia - El Pinon Lima Peru LA1611 Rio Mala Lima Peru LA1612 Rio Chilca Lima Peru LA1613 Santa Eusebia Lima Peru LA1614 Pampa Chumbes Lima Peru LA1615 Piura to Simbala Piura Peru LA1617* Tumbes South Tumbes Peru LA1618 Tumbes North Tumbes Peru LA1628 Huanchaco La Libertad Peru LA1629 Miraflores to Costa Verde Lima Peru LA1630 Fundo La Palma Ica Peru LA1631 Planta Envasadora San Fernando La Libertad Peru LA1633 Co-op Huayna Capac Ica Peru LA1634 Fundo Bogotalla #1 Ica Peru LA1635 Fundo Bogotalla #2 Ica Peru LA1636 Laran Ica Peru LA1637 La Calera Ica Peru LA1638 Fundo El Portillo Lima Peru LA1645 Miraflores to Quebrada Armendariz Lima Peru LA1651 La Molina Lima Peru LA1652 Cienguilla Lima Peru LA1659* Pariacoto Ancash Peru LA1660 Yautan to Pariacoto Ancash Peru LA1661 Esquina de Asia Lima Peru LA1670 Rio Sama Tacna Peru LA1676 Fundo Huadquina to Topara Ica Peru LA1678 San Juan Lucumo de Topara Ica Peru LA1679 Tambo de Mora Ica Peru LA1680 La Encanada Lima Peru LA1682 Montalban Lima Peru LA1683* Miramar Piura Peru LA1684 Chulucanas Piura Peru LA1685 Marcavelica Piura Peru LA1686 Valle Hermosa #1 Piura Peru LA1687 Valle Hermoso #2 Piura Peru LA1688 Pedregal Piura Peru LA1689* Piura, Castilla #1 Piura Peru LA1690 Piura, Castilla #2 Piura Peru LA1697 Hacienda Santa Anita Lima Peru LA1719 East of Arenillas El Oro Ecuador LA1720 Yautan Ancash Peru LA1728 Rio San Juan Ica Peru LA1729 Rio San Juan Ica Peru LA1742 Olmos - Marquina Lambayeque Peru LA1781 Bahia de Caraquez Manabi Ecuador LA1921 Majarena Ica Peru

L. pimpinellifolium cont’d LA1923 Cabildo Ica Peru LA1924* Piedras Gordas Ica Peru LA1925 Pangaravi Ica Peru LA1933 Jaqui Arequipa Peru LA1936 Huancalpa Arequipa Peru LA1950 Pescadores Arequipa Peru LA1987 Viru-Fundo Luis Enrique La Libertad Peru LA1992 Pishicato Lima Peru LA1993 Chicama Valley (?) Lima Peru LA2093 La Union El Oro Ecuador LA2096 Playa Loja Ecuador LA2097 Macara Loja Ecuador LA2102* El Lucero Loja Ecuador LA2112 Hacienda Monterrey Loja Ecuador LA2145 Juan Montalvo Los Rios Ecuador LA2146 Limoncarro Lambayeque Peru LA2147 Yube Lambayeque Peru LA2149 Puente Muyuno Cajamarca Peru LA2170 Pai Pai Lambayeque Peru LA2173* Cruz de Huaiquillo Cajamarca Peru LA2176 Timbaruca Cajamarca Peru LA2178 Tororume Cajamarca Peru LA2179 Tamboripa-La Manga Cajamarca Peru LA2180 La Coipa Cajamarca Peru LA2181* Balsa Huaico Cajamarca Peru LA2182 Cumba Amazonas Peru LA2183* Corral Quemado Amazonas Peru LA2184 Bagua Amazonas Peru LA2186 El Salao Amazonas Peru LA2187 La Caldera Amazonas Peru LA2188 Machugal #1 Amazonas Peru LA2189 Machugal #2 Amazonas Peru LA2335 (4x) LA2340 (4x) LA2345 (autodiploid) LA2346 (autodiploid) LA2347 (autodiploid) LA2348 (l, x) LA2389 Tembladera Cajamarca Peru LA2390 Chungal Cajamarca Peru LA2391 Chungal to Monte Grande Cajamarca Peru LA2401* Moxeque Ancash Peru LA2412 Fundo Don Javier, Chilca Lima Peru LA2533* Lomas de Latillo Lima Peru LA2576 Valle de Casma Ancash Peru LA2578 Tuturo Ancash Peru LA2585 (4x) LA2645 Desvio Chulucanas-Morropon Piura Peru

L. pimpinellifolium cont’d LA2646 Chalaco Piura Peru LA2647 Morropon-Chalaco Piura Peru LA2652 Sullana Piura Peru LA2653 San Francisco de Chocan Piura Peru LA2655 La Huaca to Sullana Piura Peru LA2656 Suarez Tumbes Peru LA2659 Campus of U.N. de Piura Piura Peru LA2718 Chilca Lima Peru LA2725 Tambo Colorado Ica Peru LA2831 Rio Nazca Ica Peru LA2832 Chichictara Ica Peru LA2833 Hacienda Asiento Ica Peru LA2836 Fundo Pongo Ica Peru LA2839 Tialango Amazonas Peru LA2840 Santa Hilarion de Tomaque Amazonas Peru LA2850 Santa Rosa Manabi Ecuador LA2851 Carcel Montecristi Manabi Ecuador LA2852* Cirsto Rey de Charapoto Manabi Ecuador LA2853 Experiment Station, Portoviejo Manabi Ecuador LA2854 Jipijapa Manabi Ecuador LA2857 Isabela: Villamil Galapagos Islands Ecuador LA2866 Via a Amaluza Loja Ecuador LA2914A La Castellana Lima Peru LA2914B La Castellana Lima Peru LA2915 Remanso de Olmos Lambayeque Peru LA2966 La Molina Lima Peru LA2974 Huaca del Sol La Libertad Peru LA2982 Chilca #1 Lima Peru LA2983 Chilca #2 Lima Peru LA3468 La Molina Vieja Lima Peru LA3634 Santa Rosa de Asia Lima Peru LA3638 Ccatac Lima Peru LA3798 Río Pativilca Ancash Peru LA3852 Atinchik, Pachacamac Lima Peru LA3859 (TYLCV resistand selection) LA3910 Santa Cruz: near tortoise preserve Galápagos Is. Ecuador LA4026 Olmos – Jaen Road Lambayeque Peru LA4138 El Corregidor, La Molina Lima Peru S. juglandifolium (8 accessions) LA2120 Sabanilla Zamora-Chinchipe Ecuador LA2134 Tinajillas Zamora-Chinchipe Ecuador LA2788 Quebrada la Buena Antioquia Colombia LA3322 Quito Pinchincha Ecuador LA3323 Manuel Cornejo Astorga Ecuador LA3324 Sabanillas Ecuador LA3325 Cordillera de los Huacamayos Morona Santiago Ecuador LA3326 San Ysidro de Yungilla Chimborazo Ecuador

S. lycopersicoides (20 accessions) LA1964 Chupapalca Tacna Peru LA1966 Palca Tacna Peru LA1990 Palca Tacna Peru LA2385 Chupapalca to Ingenio Tacna Peru LA2386 Chupapalca Tacna Peru LA2387 Lago Aricota Tacna Peru LA2407 Arica-Putre Tarapaca Chile LA2408 Above Putre Tarapaca Chile LA2730 Moquella Tarapaca Chile LA2772 Zapahuira Tarapaca Chile LA2776 Catarata Perquejeque Tarapaca Chile LA2777 Putre Tarapaca Chile LA2781 Desvio a Putre Tarapaca Chile LA2951 Quistagama Tarapaca Chile LA4018 Lago Aricota Tacna Peru LA4019 Causiri Tacna Peru LA4123 Camina Tarapaca Chile LA4126 Camina to Nama Tarapaca Chile LA4130 Pachica (Rio Camarones) Tarapaca Chile LA4131 Esquina Tarapaca Chile S. ochranthum (9 accessions) LA2118 San Lucas Loja Ecuador LA2160 Acunac Cajamarca Peru LA2161 Cruz Roja Cajamarca Peru LA2162 Yatun Cajamarca Peru LA2166 Rocoto-Pacopampa Cajamarca Peru LA2682 Chinchaypujio Cusco Peru LA3647 Chinchaypujio Cusco Peru LA3649 Curpahuasi – Pacaipampa Apurimac Peru LA3650 Choquemaray Apurimac Peru S. sitiens (11 accessions) LA1974 Chuquicamata Antofagasta Chile LA2876 Chuquicamata Antofagasta Chile LA2877 El Crucero Antofagasta Chile LA2878 Mina La Exotica Antofagasta Chile LA2885 Caracoles Antofagasta Chile LA4105 Mina La Escondida Antofagasta Chile LA4110 Mina San Juan Antofagasta Chile LA4112 Aguada Limon Verde Antofagasta Chile LA4113 Estacion Cere Antofagasta Chile LA4114 Pampa Carbonatera Antofagasta Chile LA4115 Quebrada Cerro Oeste de Paqui Antofagasta Chile *member of core collection

Membership List Aarden, Harriette, Western Seed International BV, Burgemeester Elsenweg 53, Room 106,

2671 DP Naaldwijk, The Netherlands, harriettea@westernseed.nlAdams, Dawn, Campbell R&D, 28065 County Road 104, Davis, CA 95616,

dawn_adams@campbellsoup.comAlvarez, Marta, Instituto Nacional de Ciencias Agricolas (INCA), Gaveta Postal 1, 32700 San

Jose de las Lajas, La Habana, CUBA, malvarez@inca.edu.cuAugustine, Jim, BHN Research, 16750 Bonita Beach Rd., Bonita Springs, FL 34135,

jaugustine@bhnseed.comBaas, Jeroen, PDS Executive, East West Seed Co. Ltd, 50/1 Moo 2 Sainoi-Bangbuathong Rd.

Saonoi, Nonthaburi 11150, Thailand, jeroen.th@eastwestseed.co.th Bar, Moshe, Zeraim Gedera Ltd, Seed Company, POB 103, Gedera 70750, ISRAEL,

moshe@zeraim.co.ilBarker, Susan, University of Western Australia, School of Plant Biology MO84, 35 Stirling

Highway, Crawley 6009, W.Australia, AUSTRALIA, sbarker@agric.uwa.edu.auBeck Bunn, Teresa, Seminis Vegetable Seeds, 37437 State Highway 16, Woodland, CA

95695, teresa.beck.bunn@svseeds.comBergamini, Leopoldo, ESASEM SPA., Via San Biagio 25, 37052 CASALEONE VR, ITALY,

LBergamini@esasem.comBessey, Paul, 2602 E. Arroyo Chico, Tucson, AZ 85716, pbessey@flash.netBistra, Atanassova, Institute of Genetics, Sofia 1113, BULGARIA, bistra_a@yahoo.comBontems, Sylvain, Syngenta Seeds, Domaine du Moulin, 84360 Sarrains, FRANCE Bosveld, Paul, H. J. Heinz Co. of Canada, Erie Street South, Leamington, ONTARIO N8H 3W8,

paul.bosveld@hjheinz.comBowler, Chris, Stazione Zooligica, Molecular Plant Biology, Villa Communale, I 80121 Napoli,

ITALY, chris@alpha.szn.itBurdick, Allan, 3000 Woodkirk Drive, Columbia, MO 65203 Carrijo, Iedo Valentim, Rua João Ângelo do Pinho 77 Apto 102, 32.510-040 Betim MG, Brazil

iedovc@uai.com.br Causse, Mathilde, Station d’Amelioration des Plantes Maraicheres, BP94, 84143 Montfavet

Cedex, FRANCE Chetelat, Roger, Univ. Calif., Dept. Veg Crops, One Shields Ave., Davis, CA 95616,

chetelat@ucdavis.eduCirulli, Matteo, Universita degli Studi di Bari, Dipartimento di Biol. E Patologia Veget., Via

Amendola 165-A, 70126 Bari, ITALY, bibpatve@agr.uniba.itCrill, Pat, 308 Manatee Dr., Ruskin, FL 33570-5629, patcrill@aol.comCuartero, Jesus, C.S.I.C., Estacion Exp. "La Mayora", 29750 Algarrobo-Costa (Malaga), SPAIN Darrigues, Audrey, The Ohio State University, OARDC, 208 Williams Hall, Wooster, OH 44691 Della Vecchia, Paulo, Agroflora, Caixa Postal 427, Braganca Paulista - SP, 12.900-000

BRAZIL Dhaliwal, M.S., Department of Vegetable Crops, P.A.U. Ludhiana 141004, PANJAB, INDIA Dick, Jim, 23264 Mull Rd, RR 4, Chatham, ONT N7M 5J4, CANADA, jimdick@netrover.com

Dimaculangan, Dwight, Dept of Biology, 202 Life Sciences Building, Rock Hill, SC 29730

dimanculangad@winthrop.eduEgashira, Hiroaki, Yamagata University, Faculty of Agriculture, Wakaba-machi, Tsuruoka city

997-8799, JAPAN Eyberg, Dorothy, Seminis Vegetable Seeds, 4110 Enterprise Avenue, Suite #200, Naples, FL

34104, Dorothy.Eyberg@seminis.comFeitsma, Gertjan, East West Seed Company, Crop Breeding Manager Solanaceae, PO Box

9073, Baliwag 3006, Bulacan, PHILLIPINES, gertjan.ph@eastwestseed.comFellner, Martin, Inst. Of Expt. Botany, Academy of Sciences of the Czech Republic, Joint Lab of

Inst of Exp Botany and Faculty of Life Sciences Palacky University, Slechtitelu 11, Olomouc-Holice 78371, CZECH REPUBLIC, emfee@prfholnt.upol.cz

Fernandez-Munoz, Rafael, CSIC Estacion Exp. "La Mayora", 29750 Algarrabo, Costa (Malaga, Spain, rfern@eelm.csic.es

Foolad, Majid R., Penn State Univ, Dept. of Horticuture, 102 Tyson Bldg., University Park, PA 16802-4200, majid_foolad@agcs.psu.edu

Fowler, C. W., Seminis Vegetable Seeds, 4110 Enterprise Avenue, Suite #200, Naples, FL 34104, wayne.fowler@seminis.com

Frampton, Anna, Seminis Vegetable Seeds, 37437 State Highway 16, Woodland, CA 95695, anna.frampton@seminis.com

Frantz, James, Seminis Vegetable Seeds, PO Box 249, Felda, FL 33930 Gidoni, David, The Volcani Center, Dept. of Plant Genetics, PO Box 6, Bet-Dagan 50250,

ISRAEL Gilardón, Elsa, Sarmiento 674 7 piso depto 139, 4400 Salta, ARGENTINA,

gilardon@unsa.edu.arGuichard, Emmanuel, Clause Tezier, Documentation, Domaine de Maninet, Route de

Beaumont, 26000 Valence, France Hajbi, Meirav, Seeds Technologies DM LTD, Kefar Ruth 73169, ISRAEL Hayashi, Masako Yaguchi, Asahi Industries, Biol.Engineering Lab, 222 Watarase, Kamikawa,

Kodama-gun, Saitama-ken 367-0394, JAPAN, m.hayashi@asahi-kg.co.jpHerlaar, Frits, Enza Zaden, De Enkuizer Zaadhandel B.V., Postbus 7, 1600 AA Enkhuizen, THE

NETHERLANDS Hernandez, Jr., Ambrosio, Western Seed International SA, Apdo de Correos 22, 35240 Carrizal

Ingenio, Las Palmas, SPAIN, ambrosio@western-seed.comHimmel, Phyllis, Seminis Vegetable Seeds, 37437 State Highway 16, Woodland, CA 95695 Hoogstraten, Jaap, S.V.S Holland B.V., Postbus 97, 6700 AB Wageningen, THE

NETHERLANDS INRA Antilles Guyane, A456995001 I894 SDAR-Documentation, MME Marie-Laure Abinne,

Domaine Duclos, 97170 Petit-Bourg, GUADELOUPE FWI Iwasaki, Shunya, Sakata Seed Co., Kimitu Station, 358 Uchikoshi, Sodegaura,Chiba, 299-0217,

JAPAN, s-iwasaki@sakata-seed.co.jp Jacoby, Daniel, Kobernick House, 1957 N. Honore Ave., C215, Sarasota, FL 34235 Kedar, N., Hebrew Univ of Jerusalem, Faculty of Agriculture, P.O. Box 12, Rehovot 76-100,

ISRAEL, kedar@agri.huji.ag.ilKeyes, Carol, Maryville University, Biology Dept., 13550 Conway Rd., St. Louis, MO 63141 Kimiko, Takizawa, Japan Horticultural Production and Research Institute, 2-5-1 Kamishiki,

Matsudo-shi, Chiba 270-2221, JAPAN, takizawa@enken.or.jp

Liedl, Barbara, West Virginia State College, Dept of Biology, 129 Hamblin Hall, Institute, WV

25112-1000, liedlbe@mail.wvsc.eduLinde, David, BHN Research, 16750 Bonita Beach Rd., Bonita Springs, FL 34135,

dlinde@bhnseed.comLundin, Marianne, Svalof Weibull AB, Cereal Breeding Dept., S-268 81 Svalov, SWEDEN Maluf, Wilson Roberto, Universidade Federal de Lavras, Dept. de Agricultura, Caixa Postal 37,

CEP 37200-000 Lavras-MG, BRAZIL, wrmaluf@ufla.brMaxwell, Douglas P., Dept of Plant Pathology-Univ. of WI, Russell Laboratories, 1630 Linden

Drive, Madison, WI 53706-1598, doug@spindrifters.comMcGlasson, W. B., Univ of Western Sydney, Hawkesbury Campus, Building S8, Locked Bag

1797, Penrith South DC NSW 1797, AUSTRALIA, b.mcglasson@uws.edu.auMcGrath, D. J., Horticulture Research Station, P. O. Box 538, Bowen, Queensland 4805,

AUSTRALIA Mercier, Jean-Claude, Clause Tezier, Mas St. Pierre, 13210 Saint-Remy de Provence,

FRANCE Min, Chai, PO Box 2443, Beijing 100089, PEOPLES REPUBLIC of CHINA Mochizuki, Tatsuya, National Agricultural Research Center, for Kyushu Okinawa Region, Suya,

Nishigoshi, Kumamoto 861-1192, JAPAN, tmochi@affrc.go.jpNakamura, Kosuke, Kagome Co. Ltd., 17 Nishitomiyama, Nishinasuno Nasu, Tochigi Pref.329-

2762, JAPAN, Kosuke_Nakamura@kagome.co.jpOzminkowski, Richard, Heinz North America, Sr.Plant Breeder, P.O.Box 57, Stockton, CA

95201, rich.ozminkowski@husa.comPape, Greg, 1181 Trieste Dr., Hollister, CA 95023 Peters, Susan, Sunseeds, 7087 E. Peltier Rd., Acampo, CA 95220,

susan.peters@sunseeds.comPilowsky, Meir, Agricultural Research Organization, The Volcani Center, PO Box 6, Bet Dagan

50250, ISRAEL Rascle, Christine, Clause Tezier Centre de Recherche, Domaine de Maninet, Route de

Beaumont, 26000 Valence, FRANCE, christine.rascle@clausetezier.com Rekoslavskaya, Natalya I., Siberian Institute of Plant Physiology and Biochemistry, Siberian

Branch of RAS, PO Box 1243, Irkutsk, RUSSIA, phytolab@sifibr.irk.ru Reynaerts, Arlette, Plant Genetic Systems, J Plateaustraat 22, 9000 Gent, Belgium Ruiz Martinez, Juan Jose, Miguel Hernandez University, EPSO, Crtra. Beniel Km3,2, 03312

Orihuela (Alicante), SPAIN, juanj.ruiz@umh.esSasaki, Seiko, Plant Breeding Station of Kaneko Seeds, 50-12, Furuichi-machi 1-chome,

Maebashi City, Gunma 371-0844, JAPAN, oversea@kanekoseeds.co.jpSayama, Haruki, Nippon Del Monte Corp., Research and Development, 3748 Shimizu-Cho,

Numata,Gunma-ken 378-0016, JAPAN, hsayama@delmonte.co.jpScott, J.W., University of Florida, GCREC 5007 60th Street E., Bradenton, FL 34203,

jwsc@ifas.ufl.eduSchaareman, Rob, Syngenta Seeds, Blaker 7, 2678 L W De Lier, NETHERLANDS Serquen, Felix, Syngenta Seeds, 21435 Road 98, Woodland, CA 95695

Sharma, R.P., Department of Plant Sciences, School of Life Sciences, University of Hyderabad, HYDERABAD-500 046 INDIA, rpssl@uohyd.ernet.in Shimizu, Yoshitomi, Nagano Tomato Co. Ltd., 223 Yoshikawa Murai-Machi, Matsumoto,

Nagano, JAPAN

Shintaku, Yurie, 2-10-2, Shimizu, Suginami-ku, Tokyo 167-0033, JAPAN Smith, Dale, H. J. Heinz Co. of Canada, Erie Street South, Leamington, Ontario N8H 3W8,

CANADA, dale.smith@hjheinz.comStack, Stephen, Colorado State University, Department of Biology, Fort Collins, CO 80523-

1878, sstack@lamar.colostate.eduStevens, Mikel, Brigham Young Univ., 275 Widtsoe Bldg, PO. Box 25183, Provo, UT 84602,

mikel_stevens@byu.eduStoeva-Popova, Pravda, AgroBioInstitute, Bul. "Dragan Tsankov" No. 8, 1146 Sofia,

BULGARIA, pravda_stoeva@abi.bgStommel, John, USDA-ARS Vegetable Lab, Beltsville Ag. Res. Ctr., 10300 Baltimore Avenue,

Beltsville, MD 20705, stommelj@ba.ars.usda.govSuzuki, Tohru, NIVOT, Natl.Res.Inst.Veg,Orn Plant&Tea, Ano, Mie 5142392, JAPAN,

stohru@nivot.affrc.go.jpThomas, Paul, 4 Juniper Court, Woodland, CA 95695 Tikoo, Surendra K., Syngenta Seeds Co. Ltd., First Bank Head Office Bldg, 18th Floor, 100

Kongpyung-dong, Jongro-Ku, Seoul 110-702, KOREA, surendra.tikoo@syngenta.comVecchio, Franco, Sementi Nunhems s.r.l., Via Ghiarone,2, 40019 S.Agata Bolognese, ITALY,

franco.vecchio.@nunhems.comVerhoef, Ir. Ruud, Rijk Zwaan Breeding B.V., Burgemeester Crezeelaan 40, PO Box 40, 2678

ZG De Lier, THE NETHERLANDS, r.verhoef@rijkzwaan.nl Volin, Ray, Western Seed Americas, 15165 Dulzura Court, Rancho Murieta, CA 95683-9120,

RBV4TopSeed@worldnet.att.netWalley, Peter Glen, Genetic Improvement of Product Quality, Hort. Research International,

Wellesbourne, Warwick, CV35 9EF, UK, peter.walley@hri.ac.uk Zamir, Dani, Hebrew Univ of Jerusalem, Dept of Field Crops, POB 12, Rehovot, ISRAEL Zischke, Jeff, Sakata Seed America, 105 Boronda Rd, Salinas, CA 93907,

jzischke@sakata.com Libraries, Institutions, etc. Agraria Bologna, Universita Studi di Bologna, Biblioteca Centralizzata, Fac. Agraria/G.

Goidanich, via Fanin 40, 40127 Bologna, ITALY Albert R. Mann Library, Cornell University, Serials unit/Acq Div, Ithaca, NY 14853-4301 AVRDC Librarian, Information and Documentation, PO Box 42, Shanhua, Tainan, Taiwan 741,

Republic of China California Tomato Research Institute, Inc., 18650 E. Lone Tree Rd., Escalon, CA 95320-9759 Eastwestseed Vietnam, Xuan Thoi Thuong, Hoc Mon Dist., Ho Chi Minh City, Vietnam EE La Consulta-INTA, Biblioteca, Casilla de Correo 8, 5567 La Consulta-Mendoza, Argentina Frank A. Lee Library, New York State Agr. Expt. Sta., Cornell University, 630 W. North Street,

Geneva, NY 14456-0462, Indian Institute of Hort.Research, c/o.Schenker/Informatics, PO Box 306, Folcroft Indu Area,

Folcroft, PA 19032 INRA, GAFL, 219372/0040, Domaine Saint Maurice, BP 84, 84143 Montfavet Cedex, FRANCE

Instituto Murciano de Investigacion y Desarrollo Agrario y Alimentario (IMIDA), Biblioteca,

Apartado Oficial, 30150 La Alberca Murcia, SPAIN J.S. Gericke Library, P.O. Box 830661, Birmingham, AL 35283-0661 Library ARC, Roodeplaat Veg.&Ornamental, Plant Institute, Private Bag X293, Pretoria 0001,

SOUTH AFRICA North Carolina State University, Acquisitions Dept C, DH Hill Library, D. H. Hill Library, P.O. Box

7111, Raleigh, NC 27695-7111 Nunhems Zaden BV, PO Box 4005, 6080 AA Haelen, NETHERLANDS Serials Section, University of Iowa Libraries, 988925-1 (02), 100 Main Library, Iowa City, IA

52242 Serials Unit, Purdue University Libraries TSS, 504 W State St, West Lafayette, IN 47907-2058 TGRC, University of California, Vegetable Crops Dept, 1 Shields Avenue, Davis, CA 95616 U.S.D.A. Nat'l Agric. Library, Proc. Sec./Current Ser. Rec., Beltsville, MD 20705 University of California Riverside, Science Library, Technical Serv/Serials, P.O. Box 5900,

Riverside, CA 92517-5900 University of Minnesota, Magrath Library Serials Dept., 1984 Buford Avenue, St. Paul, MN

55108-1012 University of New Hampshire, Library-Serials Unit, 18 Library Way, Durham, NH 03824-3592 W.S.U. Library, SEA Serials Rec Holland Library, 100 Dairy Road, Pullman, WA 99164-5610 Young Library Serials-Ag 1ACA2875, Univ. of Kentucky, 500 S. Limestone, Lexington, KY

40506-0001

AUTHOR INDEX Alvarez, M., 48 Atanassova, B., 9 Balacheva, E., 9 Bartz, J.A., 50, 51 Bonomo, C., 19 Broglia, V., 19 Chepinoga, A.V., 36 Chetelat, R., 52 Collavino, G., 19 Cuartero, J., 34, 48 Dimaculangan, D., 16, 43 Fernández-Muñoz, R., 34, 48 Francis, D.M., 49 Frary, A., 22 García-Gusano, M., 12 García-Martínez, S., 12 Gardner, R.G., 22 Gianniny, C., 16 Gilardón, E., 19 Gorustovich, M., 19 Graham, E.B., 22 Gray, L., 19 Jones, C.M., 22 Jones, J.B., 50 Hernández, C., 19 Kang, J.J., 22 Korneva, A.V., 36 Lara, M., 48 López-Casado, G., 34 Mapelli, S., 27, 36 Maynard, D.N., 51 Miller, S., 49 Olsen, A., 19 Olson, S.M., 50, 51 Ozminkowski, R., 26 Pacovski, R., 27 Pocoví, M., 19 Rekoslavskaya, N.I., 27, 36 Rodríquez, J., 48 Romero-Aranda, R., 34 Ruiz, J.J., 12 Salyaev, R.K., 27, 36 Scott, J.W., 41, 50, 51 Somodi, G.C., 50 Stofella, P.J., 50, 51 Steponova, E.G., 36 Stoeva-Popova, P., 16, 43 Truchin, A.A., 27, 36 Wilson, K.S., 43

THIS PAGE IS BLANK IN THE ORIGINAL DOCUMENT

Obituary Oscar Harris Pearson 1902-2004 Noted Plant Breeder Oscar Harris Pearson (Doc) died Saturday, July 3, 2004 peacefully at home in Portsmouth, RI at the age of 102. Oscar Pearson was born in Stratham, NH to Frank H. Pearson and Grace E. Gowen on January 17, 1902. He was an important contributor to US agriculture and is well known for his contribution to the development of vegetable crops, particularly, the Pearson Tomato and Butter and Sugar Corn. He graduated from the Exeter, NH high school as valedictorian of the class of 1918. He received a B.S. (1923) and an M.S. (1925) in Agriculture from the University of New Hampshire. He received a Ph.D. in Horticulture from the University of California, Davis (1928) and has been a life-long member of the American Association for the Advancement of Science. After receiving his Ph.D. he held the position of Junior Olericulturist at the University of California, Davis, until 1933. He moved east and became a Plant Breeder for the Eastern States Farmers Exchange (Agway) in West Springfield, MA. He was promoted to Head of Seed Research and supervised their Feeding Hills, MA trials farm until 1959. He returned to California to become Associate Director of Seed Research at Seed Research Specialists (SRS), Hollister, CA. He became Manager of Seed Research and Development when SRS was bought by FMC. In 1967 he retired from FMC and became Seed Research Associate in the Plant Breeding Department at Cornell University (Ithaca, NY). In the 1970’s he split his time between Cornell University and Dakar, Senegal, Africa, where he was consultant to Bud Senegal, a Dutch company developing vegetable crops for the Common Market. After his wife, Helen, died in 1993 he closed his office at Cornell University and permanently retired. He carried on an active correspondence with friends and business associates. In 1929, he married Helen Ruth Monosmith (PhD, Genetics, University of California, Berkeley 1928). They shared many common scientific interests as they raised their six children. He is predeceased by his wife, Helen, (1993) and his son, Charles Pearson (2001). He is survived by 5 children, Robert Pearson (PhD, Portland, OR), David Pearson (MD, Warwick, RI), Dorothy Ann Proctor (RN, Portsmouth, RI), George Pearson (Mojave, CA) and Sandra Pearson Shlapak (Chatsworth, CA) and by his sister, Georgiana Pearson (Exeter, NH), 11 grandchildren, 8 great grandchildren and one great-great grandchild as well as several nieces and nephews.

A memorial service is planned for Saturday, October 2, 2004 at the Stratham Community Church, Stratham, NH. Memorial donations may be made to the Kaplan Research Fund, Swedish Foundation, 747 Broadway, Seattle, WA in the name of his son, Charles Pearson, or to the ALS Therapy Development Foundation, 215 First St., Cambridge, MA 02142 in the name of his grandson, Stephen L. Proctor. -compiled by his family

Plant Breeding Summary with Emphasis on Tomato

From the time Oscar Pearson obtained a Ph.D. in1928 until he permanently retired in 1993, he made numerous important contributions to the methodology of plant breeding and developed many commercially successful vegetable varieties. None of his accomplishments were more important than those involving tomato breeding and the development of the “Pearson” tomato. While on the University of California faculty from 1928 to 1933, Dr. Pearson bred, selected and essentially completed the testing of the line that the University released in 1936 and named in his honor.

Following its release, Pearson quickly became the leading processing variety grown in California and accounted for over 50% of the processing tomato production in the U.S., until it was replaced by mechanically harvestable types beginning in 1964. Pearson, which was the first determinate tomato variety grown on a large scale, possessed tolerance to Fusarium and Verticillium wilts and was extremely fruitful in the interior valleys of California. Pearson was also widely grown for fresh market use in the U.S. In addition, Pearson was grown extensively in Egypt and other middle-eastern countries.

Following release of the original variety, public and private breeders selected, or developed through backcrossing, numerous “Pearson types” that were also grown extensively throughout the Western U.S. These included Pearson A1, Pearson B, Pearson S, Improved Pearson, Pearson VF 6, and Pearson VF 11. In addition to its use for commercial production, Pearson was widely used as a parent for numerous other varieties (e.g. J. Moran, Early Pak, Early Pak No. 7, Grand Pak) that became commercially important.

After leaving the University of California, Dr. Pearson worked as a plant breeder and manager with the Eastern States Farmers Exchange (Agway), Seed Research Specialists (subsequently FMC), and Cornell University. In these positions he continued to breed tomatoes, but expanded his work to include numerous other species such as cabbage, broccoli, sweet corn, lettuce and various cucurbits. A trademark of Dr. Pearson, throughout his long career, was his willingness to share new breeding material with other (and often competing) vegetable breeders. -Allan K. Stoner USDA, Beltsville, MD