regulation of vertebrate corticotropin-releasing factor...

General and Comparative Endocrinology 153 (2007) 200–216

www.elsevier.com/locate/ygcen

Review

Regulation of vertebrate corticotropin-releasing factor genes

Meng Yao, Robert J. Denver ¤

Department of Molecular, Cellular and Developmental Biology, 3065C Kraus Natural Science Building, The University of Michigan, Ann Arbor, MI 48109-1048, USA

Received 28 September 2006; accepted 21 January 2007Available online 17 February 2007

Abstract

Developmental, physiological, and behavioral adjustments in response to environmental change are crucial for animal survival. In ver-tebrates, the neuroendocrine stress system, comprised of the hypothalamus, pituitary, and adrenal/interrenal glands (HPA/HPI axis) playsa central role in adaptive stress responses. Corticotropin-releasing factor (CRF) is the primary hypothalamic neurohormone regulatingthe HPA/HPI axis. CRF also functions as a neurotransmitter/neuromodulator in the limbic system and brain stem to coordinate endo-crine, behavioral, and autonomic responses to stressors. Glucocorticoids, the end products of the HPA/HPI axis, cause feedback regula-tion at multiple levels of the stress axis, exerting direct and indirect actions on CRF neurons. The spatial expression patterns of CRF, andstressor-dependent CRF gene activation in the central nervous system (CNS) are evolutionarily conserved. This suggests conservation ofthe gene regulatory mechanisms that underlie tissue-speciWc and stressor-dependent CRF expression. Comparative genomic analysisshowed that the proximal promoter regions of vertebrate CRF genes are highly conserved. Several cis regulatory elements and trans act-ing factors have been implicated in stressor-dependent CRF gene activation, including cyclic AMP response element binding protein(CREB), activator protein 1 (AP-1/Fos/Jun), and nerve growth factor induced gene B (NGFI-B). Glucocorticoids, acting through the glu-cocorticoid and mineralocorticoid receptors, either repress or promote CRF expression depending on physiological state and CNSregion. In this review, we take a comparative/evolutionary approach to understand the physiological regulation of CRF gene expression.We also discuss evolutionarily conserved molecular mechanisms that operate at the level of CRF gene transcription.© 2007 Elsevier Inc. All rights reserved.

Keywords: Corticotropin-releasing factor; Corticotropin-releasing hormone; Hypothalamic–pituitary–adrenal axis; Stress response; Corticosteroid receptor

1. Introduction

“Life is stress and stress is life”.—Hans Selye, MD.

Animals must continuously adapt to internal and exter-nal environmental changes that threaten to disrupt homeo-stasis. Allostasis, a term Wrst introduced by Sterling andEyer (Sterling and Eyer, 1981), refers to the maintenance ofstability through change. McEwen and colleagues (McE-wen and Stellar, 1993) later applied this concept to thebody’s response to stressors. The vertebrate stress responseinvolves endocrine, behavioral, autonomic, immune, andmetabolic adjustments that allow animals to adapt to

* Corresponding author. Fax: +1 734 647 0884.E-mail address: [email protected] (R.J. Denver).

0016-6480/$ - see front matter © 2007 Elsevier Inc. All rights reserved.doi:10.1016/j.ygcen.2007.01.046

challenges to homeostasis (Herman et al., 1996; Speert andSeasholtz, 2001). The perception of stressors involvesmultiple neural pathways that ultimately converge onpeptidergic neurons located in the paraventricular nucleus(PVN) in mammals, or the anterior preoptic area (POA) innonmammalian species. These neurons produce corticotro-pin-releasing factor (CRF), which is the primary neurohor-mone that activates the hypothalamic–pituitary–adrenal/interrenal (HPA/HPI) axis in response to a stressor. Inaddition to its hypophysiotropic role, CRF coordinatesmany aspects of the stress response such as behavioral andautonomic adjustments (see Aguilera, 1998; Ziegler andHerman, 2002, for reviews). In nonmammalian species,CRF and related peptides are potent thyrotropin (TSH)releasing factors where they regulate critical life historytransitions such as amphibian metamorphosis by activating

mailto: [email protected]

mailto: [email protected]

M. Yao, R.J. Denver / General and Comparative Endocrinology 153 (2007) 200–216 201

the thyroid axis (see Denver et al., 2002; De Groef et al.,2006, for reviews).

Corticotropin releasing factor is a 41-amino acid peptideWrst isolated from sheep hypothalamus and named for itsstimulatory actions on corticotropin release by the anteriorpituitary gland (Vale et al., 1981). Since then, CRF has beenisolated from diverse species representing each vertebrateclass except reptiles (see Lovejoy and Balment, 1999, forreview). In addition to its hypophysiotropic role, CRF iswidely expressed in the brain and spinal cord in both mam-malian and nonmammalian species (Cummings et al., 1983;Swanson et al., 1983; Zupanc et al., 1999; Pepels et al., 2002;Lu et al., 2004; Richard et al., 2004; Yao et al., 2004; Calleet al., 2005; see Boorse and Denver, 2006, for review) whereit functions as a neurotransmitter/neuronmodulator tocoordinate behavioral and autonomic responses to stress(Orozco-Cabal et al., 2006; see Lovejoy and Balment, 1999,for review). Corticotropin-releasing factor and related pep-tides are known to play important roles in satiety and foodintake (Crespi and Denver, 2004; Crespi et al., 2004; seeMastorakos and Zapanti, 2004, for review) and also inXu-ence learning and memory consolidation (see Croiset et al.,2000; Gulpinar and Yegen, 2004; Fenoglio et al., 2006, forreviews). Components of the CRF signaling pathway,including CRF, urocortins, CRF receptors and CRF bind-ing protein are also expressed in many peripheral tissuessuch as the adrenal gland, spleen, heart, lung, liver, thymus,pancreas, intestines, ovary, testis, and placenta (human andhigher primates) (Suda et al., 1984; Petrusz et al., 1985;Muglia et al., 1994; Boorse and Denver, 2006). Corticotro-pin-releasing factor and related peptides likely inXuencemost if not all physiological functions including nervous,endocrine, vascular, cardiovascular, skeletomuscular,immune, and reproductive systems (Boorse et al., 2006; seeBoorse and Denver, 2006, for review). Dysregulation ofCRF and the HPA axis have been implicated in pathogene-sis of several human disorders such as anxiety and depres-sion, eating disorders, inXammatory diseases, substanceabuse, and preterm parturition (see Chrousos and Gold,1992; Majzoub et al., 1999; Tsigos and Chrousos, 2002, forreviews).

The hypophysiotropic neurons of the PVN/POA exhibitthe highest level of CRF expression in vertebrate brains,and play an essential role in HPA/HPI axis regulation. Intetrapod species, CRF neurons project axons to the medianeminence where neurohormones are released into the pitui-tary portal circulation to regulate anterior pituitary func-tion. In teleost Wshes, the hypophysiotropic CRF neuronsproject to the proximal pars distalis where they release theircontents in close proximity to corticotrope cells (reviewedby Lovejoy and Balment, 1999). These preoptic region neu-rons have received greatest attention with regard to factorsthat regulate expression of the CRF gene (Doyon et al.,2003; Yao et al., 2004). Other brain regions, in particularlimbic (amygdala, bed nucleus of the stria terminalis) andhindbrain (locus coeruleus) areas also possess CRF neu-rons that respond to stressors and may be inXuenced by

glucocorticoids (see Tsigos and Chrousos, 2002; Zieglerand Herman, 2002, for reviews). This review focuses on thephysiological and molecular regulation of CRF geneexpression in the CNS by stressors and by glucocorticoids.

2. Physiological regulation of CRF gene expression in the central nervous system

2.1. Central distribution of CRF neurons and basal (unstressed) expression of the CRF gene

Corticotropin-releasing factor is expressed throughoutthe brain of mammals in regions that include the limbic sys-tem (hippocampus, amygdala, nucleus accumbens, and bednucleus of the stria terminalis), hypothalamus, thalamus,cerebral cortex, cerebellum, and hindbrain (Cummingset al., 1983; Swanson et al., 1983). Similar distribution pat-terns of CRF neurons have also been described in non-mammalian species, which suggests that this expressionpattern arose early in vertebrate evolution and has beenmaintained by strong selective forces (see Lovejoy and Bal-ment, 1999; Yao et al., 2004). This distribution pattern alsosuggests that the gene regulatory sequences that determinetissue speciWc expression are evolutionarily conserved(discussed below).

The primary site of CRF synthesis in the mammalianhypothalamus is the parvocellular subdivision of the PVN.The homologous region in nonmammalian species is theanterior preoptic area (POA; preoptic nucleus). In tetra-pods, these neurons project axons to capillaries in the exter-nal zone of the median eminence, where CRF is releasedinto the portal blood and subsequently transported to theanterior pituitary (see Aguilera, 1998, for review). In teleostWshes, pituitary cells are directly innervated by projectionsfrom hypophysiotropic neurosecretory neurons (i.e., thereis no median eminence; see Lovejoy and Balment, 1999).Expression of CRF in the mammalian PVN is regulated bytonic input from several brain structures. There is a circa-dian rhythm in the expression of CRF mRNA and hetero-nuclear RNA (hnRNA) in the mammalian PVN (Kwaket al., 1993; Watts et al., 2004). The cyclic expression of theCRF gene is thought to be generated and maintained byactivity in the suprachiasmatic nucleus (SCN) (Szafarczyket al., 1979). Descending pathways from the hippocampusplay an important role in maintaining the set point forbasal HPA activity through the communication of gluco-corticoid (GC) negative feedback (Jacobson and Sapolsky,1991; Meijer and de Kloet, 1998).

2.2. Stress-activation of the central CRF system and neuronal circuitry of stress integration

Upon exposure to a stressor, the HPA/HPI axis is rap-idly activated. In tetrapods, corticotropin releasing factor isreleased from modiWed nerve terminals in the median emi-nence within seconds, and travels to the anterior pituitarywhere it activates CRF receptors to increase production of

202 M. Yao, R.J. Denver / General and Comparative Endocrinology 153 (2007) 200–216

adrenocorticotropic hormone (ACTH). A rise in plasmaACTH leads to increased production of GCs by the adrenalcortex, and a rise in plasma GC concentration. Glucocorti-coids exert diverse eVects on target tissues to mobilizeenergy for the body to deal with the stressor. Plasma GCsalso exert feedback at diVerent levels of the HPA axis tomodulate the stress response (see Sapolsky et al., 2000;Tsigos and Chrousos, 2002; Ziegler and Herman, 2002, forreviews).

Release of CRF from the dendritic terminals of PVNneurons into the hypophyseal portal blood is the key eventthat leads to activation of the HPA/HPI axis during thestress response. Increases in CRF mRNA, and in somecases hnRNA (a measure of CRF gene transcription) levelsin these neurons have been documented after exposure ofrats to diVerent physical, physiological, and psychologicalstressors (e.g., foot shock, immobilization, forced swim-ming, ether stress, and endotoxin stimulation; Hermanet al., 1989a; Imaki et al., 1991; Bartanusz et al., 1993;Rivest et al., 1995; Kovacs and Sawchenko, 1996a,b; Maet al., 1997a,b; Hsu et al., 1998; Chen et al., 2001; Liu et al.,2001). Work from our laboratory in the frog Xenopus laevisshowed that both CRF immunoreactivity and CRFhnRNA exhibited rapid increases in the POA followingexposure to a shaking/conWnement stressor (Yao et al.,2004; Yao et al., 2007). Studies in teleost Wshes (rainbowtrout Oncorhynchus mykiss, carp Cyprinus carpio L., andtilapia Oreochromis mossambicus) also demonstrated thatstressors elevated CRF mRNA in the POA or hypothala-mus (social stressor: Doyon et al., 2003; restraint stressor:Huising et al., 2004; chasing or restraint stressor: Doyonet al., 2005) and increased concentrations of CRF in thesystemic circulation (capture stressor: Pepels et al., 2004);see also (Flik et al., 2006). Taken together, Wndings in mam-mals, in Xenopus and in Wshes show that stressor-dependentactivation of CRF genes arose early in vertebrate evolution,and that exposure to stressors leads to a rapid increase inCRF gene transcription.

Hypothalamic CRF neurons receive dense projectionsfrom forebrain limbic sites, brain stem autonomic centers,and a number of local hypothalamic regions. Brain sitesthat do not have dense direct connections with the PVNsuch as the hippocampus, the amygdala, and the locus coe-ruleus likely inXuence PVN neurons indirectly via a relaymechanism (see Herman and Cullinan, 1997; Ziegler andHerman, 2002, for reviews). These neuronal connectionsplay pivotal roles in the regulation of CRF gene activityunder both basal and stressor-induced conditions.

Limbic structures are rapidly activated in response tostress, indicated by extensive induction of immediate earlygenes (IEGs; Honkaniemi et al., 1992; Cullinan et al., 1995)and increased CRF expression (Kalin et al., 1994; Meraliet al., 1998; Yao et al., 2004). Damage to the hippocampussigniWcantly increased CRF mRNA in the PVN of rats, andcaused GC hypersecretion in Cynomolgus monkeys (Her-man et al., 1989b; Sapolsky et al., 1991), showing that thisbrain structure exerts tonic repression on PVN CRF

expression. The hippocampus appears to have a stressor-dependent inhibitory input to the PVN, since stimulation ofthis region decreased HPA activity, while hippocampallesions increased secretion of ACTH and GC in response tosome stressors, but not others (see Jacobson and Sapolsky,1991; Herman and Cullinan, 1997; for reviews). It isthought that the limbic system is more sensitive to psycho-logical and multi-modal stressors requiring higher-ordersensory processing (Herman and Cullinan, 1997).

Limbic structures such as the amygdala and the bednucleus of the stria terminalis (BNST) seem to have theopposite inXuence on CRF neurons in the PVN comparedwith the hippocampus. The central nucleus of the amygdalaplays a key role in mediating neuroendocrine as well asother aspects of the stress response. Electrical stimulationof this region caused secretion of CRF from the medianeminence (Weidenfeld et al., 1997). Whereas, lesions of theamygdala decreased CRF mRNA in the PVN and CRF-like immunoreactivity in the median eminence in unstressedrats (Beaulieu et al., 1989; Prewitt and Herman, 1994), andblocked CRF induced behavioral responses and the HPAresponse to acoustic and photic stimulation (Liang et al.,1992). Injection of CRF into the amygdala enhanced inhib-itory avoidance learning and decreased exploratory activityin rats (Liang and Lee, 1988), and antagonism of CRFreceptors in the central amygdala attenuated foot shock-induced freezing behavior (Swiergiel et al., 1993). Thus, theamygdala circuit may be essential for relaying a stimulatorysignal with certain types of stressors to the PVN CRFneurons (Gray, 1993; Herman and Cullinan, 1997).

Similar to the lesion studies of the amygdala, ablation ofthe BNST caused a signiWcant decrease in CRF mRNA inthe PVN in unstressed rats (Herman et al., 1994). Electricalstimulation of the medial and rostral BNST resulted in anincrease in plasma GC (Dunn, 1987), and lesions of the lat-eral BNST also attenuated conditioned fear-inducedrelease of ACTH and GC (Gray et al., 1993). Furthermore,in response to a psychological stressor, CRF mRNA wasincreased in the limbic system (the central nucleus of theamygdala and the dorsolateral BNST) without a detectableincrease in the hypothalamus (Makino et al., 1999), suggest-ing that the limbic stress pathway responds to certain typesof stressors independent of HPA axis activation.

The brain stem is essential for autonomic responses tostressors. Sympathetic and parasympathetic systems of theautonomic nervous system regulate skeletal muscles andsmooth muscles of the vasculature, heart, gut, and otherorgans to coordinate with other aspects of the stressresponse. The brain stem also mediates arousal, sensoryprocessing, and responses to physiological stress (see Brun-son et al., 2001; Tsigos and Chrousos, 2002; Ziegler andHerman, 2002, for reviews). Hemisection of the lowerbrainstem (including the locus coeruleus) decreased CRFmRNA in the ipsilateral PVN in unstressed rats (Kiss et al.,1996), suggesting basal CRF expression in the PVN isunder tonic stimulatory control by brain stem structures.Lesions of the locus coeruleus caused a reduction in GC


release after restraint stress, suggesting a stimulatory inputfrom this site to the hypothalamic neuroendocrine cells(Ziegler et al., 1999).

Corticotropin-releasing factor also increases its ownexpression and that of CRF receptors, and thus might haveautocrine or paracrine functions within a tissue. Both i.c.v.administration of CRF and exposure to acute immobiliza-tion rapidly induced expression of CRF and CRF receptor1 mRNA in the PVN, suggesting autoregulation of theCRF gene in the stress response (Luo et al., 1994; Imakiet al., 1996). Pretreatment with a CRF receptor 1 antagonistsigniWcantly reduced stressor-induced ACTH secretion andc-fos mRNA expression in the PVN (Imaki et al., 2001),suggesting that autoregulation of CRF contributes to stres-sor-dependent activation of the CRF gene and/or secretionof CRF from hypothalamic neurons.

In addition to CRF, other neuropeptides such as argi-nine vasopressin (AVP) and urocortins (CRF related pep-tides) may also be involved in stress activation of the HPA/HPI axis, but these pathways are beyond the scope of thecurrent discussion (see Lovejoy and Balment, 1999;Heinrichs and Koob, 2004; Suda et al., 2004, for reviews).

2.3. Feedback regulation of CRF expression by glucocorticoids

Glucocorticoids, the end eVectors of the HPA/HPI axis,play critical roles in regulation of CRF expression andadrenal/interrenal activity. High concentrations of circulat-ing GCs induced by stressors have an inhibitory eVect onthe synthesis and secretion of hypothalamic CRF, and theproduction and secretion of ACTH by the pituitary. Suchnegative feedback is a critical mechanism for terminatingthe stress response and restoring the system to homeostasis(see Makino et al., 2002, for review). In unstressed animals,CRF mRNA levels in the PVN exhibit a reverse correlationwith plasma GC concentration (Watts and Swanson, 1989;Kwak et al., 1992). However, the circadian rhythm of CRFmRNA and heteronuclear RNA (hnRNA) levels in thePVN are maintained in adrenalectomized rats, indicatingcirculating GCs are not required for the cyclic expression ofCRF (Kwak et al., 1993; Watts et al., 2004).

Two types of intracellular GC receptors are expressed inthe brain: the high aYnity type I receptor (also called themineralocorticoid receptor; MR), and the lower aYnitytype II receptor (also called the glucocorticoid receptor;GR) (see Funder, 1997, for review). The GR is expressedthroughout the mammalian brain, with the highest level inthe PVN and the corticotropes of the anterior pituitary. Bycontrast, the highest expression of MR in mammals isfound in the hippocampus. Due to its high aYnity for corti-costerone, the MR expressed in the hippocampus isthought to mediate the feedback actions of GCs at the cir-cadian peak, and to maintain the basal activity of the HPAaxis (see De Kloet et al., 1998, for review). Following anacute stressor, the concentration of plasma GC is increased,and the low aYnity receptor GR may play an essential role

in mediating GC feedback directly on the PVN and thepituitary corticotropes to terminate the HPA stressresponse by negative feedback (De Kloet et al., 1998).

The predominant sites for inhibition of the HPA axis bythe GR are the PVN and the pituitary corticotropes. It hasbeen shown that activated GR suppresses expression of theCRF gene in the hypothalamus, and inhibits expression ofpro-opiomelanocortin (POMC; a precursor protein of avariety of peptides including ACTH) in pituitary cortico-tropes (Dallman et al., 1992; see below for more discussion).The GR may also mediate feedback regulation by GCs inthe limbic system including the hippocampus and amyg-dala, as well as in brain stem neurons such as the locus coe-ruleus. These neuronal groups have extensive direct andindirect connections with CRF neurons in the PVN, andactivation of GR at these sites is involved in modulation ofHPA activity in response to acute as well as chronic stress(De Kloet et al., 1998). In addition, acute stress causedincreased GR expression in the PVN and pituitary (Mam-alaki et al., 1992), while repeated stress or sustained admin-istration of exogenous GCs down-regulated GR in thehippocampus and amygdala (Sapolsky et al., 1984), provid-ing a secondary mechanism to modulate CRF expressionand HPA activity.

Studies in rats showed that administration of the GCsynthesis inhibitor metyrapone caused a rapid increase inCRF hnRNA in the PVN followed by an increase in CRFmRNA (Herman et al., 1992). Adrenalectomy (ADX) alsoincreased CRF mRNA in the PVN, while high doses ofdexamethasone decreased it (Jingami et al., 1985; Beyeret al., 1988). These results suggest that expression of theCRF gene is under tonic suppression by GCs in theunstressed condition. In addition, ADX augmented, butdexamethasone pretreatment inhibited CRF hnRNA andmRNA increases in the rat PVN following exposure torestraint or photic stimulation (Imaki et al., 1995; Feldmanand Weidenfeld, 2002).

However, physiological concentrations of GCs in intactanimals have been shown to be essential for the initiationand sustenance of the stress response. In fact, in ADX ratslevels of CRF hnRNA and mRNA in the PVN weredecreased following stress stimulation (Tanimura andWatts, 1998). ADX rats supplemented with a low dose ofGCs showed augmented PVN CRF mRNA levels follow-ing hypovolemia (Tanimura and Watts, 1998). In anotherstudy in rat, both CRF hnRNA and mRNA increased andremained elevated during sustained hypovolemia in adrenalintact animals (Tanimura and Watts, 2000). However, theseinvestigators found that in ADX animals hypovolemiacaused an earlier increase in CRF hnRNA in the PVN,which declined rapidly; no changes in CRF mRNA in thePVN were observed in the ADX rats. Furthermore, CRFpeptide concentrations in the portal blood of ADX ratswere decreased (Plotsky and Sawchenko, 1987), and stimu-lus-evoked CRF secretion from the mediobasal hypothala-mus of transgenic mice with impaired GR was reducedcompared to wild type (Dijkstra et al., 1998). Thus plasma


GCs apparently exert a dual action on CRF expression inthe PVN: high concentrations of circulating GCs (exoge-nous or obtained during stress) inhibit CRF gene transcrip-tion in the PVN (negative feedback action), while lowerlevels of GCs may exert a permissive action on stressor-dependent gene activation and secretion, and the mainte-nance of CRF expression in the initial stages of the stressresponse (see Tanimura and Watts, 2001, for review).

Evidence for a role for the MR in negative feedback reg-ulation of the HPA comes from studies of MR knockoutmice. Compared with wildtype, the knockouts exhibitedincreased HPA activity as evidenced by elevated CRFmRNA levels in the PVN, and increased plasma ACTHand corticosterone concentrations (Gass et al., 2001). ThusGCs acting via the MR expressed in the limbic system arethought to exert a “tonic” inhibition on the CRF gene inthe PVN, while GR likely mediates the “phasic” regulationof CRF in the stress response (Gass et al., 2001).

3. Molecular mechanisms of transcriptional regulation of CRF genes

The commonalities in the spatial, temporal and stressor-dependent expression of CRF among species suggest thatthe basic cis elements responsible for the regulation of CRFgenes were present in the earliest vertebrates, and have beenmaintained by positive selection owing to the critical rolethat CRF plays in adaptive stress responses. We conducteda comparative genomic analysis of vertebrate CRF genesand identiWed several regions of strong sequence similarity(Fig. 1). Within the coding region the area of highest

sequence similarity was in the mature peptide, while thecryptic peptide of the prohormone exhibited much lowerconservation. There was virtually no sequence conservationin the introns among vertebrate classes, but surprisingly,the 3� untranslated regions (3� UTR) exhibited severalhighly conserved stretches of nucleotide sequence amongtetrapods. A more detailed analysis of the 3� UTRs of CRFgenes among several Wsh species (puVerWsh, scaleless carp,tilapia, rainbow trout, and zebraWsh) and tetrapodsrevealed much lower sequence conservation (M. Yao,unpublished). The functional signiWcance of the sequenceconservation in the 3� UTR of tetrapods is not known, butcould be related to conserved elements necessary for trans-lational or transcriptional control. After the mature pep-tides, the proximal promoter regions shared the highestdegree of sequence similarity; analysis of »330 bp ofupstream sequences showed 94% sequence similarityamong human, rat, and ovine CRF genes (Vamvakopouloset al., 1990), and »72% similarity among frog (xCRFbgene) and mammalian genes.

Computer analysis of the proximal CRF promotersrevealed several putative transcription regulatory elements,including two TATA boxes, CAAT boxes, a cAMPresponse element (CRE), several AP-1 protein (Fos/Jun)binding sites, several half-glucocorticoid response elements(GRE), and half-estrogen responsive elements (ERE)(Vamvakopoulos et al., 1990; Vamvakopoulos and Chrou-sos, 1994; Fig. 2). The majority of the cis elements withinthe proximal promoter region are highly conserved amongvertebrate CRF genes (Yao et al., 2007; Fig. 2). The func-tion of some of these putative regulatory elements in the

Fig. 1. Alignment of vertebrate CRF genes (in decending order on Wgure): puVerWsh (Fugu rubripes), chicken (Gallus domesticus), frog (Xenopus tropicalis),opossum (Didelphis virginiana), mouse (Mus musculus), dog (Canis domesticus), and rhesus monkey (Macaca mulatta) genomes using the human as thebase sequence. Peaks on the graph represent percentage identity between the aligned genomes at the speciWed positions. A vertical axis cut-oV of 50% iden-tity was used. Alignments were done using the evolutionary conserved region (ECR) browser (Ovcharenko et al., 2004; http://ecrbrowser.dcode.org/). Themost highly conserved regions are the mature peptide and the proximal promoter. The cryptic peptide is part of the prohormone that is cleaved to generatethe mature peptide. Note that only limited 5� upstream sequence was available in the current ECR browser update for X. tropicalis and Fugu rubripes (the
extent of sequence for each species used is indicated by the gray bars under each histogram).
http://ecrbrowser.dcode.org/

http://ecrbrowser.dcode.org/


human and rat CRF genes have been addressed using celltransfection and in vitro binding assays. A schematic dia-gram of several of these regulatory pathways is shown inFig. 3. Below we address the functions of the major cis ele-ments that have been characterized thus far, and discussnew data that provide evidence for their importance inmediating stressor-dependent gene activation in vivo.

3.1. Cyclic AMP response element binding protein

The activation of CRF promoter activity through thecAMP-dependent protein kinase A (PKA) pathway hasbeen shown by cell transfection assay in a number of celltypes: mouse anterior pituitary cell AtT20 (Van et al., 1990;Rosen et al., 1992; Guardiola-Diaz et al., 1996; Malkoskiet al., 1997; King et al., 2002), rat pheochromocytoma cell

PC-12 (Seasholtz et al., 1988; Guardiola-Diaz et al., 1994),chicken macrophage HD11 (Van, 1993), neuroblastomacell SK-N-MC, choriocaarccinoma cell JAR (Spengleret al., 1992), COS-7 cell (Vamvakopoulos and Chrousos,1993a), and primary human placental cytotrophoblast cells(Cheng et al., 2000a). Also, upregulation of the endogenousCRF gene following activation of the cAMP pathway hasbeen shown in a primary fetal rat hypothalamic cell line(Emanuel et al., 1990).

Cyclic AMP response element binding protein (CREB)is a member of the basic leucine zipper (bZIP) family oftranscription factors. This family also includes the cAMPresponse element modulatory protein (CREM) and theactivating transcription factor 1 (ATF-1) (see Lonze andGinty, 2002, for review). Members of this family formhomo or heterodimers through their leucine zipper

Fig. 2. ClustalW alignment of the proximal promoter regions of human (h), chimp (pt), sheep (sh), mouse (m), rat (r), and Xenopus laevis (x; genes a and b)CRF genes. Sequences that are identical among CRF genes are shadowed. The asterisk indicates the predicted transcriptional start sites for each gene.Putative binding sites of transcription factors are indicated. NGFI-B, nerve growth factor induced gene B; ER, estrogen receptor; Oct-1, octomer bidingfactor 1; GR, glucocotricoid receptor; AP1, activation protein 1 (Jun/ Fos); CREB, cyclic AMP response element binding protein; XFD2, Xenopus fork-head domain factor 2; Nkx 2–5, cardiac-speciWc homobox protein; AhR, aryl hydrocarbon receptor (modiWed from Yao et al., 2007).

1 8210 20 30 40 50 60 70(1)CCCACTTCCCCTTCCTCCTCCCATTCGCTGTCTCTTTGCACACCCCTAATATGGCCTTTCATAGTAAGAGGTCAATATGTTThCRF (1)CCCACTTCCCCTTCCTCCTCCCATTCGCTGTCTCTTTGCACACCCCTAATATGGCCTTTCATAGTAAGAGGTCAATATGTTTptCRF (1)CCCTCCCCTTCTCTCCCCTCCCATTCACT--CTCTTTTCTGACCTTCCCTTTGGCCTTTCCTAGTAAGAGGCCAGTATGTCTshCRF (1)ACCTCTTCTTCTTTCCCCTCCCACTCTCTGTCTCTTTTCTGGTCCGTA-TCTGGCCTATCATAGTAAGAGGTCAGTCTGTTTmCRF (1)-TCCCCACCTCTTTCTC-TCTCCCACTCTGCCTCTTTTCTGGTCTGTA-TCTGGCCTATCATAGTAAGAGGTCAGTATGTTTrCRF (1)ACCACACCTTCTA-TACATCCATGGGGTTAAATATCTGC----CTGCT---TGACCTTTGGTAGTAAAAGGTCACTTGGTGTxCRFb (1)ATCAGATTCCCTAATACCACAAATACTTTAGA--TCAGC----CTCTT---TGACCTTGGCTAATAAAGGGTCACTTGGCGAxCRFa (1)

83 16490 100 110 120 130 140 150(83)TC-AC-----ACTTGGGAAATCTCATTCAAGAATTTTT-GTCAATGGACAAGTCATAAGAAGCCCTTCCATTTTAGGGCTCGhCRF (83)TC-AC-----ACTTGGGAAATCTCATTCAAGAATTTTT-GTCAATGGACAAGTCATAAGAAGCCCTTCCATTTTAGGGCTCGptCRF (83)TC-AC-----ACTTGGGAAATCTCATTCAAGAATTTTT-GTCAATGGACAAGTCATAAGAAGCCCTTCCATTTTAGGGCTCTshCRF (81)TCCAC-----ACTTGGATAGTCTCATTCAAAAATTTTT-GTCAATGGACAAGTCATAAGAAACCCTTCCATTTTCGGGCTCGmCRF (82)TCCAC-----ACTTGGATAATCTCATTCAAGAATTTTT-GTCAATGGACAAGTCATAAGAAGCCCTTCCATTTTAGGGCTCGrCRF (80)TGCACGGCCCACATGGGAAACCTCATTCATGATTTCTT-GTCAATGGGAGACTTGTGAACGTCACTTTCAGTTAAGGTGTCAxCRFb (75)GGAA-----------GGAAACCTCTTCAGATATTTCTTTGTCAATGGAAAATTTTTGAACATCGCATTT-----AGGTTGCAxCRFa (74)

165 246170 180 190 200 210 220 230(165)TTGACGTCACCAAG-AGGCGATAAATATCTGTTGATATAATTGGATGTGAGATTCAGTGTTGAGATAGCAAAA-TTCTGCCChCRF (158)TTGACGTCACCAAG-AGGCGATAAATATCTGTTGATATAATTGGATGTGAGATTCAGTGTTGAGATAGCAAAA-TTCTGCCCptCRF (158)TTGACGTCATCAAGGAGGCGATAAATATCTGTTGATATAATTGGATGTGAGATTCAGTGTTGAGATAGCAAAAATTCTGCCCshCRF (156)TTGACGTCACCAAGGAGGCGATAAATATCTGTTGATATAATTGGATGTGAGATTCAGTGTTGAAATAGCAGAA-CTCTGTCCmCRF (158)TTGACGTCACCAAGGAGGCGATAAATATCTGTTGATATAATTGGATGTGAGATTCAGTGTTGAAATAGCAGAA-CCCTGTCCrCRF (156)TTTACGTCACTAAAGAGGCAATAAATATCCGAGAACATAATTGGATGTAAGAGTCATTGTTGTAATAGCAAAC--TCTGCCCxCRFb (156)CCTACGTCACTAAAGAGGCAATGAAAATCCGAGAGCGTAATTTGAAGGGAGATCCATG---GCA-----AAAC--TCCACCTxCRFa (140)

247 328260 270 280 290 300 310(247)CTCGTTCCTTGGCAGGGCCCTATGATTTATGCAG---GAGCAGAGGCAGCACGCAATCGAGCTGTCAAGAGAGCGTCAGCTThCRF (238)CTCGTTCCTTGGCAGGGCCCTATGATTTATGCAG---GAGCAGAGGCAGCACGCAATCGAGCTGTCAAGAGAGCGTCAGCTTptCRF (238)CTCGTTCCCGGGCAGG--CCTATGATTTATGCAG---GAGCAGAGGCAGCG-GCAATCCAGCTGTCAAGAGAGCGTCAG-TTshCRF (238)CTCGCTCCTTGGCAGGGCCCTATTATTTATGCAG---GAGCAGAGGCAGCACGCAATCGAGCTGTCAAGAGAGCGTCAGCTTmCRF (239)CTCGCTCCTTGGCAGGGCCCTATTATTTATGCAG---GAGCAGAGGCAGCACGCAATCGAGCTGTCAAGAGAGCGTCAGCTTrCRF (237)ATTGCTC---TGAAGAGCC--ATTATTTATTCATTGAGCAGAGGAGTTACACGCAA--CAGTTGTCAAGAAAGCGTCAGCTTxCRFb (236)ATTGCTC---TCAAGGGAC--ATTATTTATTCA----GCACAAAAGCTACATGCAA--CAGTTGTCAAGAAAGCATCAGCTTxCRFa (212)

329 410340 350 360 370 380 390 400(329)-------ATTAGGCAAATGCTGCGTGGTTTTTGAAGAGGGTCGACACTATAAAATCCCACTCCAGG-CTCTGGAGTGGAGAAhCRF (317)-------ATTAGGCAAATGCTGCGTGGTTTTTGAAGAGGGTCGACACTATAAAATCCCACTCCAGG-CTCTGGAGTGAAGAAptCRF (317)-------ATTAGGCAAATGCTGCGTGGTTTCTGAAGAGGGTCGACACTATAAAATCCCCTTCCAGG-CTCTGGTGTGGAGAAshCRF (313)-------ATTAGGCAAATGCTGCGTGCTTTCTGAAGAGGGTCGACATTATAAAATCTCACTCCAGG-CTCTGGTGTGGAGAAmCRF (318)-------ATTAGGCAAATGCTGCGTGCTTTCTGAAGAGGGTCGACGTTATAAAATCTCACTCCGGG-CTCTGGTGTGGAGAArCRF (316)-------ATTAGGCAAGATCTGCGTGATCCCCGAAGAAAGTCTAAGCTATAAAACCTGGGTTCAAGACTTCTGTTTGTAGAGxCRFb (311)TCAGAGGAATCAGAAGGAATTGCTCGATCTTGAAAGGAGTTCTAAGCTATAACATCTGATTTCAGGGCTTATGTTTCTAG-GxCRFa (283)


domains and bind to DNA. Transcriptional activity ofCREB is regulated by phosphorylation at conserved ser-ine residues, and several intracellular signaling pathwayscan induce phosphorylation of CREB, including thePKA, Ca2+, and mitogen-activated protein kinases(MAPKs) (see Shaywitz and Greenberg, 1999; Johannes-sen et al., 2004, for reviews). Although phosphorylationdid not alter CREB binding to DNA in vitro (Richardset al., 1996; Wu et al., 1998), phosphorylation has beenshown to increase CREB DNA binding activity withoutchanging the total CREB protein level in vivo (Hatalskiand Baram, 1997; Whitehead and Carter, 1997; WolXet al., 1999; Hiroi et al., 2004). Phosphorylation of CREBalso induces recruitment of the coactivators CBP andp300 to gene promoters (although the CRF promoter hasnot been studied in this regard) which promote gene acti-vation through their intrinsic histone acetyl transferaseactivity and interaction with the RNA polymerase IIcomplex (see Mayr and Montminy, 2001; Johannessenet al., 2004, for reviews). A highly conserved cAMPresponse element (CRE) TGACGTCA is present inthe human CRF gene promoter centered at ¡224 bpupstream of the transcription start site. This element canconfer cAMP-responsiveness to a heterologous pro-moter, and mutation of this sequence abolished stimula-tion by 8-bromo-cAMP or forskolin (Seasholtz et al.,1988; Spengler et al., 1992). We have also shown that thiselement in the frog CRF gene promoters is responsiblefor cAMP pathway-mediated gene activation in vitro andin vivo (Yao et al., 2007).

Several studies have shown that in the rat, CREB is rap-idly phosphorylated in CRF neurons in response to variousstressors, preceding elevation of CRF expression in thosecells (Kovacs and Sawchenko, 1996b; Chen et al., 2001;Bilang-Bleuel et al., 2002). We also showed in the frog thatexposure to a shaking stressor increased phosphorylatedCREB immunoreactivity in the POA by 20 min, and thatpCREB immunoreactivity (CREB-ir) colocalizes with

CRF-ir (Yao et al., 2007). Though indirect, these resultssupport the view that activation of CREB could contributeto increased transcription of the CRF gene during the stressresponse.

Microinjection of 8-bromo-cAMP into the PVN of ratsincreased CRF mRNA content, while preinjection ofantisense oligodeoxyonucleotides to CREB blocked theincrease in CRF mRNA caused by insulin-inducedhypoglycemia (Itoi et al., 1996). We recently reported thatmutation of the CRE site abolished cAMP or and stressor-dependent activation of the frog CRF promoter in transfec-ted tadpole or frog brain (Yao et al., 2007). These dataprovide strong support that the PKA/CREB pathway,acting via the CRE site in the CRF promoter, plays acritical role in stress-induced CRF expression in vivo.

Among the other CREB family members, interest hasfocused recently on the inducible cAMP early repressor(ICER) which may be responsible for turning oV stressor-dependent activation of the CRF gene. Consisting of onlythe DNA-binding domain and lacking the transactivationdomain of CREM, ICER is able to dimerize with CREBand CREM and bind to a consensus CRE site, but does notactivate transcription. Instead, the protein functions as apotent repressor of cAMP-induced transcription. Expres-sion of ICER is induced by other CRE-binding proteinssuch as CREB or CREM binding to the ICER promoter,and it is the only member of the CREB family whose activ-ity is regulated by its intracellular concentration ratherthan by phosphorylation state. Induction of ICER itthought to function as a feedback mechanism, turningdown the activation induced by the initial phosphorylationof CREB or CREM (see Sassone-Corsi, 1995; Mio-duszewska et al., 2003, for reviews). In unstressed rodentsICRE-immunoreactivity was found in the paraventricularnucleus in the hypothalamus (Conti et al., 2004; Kell et al.,2004). Restraint stress caused an increase in ICER mRNAand CREM recruitment to the CRF promoter in the PVN,which could be responsible for the decline in CRF mRNA

Fig. 3. Schematic representation of the major pathways involved in the regulation of CRF gene transcription at the proximal promoter. PKA, proteinkinase A; PKC, protein kinase C; GC, glucocorticoid; GR, glucocorticoid receptor; GRE/AP1, composite glucocorticoid response element and AP1 (Fos/Jun) binding sites; NGFI-B, nerve growth factor-induced gene B; NBRE, NGFI-B-response element; CRE, cyclic AMP-response element; CREB, CREbinding protein; ICER, inducible cAMP early repressor; JNK, Jun N-terminal kinase. TATA box and transcription start site are indicated. Positive andnegative regulation are indicated as + and ¡, respectively.


following its initial induction by stress (Shepard et al.,2005). ICER was also increased in the hypothalamus fol-lowing antidepressant treatment, and it is required for anti-depressant treatment to reduce stress-induced elevations inplasma corticosterone in mice (Conti et al., 2004). In addi-tion, stressors induced expression of ICER mRNA in boththe pituitary and the adrenal gland (Della Fazia et al., 1998;Mazzucchelli and Sassone-Corsi, 1999), suggesting upregu-lation of ICER may be an integral component of the regu-lation of the HPA axis, and perhaps a common mechanismfor feedback regulation of stress-activated gene expression.

3.2. Activator protein 1 (Fos and Jun)

The protein kinase C (PKC) pathway, acting throughthe transcription factors Fos and Jun (originally termedactivator protein 1; AP-1), is also implicated in the transac-tivation of the CRF gene. c-fos and c-Jun belong to thefamily of immediate early genes (IEGs) that were Wrst iden-tiWed based on their rapid and transient induction bygrowth factors (McMahon and Monroe, 1992; Robertson,1992). The induction of c-fos (mRNA and/or Fos-ir) hasbeen widely used as a marker for neuronal activation, andfor mapping the stress-response circuitry in the CNS (Cec-catelli et al., 1989; Emmert and Herman, 1999; see HoVmanet al., 1993; Senba and Ueyama, 1997, for reviews). Studiesin rodents have shown that in response to a wide range ofstressors c-fos mRNA increased in several stress-relatedstructures including the PVN, central and medial amyg-dala, bed nucleus of the stria terminalis, hippocampus, andlocus coeruleus (Ceccatelli et al., 1989; Imaki et al., 1992,1993; Sawchenko et al., 1996; Emmert and Herman, 1999;Watts and Sanchez-Watts, 2002). In agreement with Wnd-ings in rodents, we also showed that Fos-ir was increased inthe POA of the frog following exposure to a shaking stres-sor, and that Fos-ir was colocalized with CRF-ir (Yaoet al., 2004). These results suggest that AP-1 proteins mayplay an evolutionarily conserved role in CRF generegulation in response to stressors.

In COS-7 or HD11 cells transfected with a human CRFpromoter–reporter construct, treatment with the phorbolester TPA, which activates the PKC pathway, increasedCRF promoter activity (Vamvakopoulos and Chrousos,1993a; Van, 1993). Activation of the PKC pathway alsoincreased expression of the endogenous CRF gene as mea-sured by mRNA levels in the human hepatoma cell lineNPLC, and in primary fetal rat hypothalamic cells (Eman-uel et al., 1990; Adler et al., 1992; Rosen et al., 1992). TheeVect of TPA treatment on CRF promoter activity is celltype-dependent, and is not observed in transfected AtT 20or PC-12 cells; nor did TPA upregulate endogenous CRFgene expression in primary cultures of rat amygdala (Vanet al., 1990; Rosen et al., 1992; Kasckow et al., 2003; A. F.Seasholtz, personal communication; and M. Yao and R.J.Denver, unpublished data). Increased CRF mRNA causedby treatment of NPLC cells with TPA required de novo pro-tein synthesis (Adler et al., 1992). In these cells TPA also

increased CRF mRNA size owing to a 3-fold increase inthe length of the poly(A) tail, which could potentially aVectmRNA stability or translatability (Adler et al., 1992).

Several AP-1 binding sites are present in the 5� Xankingregion of vertebrate CRF genes (Vamvakopoulos andChrousos, 1994; Fig. 2), although Fos/Jun binding at eachof these sites has not been characterized. Two closelylocated AP-1 sites overlap with three putative GRE sites,and it was shown that both AP-1 proteins and GR can spe-ciWcally bind to this region of the human CRF promoter(Malkoski and Dorin, 1999). We have also found that GRcan bind to the homologous region of the frog CRF gene(M. Yao and R.J. Denver, unpublished data). Furthermore,mutational analysis suggests that this region is importantboth for AP-1-mediated stimulation and for GR-mediatedrepression of CRF promoter activity (Malkoski and Dorin,1999). Composite AP-1/GRE sites have been found in anumber of genes, and opposing actions of AP-1 and GRproteins at these sites have been demonstrated (e.g., prolif-erin gene: Diamond et al., 1990; Miner and Yamamoto,1992; �-fetoprotein gene: Zhang et al., 1991). Thus antago-nism, or even cooperation, between Fos/Jun and GR (orMR) may be a common regulatory phenomenon. Thishypothesis remains to be tested in the context of CRF generegulation.

Despite the Wndings that c-fos is induced in CRF neu-rons by stressors in vivo, and that the PKC pathway canactivate CRF gene transcription in vitro, other studiesfailed to Wnd evidence for a role for this pathway. Itoi andcolleagues (Itoi et al., 1996) observed no eVect on PVNCRF mRNA levels following microinjection of TPA intothe PVN of conscious rats; conversely, i.c.v. injection ofantisense oligodeoxynucleotides directed against c-fos orc-jun mRNA did not aVect activation of the CRF gene byinsulin-induced hypoglycemia (Itoi et al., 1996). Other stud-ies also demonstrated that there is a delayed increase inc-fos mRNA compared with CRF hnRNA in the PVN inresponse to a stressor (Kovacs and Sawchenko, 1996a,b).Furthermore, blockade of protein synthesis in rats pre-vented induction of Fos, but had no eVect on CREB phos-phorylation or CRF hnRNA expression in the PVN duringan acute stress response (Kovacs et al., 1998). These Wnd-ings have led to the conclusion that the early upregulationof CRF expression during the stress response does notdepend on Fos, at least not in the PVN (Kovacs and Saw-chenko, 1996a,b; Kovacs et al., 1998). Instead, rapid phos-phorylation of CREB appears to be primarily responsiblefor the early induction of the CRF gene in the stressresponse. The PKC pathway eVectors Fos/Jun may play arole in the delayed regulation of CRF expression inresponse to sustained or chronic stressors.

3.3. Corticosteroid receptors

Glucocorticoids play a critical role in the regulation ofboth basal and stressor-induced CRF gene expression. Theactions of GCs on CRF expression vary with cell-type,


physiological state and hormone dosage. Studies in rodentsfound that administration of corticosterone decreased CRFmRNA in the PVN, but increased CRF mRNA in the cen-tral nucleus of the amygdala and the bed nucleus of thestria terminalis (Makino et al., 1994a,b), suggesting tissue-speciWc GC actions on CRF gene expression. Treatment ofNPLC cells with dexamethasone (DEX), a potent agonistof the glucocorticoid receptor (GR), decreased endogenousCRF mRNA. Dexamethasone reduced basal activity of an8 kb upstream human CRF gene promoter–reporter con-struct in transfected AtT20 cells (Adler et al., 1988; Rosenet al., 1992). Dexamethasone also signiWcantly reducedPKA pathway-dependent activation of the human proxi-mal CRF promoter in AtT20 cells, and TPA-induced CRFpromoter activation in COS-7 and NPLC cells (Van et al.,1990; Rosen et al., 1992; Vamvakopoulos and Chrousos,1993a; Guardiola-Diaz et al., 1996; Malkoski et al., 1997;King et al., 2002). By contrast, DEX enhanced PKA path-way-dependent induction of CRF mRNA in PC-12 cellsand CRF promoter activity in transfected human placentacells (Guardiola-Diaz et al., 1996; Cheng et al., 2000b); but,had no eVect on basal or forskolin-induced CRF expressionin primary amygdalar cultures (Kasckow et al., 1997).

The cellular targets, and the molecular mechanisms bywhich GCs regulate CRF gene expression are incompletelyunderstood. As described above, the regulation of PVNCRF expression is direct, likely involving GRE half sitespresent in the CRF promoter, and also indirect, involving acomplex limbic circuit that includes the hippocampus andperhaps the amygdala (see Tsigos and Chrousos, 2002; Zie-gler and Herman, 2002, for reviews). Glucocorticoids canalso regulate CRF expression in these limbic structures, butthe character of the regulation may diVer from the PVN.The direct actions of GCs on the PVN or limbic structuresin CRF gene regulation likely requires, in large part theexpression in these cells of GR or MR (Cole et al., 1995;Tronche et al., 1999; Gass et al., 2000). However, there isevidence that rapid actions of GCs on the hippocampusand PVN are accomplished via mechanisms that do notdepend on transcriptional activation by these receptors (i.e.,nongenomic mechanisms; see Chen and Qiu, 1999; Borski,2000; Norman et al., 2004, for reviews; discussed below).

The direct actions of GR on target genes are character-ized by either DNA-binding dependent, or DNA-bindingindependent mechanisms. Several regions of the humanCRF gene have been found to be occupied by GR in vitrousing DNase I protection assay (Guardiola-Diaz et al.,1996). One of these regions, the composite AP-1/GRE site,was shown to be important for the inhibition of 8-bromo-cAMP-induced activation of the CRF promoter by GCs intransfected cells (Malkoski et al., 1997; Malkoski andDorin, 1999). We have found using electrophoretic mobilityshift assay (EMSA) that GR binds to the homologousregion of the frog CRF promoters (M. Yao and R.J. Den-ver, unpublished data). However, it is not yet clear in anyspecies whether the direct regulation of CRF by GR isexerted through DNA-binding to these putative GRE sites.

Several lines of evidence suggest that the DNA-bindingfunction of GR is critical for its transactivation function oncertain genes (Reichardt et al., 1998; Scott et al., 1998). Bycontrast, GR repression of AP-1 or NGFI-B-dependenttranscription may not require direct interaction of GR withthe target gene, but rather depends on protein–proteininteraction (or “cross-talk”) to inhibit their transactivationactivity. In fact, GR was found to directly interact withseveral transcription factors including AP-1 (Fos/Jun),NGFI-B, CREB, and nuclear factor-�B (NF-�B) in vitro(Diamond et al., 1990; Jonat et al., 1990; Yang-Yen et al.,1990; Imai et al., 1993; De Bosscher et al., 1997; Martenset al., 2005), and a functional DNA-binding domain is notrequired for GR inhibition of AP-1 at the collagenase pro-moter (Jonat et al., 1990; Schule et al., 1990; Yang-Yenet al., 1990; Heck et al., 1994), or of NGFI-B at the POMCpromoter (Martens et al., 2005). In transgenic mice thatexpress a DNA-binding defective GR mutant the cross-talkbetween GR and other transcription factors was notimpaired (Reichardt et al., 1998).

In addition to the direct protein–protein interactionmodel, a competition mechanism has been proposed whichpostulates that GR antagonizes other transcription factorsby competing for a limited amount of nuclear coactivatorssuch as CBP, p300, and steroid receptor coactivator (SRC)-1 (Kamei et al., 1996; Aarnisalo et al., 1998; Sheppard et al.,1998). However, other studies have argued against thiscompetition model by showing that repression of NF-�Bby GR was not limited by intracellular concentrations ofcoactivators (De Bosscher et al., 2000; De Bosscher et al.,2001).

The GR may also interfere with target gene transcrip-tion indirectly by inhibiting activation of the c-Jun N-ter-minal kinase (JNK), and MAPKs such as the extracellularregulated kinase (ERK) and p38 (Caelles et al., 1997; Swan-tek et al., 1997; Hirasawa et al., 1998; Lasa et al., 2001). Incultured cells DEX increased expression of MAPK phos-phatase MKP-1, an inhibitor of MAPKs (Kassel et al.,2001; Lasa et al., 2002).

Another mechanism by which GCs may regulate CRFgene expression is by modulating mRNA turnover. Treat-ment of rat hypothalamic explants with corticosterone sig-niWcantly reduced CRF mRNA half-life, suggesting that inaddition to their role as repressors of transcription, GCsmay also down-regulate CRF expression by decreasingCRF mRNA stability (Ma et al., 2001).

3.3.1. Nongenomic mechanisms of GC signalingIn addition to the genomic mechanisms of GC actions,

nongenomic actions that are mediated by G-protein cou-pled membrane receptors have also been shown (see Chenand Qiu, 1999; Borski, 2000; Norman et al., 2004, forreviews). At the level of the pituitary gland, GCs adminis-tered to rats intravenously inhibited CRF-induced ACTHsecretion within 15 min, and this eVect was not blocked bypretreatment with the GR antagonist, RU486 (Hinz andHirschelmann, 2000). Similar rapid inhibition by GCs on


CRF-induced ACTH secretion was observed with pituitaryglands in perifusion culture (Widmaier and Dallman, 1984),and DEX rapidly inhibited CRF-induced cAMP accumula-tion and ACTH release by primary rat pituitary cells, aneVect that could not be blocked by inhibition of proteinsynthesis (Bilezikjian and Vale, 1983; Iwasaki et al., 1997).At the hypothalamic level, DEX caused rapid suppressionof basal CRF release from rat hypothalamic explants inperifusion culture (Suda et al., 1985).

In the hippocampus, corticosterone treatment rapidlyincreased synaptic potentiation in the CA1 area in mouse(Wiegert et al., 2006). Since hippocampal neurons project tothe PVN and are thought to inXuence CRF neuronsthrough a GABAergic inhibitory relay mechanism (Her-man et al., 1995; Herman et al., 2002), GCs could rapidlymodulate activity of PVN neurosecretary cells by regulat-ing hippocampal output. Taken together, these studieshighlight the potential for rapid, membrane mediated GCfeedback on HPA activity.

3.4. Nerve growth factor induced gene B (NGFI-B)

Nerve growth factor induced gene B (also termedNur77) is another IEG that is rapidly induced by exposureto stressors. NGFI-B and the related protein Nurr1 areorphan receptors belonging to the steroid/thyroid receptorsuperfamily (Hazel et al., 1988; Milbrandt, 1988). Expres-sion of NGFI-B was rapidly induced in the PVN of rats fol-lowing acute footshock (Rivest and Rivier, 1994) orcapsaicin exposure (Honkaniemi et al., 1994), and in severalbrain regions following seizure (Watson and Milbrandt,1989). Injection (i.c.v.) of CRF also caused an increase inNGFI-B mRNA in the PVN within 30 min, preceding theincrease in CRF mRNA in the same region (Parkes et al.,1993). These results suggest that NGFI-B may be involvedin the stressor-dependent activation of hypothalamicneurons.

The consensus NGFI-B binding site (NGFI-B responseelement; NBRE) comprises a 9 bp sequence AAAAGGTCA (Wilson et al., 1991). A NBRE with 1 bp diVerencefrom the consensus sequence is present in the rat CRF pro-moter (Wilson et al., 1991), but the functional signiWcanceof this element is unknown. Our comparative genomic anal-ysis revealed a perfect NBRE in the X. laevis CRFb genepromoter, and a highly conserved NBRE with 1 bp substi-tution in the corresponding regions of the human, chim-panzee, mouse, and X. laevis CRFa genes (Yao et al., 2007).In the rat anterior pituitary cell line AtT20, treatment withCRF or forskolin rapidly increased nuclear DNA-bindingactivity of NGFI-B dimers (Maira et al., 2003). Similartreatments of AtT20 cells induced NGFI-B expression, andcotransfection with a NGFI-B expression vector resulted ina strong stimulation of the activity of the ovine CRF andPOMC promoters in transfected AtT20 cells (Murphy andConneely, 1997; Kovalovsky et al., 2002). Treatment of themouse adrenocortical cell line Y1 with ACTH rapidlyinduced NGFI-B mRNA, and expression of recombinant

NGFI-B signiWcantly increased the promoter activity of thesteroidogenic enzyme 21-hydroxylase gene in a dose-depen-dent manner (Wilson et al., 1993). In addition, it has alsobeen shown that NGFI-B antagonizes the actions of GR(Phillips et al., 1997; Okabe et al., 1998; Martens et al.,2005). Taken together, NGFI-B (and possibly other familymembers) may mediate stress-regulation of vertebrate CRFgenes in the hypothalamus, the POMC gene in the pituitarycorticotropes, and steroidogenic enzymes in the adrenalglands, and thus coordinate the activity of the HPA/HPIaxis at multiple levels (Murphy and Conneely, 1997).

3.5. Other regulators of CRF expression

Other endocrine factors, in particular gonadal steroids,have been shown to interact with the CRF system to coor-dinate stress responses. For example, consensus estrogenresponse elements (EREs) were identiWed in the humanCRF promoter, and shown to be capable of binding estro-gen receptor (ER) and mediating estrogen’s stimulatoryeVects on gene expression in CV-1 cells (Vamvakopoulosand Chrousos, 1993b). On the other hand, estrogen treat-ment of transfected human placental cells down-regulatedbasal and 8-bromo-cAMP-stimulated CRF promoter activ-ity (Ni et al., 2004). Estrogen replacement of ovariecto-mized monkeys resulted in elevation of CRF mRNA in thePVN, an eVect that was abrogated by progesterone admin-istration (Roy et al., 1999). These Wndings suggest that sexsteroids may regulate CRF gene expression in a tissue spe-ciWc manner, and this direct regulation may explain, inwhole or in part the sexual dimorphism in basal CRFexpression, and gender diVerences in the stress response.

The repressor element silencing transcription factor/neuron-restrictive silencing factor (REST/NRSF) is a zincWnger transcription factor initially thought to repress neu-ronal genes in nonneuronal cells by binding to the repres-sor element-1/neuron-restrictive silencing element (RE-1/NRSE) (Kraner et al., 1992; Mori et al., 1992; Chong et al.,1995; Schoenherr and Anderson, 1995). Later workshowed a more complex regulation of gene expression byREST/NRSF, suggesting that this protein may have func-tions other than its role as a neuron-restrictive silencingfactor (Bessis et al., 1997; Kallunki et al., 1998; Palm et al.,1998). A highly conserved putative RE-1/NRSE is presentin the intron of the CRF genes of human, rat, mouse,sheep, and X. laevis (Seth and Majzoub, 2001). We alsoidentiWed a putative RE-1/NRSE site in the intron of thechicken CRF gene (Table 1). The REST/NRSF binds tothe RE-1/NRSE site in the mouse/rat CRF gene andrepresses transcriptional activity in heterologous transfec-tion assays (Seth and Majzoub, 2001). It is possible thatREST/NRSF plays a role in the developmental and/or tis-sue-speciWc expression of CRF gene but this hypothesishas yet to be tested.

The POU-homeodomain protein Brn-2 has also beenimplicated in the regulation of the CRF gene in thehypothalamus. Brn-2 is required for the development of


hypothalamic CRF neurons in that homozygous Brn-2 nullmice lack CRF neurons (Schonemann et al., 1995). It bindsto the CRF promoter in vitro, and increases CRF promoteractivity in heterologous systems. It is not yet knownwhether this transcription factor is involved in the stressor-dependent regulation of the CRF gene (see Burbach, 2002,for review).

Cytokines (interleukin-1, -2, and -6), GABA, and bio-genic amines such as acetylcholine, serotonin, and norepi-nephrine have also been shown to modulate CRFexpression in vitro and in vivo (see Itoi et al., 1998; Pisarskaet al., 2001, for reviews). However, the intracellular signal-ing pathways induced by these factors, and the cellular pro-cesses that are initiated leading to the regulation of CRFexpression have not been elucidated.

4. Conclusions and future directions

Corticotropin releasing factor plays a central role inmodulating the activity of the HPA/HPI axis, and in coor-dinating behavioral and autonomic aspects of the stressresponse in vertebrates. The expression of CRF in theCNS is under complex regulation by endocrine and neu-ronal signals. At the molecular level, the orchestratedaction of multiple intracellular signaling pathways andtranscription factors is required for transcriptional con-trol of the CRF gene, but many of these pathways arepoorly understood. For example, despite progress onidentifying cis elements that mediate stressor-dependenttranscription, almost nothing is known about the generegulatory sequences that govern tissue speciWc or devel-opmental gene expression. Comparative genomics pro-vides a powerful tool for identifying conserved cisregulatory elements important for developmental, tissue-speciWc and stressor-dependent gene regulation. Futurestudies that rely on the comparative method combinedwith germline transgenesis in vertebrate model systemswith high throughput capacity such as Xenopus shouldallow us to decipher the complex gene regulatory mecha-nisms that inXuence CRF expression.

Table 1Repressor element-1/neuron-restrictive silencing element (RE-1/NRSE)sequences found within the introns of CRF genes of human, mouse, rat,sheep, chicken, and Xenopus laevis (CRFa)

Highly conserved RE-1/NRSE sites are present in the introns of thehuman, mouse, rat, sheep, and X. laevis (gene a) CRF genes (from Sethand Majzoub, 2001). We also identiWed a putative RE-1/NRSE site in theintron of the chicken CRF gene. We could not locate a conserved RE-1/NRSE site in the intron of the X. laevis CRFb gene. The location of thissite within the CRF introns is highly variable among species.

Consensus TTCAGCACCACGGACAGCGCC

Human CRF –––––––––G–––––––––––

Mouse CRF –––––––––G–––––––––T–

Rat CRF –––––––––G–––––––––T–

Sheep CRF ––––––––T––––––––––––

Chicken CRF –––––––––G–––––––– –G–

Xenopus CRFa –––––––––––––––––––AA

Acknowledgment

This work was supported by NSF Grant IBN 0235401to R.J.D.

References

Aarnisalo, P., Palvimo, J.J., Janne, O.A., 1998. CREB-binding protein inandrogen receptor-mediated signaling. Proc. Natl. Acad. Sci. USA 95,2122–2127.

Adler, G.K., Smas, C.M., Majzoub, J.A., 1988. Expression and dexametha-sone regulation of the human corticotropin-releasing hormone gene ina mouse anterior pituitary cell line. J. Biol. Chem. 263, 5846–5852.

Adler, G.K., Rosen, L.B., Fiandaca, M.J., Majzoub, J.A., 1992. Proteinkinase-C activation increases the quantity and poly(A) tail length ofcorticotropin-releasing hormone messenger RNA in NPLC cells. Mol.Endocrinol. 6, 476–484.

Aguilera, G., 1998. Corticotropin releasing hormone, receptor regulationand the stress response. Trends Endocrinol. Metab. 9, 329–336.

Bartanusz, V., Jezova, D., Bertini, L.T., Tilders, F.J.H., Aubry, J.M., Kiss,J.Z., 1993. Stress-induced increase in vasopressin and corticotropin-releasing factor expression in hypophysiotrophic paraventricularneurons. Endocrinology 132, 895–902.

Beaulieu, S., Pelletier, G., Vaudry, H., Barden, N., 1989. InXuence of thedentral nucleus of the amygdala on the content of corticotropin-releas-ing factor in the median eminence. Neuroendocrinology 49, 255–261.

Bessis, A., Champtiaux, N., Chatelin, L., Changeux, J.P., 1997. The neuron-restrictive silencer element: a dual enhancer/silencer crucial for pat-terned expression of a nicotinic receptor gene in the brain. Proc. Natl.Acad. Sci. USA 94, 5906–5911.

Beyer, H.S., Matta, S.G., Sharp, B.M., 1988. Regulation of the messengerribonucleic acid for corticotropin-releasing factor in the paraventricularnucleus and other brain sites of the rat. Endocrinology 123, 2117–2122.

Bilang-Bleuel, A., Rech, J., De Carli, S., Holsboer, F., Reul, J., 2002. Forcedswimming evokes a biphasic response in CREB phosphorylation inextrahypothalamic limbic and neocortical brain structures in the rat.Eur. J. Neurosci. 15, 1048–1060.

Bilezikjian, L.M., Vale, W.W., 1983. Glucocorticoids inhibit corticotropin-releasing factor-induced production of adenosine-3�,5�-monophos-phate in cultured anterior pituitary cells. Endocrinology 113, 657–662.

Boorse, G.C., Denver, R.J., 2006. Widespread tissue distribution anddiverse functions of corticotropin-releasing factor and related peptides.Gen. Comp. Endocrinol. 146, 9–18.

Boorse, G.C., Kholdani, C.A., Seasholtz, A.F., Denver, R.J., 2006. Cortico-tropin-releasing factor is cytoprotective in Xenopus tadpole tail: coor-dination of ligand, receptor, and binding protein in tail muscle cellsurvival. Endocrinology 147, 1498–1507.

Borski, R.J., 2000. Nongenomic membrane actions of glucocorticoids invertebrates. Trends Endocrinol. Metab. 11, 427–436.

Brunson, K.L., Avishai-Eliner, S., Hatalski, C.G., Baram, T.Z., 2001. Neuro-biology of the stress response early in life: evolution of a concept and therole of corticotropin releasing hormone. Mol. Psychiatry 6, 647–656.

Burbach, J.P.H., 2002. Regulation of gene promoters of hypothalamicpeptides. Front. Neuroendocrinol. 23, 342–369.

Caelles, C., Gonzalez-Sancho, J.M., Munoz, A., 1997. Nuclear hormonereceptor antagonism with AP-1 by inhibition of the JNK pathway.Genes Dev. 11, 3351–3364.

Calle, M., Corstens, G.J.H., Wang, L.C., Kozicz, T., Denver, R.J., Barend-regt, H.P., Roubos, E.W., 2005. Evidence that urocortin I acts as a neu-rohormone to stimulate alpha-MSH release in the toad Xenopus laevis.Brain Res. 1040, 14–28.

Ceccatelli, S., Villar, M.J., Goldstein, M., Hokfelt, T., 1989. Expression ofc-Fos immunoreactivity in transmitter-characterized neurons afterstress. Proc. Natl. Acad. Sci. USA 86, 9569–9573.

Chen, Y.-Z., Qiu, J., 1999. Pleiotropic signaling pathways in rapid, non-genomic action of glucocorticoid. Mol. Cell Biol. Res. Commun. 2,145–149.


Chen, Y.C., Hatalski, C.G., Brunson, K.L., Baram, T.Z., 2001. Rapid phos-phorylation of the CRE binding protein precedes stress-induced acti-vation of the corticotropin releasing hormone gene in medialparvocellular hypothalamic neurons of the immature rat. Mol. BrainRes. 96, 39–49.

Cheng, Y.H., Nicholson, R.C., King, B., Chan, E.C., Fitter, J.T., Smith, R.,2000a. Corticotropin-releasing hormone gene expression in primaryplacental cells is modulated by cyclic adenosine 3�,5�- monophosphate.J. Clin. Endocrinol. Metab. 85, 1239–1244.

Cheng, Y.H., Nicholson, R.C., King, B., Chan, E.C., Fitter, J.T., Smith, R.,2000b. Glucocorticoid stimulation of corticotropin-releasing hormonegene expression requires a cyclic adenosine 3�,5�-monophosphate regu-latory element in human primary placental cytotrophoblast cells. J.Clin. Endocrinol. Metab. 85, 1937–1945.

Chong, J.H.A., Tapiaramirez, J., Kim, S., Toledoaral, J.J., Zheng, Y.C.,Boutros, M.C., Altshuller, Y.M., Frohman, M.A., Kraner, S.D., Man-del, G., 1995. Rest: a mammalian silencer protein that restricts sodiumchannel gene expression to neurons. Cell 80, 949–957.

Chrousos, G.P., Gold, P.W., 1992. The concepts of stress and stress systemdisorders—overview of physical and behavioral homeostasis. J. Am.Med. Associat. 267, 1244–1252.

Cole, T.J., Blendy, J.A., Monaghan, A.P., Krieglstein, K., Schmid, W., Agu-zzi, A., Fantuzzi, G., Hummler, E., Unsicker, K., Schutz, G., 1995. Tar-geted disruption of the glucocorticoid receptor gene blocks adrenergicchromaYn cell development and severely retards lung maturation.Genes Dev. 9, 1608–1621.

Conti, A.C., Kuo, Y.C., Valentino, R.J., Blendy, J.A., 2004. InduciblecAMP early repressor regulates corticosterone suppression after tricy-clic antidepressant treatment. J. Neurosci. 24, 1967–1975.

Crespi, E.J., Denver, R.J., 2004. Ontogeny of corticotropin-releasing factoreVects on locomotion and foraging in the Western spadefoot toad(Spea hammondii). Horm. Behav. 46, 399–410.

Crespi, E.J., Vaudry, H., Denver, R.J., 2004. Roles of corticotropin-releas-ing factor, neuropeptide Y and corticosterone in the regulation of foodintake in Xenopus laevis. J. Neuroendocrinol. 16, 279–288.

Croiset, G., Nijsen, M., Kamphuis, P., 2000. Role of corticotropin-releas-ing factor, vasopressin and the autonomic nervous system in learningand memory. Eur. J. Pharmacol. 405, 225–234.

Cullinan, W.E., Herman, J.P., Battaglia, D.F., Akil, H., Watson, S.J., 1995.Pattern and time-course of immediate-early gene expression in ratbrain following acute stress. Neuroscience 64, 477–505.

Cummings, S., Elde, R., Ells, J., Lindall, A., 1983. Corticotropin-releasingfactor immunoreactivity is widely distributed within the central ner-vous system of the rat: an immunohistochemical study. J. Neurosci. 3,1355–1368.

Dallman, M.F., Akana, S.F., Scribner, K.A., Bradbury, M.J., Walker, C.D.,Strack, A.M., Cascio, C.S., 1992. Stress, feedback and facilitation in thehypothalamopituitary–adrenal axis. J. Neuroendocrinol. 4, 517–526.

De Bosscher, K., Schmitz, M.L., Vanden Berghe, W., Plaisance, S., Fiers, W.,Haegeman, G., 1997. Glucocorticoid-mediated repression of nuclear fac-tor-kappa B-dependent transcription involves direct interference withtransactivation. Proc. Natl. Acad. Sci. USA 94, 13504–13509.

De Bosscher, K., Berghe, W.V., Vermeulen, L., Plaisance, S., Boone, E.,Haegeman, G., 2000. Glucocorticoids repress NF-kappa B-drivengenes by disturbing the interaction of p65 with the basal transcriptionmachinery, irrespective of coactivator levels in the cell. Proc. Natl.Acad. Sci. USA 97, 3919–3924.

De Bosscher, K., Vanden Berghe, W., Haegeman, G., 2001. Glucocorticoidrepression of AP-1 is not mediated by competition for nuclear coacti-vators. Mol. Endocrinol. 15, 219–227.

De Groef, B., Van der Geyten, S., Darras, V.M., Kuhn, E.R., 2006. Role ofcorticotropin-releasing hormone as a thyrotropin-releasing factor innon-mammalian vertebrates. Gen. Comp. Endocrinol. 146, 62–68.

De Kloet, E.R., Vreugdenhil, E., Oitzl, M.S., Joels, M., 1998. Brain corticoste-roid receptor balance in health and disease. Endocr. Rev. 19, 269–301.

Della Fazia, M.A., Servillo, G., Foulkes, N.S., Sassone-Corsi, P., 1998.Stress-induced expression of transcriptional repressor ICER in theadrenal gland. FEBS Lett. 434, 33–36.

Denver, R.J., Boorse, G.C., Glennemeier, K.A., 2002. Endocrinology ofcomplex life cycles: Amphibians. In: PfaV, D., Arnold, A., Fahrbach, S.,Moss, R., Rubin, R. (Eds.), Hormones, Brain and Behavior. AcademicPress Inc., San Diego, pp. 469–513.

Diamond, M.I., Miner, J.N., Yoshinaga, S.K., Yamamoto, K.R., 1990.Transcription factor interactions—selectors of positive or negative reg-ulation from a single DNA element. Science 249, 1266–1272.

Dijkstra, I., Tilders, F.J.H., Aguilera, G., Kiss, A., Rabadan-Diehl, C., Bar-den, N., Karanth, S., Holsboer, F., Reul, J., 1998. Reduced activity ofhypothalamic corticotropin-releasing hormone neurons in transgenicmice with impaired glucocorticoid receptor function. J. Neurosci. 18,3909–3918.

Doyon, C., Gilmour, K.M., Trudeau, V.L., Moon, T.W., 2003. Corticotro-pin-releasing factor and neuropeptide Y mRNA levels are elevated inthe preoptic area of socially subordinate rainbow trout. Gen. Comp.Endocrinol. 133, 260–271.

Doyon, C., Trudeau, V.L., Moon, T.W., 2005. Stress elevates corticotropin-releasing factor (CRF) and CRF-binding protein mRNA levels in rain-bow trout (Oncorhynchus mykiss). J. Endocrinol. 186, 123–130.

Dunn, J.D., 1987. Plasma corticosterone responses to electrical stimulationof the bed nucleus of the stria terminalis. Brain Res. 407, 327–331.

Emanuel, R.L., Girard, D.M., Thull, D.L., Majzoub, J.A., 1990. 2nd mes-sengers involved in the regulation of corticotropin-releasing hormonemessenger-RNA and peptide in cultured rat fetal hypothalamic pri-mary cultures. Endocrinology 126, 3016–3021.

Emmert, M.H., Herman, J.P., 1999. DiVerential forebrain c-fos mRNAinduction by ether inhalation and novelty: evidence for distinctivestress pathways. Brain Res. 845, 60–67.

Feldman, S., Weidenfeld, J., 2002. Further evidence for the central eVect ofdexamethasone at the hypothalamic level in the negative feedbackmechanism. Brain Res. 958, 291–296.

Fenoglio, K.A., Brunson, K.L., Baram, T.Z., 2006. Hippocampal neuro-plasticity induced by early-life stress: functional and molecular aspects.Front. Neuroendocrinol. 27, 180–192.

Flik, G., Klaren, P.H.M., Van den Burg, E.H., Metz, J.R., Huising, M.O.,2006. CRF and stress in Wsh. Gen. Comp. Endocrinol. 146, 36–44.

Funder, J.W., 1997. Glucocorticoid and mineralocorticoid receptors: biol-ogy and clinical relevance. Annu. Rev. Med. 48, 231–240.

Gass, P., Kretz, O., Wolfer, D.P., Berger, S., Tronche, F., Reichardt, H.M.,Kellendonk, C., Lipp, H.P., Schmid, W., Schutz, G., 2000. Genetic dis-ruption of mineralocorticoid receptor leads to impaired neurogenesisand granule cell degeneration in the hippocampus of adult mice.EMBO Rep. 1, 447–451.

Gass, P., Reichardt, H.M., Strekalova, T., Henn, F., Tronche, F., 2001.Mice with targeted mutations of glucocorticoid and mineralocorticoidreceptors: models for depression and anxiety? Physiol. Behav. 73,811–825.

Gray, T.S., 1993. Amygdaloid CRF pathways: role in autonomic, neuroen-docrine, and behavioral responses to stress. In: McCubbin, J.A., Kauf-man, P.G., NemeroV, C.B. (Eds.), Corticotropin-Releasing Factor andCytokines: Role in the Stress Response. Academic Press, New York,pp. 53–60.

Gray, T.S., Piechowski, R.A., Yracheta, J.M., Rittenhouse, P.A., Bethea, C.L.,Vandekar, L.D., 1993. Ibotenic acid lesions in the bed nucleus of the striaterminalis attenuate conditioned stress-induced increases in Prolactin,ACTH and corticosterone. Neuroendocrinology 57, 517–524.

Guardiola-Diaz, H.M., Boswell, C., Seasholtz, A.F., 1994. The cAMP-responsive element in the corticotropin-releasing hormone gene medi-ates transcriptional regulation by depolarization. J. Biol. Chem. 269,14784–14791.

Guardiola-Diaz, H.M., Kolinske, J.S., Gates, L.H., Seasholtz, A.F., 1996.Negative glucocorticoid regulation of cyclic adenosine 3�,5�-mono-phosphate-stimulated corticotropin-releasing hormone–reporterexpression in AtT-20 cells. Mol. Endocrinol. 10, 317–329.

Gulpinar, M.A., Yegen, B.C., 2004. The physiology of learning and mem-ory: role of peptides and stress. Curr. Protein Peptide Sci. 5, 457–473.

Hatalski, C.G., Baram, T.Z., 1997. Stress-induced transcriptional regula-tion in the developing rat brain involves increased cyclic adenosine


3�,5�-monophosphate regulatory element binding activity. Mol. Endo-crinol. 11, 2016–2024.

Hazel, T.G., Nathans, D., Lau, L.F., 1988. A gene inducible by serumgrowth factors encodes a member of the steroid and thyroid hormonereceptor superfamily. Proc. Natl. Acad. Sci. USA 85, 8444–8448.

Heck, S., Kullmann, M., Gast, A., Ponta, H., Rahmsdorf, H.J., Herrlich, P.,Cato, A.C.B., 1994. A distinct modulating domain in glucocorticoidreceptor monomers in the repression of activity of the transcriptionfactor AP-1. EMBO J. 13, 4087–4095.

Heinrichs, S.C., Koob, G.F., 2004. Corticotropin-releasing factor in brain:a role in activation, arousal, and aVect regulation. J. Pharmacol. Exp.Ther. 311, 427–440.

Herman, J.P., Schafer, M.K.H., Sladek, C.D., Day, R., Young, E.A., Akil,H., Watson, S.J., 1989a. Chronic electroconvulsive shock treatmentelicits up-regulation of CRF and AVP messenger RNA in select popu-lations of neuroendocrine neurons. Brain Res. 501, 235–246.

Herman, J.P., Schafer, M.K.H., Young, E.A., Thompson, R., Douglass, J.,Akil, H., Watson, S.J., 1989b. Evidence for hippocampal regulation ofneuro-endocrine neurons of the hypothalamo pituitary adrenocorticalaxis. J. Neurosci. 9, 3072–3082.

Herman, J.P., Schafer, M.K.H., Thompson, R.C., Watson, S.J., 1992. Rapidregulation of corticotropin-releasing hormone gene transcriptionin vivo. Mol. Endocrinol. 6, 1061–1069.

Herman, J.P., Cullinan, W.E., Watson, S.J., 1994. Involvement of the bednucleus of the stria terminalis in tonic regulation of paraventricularhypothalamic CRH and AVP messenger-RNA expression. J. Neuroen-docrinol. 6, 433–442.

Herman, J.P., Cullinan, W.E., Morano, M.I., Akil, H., Watson, S.J., 1995.Contribution of the ventral subiculum to inhibitory regulation of thehypothalamo–pituitary–adrenocortical axis. J. Neuroendocrinol. 7,475–482.

Herman, J.P., Prewitt, C.M.F., Cullinan, W.E., 1996. Neuronal circuit regu-lation of the hypothalamo–pituitary–adrenocortical stress axis. Crit.Rev. Neurobiol. 10, 371–394.

Herman, J.P., Cullinan, W.E., 1997. Neurocircuitry of stress: central con-trol of the hypothalamo–pituitary–adrenocortical axis. Trends Neuro-sci. 20, 78–84.

Herman, J.P., Cullinan, W.E., Ziegler, D.R., Tasker, J.G., 2002. Role of theparaventricular nucleus microenvironment in stress integration. Eur. J.Neurosci. 16, 381–385.

Hinz, B., Hirschelmann, R., 2000. Rapid non-genomic feedback eVects ofglucocorticoids on CRF-induced ACTH secretion in rats. Pharm. Res.17, 1273–1277.

Hirasawa, N., Sato, Y., Fujita, Y., Mue, S., Ohuchi, K., 1998. Inhibition bydexamethasone of antigen-induced c-Jun N-terminal kinase activationin rat basophilic leukemia cells. J. Immunol. 161, 4939–4943.

Hiroi, H., Christenson, L.K., Chang, L., Sammel, M.D., Berger, S.L.,Strauss, J.F., 2004. Temporal and spatial changes in transcription fac-tor binding and histone modiWcations at the steroidogenic acute regu-latory protein (StAR) locus associated with StAR transcription. Mol.Endocrinol. 18, 791–806.

HoVman, G.E., Smith, M.S., Verbalis, J.G., 1993. c-Fos and related imme-diate-early gene products as markers of activity in neuroendocrine sys-tems. Front. Neuroendocrinol. 14, 173–213.

Honkaniemi, J., Kainu, T., Ceccatelli, S., Rechardt, L., Hokfelt, T., Pelt-ohuikko, M., 1992. Fos and Jun in rat central amygdaloid nucleus andparaventricular nucleus after stress. Neuroreport 3, 849–852.

Honkaniemi, J., Kononen, J., Kainu, T., Pyykonen, I., Peltohuikko, M.,1994. Induction of multiple immediate-early genes in rat hypotha-lamic paraventricular nucleus after stress. Mol. Brain Res. 25, 234–241.

Hsu, D.T., Chen, F.L., Takahashi, L.K., Kalin, N.H., 1998. Rapid stress-induced elevations in corticotropin-releasing hormone mRNA in ratcentral amygdala nucleus and hypothalamic paraventricular nucleus:an in situ hybridization analysis. Brain Res. 788, 305–310.

Huising, M., Metz, J.R., van Schooten, C., Taverne-Thiele, A.J., Hermsen,T., Verburg-van Kemanade, B.M.L., Flik, G., 2004. Structural charac-terisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-

R1, and the role of these proteins in the acute stress response. J. Mol.Endocrinol. 32, 627–648.

Imai, E., Miner, J.N., Mitchell, J.A., Yamamoto, K.R., Granner, D.K.,1993. Glucocorticoid receptor-cAMP response element binding pro-tein interaction and the response of the phosphoenolpyruvate carboxy-kinase gene to glucocorticoids. J. Biol. Chem. 268, 5353–5356.

Imaki, T., Nahan, J.L., Rivier, C., Sawchenko, P.E., Vale, W., 1991. DiVer-ential regulation of corticotropin-releasing factor messenger RNA inrat brain regions by glucocorticoids and stress. J. Neurosci. 11, 585–599.

Imaki, T., Shibasaki, T., Hotta, M., Demura, H., 1992. Early Induction ofc-fos precedes increased expression of corticotropin-releasing factormessenger ribonucleic acid in the paraventricular nucleus after immo-bilization stress. Endocrinology 131, 240–246.

Imaki, T., Shibasaki, T., Hotta, M., Demura, H., 1993. Intracerebroventric-ular administration of corticotropin-releasing factor induces c-fosmRNA expression in brain regions related to stress responses—com-parison with pattern of c-fos mRNA induction after stress. Brain Res.616, 114–125.

Imaki, T., Wang, X.Q., Shibasaki, T., Yamada, K., Harada, S., Chikada, N.,Naruse, M., Demura, H., 1995. Stress-induced activation of neuronalactivity and corticotropin-releasing factor gene expression in the para-ventricular nucleus is modulated by glucocorticoids in rats. J. Clin.Invest. 96, 231–238.

Imaki, T., Naruse, M., Harada, S., Chikada, N., Imaki, J., Onodera, H.,Demura, H., Vale, W., 1996. Corticotropin-releasing factor up-regu-lates its own receptor mRNA in the paraventricular nucleus of thehypothalamus. Mol. Brain Res. 38, 166–170.

Imaki, T., Katsumata, H., Miyata, M., Naruse, M., Imaki, J., Minami, S.,2001. Expression of corticotropin-releasing hormone type 1 receptor inparaventricular nucleus after acute stress. Neuroendocrinology 73,293–301.

Itoi, K., Horiba, N., Tozawa, F., Sakai, Y., Sakai, K., Abe, K., Demura, H.,Suda, T., 1996. Major role of 3�,5�-cyclic adenosine monophosphate-dependent protein kinase A pathway in corticotropin-releasing factorgene expression in the rat hypothalamus in vivo. Endocrinology 137,2389–2396.

Itoi, K., Seasholtz, A.F., Watson, S.J., 1998. Cellular and extracellular regu-latory mechanisms of hypothalamic corticotropin-releasing hormoneneurons. Endocr. J. 45, 13–33.

Iwasaki, Y., Aoki, Y., Katahira, M., Oiso, Y., Saito, H., 1997. Non-genomicmechanisms of glucocorticoid inhibition of adrenocorticotropin secre-tion: possible involvement of GTP-binding protein. Biochem. Biophys.Res. Commun. 235, 295–299.

Jacobson, L., Sapolsky, R., 1991. The role of the hippocampus in feed-back-regulation of the hypothalamic–pituitary–adrenocortical axis.Endocr. Rev. 12, 118–134.

Jingami, H., Matsukura, S., Numa, S., Imura, H., 1985. EVects of adrenal-ectomy and dexamethasone administration on the level of prepro-cor-ticotropin-releasing factor messenger ribonucleic acid (messengerRNA) in the hypothalamus and adrenocorticotropin-beta-lipotropinprecursor messenger RNA in the pituitary in rats. Endocrinology 117,1314–1320.

Johannessen, M., Delghandi, M.P., Moens, U., 2004. What turns CREBon? Cell Signal 16, 1211–1227.

Jonat, C., Rahmsdorf, H.J., Park, K.K., Cato, A.C.B., Gebel, S., Ponta, H.,Herrlich, P., 1990. Antitumor promotion and antiinXammation—down-modulation of Ap-1 (Fos Jun) activity by glucocorticoid hor-mone. Cell 62, 1189–1204.

Kalin, N.H., Takahashi, L.K., Chen, F.L., 1994. Restraint stress increasescorticotropin-releasing hormone messenger-RNA content in the amyg-dala and paraventricular nucleus. Brain Res. 656, 182–186.

Kallunki, P., Edelman, G.M., Jones, F.S., 1998. The neural restrictivesilencer element can act as both a repressor and enhancer of L1 celladhesion molecule gene expression during postnatal development.Proc. Natl. Acad. Sci. USA 95, 3233–3238.

Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin,S.C., Heyman, R.A., Rose, D.W., Glass, C.K., Rosenfeld, M.G., 1996. A


CBP integrator complex mediates transcriptional activation and AP-1inhibition by nuclear receptors. Cell 85, 403–414.

Kasckow, J., Mulchahey, J.J., Aguilera, G., Pisarska, M., Nikodemova, M.,Chen, H.C., Herman, J.P., Murphy, E.K., Liu, Y., Rizvi, T.A., Dautzen-berg, F.M., SheriV, S., 2003. Corticotropin-releasing hormone (CRH)expression and protein kinase A mediated CRH receptor signalling inan immortalized hypothalamic cell line. J. Neuroendocrinol. 15,521–529.

Kasckow, J.W., Regmi, A., Gill, P.S., Parkes, D.G., Geracioti, T.D., 1997.Regulation of corticotropin-releasing factor (CRF) messenger ribonu-cleic acid and crf peptide in the amygdala: studies in primary amygda-lar cultures. Endocrinology 138, 4774–4782.

Kassel, O., Sancono, A., Kratzschmar, J., Kreft, B., Stassen, M., Cato,A.C.B., 2001. Glucocorticoids inhibit MAP kinase via increased expres-sion and decreased degradation of MKP-1. EMBO J. 20, 7108–7116.

Kell, C.A., Dehghani, F., Wicht, H., Molina, C.A., Korf, H.W., Stehle, J.H.,2004. Distribution of transcription factor inducible cyclicAMP earlyrepressor (ICER) in rodent brain and pituitary. J. Comp. Neurol. 478,379–394.

King, B.R., Smith, R., Nicholson, R.C., 2002. Novel glucocorticoid andcAMP interactions on the CRH gene promoter. Mol. Cell. Endocrinol.194, 19–28.

Kiss, A., Palkovits, M., Aguilera, G., 1996. Neural regulation of corticotropinreleasing hormone (CRH) and CRH receptor mRNA in the hypotha-lamic paraventricular nucleus in the rat. J. Neuroendocrinol. 8, 103–112.

Kovacs, K.J., Sawchenko, P.E., 1996a. Regulation of stress-induced tran-scriptional changes in the hypothalamic neurosecretory neurons. J.Mol. Neurosci. 7, 125–133.

Kovacs, K.J., Sawchenko, P.E., 1996b. Sequence of stress-induced altera-tions in indices of synaptic and transcriptional activation on parvocel-lular neurosecretory neurons. J. Neurosci. 16, 262–273.

Kovacs, K.J., Arias, C., Sawchenko, P.E., 1998. Protein synthesis blockadediVerentially aVects the stress-induced transcriptional activation ofneuropeptide genes in parvocellular neurosecretory neurons. Mol.Brain Res. 54, 85–91.

Kovalovsky, D., Refojo, D., Liberman, A.C., Hochbaum, D., Pereda, M.P.,Coso, O.A., Stalla, G.K., Holsboer, F., Arzt, E., 2002. Activation andinduction of NUR77/NURR1 in corticotrophs by CRH/cAMP:involvement of calcium, protein kinase A, and MAPK pathways. Mol.Endocrinol. 16, 1638–1651.

Kraner, S.D., Chong, J.A., Tsay, H.J., Mandel, G., 1992. Silencing the type-II sodium channel gene: a model for neural-speciWc gene regulation.Neuron 9, 37–44.

Kwak, S.P., Young, E.A., Morano, I., Watson, S.J., Akil, H., 1992. Diurnalcorticotropin-releasing hormone messenger-RNA variation in thehypothalamus exhibits a rhythm distinct from that of plasma cortico-sterone. Neuroendocrinology 55, 74–83.

Kwak, S.P., Morano, M.I., Young, E.A., Watson, S.J., Akil, H., 1993. Diur-nal CRH messenger RNA rhythm in the hypothalamus: decreasedexpression in the evening is not dependent on endogenous glucocorti-coids. Neuroendocrinology 57, 96–105.

Lasa, M., Brook, M., Saklatvala, J., Clark, A.R., 2001. Dexamethasonedestabilizes cyclooxygenase 2 mRNA by inhibiting mitogen-activatedprotein kinase p38. Mol. Cell. Biol. 21, 771–780.

Lasa, M., Abraham, S.M., Boucheron, C., Saklatvala, J., Clark, A.R., 2002.Dexamethasone causes sustained expression of mitogen-activated pro-tein kinase (MAPK) phosphatase 1 and phosphatase-mediated inhibi-tion of MAPK p38. Mol. Cell. Biol. 22, 7802–7811.

Liang, K.C., Lee, E.H.Y., 1988. Intra-amygdala injections of corticotropin-releasing factor facilitate inhibitory avoidance-learning and reduceexploratory-behavior in rats. Psychopharmacology 96, 232–236.

Liang, K.C., Melia, K.R., Campeau, S., Falls, W.A., Miserendino, M.J.D.,Davis, M., 1992. Lesions of the central nucleus of the amygdala, butnot the paraventricular nucleus of the hypothalamus, block the excit-atory eVects of corticotropin-releasing factor on the acoustic startlereXex. J. Neurosci. 12, 2313–2320.

Liu, Y., Curtis, J.T., Fowler, C.D., Spencer, C., Houpt, T., Wang, Z.X.,2001. DiVerential expression of vasopressin, oxytocin and corticotro-

phin-releasing hormone messenger RNA in the paraventricularnucleus of the prairie vole brain following stress. J. Neuroendocrinol.13, 1059–1065.

Lonze, B.E., Ginty, D.D., 2002. Function and regulation of CREB familytranscription factors in the nervous system. Neuron 35, 605–623.

Lovejoy, D.A., Balment, R.J., 1999. Evolution and physiology of the corti-cotropin-releasing factor (CRF) family of neuropeptides in verte-brates. Gen. Comp. Endocrinol. 115, 1–22.

Lu, W.Q., Dow, L., Gumusgoz, S., Brierley, M.J., Warne, J.M., McCrohan,C.R., Balment, R.J., Riccardi, D., 2004. Coexpression of corticotropin-releasing hormone and urotensin I precursor genes in the caudal neu-rosecretory system of the euryhaline Xounder (Platichthys Xesus): apossible shared role in peripheral regulation. Endocrinology 145,5786–5797.

Luo, X., Kiss, A., Makara, G., Lolait, S.J., Aguilera, G., 1994. Stress-spe-ciWc regulation of corticotropin-releasing hormone receptor expressionin the paraventricular and supraoptic nuclei of the hypothalamus inthe rat. J. Neuroendocrinol. 6, 689–696.

Ma, X.M., Levy, A., Lightman, S.L., 1997a. Rapid changes in heteronu-clear RNA for corticotrophin-releasing hormone and arginine vaso-pressin in response to acute stress. J. Endocrinol. 152, 81–89.

Ma, X.M., Levy, A., Lightman, S.L., 1997b. Emergence of an isolated argininevasopressin (AVP) response to stress after repeated restraint: a study ofboth AVP and corticotropin-releasing hormone messenger ribonucleicacid (RNA) and heteronuclear RNA. Endocrinology 138, 4351–4357.

Ma, X.M., Camacho, C., Aguilera, G., 2001. Regulation of corticotropin-releasing hormone (CRH) transcription and CRH mRNA stability byglucocorticoids. Cell Mol. Neurobiol. 21, 465–475.

Maira, M., Martens, C., Batsche, E., Gauthier, Y., Drouin, J., 2003. Dimer-speciWc potentiation of NGFI-B (Nur77) transcriptional activity by theprotein kinase a pathway and AF-1-dependent coactivator recruit-ment. Mol. Cell. Biol. 23, 763–776.

Majzoub, J.A., McGregor, J.A., Lockwood, C.J., Smith, R., Taggart, M.S.,Schulkin, J., 1999. A central theory of preterm and term labor: putativerole for corticotropin-releasing hormone. Am. J. Obstet. Gynecol. 180,S232–S241.

Makino, S., Gold, P.W., Schulkin, J., 1994a. EVects of corticosterone onCRH messenger RNA and content in the bed nucleus of the stria ter-minalis—comparison with the eVects in the central nucleus of theamygdala and the paraventricular nucleus of the hypothalamus. BrainRes. 657, 141–149.

Makino, S., Gold, P.W., Schulkin, J., 1994b. Corticosterone eVects on corti-cotropin-releasing hormone messenger RNA in the central nucleus ofthe amygdala and the parvocellular region of the paraventricularnucleus of the hypothalamus. Brain Res. 640, 105–112.

Makino, S., Shibasaki, T., Yamauchi, N., Nishioka, T., Mimoto, T., Waka-bayashi, I., Gold, P.W., Hashimoto, K., 1999. Psychological stressincreased corticotropin-releasing hormone mRNA and content in thecentral nucleus of the amygdala but not in the hypothalamic paraven-tricular nucleus in the rat. Brain Res. 850, 136–143.

Makino, S., Hashimoto, K., Gold, P.W., 2002. Multiple feedback mecha-nisms activating corticotropin-releasing hormone system in the brainduring stress. Pharmacol. Biochem. Behav. 73, 147–158.

Malkoski, S.P., Handanos, C.M., Dorin, R.I., 1997. Localization of a nega-tive glucocorticoid response element of the human corticotropinreleasing hormone gene. Mol. Cell. Endocrinol. 127, 189–199.

Malkoski, S.P., Dorin, R.I., 1999. Composite glucocorticoid regulation at afunctionally deWned negative glucocorticoid response element of thehuman corticotropin-releasing hormone gene. Mol. Endocrinol. 13,1629–1644.

Mamalaki, E., Kvetnansky, R., Brady, L.S., Gold, P.W., Herkenham, M.,1992. Repeated immobilization stress alters tyrosine hydroxylase, cor-ticotropin-releasing hormone and corticosteroid receptor messengerribonucleic acid levels in rat brain. J. Neuroendocrinol. 4, 689–699.

Martens, C., Bilodeau, S., Maira, M., Gauthier, Y., Drouin, J., 2005. Pro-tein-protein interactions and transcriptional antagonism between thesubfamily of NGFI-B/Nur77 orphan nuclear receptors and glucocorti-coid receptor. Mol. Endocrinol. 19, 885–897.


Mastorakos, G., Zapanti, E., 2004. Thy hypothalamic–pituitary–adrenalaxis in the neuroendocrine regulation of food intake and obesity: therole of corticotropin releasing hormone. Nutr. Neurosci. 7, 271–280.

Mayr, B., Montminy, M., 2001. Transcriptional regulation by the phos-phorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2, 599–609.

Mazzucchelli, C., Sassone-Corsi, P., 1999. The inducible cyclic adenosinemonophosphate early repressor (ICER) in the pituitary intermediatelobe: role in the stress response. Mol. Cell Endocrinol. 155, 101–113.

McEwen, B.S., Stellar, E., 1993. Stress and the individual: mechanismsleading to disease. Arch. Intern. Med. 153, 2093–2101.

McMahon, S.B., Monroe, J.G., 1992. Role of primary response genes ingenerating cellular responses to growth factors. FASEB J. 6, 2707–2715.

Meijer, O.C., de Kloet, E.R., 1998. Corticosterone and serotonergic neuro-transmission in the hippocampus: functional implications of centralcorticosteroid receptor diversity. Crit. Rev. Neurobiol. 12, 1–20.

Merali, Z., McIntosh, J., Kent, P., Michaud, D., Anisman, H., 1998. Aver-sive and appetitive events evoke the release of corticotropin-releasinghormone and bombesin-like peptides at the central nucleus of theamygdala. J. Neurosci. 18, 4758–4766.

Milbrandt, J., 1988. Nerve growth factor induces a gene homologous tothe glucocorticoid receptor gene. Neuron 1, 183–188.

Miner, J.N., Yamamoto, K.R., 1992. The basic region of AP-1 speciWes glu-cocorticoid receptor activity at a composite response element. GenesDev. 6, 2491–2501.

Mioduszewska, B., Jaworski, J., Kaczmarek, L., 2003. Inducible cAMPearly repressor (ICER) in the nervous system—a transcriptional regu-lator of neuronal plasticity and programmed cell death. J. Neurochem.87, 1313–1320.

Mori, N., Schoenherr, C., Vandenbergh, D.J., Anderson, D.J., 1992. A com-mon silencer element in the Scg-10 and Type-II Na+ channel genesbinds a factor present in nonneuronal cells but not in neuronal cells.Neuron 9, 45–54.

Muglia, L.J., Jenkins, N.A., Gilbert, D.J., Copeland, N.G., Majzoub, J.A.,1994. Expression of the mouse corticotropin-releasing hormone genein vivo and targeted inactivation in embryonic stem cells. J. Clin. Invest.93, 2066–2072.

Murphy, E.P., Conneely, O.M., 1997. Neuroendocrine regulation of thehypothalamic pituitary adrenal axis by the nurr1/nur77 subfamily ofnuclear receptors. Mol. Endocrinol. 11, 39–47.

Ni, X., Hou, Y., King, B.R., Tang, X.L., Read, M.A., Smith, R., Nicholson,R.C., 2004. Estrogen receptor-mediated down-regulation of corticotro-pin-releasing hormone gene expression is dependent on a cyclic adeno-sine 3�,5�-monophosphate regulatory element in human placentalsyncytiotrophoblast cells. J. Clin. Endocrinol. Metab. 89, 2312–2318.

Norman, A.W., Mizwicki, M.T., Norman, D.P.G., 2004. Steroid-hormonerapid actions, membrane receptors and a conformational ensemblemodel. Nat. Rev. Drug Discov. 3, 27–41.

Okabe, T., Takayanagi, R., Adachi, M., Imasaki, K., Nawata, H., 1998.Nur77, a member of the steroid receptor superfamily, antagonizes neg-ative feedback of ACTH synthesis and secretion by glucocorticoid inpituitary corticotrope cells. J. Endocrinol. 156, 169–175.

Orozco-Cabal, L., Pollandt, S., Liu, J., Shinnick-Gallagher, P., Gallagher,J.P., 2006. Regulation of synaptic transmission by CRF receptors. Rev.Neurosci. 17, 279–307.

Ovcharenko, I., Nobrega, M.A., Loots, G.G., Stubbs, L., 2004. ECRBrowser: a tool for visualizing and accessing data from comparisons ofmultiple vertebrate genomes. Nucleic Acids Res. 32, W280–W286.

Palm, K., Belluardo, N., Metsis, M., Timmusk, T., 1998. Neuronal expres-sion of zinc Wnger transcription factor REST/NRSF/XRB gene. J.Neurosci. 18, 1280–1296.

Parkes, D., Rivest, S., Lee, S., Rivier, C., Vale, W., 1993. Corticotropin-releasing factor activates c-Fos, NGFI-B, and corticotropin-releasingfactor gene-expression within the paraventricular nucleus of the rathypothalamus. Mol. Endocrinol. 7, 1357–1367.

Pepels, P., Meek, J., Bonga, S.E.W., Balm, P.H.M., 2002. Distribution andquantiWcation of corticotropin-releasing hormone (CRH) in the brain

of the teleost Wsh Oreochromis mossambicus (tilapia). J. Comp. Neurol.453, 247–268.

Pepels, P., van Helvoort, H., Bonga, S.E.W., Balm, P.H.M., 2004. Cortico-tropin-releasing hormone in the teleost stress response: rapid appear-ance of the peptide in plasma of tilapia (Oreochromis mossambicus). J.Endocrinol. 180, 425–438.

Petrusz, P., Merchenthaler, I., Maderdrut, J.L., Heitz, P.U., 1985. Centraland peripheral distribution of corticotropin-releasing factor. Fed. Proc.44, 229–235.

Phillips, A., Maira, M., Mullick, A., Chamberland, M., Lesage, S., Hugo, P.,Drouin, J., 1997. Antagonism between Nur77 and glucocorticoidreceptor for control of transcription. Mol. Cell. Biol. 17, 5952–5959.

Pisarska, M., Mulchahey, J.J., SheriV, S., Geracioti, T.D., Kasckow, J.W.,2001. Regulation of corticotropin-releasing hormone in vitro. Peptides22, 705–712.

Plotsky, P.M., Sawchenko, P.E., 1987. Hypophyseal-portal plasma levels,median eminence content, and immunohistochemical staining of corti-cotropin-releasing factor, arginine vasopressin, and oxytocin afterpharmacological adrenalectomy. Endocrinology 120, 1361–1369.

Prewitt, C.M., Herman, J.P., 1994. Lesion of the central nucleus of theamygdala decreases basal CRH messenger RNA expression and stress-induced ACTH release. Ann. NY Acad. Sci. 746, 438–440.

Reichardt, H.M., Kaestner, K.H., Tuckermann, J., Kretz, O., Wessely, O.,Bock, R., Gass, P., Schmid, W., Herrlich, P., Angel, P., Schutz, G., 1998.DNA binding of the glucocorticoid receptor is not essential for sur-vival. Cell 93, 531–541.

Richard, S., Martinez-Garcia, F., Lanuza, E., Davies, D.C., 2004. Distribu-tion of corticotropin-releasing factor-immunoreactive neurons in thecentral nervous system of the domestic chicken and Japanese quail. J.Comp. Neurol. 469, 559–580.

Richards, J.P., Bachinger, H.P., Goodman, R.H., Brennan, R.G., 1996.Analysis of the structural properties of cAMP-responsive element-binding protein (CREB) and phosphorylated CREB. J. Biol. Chem.271, 13716–13723.

Rivest, S., Rivier, C., 1994. Stress and interleukin-1-beta-induced activa-tion of c-Fos, NGFI-B and CRF gene expression in the hypothalamicPVN—comparison between Sprague–Dawley, Fisher-344 and Lewisrats. J. Neuroendocrinol. 6, 101–117.

Rivest, S., LaXamme, N., Nappi, R.E., 1995. Immune challenge and immo-bilization stress induce transcription of the gene encoding the CRFreceptor in selective nuclei of the rat hypothalamus. J. Neurosci. 15,2680–2695.

Robertson, H.A., 1992. Immediate-early genes, neuronal plasticity, andmemory. Biochem. Cell Biol. 70, 729–737.

Rosen, L.B., Majzoub, J.A., Adler, G.K., 1992. EVects of glucocorticoidon corticotropin-releasing hormone gene-regulation by 2nd mes-senger pathways in NPLC and ATT-20 cells. Endocrinology 130,2237–2244.

Roy, B.N., Reid, R.L., Van Vugt, D.A., 1999. The eVects of estrogen andprogesterone on corticotropin-releasing hormone and arginine vaso-pressin messenger ribonucleic acid levels in the paraventricular nucleusand supraoptic nucleus of the rhesus monkey. Endocrinology 140,2191–2198.

Sapolsky, R.M., Krey, L.C., McEwen, B.S., 1984. Stress down-regulatescorticosterone receptors in a site-speciWc manner in the brain. Endocri-nology 114, 287–292.

Sapolsky, R.M., Zolamorgan, S., Squire, L.R., 1991. Inhibition of gluco-corticoid secretion by the hippocampal formation in the primate. J.Neurosci. 11, 3695–3704.

Sapolsky, R.M., Romero, L.M., Munck, A.U., 2000. How do glucocorti-coids inXuence stress responses? Integrating permissive, suppressive,stimulatory, and preparative actions. Endocr. Rev. 21, 55–89.

Sassone-Corsi, P., 1995. Transcription factors responsive to cAMP. Annu.Rev. Cell Dev. Biol. 11, 355–377.

Sawchenko, P.E., Brown, E.R., Chan, R.K.W., Ericsson, A., Li, H.Y.,Roland, B.L., Kovacs, K.J., 1996. The paraventricular nucleus of thehypothalamus and the functional neuroanatomy of visceromotorresponses to stress. Prog. Brain Res. 107, 201–222.


Schoenherr, C.J., Anderson, D.J., 1995. The neuron-restrictive silencer fac-tor (NRSF): a coordinate repressor of multiple neuron-speciWc genes.Science 267, 1360–1363.

Schonemann, M.D., Ryan, A.K., McEvilly, R.J., Oconnell, S.M., Arias,C.A., Kalla, K.A., Li, P., Sawchenko, P.E., Rosenfeld, M.G., 1995.Development and survival of the endocrine hypothalamus and poster-ior pituitary gld requires the neuronal POU domain factor Brn-2.Genes Dev. 9, 3122–3135.

Schule, R., Rangarajan, P., Kliewer, S., Ransone, L.J., Bolado, J., Yang, N.,Verma, I.M., Evans, R.M., 1990. Functional antagonism between onco-protein c-Jun and the glucocorticoid receptor. Cell 62, 1217–1226.

Scott, D.K., Stromstedt, P.E., Wang, J.C., Granner, D.K., 1998. Furthercharacterization of the glucocorticoid response unit in the phospho-enolpyruvate carboxykinase gene. The role of the glucocorticoid recep-tor-binding sites. Mol. Endocrinol. 12, 482–491.

Seasholtz, A.F., Thompson, R.C., Douglass, J.O., 1988. IdentiWcation of acyclic adenosine monophosphate-responsive element in the rat cortico-tropin-releasing hormone gene. Mol. Endocrinol. 2, 1311–1319.

Senba, E., Ueyama, T., 1997. Stress-induced expression of immediate earlygenes in the brain and peripheral organs of the rat. Neurosci. Res. 29,183–207.

Seth, K.A., Majzoub, J.A., 2001. Repressor element silencing transcriptionfactor/neuronrestrictive silencing factor (REST/NRSF) can act as anenhancer as well as a repressor of corticotropin-releasing hormonegene transcription. J. Biol. Chem. 276, 13917–13923.

Shaywitz, A.J., Greenberg, M.E., 1999. CREB: a stimulus-induced tran-scription factor activated by a diverse array of extracellular signals.Annu. Rev. Biochem. 68, 821–861.

Shepard, J.D., Liu, Y., Sassone-Corsi, P., Aguilera, G., 2005. Role of glucocor-ticoids and cAMP-mediated repression in limiting corticotropin-releasinghormone transcription during stress. J. Neurosci. 25, 4073–4081.

Sheppard, K.A., Phelps, K.M., Williams, A.J., Thanos, D., Glass, C.K.,Rosenfeld, M.G., Gerritsen, M.E., Collins, T., 1998. Nuclear integrationof glucocorticoid receptor and nuclear factor-kappa B signaling byCREB-binding protein and steroid receptor coactivator-1. J. Biol.Chem. 273, 29291–29294.

Speert, D.B., Seasholtz, A.F., 2001. Corticotropin-releasing hormonereceptors and ligands in stress: who’s the Wrst? Curr. Opin. Endocri.Diabetes 8, 161–165.

Spengler, D., Rupprecht, R., Van, L.P., Holsboer, F., 1992. IdentiWcationand characterization of a 3�,5�-cyclic adenosine monophosphate-responsive element in the human corticotropin-releasing hormone genepromoter. Mol. Endocrinol. 6, 1931–1941.

Sterling, P., Eyer, J., 1981. Allostasis: a new paradigm to explain arousalpathology. In: Fisher, S., Reason, H.S. (Eds.), Handbook of Life Stress,Cognition and Health. John Wiley and Sons, New York.

Suda, T., Tomori, N., Tozawa, F., Mouri, T., Demura, H., Shizume, K.,1984. Distribution and characterization of immunoreactive corticotro-pin-releasing factor in human tissues. J. Clin. Endocrinol. Metab. 59,861–866.

Suda, T., Yajima, F., Tomori, N., Demura, H., Shizume, K., 1985. In vitrostudy of immunoreactive corticotropin-releasing factor release fromthe rat hypothalamus. Life Sci. 37, 1499–1505.

Suda, T., Kageyama, K., Sakihara, S., Nigawara, T., 2004. Physiologicalroles of urocortins, human homologues of Wsh urotensin I, and theirreceptors. Peptides 25, 1689–1701.

Swanson, L.W., Sawchenko, P.E., Rivier, J., Vale, W.W., 1983. Organiza-tion of ovine corticotropin-releasing factor immunoreactive cells andWbers in the rat brain: an immunohistochemical study. Neuroendocri-nology 36, 165–186.

Swantek, J.L., Cobb, M.H., Geppert, T.D., 1997. Jun N-terminal kinasestress-activated protein kinase (JNK/SAPK) is required for lipopoly-saccharide stimulation of tumor necrosis factor alpha (TNF-alpha)translation: glucocorticoids inhibit TNF-alpha translation by blockingJNK/SAPK. Mol. Cell. Biol. 17, 6274–6282.

Swiergiel, A.H., Takahashi, L.K., Kalin, N.H., 1993. Attenuation of stress-induced behavior by antagonism of corticotropin-releasing factorreceptors in the central amygdala in the rat. Brain Res. 623, 229–234.

Szafarczyk, A., Ixart, G., Malaval, F., Nouguiersoule, J., Assenmacher, I.,1979. EVects of lesions of the suprachiasmatic nuclei and of para-chlor-ophenylalanine on the circadian rhythms of adrenocorticotropic hor-mone and corticosterone in the plasma, and on locomotor activity ofrats. J. Endocrinol. 83, 1–16.

Tanimura, S.M., Watts, A.G., 1998. Corticosterone can facilitate as well asinhibit corticotropin-releasing hormone gene expression in the rathypothalamic paraventricular nucleus. Endocrinology 139, 3830–3836.

Tanimura, S.M., Watts, A.G., 2000. Adrenalectomy dramatically modiWesthe dynamics of neuropeptide and c-fos gene responses to stress in thehypothalamic paraventricular nucleus. J. Neuroendocrinol. 12, 715–722.

Tanimura, S.M., Watts, A.G., 2001. Corticosterone modulation of ACTHsecretogogue gene expression in the paraventricular nucleus. Peptides22, 775–783.

Tronche, F., Kellendonk, C., Kretz, O., Gass, P., Anlag, K., Orban, P.C.,Bock, R., Klein, R., Schutz, G., 1999. Disruption of the glucocorticoidreceptor gene in the nervous system results in reduced anxiety. Nat.Genet. 23, 99–103.

Tsigos, C., Chrousos, G.P., 2002. Hypothalamic–pituitary–adrenal axis,neuroendocrine factors and stress. J. Psychosomat. Res. 53, 865–871.

Vale, W., Spiess, J., Rivier, C., Rivier, J., 1981. Characterization of a 41-res-idue ovine hypothalamic peptide that stimulates secretion of cortico-tropin and beta-endorphin. Science 213, 1394–1397.

Vamvakopoulos, N.C., Karl, M., Mayol, V., Gomez, T., Stratakis, C.A.,Margioris, A., Chrousos, G.P., 1990. Structural-analysis of the regula-tory region of the human corticotropin releasing hormone gene. FEBSLett. 267, 1–5.

Vamvakopoulos, N.C., Chrousos, G.P., 1993a. Regulated activity of thedistal promoter-like element of the human corticotropin-releasing hor-mone gene and secondary structural features of its corresponding tran-scripts. Mol. Cell. Endocrinol. 94, 73–78.

Vamvakopoulos, N.C., Chrousos, G.P., 1993b. Evidence of direct estro-genic regulation of human corticotropin-releasing hormone geneexpression: potential implications for the sexual dimorphism of thestress-response and immune/inXammatory reaction. J. Clin. Invest. 92,1896–1902.

Vamvakopoulos, N.C., Chrousos, G.P., 1994. Hormonal-regulation ofhuman corticotropin-releasing hormone gene-expression—implica-tions for the stress-response and immune/inXammatory reaction.Endocr. Rev. 15, 409–420.

Van, L.P., Spengler, D.H., Holsboer, F., 1990. Glucocorticoid repression of3�,5�-cyclic-adenosine monophosphate-dependent human corticotro-pin-releasing-hormone gene promoter activity in a transfected mouseanterior pituitary cell line. Endocrinology 127, 1412–1418.

Van, L.P., 1993. Phorbolester stimulates the activity of human coriticotro-pin-releasing hormone gene promoter via 3�,5�-cyclic adenosine-mono-phosphate response element in transiently Transfected chickenmacrophages. Endocrinology 132, 30–34.

Watson, M.A., Milbrandt, J., 1989. The NGFI-B gene, a transcriptionallyinducible member of the steroid-receptor gene superfamily: genomicstructure and expression in rat brain after seizure induction. Mol. Cell.Biol. 9, 4213–4219.

Watts, A.G., Swanson, L.W., 1989. Diurnal variations in the content ofpreprocorticotropin-releasing hormone messenger ribonucleic acids inthe hypothalamic paraventricular nucleus of rats of both sexes as mea-sured by in situ hybridization. Endocrinology 125, 1734–1738.

Watts, A.G., Sanchez-Watts, G., 2002. Interactions between heterotypicstressors and corticosterone reveal integrative mechanisms for control-ling corticotropin-releasing hormone gene expression in the rat para-ventricular nucleus. J. Neurosci. 22, 6282–6289.

Watts, A.G., Tanimura, S., Sanchez-Watts, G., 2004. Corticotropin-releas-ing hormone and arginine vasopressin gene transcription in the hypo-thalamic paraventricular nucleus of unstressed rats: daily rhythms andtheir interactions with corticosterone. Endocrinology 145, 529–540.

Weidenfeld, J., Itzik, A., Feldman, S., 1997. EVect of glucocorticoids on theadrenocortical axis responses to electrical stimulation of the amygdalaand the ventral noradrenergic bundle. Brain Res. 754, 187–194.


Whitehead, D., Carter, D.A., 1997. cAMP response element-binding pro-tein phosphorylation and DNA binding activity are increased in theanterior pituitary gland following glucocorticoid depletion. J. Mol.Endocrinol. 19, 291–297.

Widmaier, E.P., Dallman, M.F., 1984. The eVects of corticotropin-releasingfactor on adrenocorticotropin secretion from perifused pituitaries in vitro:rapid inhibition by glucocorticoids. Endocrinology 115, 2368–2374.

Wiegert, O., Joels, M., Krugers, H., 2006. Timing is essential for rapideVects of corticosterone on synaptic potentiation in the mouse hippo-campus. Learn. Mem. 13, 110–113.

Wilson, T.E., Fahrner, T.J., Johnston, M., Milbrandt, J., 1991. IdentiWca-tion of the DNA-binding site for NFGI-B by genetic selection in yeast.Science 252, 1296–1300.

Wilson, T.E., Mouw, A.R., Weaver, C.A., Milbrandt, J., Parker, K.L., 1993.The orphan nuclear receptor NGFI-B regulates expression of the geneencoding steroid 21-hydroxylase. Mol. Cell. Biol. 13, 861–868.

WolX, S., Martinez, C., Majzoub, J.A., 1999. Inducible binding of cyclicadenosine 3�,5�-monophosphate (cAMP)-responsive element bindingprotein (CREB) to a cAMP-responsive promoter in vivo. Mol. Endo-crinol. 13, 659–669.

Wu, X.L., Spiro, C., Owen, W.G., McMurray, C.T., 1998. cAMP responseelement-binding protein monomers cooperatively assemble to formdimers on DNA. J. Biol. Chem. 273, 20820–20827.

Yang-Yen, H.F., Chambard, J.C., Sun, Y.L., Smeal, T., Schmidt, T.J.,Drouin, J., Karin, M., 1990. Transcriptional interference between

c-Jun and the glucocorticoid receptor—mutual inhibition of DNA-binding due to direct protein–protein interaction. Cell 62, 1205–1215.

Yao, M., Westphal, N.J., Denver, R.J., 2004. Distribution and acute stres-sor-induced activation of corticotrophin-releasing hormone neuronesin the central nervous system of Xenopus laevis. J. Neuroendocrinol. 16,880–893.

Yao, M., Stenzel-Poore, M., Denver, R.J., 2007. Structural and functionalconservation of vertebrate corticotropin-releasing factor genes: evi-dence for a critical role for a conserved cyclic AMP response element.Endocrinology, in press, doi:10.1210/en.2006-1413.

Zhang, X.K., Dong, J.M., Chiu, J.F., 1991. Regulation of alpha-fetoproteingene expression by antagonism between AP-1 and the glucocorticoidreceptor at their overlapping binding site. J. Biol. Chem. 266, 8248–8254.

Ziegler, D.R., Cass, W.A., Herman, J.P., 1999. Excitatory inXuence of thelocus coeruleus in hypothalamic– pituitary–adrenocortical axisresponses to stress. J. Neuroendocrinol. 11, 361–369.

Ziegler, D.R., Herman, J.P., 2002. Neurocircuitry of stress integration: ana-tomical pathways regulating the hypothalamo–pituitary–adrenocorti-cal axis of the rat. Integr. Comp. Biol. 42, 541–551.

Zupanc, G.K.H., Horschke, I., Lovejoy, D.A., 1999. Corticotropin releas-ing factor in the brain of the gymnotiform Wsh, Apteronotus leptorhyn-chus: immunohistochemical studies combined with neuronal tracttracing. Gen. Comp. Endocrinol. 114, 349–364.

http://dx.doi.org/10.1210/en.2006-1413

http://dx.doi.org/10.1210/en.2006-1413

regulation of vertebrate corticotropin-releasing factor...

Documents