Rmi

JJa

b

c

a

ARRAA

KLATRC

1

lidcmc

PR

h0

Acta Tropica 153 (2016) 101–110

Contents lists available at ScienceDirect

Acta Tropica

jo ur nal home p age: www.elsev ier .com/ locate /ac ta t ropica

egulation of intrinsic apoptosis in cycloheximide-treatedacrophages by the Sichuan human strain of Chinese Leishmania

solates

in Zenga,1, Qi-Wei Chena,1, Ze-Ying Yua,2, Jun-Rong Zhanga,2, Da-Li Chena, Chen Songb,ie Luob, Chen Zhangb, Shun-Li Wangb, Jian-Ping Chena,c,∗

Department of Parasitology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, Sichuan, PR ChinaWest China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, Sichuan, PR ChinaAnimal Disease Prevention and Food Safety Key Laboratory of Sichuan Province, Sichuan University, Chengdu, Sichuan, PR China

r t i c l e i n f o

rticle history:eceived 29 March 2015eceived in revised form 27 August 2015ccepted 12 October 2015vailable online 23 October 2015

eywords:eishmaniapoptosisHP-1AW264.7ycloheximide

a b s t r a c t

Leishmania spp. are able to survive and proliferate inside mammals’ mononuclear phagocytes, causingLeishmaniasis. Previous studies have noted that the regulation of apoptosis in host cells by these parasitesmay contribute to their ability to evade the immune system. However, current results remain unclearabout whether the parasites can promote or delay the apoptotic process in host cells, because the regula-tory effect of Leishmania was assumed to be strain-, species- and even infection time-dependent. The aimof this study was to investigate whether the Sichuan isolates of Chinese Leishmania (SC10H2) can alter theprocess of intrinsic apoptosis induced by cycloheximide in different types of macrophage cell lines and todetermine in which steps of the signaling pathway the parasites were involved. Human THP-1 and mouseRAW264.7 macrophages were infected by SC10H2 promastigotes followed by cycloheximide stimulationto assess the alteration of intrinsic apoptosis in these cells. The results indicated that SC10H2 infectionof human THP-1 macrophages could promote the initiation of intrinsic apoptosis, but completely oppo-site results were found in mouse RAW264.7 macrophages. Nevertheless, the expression of Bcl-2 and theDNA fragmentation rates were not altered by SC10H2 infection in the cell lines used in the experiments.

This study suggests that SC10H2 promastigote infection is able to promote and delay the transductionof early apoptotic signals induced by cycloheximide in THP-1 and RAW264.7 macrophages, revealingthat the regulation of intrinsic apoptosis in host cells by SC10H2 in vitro occurs in a host cell-dependentmanner. The data from this study might play a significant role in further understanding the relationshipbetween Leishmania and different host cells.

. Introduction

Protozoan parasites of the genus Leishmania, obligate intracellu-ar pathogens, primarily invade macrophages as well as monocytesn mammals and cause zoonotic leishmaniasis. Depending on theifferent organs where the pathogen is found, human leishmaniasis

an be categorized into three main forms: visceral, cutaneous anducocutaneous leishmaniasis. Substantial human infection can be

aused by at least 21 of 30 species of the genus Leishmania in dif-

∗ Corresponding author at: Department of Parasitology, West China School ofreclinical and Forensic Medicine, Sichuan University, No. 24, 1st Section of Firsting Road South, Chengdu, Sichuan 610041, PR China.

E-mail address: jpchen007@163.com (J.-P. Chen).1 These authors contributed equally to this work.2 These authors also contributed equally to this work.

ttp://dx.doi.org/10.1016/j.actatropica.2015.10.010001-706X/© 2015 Elsevier B.V. All rights reserved.

© 2015 Elsevier B.V. All rights reserved.

ferent regions (Chandra and Naik, 2008; Olivier et al., 2005). In therelationship between Leishmania and humans, the sand fly playsan important role as a vector that carries and transmits the para-site to human beings. The two forms of Leishmania, promastigotesand amastigotes, represent the different stages in sand flies andhumans, respectively. When transmitted by sand flies, promastig-otes develop into amastigotes in macrophages and continue toproliferate inside of the flies. An intriguing component of Leish-mania pathogenesis is the ability to evade the immune system,which promotes successful survival and further proliferation byprotecting the parasites from the killing effect of macrophages.

To avoid immune elimination and guarantee their survivalwithin hosts, Leishmania can evade and suppress the immune

defense system of hosts by developing multiple tactics, suchas modifying the complement system and phagocytosis process,interfering with signaling pathways in macrophages, modulating

1 opica

caenoiooLaiTtic

naa(mimeso2tisn2bmoe2otWhr

iGdaetcbsmlSitablipLtlF

02 J. Zeng et al. / Acta Tr

ytokine and chemokine production, and altering Toll-like receptornd T cell response pathways, etc. (Gupta et al., 2013; Mougneaut al., 2011; Bogdan and Rollinghoff, 1998). A prominent mecha-ism of the immune evasion of Leishmania is apoptosis, a processf programmed cell death. Traditionally, the activation of apoptosisn response to various stimuli has been known to terminate the lifef cells in a “silent” way without initiating inflammatory processesr causing further injury to the adjacent tissue or cells. However,eishmania parasites have been found to regulate the process ofpoptosis by interfering with the transduction of apoptotic signalsn infected host cells (Getti et al., 2008; Wanderley et al., 2005).herefore, the parasites may benefit from this regulation to avoidhe killing by internal inflammatory factors produced by host cellsn the early stage and thus may continue proliferating inside hostells.

Several previous studies have demonstrated that Leishma-ia undermine the apoptotic process in infected host cells. Themastigotes of Leishmania mexicana have been found to inhibitpoptosis of infected monocyte-derived dendritic cells in vitroGutierrez-Kobeh et al., 2013). Early stage infection with both Leish-ania donovani and Leishmania infantum has also been shown to

nvolve a delay in the induced apoptosis process of primary mouseacrophages (PMM) and RAW264.7 macrophages (Deschacht

t al., 2012). Moreover, infection with Leishmania major has beenhown to delay spontaneous apoptosis and prolong the life spanf infected neutrophil granulocytes (Sarkar et al., 2013; Aga et al.,002). On the other hand, there are also opposite findings arguinghat Leishmania is able to promote apoptosis in host cells. Whenncubated with L. major and two additional Old World Leishmaniapecies for long time periods of time, THP-1 cells showed increasedumbers of apoptotic bodies with amastigotes inside (Getti et al.,008). Although the results regarding the regulation of apoptosisy Leishmania remain controversial, most of the investigators areore or less in agreement that the regulatory effects of the parasites

n host cell apoptosis are dependent on different strains, differ-nt species and different experimental time points (Getti et al.,008; Deschacht et al., 2012; Donovan et al., 2009). Notably, mostf the studies have employed either mouse cells or human cells forheir investigation and have obtained consistent results from them.

hether the utilization of cells from both humans and mice as theost cells for one Leishmania species can lead to different outcomesegarding the regulation of apoptosis has not yet been investigated.

In this study, MHOM/CN/90/SC10H2 Leishmania isolates weresolated from symptomatic patients in Sichuan Province, China.reat efforts have been made to investigate this isolated strain inifferent aspects in previous studies, including in vitro cultivationnd critical gene expression (Cao et al., 2012; Guan et al., 2012; Lit al., 2007; Hu et al., 2002; Tian et al., 2004). The aim of this study iso gain insight into whether and how Leishmania SC10H2 regulatesycloheximide (CHX)-induced intrinsic apoptosis of macrophagesy measuring of several hallmarks of the signaling pathway. Con-idering the possibility of different outcomes due to the differentammalian cells used, we extended this study by using two cell

ines, human THP-1 and mouse RAW264.7. Notably, LeishmaniaC10H2 was found to regulate cycloheximide-induced apoptosisn human and mouse macrophages, but the two cell types hadotally contrasting results. In the case of RAW264.7 cells, the par-sites successfully prevented early apoptotic signal transductiony delaying the loss of mitochondrial transmembrane permeabi-

ization, decreasing the activities of caspase-9 and caspase-3 andnducing the expression and synthesis of XIAP. However, sur-risingly, the induced apoptosis in THP-1 cells was promoted by

eishmania infection under the same experimental conditions. Athe same time, the expression of Bcl-2, an important death inhibitorocated on mitochondria, was not affected by parasite infection.inally, the parasites-mediated regulation was found to persist

153 (2016) 101–110

throughout the early stage of apoptosis, with an absence of changesof DNA fragmentation rates. Altogether, our findings may help toclarify the immune evasion of Leishmania regarding its role in apo-ptosis, and this study is the first to compare the regulation of thesignaling pathway of intrinsic apoptosis in different mammaliancells by the SC10H2 strain.

2. Materials and methods

2.1. Cultivation of parasites and macrophage cells

Leishmania MHOM/CN/90/SC10H2 was maintained as pro-mastigotes in vitro in liquid nitrogen. The promastigotes werecultured at 27 ◦C in M199 medium (Hyclone), enriched with 10%new-born calf serum (NBCS) (Sijiqing), 50 �g/ml streptomycin and50 U/ml penicillin. The promastigotes were used at the late loga-rithmical growth phase.

A murine macrophage-like stable cell line RAW 264.7 was a kindgift from Dr. Xue F., Friendship Hospital of Capital Medical Univer-sity, China and cultured at 37 ◦C in a 5% CO2 −95% air mixture inRPMI-1640 media (Thermo) containing 2.05 mM l-glutamine, sup-plemented with 10% heat-inactivated fetal bovine serum (HiFBS)(Bioind), 100 �g/ml penicillin, 100 �g/ml streptomycin, with pas-sage every two days. A human monocytic cell line THP-1 waspurchased from Shanghai Institutes for Biological Sciences and rou-tinely maintained in the same conditions as RAW264.7 cells, withmedium changed three times a week.

2.2. Preparation and treatment of macrophages

Those cells were maintained in cell culture flasks of multi-well plates. To induce differentiation into macrophage-like cells,THP-1 cells were treated with phorbol 12-myristate 13-acetate(PMA) stimulation (0.6 �g/ml) (Sigma) for 1 day. Cells were washedtwice with sterile phosphate-buffered saline (PBS) to remove PMAand were incubated for an additional 3 days in fresh RPMI-1640medium prior to infection.

Both terminally differentiated THP-1 and RAW264.7 cells weresubjected to infection with SC10H2 promastigotes (10:1 parasite:cell ratio) for 4 h only or followed by treatment of pro-apoptoticagent cycloheximide (CHX) (5 �g/ml for THP-1, 2.5 �g/ml forRAW264.7 cells) for 16 h. All incubations were performed at 37 ◦Cin a 5% CO2 −95% air mixture for variable periods of time. Aftera 4-h post-infection, all medium with non-infecting promastig-otes was washed away and replaced by fresh RPMI-1640 medium,then followed by CHX treatment. After 16 h of treatment with CHX,all medium was discarded and cells were harvested for followingexperiments. Uninfected and untreated macrophages were used ascontrol.

2.3. Optical microscopy and transmission electron microscopy

Terminally differentiated THP-1 cells were infected by Leishma-nia SC10H2 promastigotes at a desired parasite to cell ratio. Afterthe desired time of infection, cells were harvested for prepara-tion of samples. The infected macrophages were methanol fixed,Wright-stained and observed by optical microscopy. Spare sam-ple of the macrophages was collected by centrifugation, fixed inglutaraldehyde, processed and observed by transmission electronmicroscopy.

2.4. Mitochondrial transmembrane potential

To detect the impact of the parasites infection on themitochondrial transmembrane potential of the macrophages, amitocaptureTM mitochondrial apoptosis detection fluorometric kit

J. Zeng et al. / Acta Tropica 153 (2016) 101–110 103

Table 1Primers used for reverse transcription PCR.

cDNA Transcript Primer sequence (5′–3′)

Sense Antisense

Human Bcl-2 TTTGAGTTCGGTGGGGTCAT TGACTTCACTTGTGGCCCAGcIAP1 CTCCAGCCTTTCTCCAAACCC CCAGTTACTGAGCTTCCCACCACXIAP AGACACCATATACCCGAGGAACC GTTTTCCACCACAACAAAAGCACGAPDH GAAGGTGAAGGTCGGAGTCA TTCACACCCATGACGAACAT

Mouse Bcl-2 GCACCCACTCCCTTCATACAAT ACGCAGGTTACATTCGTCTTCCAAAGCATGCTGC

(tiswtutbgtm

2

P6l(0awcfBa

2

wtpictbm

2

p

TP

c1AP-1 GTGGTTXIAP TTGGAA�-actin ATATCG

Biovision) was used. Enough incubation buffer was pre-warmedo 37 ◦C and MitoCaptureTM reagent was diluted, just prior to use,n the buffer (1 �l MitoCapture to 1 ml buffer) with vortex of theolution immediately. The cells prepared on coverslips in platesere stained with MitoCapture. Observation and images acquisi-

ion were performed immediately by a fluorescence microscopysing a band-pass filter. Cells in resting stage, because of MitoCap-ure accumulation and aggregation in the mitochondria, show aright orange to red fluorescence, whereas apoptotic cells showreen due to the altered mitochondrial transmembrane poten-ial making MitoCapture diffused in the cytoplasm remaining its

onomer form.

.5. Extraction of protein

The treated macrophages were washed three times with coldBS, scraped from the 25 cm2 flasks, collected by centrifugation at00 g, 4 ◦C for 5 min. The pellets were re-suspended in two different

ysis buffer solution to prepare lysates for western blot analysisRIPA lyses buffer: 50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA,.2% Nonidet P-40, 0.5 mM PMSF) (all from Sigma) and for proteasectivity assay (Caspase lysis buffer, Beyotime), respectively. Lysatesere kept on ice for 30 min with occasional vortex followed by

entrifugation at 18,000 g, 4 ◦C for 10 min to obtain supernatantsor further experiments. Protein samples were subjected to BCA andradford methods for determination of total protein concentration,nd frozen immediately at −80 ◦C until utilization.

.6. Caspase-3 and caspase-9 activation assay

The detection of caspase-3 and caspase-9 protease activitiesas carried out according to the manufacturer’s instructions by

he caspase-3 and caspase-9 activity assay kit (Beyotime). Therepared protein lysates were transferred to a 96-well plate and

ncubated with the reaction buffer individually containing theaspase-3 substrate Ac-DEVD-pNA (2 mM), the caspase-9 subus-rate Ac-LEHD-pNA (2 mM) at 37 ◦C for 2 h. The pNA was releasedy the caspase-3 and caspase-9 activity and measured by Tecanicro plate reader at 405 nm wavelengths.

.7. Western blot

A western blot analysis of prepared protein samples waserformed following standard protocols. A 10 �L of each sam-

able 2CR cycles and temperatures for amplification of the different human cDNA.

Thermo-cycling conditions Bcl-2 cIAP1

Temperature Duration Temperature

Melting 95 ◦C 30 s 95 ◦C

Annealing 63 ◦C 30 s 59 ◦C

Extension 72 ◦C 1 min 72 ◦C

Final extension 72 ◦C 5 min 72 ◦C

Cycles 35 28

CAGCCTTGGA CATTGGTGTCACACACGTCAGACATCCTCA CGCCTTAGCTGCTCTTCAGTGCTGGTCGTC AGGATGGCGTGAGGGAGAGC

ple containing 30 �g proteins were used for SDS-PAGE analysisin 12% acrylamide gels. Proteins were separated at 120 V, untilthe dye front had reached the bottom of the gel, and thentransferred at 150 mA for 150 min from gels to polyvinylidenefluoride(PVDF) membranes (Whatman) in transfer buffer (25 mMTris–HCl, 192 mM glycine, 20% methanol, 0.02% SDS, pH 8.3). After-ward, the membranes were incubated for 2 h in blocking solutionconsisting of PBS-T buffer (1 × PBS, 0.1% Tween) supplemented with1% bovine serum albumin (BSA) (Sigma). Then they were incubatedin antibody dilutions, for 16 h at 4 ◦C with shaking, individually withXIAP, Bcl-2 (both from Cell Signaling Technology), GAPDH and �-actin (both from ImmunoWay), respectively. All primary antibodieswere used at a 1:1000 dilution and HRP conjugated anti-rabbitsecondary antibodies (ZSGB-BIO) were used at a 1:5000 dilution.Membranes were then visualized by ECL Western blot detectionsystem (Beyotime).

2.8. Reverse transcription PCR and related procedures

The treated macrophages as well as control macrophages wereharvested and total RNA was isolated following the guideline of theSimply P Total RNA Extraction Kit (BioFlux). Genomic DNA removaland the first strand cDNA synthesis were conducted following theprocedure by using One-Step gDNA removal and cDNA SynthesisSuperMix (TransGen Biotech).

The relative expression of Bcl-2, c-IAP1, XIAP, GAPDH and �-actin mRNA were determined by using 1 �l of cDNA of the differentsamples, 2 �l of forward and reverse primer (TSINGE), respectively,for the genes listed in Table 1, 25 �l of 2 × Taq Plus MasterMix. ThePCR conditions, including cycles and temperatures for amplificationof macrophage cDNAs were indicated as follows (Tables 2 and 3).The PCR products were analyzed by the 1.2% agarose gel elec-trophoresis.

2.9. TUNEL assay for chromatin fragmentation

TdT-mediated dUTP Nick-End Labeling (TUNEL) assays wereperformed using the in situ cell death detection kit (Keygen

Biotech), according to manufacturer’s instructions. It was usedto detect apopototic cell death by enzymatic labeling of DNAstrand breaks with fluorescein-dUTP and TdT. THP-1 and RAW264.7cells were plated onto coverslips in 24-well plates with infec-

XIAP GAPDH

Duration Temperature Duration Temperature Duration

30 s 95 ◦C 30 s 94 ◦C 2 min30 s 61 ◦C 30 s 55 ◦C 1 min1 min 72 ◦C 1 min 72 ◦C 1 min5 min 72 ◦C 5 min 72 ◦C 5 min

29 30

104 J. Zeng et al. / Acta Tropica 153 (2016) 101–110

Table 3PCR cycles, and temperatures for amplification of the different mouse cDNA.

Thermo-cycling conditions Bcl-2 cIAP1 XIAP �-actin

Temperature Duration Temperature Duration Temperature Duration Temperature Duration

Melting 94 ◦C 30 s 94 ◦C 2 min 94 ◦C 30 s 95 ◦C 30 sAnnealing 56 ◦C 30 s 55 ◦C 1 min 55 ◦C 30 s 59 ◦C 30 s

◦ ◦ ◦ ◦

twtba

2

SBSti

3

3t

aptfliSTmm

F(eDrmt

Extension 72 C 30 s 72 C

Final extension 72 ◦C 5 min 72 ◦C

Cycles 30 30

ion and treatments described previously. The prepared coverslipsere fixed with paraformaldehyde and subjected to TUNEL sys-

em. Macrophages with DNA double-strand ruptures appeared darkrown. Finally, images were acquired by phase contrast microscopyt ×1,000 magnification.

.10. Statistical analysis

Statistical analysis was performed by GraphPad Prism 6oftware using one-way analysis of variance followed by theonferroni’s multiple comparisons test (nonparametric ANOVA).ignificance was set at P < 0.05. Each experiment was carried outwo or three times independently according to the condition ofndividual experiment.

. Results

.1. Culture and establishment of an internal parasitic model ofhe Chinese Leishmania strain SC10H2

An internal parasitic model needed to be established to guar-ntee the internalization of parasites by macrophages prior toerforming any other experiment. There are usually two forms ofhe parasites: promastigotes, the form that is found in the sandy, and amastigotes, the form that is found inside host cells. The

n vitro cultured promastigotes of the Chinese Leishmania strain

C10H2 were used to infect macrophages derived from humanHP-1 cells at an optimized ratio and time before harvesting andorphological conformation with Wright’s Dye. Under an opticalicroscope, the nuclei and kinetoplasts of the promastigotes were

ig. 1. The morphology and infectivity of Leishmania SC10H2. (A) Leishmania SC10Hparasites–macrophages) and an infection time of 4 h, the culture medium with uninfectach individual under an optical microscope. The results are from one representative exye. With the same infection ratio and time as above, the infected cells on slides with tr

esults are from one representative experiment out of three. (C) The transformed SC10Hicroscope. A single amastigote with the structure of both the cell nucleus and the kinet

ransmission electron microscope. The results are from one representative experiment ou

1 min 72 C 1 min 72 C 1 min5 min 72 ◦C 5 min 72 ◦C 5 min

30 30

observed (Fig. 1A), while the internal amastigotes were typicallyround or round-like in shape (Fig. 1B). After lysis with trypsin, theinfected cells contained typical amastigotes within the cytoplasm,as observed under a transmission electron microscope, indicatingthe alteration of the morphology of the parasite after internaliza-tion by host cells (Fig. 1C).

3.2. Leishmania infection promotes the alteration of thecycloheximide-induced loss of mitochondrial transmembranepotential in macrophages

Because Leishmania are internal parasitic protozoa, the intrin-sic apoptotic signal pathway of host cells might be an appropriatetarget for the parasites. Mitochondria are critical to maintain cellhomeostasis because of their role in energy metabolism. In addi-tion, they also play major roles in intrinsic apoptosis. Dysfunctionof mitochondria is recognized as an important hallmark of theinitiation of the intrinsic apoptotic process because the permeabi-lization of the mitochondrial outer membrane leads to the releaseof a great amount of pro-apoptotic factors from the mitochondriainto the cytoplasm, which transducer apoptotic signals (Cosentinoand Garcia-Saez, 2014), such as nuclear condensation and cas-pase activation. Normally, the integrity of the mitochondrial outermembrane is essential for maintaining the potential of the mito-chondrial membrane. With the existence of signals such as heat,UV or reactive oxygen species, the potential is gradually reduced

and the apoptotic process is initiated (Rodust et al., 2009; Liu et al.,2009). Thus, the loss of mitochondrial transmembrane potentialrepresents an abnormal condition of the mitochondria as well asan initiation signal of apoptosis.

2 promastigotes visualized by Wright’s Dye. With an infection ratio of 10:1ed promastigotes was harvested and stained for flagella, nuclei and kinetoplasts inperiment out of three. (B) Leishmania SC10H2 amastigotes visualized by Wright’s

ansformed amastigotes in their cytoplasm could be observed by Wright’s Dye. The2 amastigotes within THP-1 macrophages visualized with a transmission electronoplast could be found close to the nuclear membrane of the macrophage under thet of two.

J. Zeng et al. / Acta Tropica 153 (2016) 101–110 105

Fig. 2. Loss of the mitochondrial transmembrane potential of macrophages shown by fluorescence. With cycloheximide stimulation (5 �g/ml for THP-1 cells and 2.5 �g/mlfor RAW264.7 cells) for 16 h after a 4 h infection time (infection ratio 10:1), the infected THP-1 cells (A1) had a greater ratio of early apoptotic cells to normal cells than that ofcontrol cells (A2), representing an increased loss of mitochondrial transmembrane potential in these cells. In contrast to the results found in THP-1 cells, infected RAW264.7cells treated with cycloheximide demonstrated a decreased loss of mitochondrial transmembrane potential (A3) by having a greater ratio of normal cells to early apoptoticc and uni ge–reT f the

t

pwdrlwnapcwpAhatb(

RsAbBtmccoi

3am

pMa

ells compared with that of control cells (A4). (B1) and (B2) represent the infected

nfected and uninfected RAW264.7 cells without stimulation, respectively. The oranhe results are from one representative experiment out of two. (For interpretation ohis article.)

To examine the alteration of the mitochondrial transmembraneotential, cells infected with Leishmania on coverslips were treatedith MitoCapture, a dye that distinguishes cells with lost mitochon-rial transmembrane potential from normal cells according to theatio of the green and red fluorescence. In this study, the baselineevel of the loss of transmembrane potential in THP-1 macrophages

as measured with or without incubation of Leishmania, showingo difference between the two groups (Fig. 2B1 and B2). Therefore,

proapoptotic treatment was included following the incubation ofarasites with macrophages. Cycloheximide is a chemical that isonventionally used as an inducer of the intrinsic apoptotic path-ay because of its role in interfering with the synthesis of essentialroteins for cell survival (Donovan et al., 2009; Martin et al., 1995).n optimal concentration (5 �g/ml) and stimulation time of cyclo-eximide was chosen to stimulate infected THP-1 macrophagesnd controls. Under cycloheximide challenge, Leishmania were ableo drive THP-1 macrophages into an accelerated apoptotic statusy increasing the ratio between the apoptotic and normal cellsFig. 2A1 and A2).

To compare cells from different species of mammals, mouseAW264.7 macrophages were treated and harvested using theame experimental conditions before staining with MitoCapture.t baseline, the infected RAW264.7 also showed a similar ratioetween the two colors compared with control cells (Fig. 2B3 and4). Notably, treatment with cycloheximide (2.5 �g/ml) as an apop-otic inducer, resulted in the opposite effect in infected mouse

acrophages compared to human THP-1 cells. The infected mouseells had a decreased ratio between early apoptotic and normal cellsompared to controls (Fig. 2A3 and A4). Therefore, the regulationf the early apoptotic process by Leishmania SC10H2 might occurn a host cell genetic background-dependent manner.

.3. Leishmania infection regulates the cycloheximide-inducedctivities of important caspases in THP-1 and RAW264.7acrophages

Caspase family members play an essential role in the apoptoticrocess by orchestrating signal transduction (McIlwain et al., 2013).embers of this family can be classified into apoptosis initiators

nd apoptosis effectors according to their roles in different steps of

infected THP-1 cells without stimulation, respectively. (B3) and (B4) demonstrated color indicates normal cells, while the green color indicates early apoptotic cells.references to color in this figure legend, the reader is referred to the web version of

apoptosis. Caspase-9 has been recognized as an important initiatorcaspase that is responsible for initiating the upstream processesin the intrinsic pathway (McIlwain et al., 2013). Caspase-3, one ofthe effector caspases, is a critical executioner that can be cleavedand activated from its zymogen form by caspase-9 (Tait and Green,2013). When intrinsic apoptosis is triggered, permeabilization ofthe mitochondrial membrane leads to the release of cytochromec to form a complex with Apaf-1, called the apoptosome, recruit-ing pro-caspase-9 and activating caspase-3 (Parrish et al., 2013;Banerjee et al., 2011). Caspase-3 executes the process of chromatindegradation via caspase-activated DNase (Cohen, 1997). Therefore,the activities of these two caspases may indicate the transductionof apoptotic signals from the mitochondria to the cytoplasm. In thisstudy, the activities of the caspases were measured by evaluatingtheir ability to cleave their corresponding substrates.

After cleavage, the tetrapeptide substrates used in the experi-ment release a chromogenic radical that can be recognized undera certain wavelength. The absorbance units within a period oftime, representing the caspase activity, were calculated. To obtainthe data, the absorbance values at 10 min, 30 min, 1 h and 2 hwere collected and bar charts were constructed with triplicatesamples. The results of the experiment revealed up-regulatedcaspase-3 and caspase-9 activity in Leishmania-infected humanTHP-1 macrophages induced by cycloheximide, revealing the pro-motion of apoptosis in these cells (Fig. 3A and C). Notably, theactivities of caspase-3 and caspase-9 in THP-1 also had an increas-ing trend during baseline infection, but to a lesser extent comparedwith the groups stimulated by cycloheximide (Fig. 3A and C).In contrast to human THP-1 macrophages, the activities of bothcaspase-3 and caspase-9 were decreased in mouse RAW264.7 cellswhen the cells were incubated with cycloheximide after parasiteinfection (Fig. 3B and D), indicating the delayed or weakened apop-totic process in these cells. Data from both of the two cell linesdemonstrated regulatory effect of initiator caspase-9 and effectorcaspase-3 towards on infection-mediated apoptotic stimulation,indicating that the apoptotic pathway was altered from upstream

to downstream. However, infected RAW264.7 macrophages did notdisplay a significant decrease of caspase activities during baselineinfection compared with control cells (Fig. 3B and D), implying that

106 J. Zeng et al. / Acta Tropica 153 (2016) 101–110

Fig. 3. Caspase-3 and caspase-9 activities of human THP-1 macrophages and mouse RAW264.7 macrophages. In (A), CHX+ and CHX− represent the caspase-3 activitiesof infected and un-infected THP-1 cells for 4 h (10:1 ratio) followed by stimulation with cycloheximide (5 �g/ml) for 16 h. + and − Represent the caspase-3 activities ofinfected and uninfected THP-1 cells for 4 h without stimulation of the inducer for 16 h. The indices of (C) represent the same experimental conditions as (A), with caspase-9activity measured in place of caspase-3. In (B), CHX+ and CHX− represent the caspase-3 activities of infected and uninfected RAW264.7 cells for 4 h followed by stimulationo f infec1 e caspa SD o

tpcco

3mB

cfsp

cieiisp(

f cycloheximide (2.5 �g/ml) for 16 h. + and − Represent the caspase-3 activities o6 h. The indices of (D) represent the same experimental conditions as (B), with thbsorbance/(time in h × concentration of protein). The results represent the mean ±

he caspase activities in mouse macrophages were not affected byarasite infection alone. Intriguingly, parasitic infection regulatedaspase activities independent of apoptosis induction in THP-1ells, but not in RAW264.7 cells, revealing the different sensitivitiesf the two cell lines towards infection.

.4. Leishmania infection regulates the expression of XIAP inacrophages stimulated by cycloheximide but has no impact on

cl-2 expression in these cells

Because Leishmania SC10H2 was found to regulate the mito-hondrial transmembrane potential as well as caspase activitiesollowing cycloheximide stimulation, the investigation of down-tream apoptotic factors is essential for understanding the wholeathway.

The inhibitors of apoptosis protein (IAP family), sharing the so-alled baculovirus-IAP-repeat (BIR) domain, are death regulatorsnterfering in the apoptotic process (Yang, 2000; Dubrez-Dalozt al., 2008). The X-linked inhibitor of apoptosis protein (XIAP)s the only family member that inhibits caspases by direct phys-

cal interaction (Obexer and Ausserlechner, 2014). Other members,uch as c-IAP1 and c-IAP2, can mark caspase-3 and caspase-7 forroteasomal degradation, but without direct physical interactionBlankenship et al., 2009). As XIAP is able to regulate the final steps

ted and uninfected RAW264.7 cells for 4 h without cycloheximide stimulation forase-9 activity measured in place of caspase-3. The unit of caspase activity was �

f three independent experiments. * P ≤ 0.05, ** P ≤ 0.01 and *** P ≤ 0.001.

in death execution, it has been studied most frequently in cancerresearch.

We chose XIAP as the main target of IAPs and assessed the pro-tein expression level by western blotting. The results showed thatfollowing cycloheximide treatment, infected THP-1 macrophageshad less XIAP synthesis than control cells (Fig. 4), indicating thatSC10H2 was able to promote cycloheximide-induced apoptosisthrough the regulation of IAPs. At the same time, the XIAP proteinlevel was found to be elevated in cycloheximide-treated, infectedRAW264.7 cells compared to control cells (Fig. 4). These regulatoryeffects of XIAP may help explain the diverse effects on caspase-3activity found in infected cells treated with cycloheximide in ourprevious results.

The B-cell lymphoma-2 (Bcl-2) family of proteins plays a sig-nificant role in regulating the mitochondrial apoptosis pathway(Garcia-Saez, 2012). According to their roles in apoptosis, the pro-teins are divided into two groups, pro-apoptotic and anti-apoptoticproteins. Among them, Bcl-2 acts as a major anti-apoptotic(pro-survival) factor to inhibit other pro-apoptotic Bcl-2 familymembers, such as Bax, as well as some important pro-apoptoticfactors released from mitochondria, such as cytochrome c (Adams

and Cory, 2007; Chipuk and Green, 2008). In several cases of intrin-sic apoptosis, Bcl-2 has been shown to be down-regulated to releasethe pro-apoptotic members it binds to. Therefore, examination of

J. Zeng et al. / Acta Tropica 153 (2016) 101–110 107

Fig. 4. Different expression levels in THP-1 macrophages and mouse RAW264.7 macrophages by Western blot and PCR. (+) indicates the XIAP, Bcl-2 and c-IAP1 expressionlevels of macrophages stimulated with cycloheximide (5 �g/ml for THP-1 cells and 2.5 �g/ml for RAW264.7 cells) for 16 h after infection with Leishmania (10:1) for 4 h. (−)I APDHc stern bT

Bf

mtwLri

IaluVstutt(ptmspsewtg

3b

s

ndicates cells stimulated with cycloheximide for 16 h without parasites infection. Gontrol for RAW264.7 cells. The molecular weight of each antigen tested in the Wehe results are from one representative experiment out of three.

cl-2 will help to determine whether this critical anti-apoptoticactor is involved in the regulatory effect on host cells by SC10H2.

Our experiments showed that Bcl-2 protein synthesis was notarkedly different between infected THP-1 macrophages and con-

rol cells treated with cycloheximide (Fig. 4). Furthermore, thereas also no alteration of Bcl-2 in RAW264.7 when infected with

eishmania followed by cycloheximide stimulation (Fig. 4). Theseesults revealed that SC10H2 might bypass Bcl-2 to regulate thentrinsic apoptosis pathway.

In addition to protein synthesis, the genetic expression ofAPs and Bcl-2 was measured to determine whether the alter-tion of protein expression resulted from alteration at the geneticevel. c-IAP1, another apoptotic inhibitor of IAPs that drives thebiquitin-mediated degradation of executioner caspases (Silke anducic, 2014), was also inspected in the experiment. The resultshowed that the expression of XIAP and c-IAP1 in cycloheximide-reated, infected THP-1 macrophages was decreased compared ton-infected cells (Fig. 4), indicating that the regulation of these pro-eins by SC10H2 was initiated at the genetic level. As expected,he expression of Bcl-2 was not changed by parasitic infectionFig. 4), revealing that neither the genetic expression nor proteinrocessing was affected by parasite infection. The apoptotic fac-ors measured in human THP-1 cells were also investigated in

ouse RAW264.7 macrophages. The results revealed that under theame experimental conditions, RAW264.7 cells showed an oppositeattern to that of THP-1 macrophages. The c-IAP1 and XIAP expres-ion levels were up-regulated with parasitic infection, while Bcl-2xpression was not altered (Fig. 4). These results were in accordanceith the protein expression results by western blot, implying that

he alteration at the protein level was a result of regulation at theenetic level, but not at the protein processing stage.

.5. The DNA fragmentation level of macrophages is not changed

y Leishmania infection

In previous experiments, the early signals of intrinsic apopto-is, including the alteration of the mitochondrial transmembrane

was the housekeeping control for THP-1 cells, and �-actin was the housekeepinglot is: 53 kDa for XIAP, 28 kDa for Bcl-2, 37 kDa for GAPDH and 43 kDa for �-actin.

potential, caspase activities and expression of apoptosis inhibitors,was assessed in Leishmania-infected macrophages. Therefore,assessing the later stage of intrinsic apoptosis was crucial to investi-gate the whole signaling pathway. To determine whether infectionwith and proliferation of Leishmania SC10H2 amastigotes insidemacrophages could have an impact on DNA fragmentation, theexecution step of apoptosis, infected or uninfected host cells oncoverslips were challenged with or without cycloheximide stim-ulation followed by a TUNEL assay. TUNEL is the most frequentlyused method for the detection of DNA fragments produced duringapoptosis. These small fragments have a 3′-OH end that can bindto dUTP marked with DAB dye catalyzed by the TdT enzyme. Theresults of the TUNEL assay can either be shown in photos with avisible dye under a microscope or charts representing the fluores-cence density of the flow cytometry. Here, the former method waschosen to obtain a more direct impression of the apoptotic level.

Surprisingly, there was no difference in the DNA fragmentationrates between infected cells with cycloheximide stimulation andcells receiving stimulation only, neither in THP-1 nor RAW264.7cells (Fig. 5A1–A4). Moreover, the DNA fragmentation rates in all ofthe cycloheximide-treated cells were very low compared with thepositive controls, indicating the absence of visible DNA fragmenta-tion in this study. At the same time, the baseline DNA fragmentationrates of infected and uninfected cells were also low and similar toeach other (Fig. 5B1–B4), implying that parasitic infection failed toinduce visible alterations in the DNA fragmentation rates in thesetwo cell lines.

4. Discussion

The regulation of host cell signaling pathways by intracel-lular parasites is of great importance for their survival andproliferation. As one of the fetal protozoa that can cause severe

diseases in the clinic, Leishmania spp. are believed to regulate theimmune system of host cells to avoid killing by the destructive fac-tors produced in the process of phagocytosis. Conventional studiesof this regulatory mechanism have mostly focused on the inflam-

108 J. Zeng et al. / Acta Tropica 153 (2016) 101–110

Fig. 5. A TUNEL assay shows the DNA fragmentation level of THP-1 and RAW264.7 macrophages following apoptosis induction and at the baseline level. (A1) revealed thatthe DNA fragmentation level of THP-1 cells infected with SC10H2 (infection ratio of 10 parasites:1 macrophage) for 4 h followed by stimulation with cycloheximide for 16 hwere similar to that of uninfected cells under the same conditions (A2). When treated with only parasites for 4 h without an apoptotic inducer, the uninfected THP-1 cells(B2) and SC10H2-infected cells (B1) also had the same DNA fragmentation level. (C1) and (C2) demonstrate the positive and negative control, respectively.(A3) shows that the DNA fragmentation level of RAW264.7 cells infected by SC10H2 (infection ratio of 10 parasites:1 macrophage) for 4 h followed by stimulation withcycloheximide for 16 h were similar to that of uninfected cells under the same conditions (A4). When treated with parasites only for 4 h, the uninfected RAW264.7 cells (B4)a d (C4o

me2esHaewatlaaRtcttbwUspTmDpu

mr

nd SC10H2-infected cells (B3) also had the same DNA fragmentation level. (C3) anne representative experiment out of three.

atory system, the main component involved in Leishmania killingffects by host immunity (Filardy et al., 2014, 2010; Wenzel et al.,012; Adalid-Peralta et al., 2011). Recently, investigators discov-red another important process that was altered by Leishmaniapp.—apoptosis (Wanderley et al., 2005; Deschacht et al., 2012; El-ani et al., 2012; Gannavaram and Debrabant, 2012; Wanderleynd Barcinski, 2010). In this study, we compared the regulatoryffects of cycloheximide-induced intrinsic apoptosis by infectionith Sichuan isolates of Chinese Leishmania (SC10H2) in human

nd mouse macrophage cell lines. Under the same experimen-al conditions, the early signals of intrinsic apoptosis, includingoss of the mitochondrial transmembrane potential and caspase-9nd caspase-3 activities, were increased in THP-1 cells by par-sitic infection, while all of these hallmarks were decreased inAW264.7 cells. Moreover, the genetic expression and protein syn-hesis of XIAP were reduced in THP-1, but elevated in RAW264.7ells by parasitic infection. These results clearly indicate that infec-ion with Leishmania SC10H2 successfully regulates the early signalransduction of apoptosis induction in THP-1 and RAW264.7 cells,ut with opposite outcomes. However, SC10H2 did not interfereith the classical apoptosis inhibitor Bcl-2 in both of the cell lines.nder the same experimental conditions, the early signals of intrin-

ic apoptosis, including loss of the mitochondrial transmembraneotential and caspase-9 and caspase-3 activities, were increased inHP-1 cells by infection with the parasites, while all of these hall-arks were decreased in RAW264.7 cells. Surprisingly, the inducedNA fragmentation rates in the two cell lines were not changed byarasitic infection, indicating the possibility of an early stage reg-

latory process, as suggested by the results of this study.

In previous studies, most of the investigators only used mouseacrophages, either primary cells derived from the bone mar-

ow or cell lines, as host cells for the assessment of alteration

) demonstrate the positive and negative control, respectively. The results are from

of apoptosis by Leishmania infection. By using different speciesof Leishmania, including L. major, L. donovani and L. infantum,the investigators evaluated their ability to interfere with apopto-sis in murine macrophages by measuring the activity of effectorcaspase-3, cytochorme c release, Bcl-2 family member expressionand associated pathways, such as NF-�B and PI3K/Akt, demonstrat-ing that Leishmania infection prevents the induction of apoptosis inthese cells (Donovan et al., 2009; Akarid et al., 2004; Moore et al.,1994; Ruhland et al., 2007; Srivastav et al., 2014). In these reports,Leishmania were able to delay the apoptosis caused by either chem-ical apoptosis inducers, such as staurosporine and cycloheximide,or the deprivation of essential stimulating factors (Donovan et al.,2009; Akarid et al., 2004; Moore et al., 1994; Ruhland et al., 2007;Srivastav et al., 2014), which is in agreement with our results. How-ever, our studies demonstrated for the first time that Leishmaniawere also able to promote the induction of intrinsic apoptosis inhost cells. Because Leishmania SC10H2 were obtained from patientswith visceral leishmaniasis, human macrophages might be a bet-ter target for the infection. Therefore, we chose one of the mostfrequently used cell lines, the THP-1 human monocytic leukemiacell line, and stimulated it with PMA for differentiation. In additionto THP-1 cells, human U-937 monocytes could also be differen-tiated into macrophages. Lisi and colleagues, who investigatedthe relationship between Leishmania infection and induced apo-ptosis in U-937 monocytes, found that infection with L. infantumpromastigotes or treatment with soluble factors from the culturemedia of parasites prevented apoptosis induced by actinomycinD. Notably, the strain of parasites and host cells that they chose

were different from those used in our experiments. Convention-ally, the only prevalent species of Leishmania in China was thoughtto be L. donovani, which causes visceral leishmaniasis (Cao et al.,2011; Yang et al., 2013). Previous studies using SC10H2 suggested

opica

tdtossMtlemaiL

Rmtbtmomot9occtmb

edntpmsatR

sRtcviteetbTr

uassahm(

J. Zeng et al. / Acta Tr

hat these isolates were more like Leishmania tarentolae than L.onovani in origin (data not shown), indicating the diversity ofhe isolates. Therefore, they might use different membrane-boundr secreted components to regulate host cells. Indeed, differentpecies of Leishmania might have different impacts upon apopto-is in infected host cells, as suggested by Donovan et al. (2009).oreover, although U-937 and THP-1 cells are both monocytes,

he former are human myeloid monocytes, while the latter areeukemic monocytes. Compared with the U-937 cell line, differ-ntiated THP-1 cells were reported to behave more like nativeonocyte-derived macrophages (Auwerx, 1991). Actually, in the

bsence of an apoptotic inducer, apoptosis was also found to benduced in THP-1 macrophages by infection with three species ofeishmania (Getti et al., 2008).

With regards to the two macrophages in this study,AW264.7 cells originated from primary mouse monocyte-derivedacrophages, while human THP-1 cells required further differen-

iation into macrophages by stimuli, such as PMA. As suggestedy Daigneault et al. (2010) the expression of CD206, a markerhe alternatively activates macrophages, in PMA-induced THP-1

acrophages was nearly null, while it was detected in nearly halff primary monocyte-derived macrophages. Furthermore, murineacrophages are assumed to express receptors that could be rec-

gnized by the virulence factors of Legionella pneumophila, leadingo the activation of caspases (Tao et al., 2013). However, human U-37 cells failed to respond to these factors because of the absencef such receptors or mutations in the alleles (Tao et al., 2013), indi-ating that the regulatory effects might vary according to the hostells’ genetic background. Thus, it is likely that Leishmania adapts tohe different expression profiles of receptors and other important

arkers on the membranes of THP-1 and RAW264.7 macrophagesy promoting or preventing apoptosis in these cells, respectively.

Moreover, Getti et al. (2008) suggested the existence of differ-nt regulatory effects at different stages of infection, because theyetected an induction of apoptosis after 48 and 72 h of Leishma-ia infection, which is much longer than the most frequently usedime point of 24 h. Based on their findings, the promastigotes mightromote the apoptosis of host cells to avoid the initiation of inflam-ation and prevent apoptosis to allow for proliferation at different

tages. In this case, the time point that we chose to measure thepoptotic pathway (4 h of infection followed by 16 h of stimula-ion) might represent different stages of regulation in THP-1 andAW264.7 cells, resulting in opposite outcomes.

In this study, neither the protein synthesis nor genetic expres-ion of Bcl-2, which functions similarly to Bcl-xL (Kang andeynolds, 2009) were altered by Leishmania infection. Previously,he expression of Bcl-2 was found to be increased in neutrophilso-incubated with L. major (Sarkar et al., 2013). However, the ele-ated Bcl-2 was a result of L. major only, but not the combination ofnfection and stimulation with the apoptotic inducer. In addition,he different host cells and different species of Leishmania used inxperiments might lead to different outcomes. Moreover, Donovant al. (2009) noted that Bcl-xL, one of the pro-survival members inhe Bcl-2 family, was up-regulated in murine macrophages infectedy several strains of Leishmania are treated with cycloheximide.herefore, the regulation of apoptosis was likely to skip Bcl-2 andely on Bcl-xL, which functions similarly to Bcl-2.

Although early signs of apoptosis were discovered to be reg-lated by Leishmania infection and treat with cycloheximide, anlteration of the DNA fragmentation rates was not observed. Mosttudies focusing on the relationship between host cell apopto-is and Leishmania infection have investigated DNA fragmentation

fter an examination of early apoptotic signal transduction. Manyave noted that the prevention of apoptosis in host cells by Leish-ania was accompanied by decreased DNA fragmentation rates

Akarid et al., 2004; Moore et al., 1994; Ruhland et al., 2007; Lisi

153 (2016) 101–110 109

et al., 2005). All of these results are based on different concentra-tions of the different chemical inducers or different time pointsto measure DNA fragments. The inducers used for these experi-ments included actinomycin D, staurosporine, cycloheximide andcampothecin (Donovan et al., 2009; Akarid et al., 2004; Ruhlandet al., 2007; Lisi et al., 2005) in different concentrations. A dose gra-dient study of cycloheximide in rats suggests that below a certainconcentration, cycloheximide has no effect on the inhibition of pro-tein synthesis (Alessenko et al., 1997). Nevertheless, it is unlikelythat the doses (5 �g/ml for THP-1 cells, 2.5 �g/ml for RAW264.7cells) were below this threshold, because these concentrationswere appropriate according to other experiments for the induc-tion of DNA fragmentation (Kim et al., 2000; Wang et al., 2005;Cipriani et al., 2001). Another condition that should be consideredis the time points used for the measurements. Studies using chem-ical inducers primarily chose a time point of approximately 28 h intotal (with infection for 4 h and stimulation for 24 h) while our timepoint was 20 h (with infection for 4 h and stimulation for 16 h). Inparticular, Donovan et al. (2009) used the same inducer with thesame infection and stimulation time points as we did, but the con-centration of cycloheximide was not stated. An interesting resultobtained from finding of induced apoptosis in THP-1 macrophagesinfected by Leishmania was the absence of DNA fragmentation(Nagata and Apoptotic, 2000), indicating that apoptosis could occurindependently of DNA fragmentation or nuclear degeneration. Theincomplete activation of macrophage apoptosis was also demon-strated in the investigation of L. pneumophila and host cell apoptosis(Abu-Zant et al., 2005). However, the results of our study indicatethat even the control cells, which were treated with cycloheximidealone, did not show increased DNA fragmentation rates, indicatingthat the particular type of apoptosis induction mentioned abovewas not the cause of the absence of DNA fragmentation. Therefore,we attributed the absence of DNA fragmentation to the time pointsthat we chose for the experiments. Because the exposure time ofmacrophages to cycloheximide was relatively short, the final stepof apoptosis may not have occurred. Indeed, when we conductedthe experiment in THP-1 macrophages with prolonged time points(24 h of infection followed by 24 h of stimulation with cyclohex-imide), we observed a difference in the DNA fragmentation ratesbetween infected and un-infected cells (data not shown), demon-strating that the absence of DNA fragmentation was due to the shortchallenge time. Surprisingly, after 48 h, infected THP-1 cells dis-played a decreased induction of apoptosis, which is the opposite ofthe result that we found at the 20 h time point. Therefore, our datasuggest that Leishmania both induce and prevent apoptotic signaltransduction. In the early stage, they promote apoptosis to avoidkilling by inflammatory factors, while in the late stage, they pre-vent the apoptosis to proliferate as much as possible inside hostcells.

5. Conclusions

In conclusion, the SC10H2 isolates of Chinese Leishmania areable to infect macrophages in vitro. Cycloheximide-induced intrin-sic apoptosis is regulated by these parasites, but has contrastingoutcomes in THP-1 and RAW264.7 cells. Therefore, it is likely thatLeishmania adapt to the particular environment of the individ-ual host cells from different mammals and thus have differentregulatory effects. However, there was no difference in the DNAfragmentation rates between the infected and un-infected cells

during apoptosis induction, despite the significant differences inthe early signs of apoptosis, indicating that the time point chosenis too early for the execution step. Future studies should focus onthe possibility of reversing of apoptosis at prolonged time points in

1 opica

da

A

Foa(

R

A

A

A

A

A

A

A

B

B

B

C

C

C

C

C

C

C

D

D

D

D

E

F

F

G

G

Yang, B.B., et al., 2013. Analysis of kinetoplast cytochrome b gene of 16 Leishmaniaisolates from different foci of China: different species of Leishmania in Chinaand their phylogenetic inference. Parasite Vectors 6, 32.

10 J. Zeng et al. / Acta Tr

ifferent host cells and the relationship between SC10H2 survivalnd host immunity in vivo.

cknowledgments

This work was supported by the National Natural Scienceoundation of China (81171607, J1103604), the National Projectf Important Infectious Diseases of China (2008-ZX10004-011),nd the Foundation for Young Teachers in Sichuan University2012SCU11093).

eferences

bu-Zant, A., et al., 2005. Incomplete activation of macrophage apoptosis duringintracellular replication of Legionella pneumophila. Infect. Immun. 73 (9),5339–5349.

dalid-Peralta, L., et al., 2011. Mechanisms underlying the induction of regulatoryT cells and its relevance in the adaptive immune response in parasiticinfections. Int. J. Biol. Sci. 7 (9), 1412–1426.

dams, J.M., Cory, S., 2007. Bcl-2-regulated apoptosis: mechanism and therapeuticpotential. Curr. Opin. Immunol. 19 (5), 488–496.

ga, E., et al., 2002. Inhibition of the spontaneous apoptosis of neutrophilgranulocytes by the intracellular parasite Leishmania major. J. Immunol. 169(2), 898–905.

karid, K., et al., 2004. Leishmania major-mediated prevention of programmed celldeath induction in infected macrophages is associated with the repression ofmitochondrial release of cytochrome c. J. Leukoc. Biol. 76 (1), 95–103.

lessenko, A.V., et al., 1997. Mechanisms of cycloheximide-induced apoptosis inliver cells. FEBS Lett. 416 (1), 113–116.

uwerx, J., 1991. The human leukemia cell line, THP-1: a multifacetted model forthe study of monocyte-macrophage differentiation. Experientia 47 (1), 22–31.

anerjee, R., et al., 2011. TGF-beta-regulated tyrosine phosphatases inducelymphocyte apoptosis in Leishmania donovani-infected hamsters. Immunol.Cell. Biol. 89 (3), 466–474.

lankenship, J.W., et al., 2009. Ubiquitin binding modulates IAPantagonist-stimulated proteasomal degradation of c-IAP1 and c-IAP2(1).Biochem. J. 417 (1), 149–160.

ogdan, C., Rollinghoff, M., 1998. The immune response to Leishmania:mechanisms of parasite control and evasion. Int. J. Parasitol. 28 (1), 121–134.

ao, D.P., et al., 2011. Species delimitation and phylogenetic relationships ofChinese Leishmania isolates reexamined using kinetoplast cytochrome oxidaseII gene sequences. Parasitol. Res. 109 (1), 163–173.

ao, D.P., et al., 2012. Axenic culture and identification of amastigotes from Sichuanhuman strain of Chinese Leishmania isolates. Vet. Parasitol. 183 (3–4), 353–355.

handra, D., Naik, S., 2008. Leishmania donovani infection down-regulatesTLR2-stimulated IL-12p40 and activates IL-10 in cells ofmacrophage/monocytic lineage by modulating MAPK pathways through acontact-dependent mechanism. Clin. Exp. Immunol. 154 (2), 224–234.

hipuk, J.E., Green, D.R., 2008. How do BCL-2 proteins induce mitochondrial outermembrane permeabilization? Trends Cell Biol. 18 (4), 157–164.

ipriani, B., et al., 2001. Curcumin inhibits activation of V gamma9Vdelta2 T cellsby phosphoantigens and induces apoptosis involving apoptosis-inducingfactor and large scale DNA fragmentation. J. Immunol. 167 (6), 3454–3462.

ohen, G.M., 1997. Caspases: the executioners of apoptosis. Biochem. J. 326 (pt. 1),1–16.

osentino, K., Garcia-Saez, A.J., 2014. Mitochondrial alterations in apoptosis. Chem.Phys. Lipids 181, 62–75.

aigneault, M., et al., 2010. The identification of markers of macrophagedifferentiation in PMA-stimulated THP-1 cells and monocyte-derivedmacrophages. PLoS One 5 (1), e8668.

eschacht, M., et al., 2012. Role of oxidative stress and apoptosis in the cellularresponse of murine macrophages upon Leishmania infection. Parasitology 139(11), 1429–1437.

onovan, M.J., et al., 2009. Leishmania infection inhibits cycloheximide-inducedmacrophage apoptosis in a strain-dependent manner. Exp. Parasitol. 123 (1),58–64.

ubrez-Daloz, L., Dupoux, A., Cartier, J., 2008. IAPs: more than just inhibitors ofapoptosis proteins. Cell Cycle 7 (8), 1036–1046.

l-Hani, C.N., et al., 2012. Apoptosis and apoptotic mimicry in Leishmania: anevolutionary perspective. Front. Cell. Infect. Microbiol. 2, 96.

ilardy, A.A., et al., 2010. Proinflammatory clearance of apoptotic neutrophilsinduces an IL-12(low) IL-10(high) regulatory phenotype in macrophages. J.Immunol. 185 (4), 2044–2050.

ilardy, A.A., et al., 2014. Infection with Leishmania major induces a cellular stressresponse in macrophages. PLoS One 9 (1), e85715.

annavaram, S., Debrabant, A., 2012. Programmed cell death in Leishmania:biochemical evidence and role in parasite infectivity. Front. Cell. Infect.Microbiol. 2, 95.

arcia-Saez, A.J., 2012. The secrets of the Bcl-2 family. Cell Death Differ. 19 (11),1733–1740.

153 (2016) 101–110

Getti, G.T., Cheke, R.A., Humber, D.P., 2008. Induction of apoptosis in host cells: asurvival mechanism for Leishmania parasites? Parasitology 135 (12),1391–1399.

Guan, W., et al., 2012. Phylogenic analysis of Chinese Leishmania isolates based onsmall subunit ribosomal RNA (SSU rRNA) and 7 spliced leader RNA (7SL RNA).Acta Parasitol. 57 (2), 101–113.

Gupta, G., Oghumu, S., Satoskar, A.R., 2013. Mechanisms of immune evasion inleishmaniasis. Adv. Appl. Microbiol. 82, 155–184.

Gutierrez-Kobeh, L., et al., 2013. Inhibition of dendritic cell apoptosis byLeishmania mexicana amastigotes. Parasitol. Res. 112 (4), 1755–1762.

Hu, X., et al., 2002. Difference in DNA sequences in SSU rDNA variable regionsamong pathogens isolated from different epidemic foci of visceralleishmaniasis in China. Chin. Med. J. (Engl.) 115 (10), 1457–1459.

Kang, M.H., Reynolds, C.P., 2009. Bcl-2 inhibitors: targeting mitochondrialapoptotic pathways in cancer therapy. Clin. Cancer. Res. 15 (4), 1126–1132.

Kim, H.S., et al., 2000. Induction of apoptosis in human leukemia cells by3-deazaadenosine is mediated by caspase-3-like activity. Exp. Mol. Med. 32(4), 197–203.

Li, J.F., et al., 2007. Cloning of avastin gene of Leishmania donovani isolates fromSichuan Province and its expression in eucaryotic system. Zhongguo Ji ShengChong Xue Yu Ji Sheng Chong Bing Za Zhi 25 (2), 124–128.

Lisi, S., et al., 2005. Infection with Leishmania infantum inhibits actinomycin-induced apoptosis of human monocytic cell line U-937. J. Eukaryot. Microbiol.52 (3), 211–217.

Liu, C.Y., Lee, C.F., Wei, Y.H., 2009. Role of reactive oxygen species-elicitedapoptosis in the pathophysiology of mitochondrial and neurodegenerativediseases associated with mitochondrial DNA mutations. J. Formos. Med. Assoc.108 (8), 599–611.

Martin, S.J., et al., 1995. Early redistribution of plasma membranephosphatidylserine is a general feature of apoptosis regardless of the initiatingstimulus: inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med. 182 (5),1545–1556.

McIlwain, D.R., Berger, T., Mak, T.W., 2013. Caspase functions in cell death anddisease. Cold Spring Harb. Perspect. Biol. 5 (4), a008656.

Moore, K.J., Turco, S.J., Matlashewski, G., 1994. Leishmania donovani infectionenhances macrophage viability in the absence of exogenous growth factor. J.Leukoc. Biol. 55 (1), 91–98.

Mougneau, E., Bihl, F., Glaichenhaus, N., 2011. Cell biology and immunology ofLeishmania. Immunol. Rev. 240 (1), 286–296.

Nagata, S., Apoptotic, D.N.A., 2000. Fragmentation. Exp. Cell Res. 256 (1), 12–18.Obexer, P., Ausserlechner, M.J., 2014. X-linked inhibitor of apoptosis protein—a

critical death resistance regulator and therapeutic target for personalizedcancer therapy. Front. Oncol. 4, 197.

Olivier, M., Gregory, D.J., Forget, G., 2005. Subversion mechanisms by whichLeishmania parasites can escape the host immune response: a signaling pointof view. Clin. Microbiol. Rev. 18 (2), 293–305.

Parrish, A.B., Freel, C.D., Kornbluth, S., 2013. Cellular mechanisms controllingcaspase activation and function. Cold Spring Harb. Perspect. Biol. 5 (6).

Rodust, P.M., et al., 2009. UV-induced squamous cell carcinoma—a role forantiapoptotic signalling pathways. Br. J. Dermatol. 3 (161 Suppl), 107–115.

Ruhland, A., Leal, N., Kima, P.E., 2007. Leishmania promastigotes activate PI3K/Aktsignalling to confer host cell resistance to apoptosis. Cell Microbiol. 9 (1),84–96.

Sarkar, A., et al., 2013. Infection of neutrophil granulocytes with Leishmania majoractivates ERK 1/2 and modulates multiple apoptotic pathways to inhibitapoptosis. Med. Microbiol. Immunol. 202 (1), 25–35.

Silke, J., Vucic, D., 2014. IAP family of cell death and signaling regulators. MethodsEnzymol. 545, 35–65.

Srivastav, S., et al., 2014. Leishmania donovani prevents oxidative burst-mediatedapoptosis of host macrophages through selective induction of suppressors ofcytokine signaling (SOCS) proteins. J. Biol. Chem. 289 (2), 1092–1105.

Tait, S.W., Green, D.R., 2013. Mitochondrial regulation of cell death. Cold SpringHarb. Perspect. Biol. 5 (9).

Tao, L., et al., 2013. Induction of rapid cell death by an environmental isolate ofLegionella pneumophila in mouse macrophages. Infect. Immun. 81 (9),3077–3088.

Tian, Y., Chen, J.P., Hu, X.S., 2004. Cloning and sequence analysis of the ribosomalDNA ITS gene of Leishmania donovani isolates from hill foci of China. ZhongguoJi Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 22 (5), 294–296.

Wanderley, J.L., Barcinski, M.A., 2010. Apoptosis and apoptotic mimicry: theLeishmania connection. Cell. Mol. Life Sci. 67 (10), 1653–1659.

Wanderley, J.L., et al., 2005. Apoptotic mimicry: an altruistic behavior inhost/Leishmania interplay. Braz. J. Med. Biol. Res. 38 (6), 807–812.

Wang, Z., et al., 2005. TNF-alpha induces proliferation or apoptosis in humansaphenous vein smooth muscle cells depending on phenotype. Am. J. Physiol.Heart Circ. Physiol. 288 (1), H293–301.

Wenzel, U.A., et al., 2012. Leishmania major parasite stage-dependent host cellinvasion and immune evasion. FASEB J. 26 (1), 29–39.

Yang, Y.L., 2000. The IAP family: endogenous caspase inhibitors with multiplebiological activities. Cell Res. 10 (3), 169–177.