purification of nuclear factor i by dna recognition site affinity

THE .JOURNAL IC‘, 1986 by The American Society of Biological

OF BIOLOGICAL CHEMISTRY Chemists, Inc.

Val. 261, No. 3, Issue ofJanuary 25, pp. 1398-1408.1986 Printed in U.S.A.

Purification of Nuclear Factor I by DNA Recognition Site Affinity Chromatography*

(Received for publication, July 9, 1985)

Philip J. RosenfeldS and Thomas J. Kelly8 From the Deaartment of Molecular Biology and Genetics, The Johns Hopkins University School of Medicine,

”

Baltimore, Maryland 21205

Nuclear factor I (NF-I) is a cellular protein that enhances the initiation of adenovirus DNA replication in vitro. The enhancement of initiation correlates with the ability of NF-I to bind a specific nucleotide sequence within the viral origin of replication. We have developed a method for the purification of NF-I which is based upon the high affinity interaction between the protein and its recognition site. This approach may be generally applicable to the purification of other site- specific DNA binding proteins. The essential feature of the method is a two-step column chromatographic procedure in which proteins are first fractionated on an affinity matrix consisting of nonspecific (Esche- richia coli) DNA and then on a matrix that is highly enriched in the specific DNA sequence that is recognized by NF-I. During the first step NF-I coelutes with proteins that have similar general affinity for DNA. During the second step NF-I elutes at a much higher ionic strength than the contaminating nonspecific DNA binding proteins. The DNA recognition site affinity matrix used in the second step is prepared from a plasmid (pKB67-88) that contains 88 copies of the NF- I binding site. This plasmid was constructed by means of a novel cloning strategy that generates concatenated NF-I binding sites arranged exclusively in a direct head to tail configuration. Using this purification scheme, we have obtained a 2400-fold purification of NF-I from crude HeLa nuclear extract with a 57% recovery of specific DNA binding activity. Throughout the purification procedure NF-I retained the ability to enhance the efficiency of initiation of adenovirus DNA replication in vitro. Electrophoresis of the purified fraction on sodium dodecyl sulfate-polyacrylamide gels revealed a population of related polypeptides that ranged in apparent molecular weight from 66,000 to 52,000. The native molecular weight of NF-I deduced from gel filtration and glycerol sedimentation studies is 55,000 and the frictional ratio is 1.3. These results suggest that NF-I exists as a globular monomer in solution.

The molecular mechanisms that are responsible for initiation and chain elongation during adenovirus DNA replication have been studied extensively (for review, see Ref. 1). In uiuo

* This study was supported by Research Grant CA16519 from the National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

GM07309. $Supported by Medical Scientist Training Program Grant

§ To whom correspondence should be addressed.

studies have shown that adenovirus DNA replication initiates at either terminus of the 35,000-bp’ linear genome and pro- ceeds by continuous DNA synthesis in the 5’ to 3’ direction. The detailed study of the replication process has been facilitated by the development of a cell-free adenovirus DNA replication system (2). In uitro studies have shown that initiation entails the covalent attachment of a dCMP residue to a virus-encoded protein, designated the preterminal protein (pTP) (3-7). The pTP .dCMP initiation complex then serves as the primer for subsequent chain elongation.

Formation of the pTp.dCMP complex requires specific DNA sequences that constitute the adenovirus origin of DNA replication (7-13). The viral genome contains two identical origins, one at each terminus. The origins of Ad2 and Ad5 have been cloned and shown to support the initiation of adenovirus DNA replication in uitro. The essential base pairs that are required for the initiation of DNA replication were identified by the study of base substitution and deletion mutations within the cloned terminal sequence. In uiuo’ (14, 49) and in uitro studies with such mutant DNAs have shown that the functional origin of replication is contained within the terminal 67 bp. Moreover, this 67-bp origin can be further subdivided into two functionally distinct domains (11, 12). The first 18 bp constitute the minimal origin of DNA replication and nucleotides 19 to 48 are required for optimal levels of initiation.

The replication proteins required for the initiation reaction are encoded by both the viral and cellular genomes. The viral initiation proteins include the 80-kDa pTP and the 140-kDa DNA polymerase (15-18). These two proteins are sufficient to catalyze the initiation of adenovirus DNA replication, albeit with low efficiency. The addition of nuclear extract from uninfected HeLa cells greatly enhances the initiation of adenovirus DNA replication. Nagata et al. (19) have purified a cellular activity that is required for optimal initiation. This cellular activity was designated nuclear factor I (NF-I).

The enhancement of initiation by NF-I appears to be mediated via its interaction with a specific sequence within the origin of adenovirus DNA replication (11, 12, 20, 50). DNase I protection analysis of bound NF-I revealed a footprint within the sequence required for optimal replication (nucleotides 19 to 48). The ability of NF-I to recognize various mutant

The abbreviations used are: bp, base pairs; pTP, 80-kDa precursor of the 55-kDa terminal protein that is covalently attached to the 5’ termini of Ad DNA; Ad, adenovirus; NF-I, nuclear factor I; Ad DNA- protein complex, adenovirus genomic DNA with the intact 55-kDa terminal protein; Ad DNA, adenovirus genomic DNA without the 55- kDa terminal protein; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; HEPES, N-2-hydroxyethylpiperazine-N’- 2-ethanesulfonic acid BSA, bovine serum albumin; PMSF, phenyl- methylsulfonyl fluoride; DTT, dithiothreitol.

M. D. Cballberg, personal communication.

1398

DNA Recognition Site Affinity Chromatography 1399

replication origins containing single base substitutions or deletions has been shown to correlate directly with its ability to enhance the initiation reaction in uitro3 (11, 12, 50, 51). Moreover, the consensus recognition sequence for NF-I, TGGA/CNNNNNGCCAA, has been identified by analysis of the Ad origin mutants and by comparison of NF-I binding sites found in several viral and cellular DNAs4 (21-25). Al- though partially purified NF-I has been sufficient for the identification of specific binding sites, detailed biochemical characterization of the NF-I protein(s) will require more highly purified preparations.

An attractive approach to the purification of a site-specific DNA binding protein is chromatography on a DNA affinity matrix that contains the specific recognition sequence. While this approach has not been used in practical purification procedures, previous studies have provided evidence of its feasibility. Herrick (26) made use of a plasmid containing a single lac operator sequence to prepare an affinity matrix for lac repressor. Elution of repressor from this matrix required exposure to higher ionic strength buffers than did elution from a matrix containing only nonspecific DNA. Oren et al. (27) obatined similar results with SV40 T antigen, a site- specific DNA binding protein that recognizes a sequence within the SV40 origin of replication. Higher ionic strength buffers were required to elute T antigen from SV40 DNA- cellulose than from calf thymus DNA-cellulose. Moreover, the proportion of specifically bound T antigen that eluted at the highest ionic strength was increased significantly by preparing the affinity matrix from the DNA of an SV40 variant that contained five origins of replication. This observation suggested that a useful affinity matrix should contain a high ratio of specific to nonspecific binding sites.

In this report we describe the use of DNA recognition site affinity chromatography for the purification of NF-I. The affinity matrix was prepared using plasmid DNA that contains 88 copies of the NF-I binding site from the adenovirus origin of replication. This plasmid was constructed by means of a novel cloning strategy that generated concatenated NF-I binding sites arranged exclusively in the direct head to tail orientation. Purification of NF-I was effected by a two-step column chromatographic procedure in which proteins were first fractionated on a matrix consisting of nonspecific (Esch- erichia coli) DNA and then on a recognition site affinity matrix. During the first step NF-I coeluted with proteins that have a similar general affinity for DNA. During the second step NF-I eluted at much higher ionic strength than the contaminating nonspecific DNA binding proteins. These two steps, combined with one stage of ion-exchange chromatography, resulted in a 2400-fold purification of NF-I from crude HeLa nuclear extract with a final yield of 57%. This general approach should be applicable to the purification of other sequence-specific DNA binding proteins.

EXPERIMENTAL PROCEDURES

Preparation of a Multiple Binding Site Plasmid

Construction of pKB67-All plasmids were propagated in the RecA- host HB101. The plasmid pMDC7d167 contains the terminal 67 bp of the Ad2 genome cloned between EcoRI and BamHI sites (11). This 67-bp fragment was inserted between the EcoRI and BarnHI sites of pKP45 to construct the plasmid pKR67. The plasmid pKP45, obtained from Keith Peden, Howard Hughes Medical Insti- tute Laboratory of Genetics, Johns Hopkins University School of Medicine, was derived from pBR322 by the deletion of nucleotides

' P. J . Rosenfeld, R. J . Wides, and T. J. Kelly, unpublished results. P. J. Rosenfeld, D. R. Rawlins, and T. J. Kelly, unpublished

results.

677-2364. The plasmid pKB67 was constructed by cleavage of pKR67 with EcoRI, treatment with Klenow fragment and dNTPs to fill in the recessed 3' termini, and ligation to unphosphorylated BglII oligonucleotide linkers, 5'-d(CAGATCTG)-3'. Attachment of this linker regenerated an EcoRI site adjacent to the EglII site a t each terminus. The plasmid DNA was separated from the unreacted linkers by 1.4% agarose gel electrophoresis and isolated by standard electroelution procedures (28). After restriction with BglII, the isolated DNA was ligated and the appropriate plasmid identified after transformation of HBlOl to ampicillin resistance. pKB67 served as the parental plasmid for the construction of the multiple binding site plasmid

Construction of pKB67-21-The first step in the construction of pKB67-11 was to isolate the 73-bp BglIIIBamHI fragment from pKB67 (Fig. 1). The 73-bp BglIIIBamHI fragment was isolated by digesting 200 pg of pKB67 with BglII (100 units) and EamHI (100 units) in 50 mM Tris-HC1 (pH 8.0)/50 mM NaC1/5 rnM MgCI, (5 ml) for 3 h a t 37 "C. The reaction was terminated by adding an equal volume of 50 mM EDTA and extracting twice with phenol. After dialysis against TE-200 (10 mM Tris-HC1 (pH 7.2)/1 mM EDTA/2OO mM NaCI), the fragments were isolated by NAGS-37 chromatography. The DNA was hound to a 3-ml NACS-37 column (1 X 3.8 crn) that was equilibrated in TE-200. The column was washed with TE-400 and developed with a 20-ml linear gradient from 400 to 650 mM NaCl followed by a 2 M NaCl step elution. Aliquots from each 0.5-ml fraction were analyzed by 2% agarose gel electrophoresis. Fractions containing either the large vector fragment or the BglIIIBamHI insert fragment were pooled, dialyzed against deionized HzO, and lyophi- lized. The 73-bp fragment was resuspended in T E (200 p1/20 pg/ml). This fragment was ligated in a direct head to tail orientation by incubating 2 pg with T4 DNA ligase (0.2 unit), BglII (5 units), and BamHI (5 units) in 70 mM Tris-HC1 (pH 7.6)/10 mM MgCI2/5 mM DTT/50 mM NaC1/1 mM ATP at 37 "C. After 60 min, an additional aliquot (25 pl) of DNA (0.5 pg), ligase (0.1 unit), BglII (2.5 units), and BamHI (2.5 units) was added. This addition was repeated every 30 min for 2 h. After 2.5 h, the reaction mixture was heated to 70 "C for 15 rnin to inactivate the ligase. An additional aliquot of BglII (10 units) and BamHI (10 units) was added and incubation at 37 "C was continued for 60 min. The reaction mixture was phenol extracted and fractionated by 2% agarose gel electrophoresis. Ligated fragments ranging in size from 0.5 to 1 kilobase pairs were electroeluted and inserted between the BglIIIBamHI sites of the vector fragment that was purified by NACS-37 chromatography. This vector fragment was treated with calf intestinal alkaline phosphatase (see below) prior to ligation. HB101 was transformed by the ligation products and a plasmid that contained 11 repeats of the 73-bp sequence was identified by restriction analysis. This plasmid was designated pKB67-11.

C o n s t r u c ~ i o n o ~ p ~ ~ 6 7 - ~ 8 frompKB67-II-Two-fold amplification of the repeated sequences was achieved by digesting pKB67-11 (4 vg) wit,h PstI (10 units) and either BglII (IO units) or BarnHI (IO units) in 50 mM Tris-HC1 (pH 8.0)/50 mM NaC1/5 mM MgCI, (50 p l ) at 37 "C for 90 min (Fig. 2). The PstIIBamHI cleavage products were phosphatased by adjusting the reaction mixture to 50 mM Tris-HC1 (pH 9)/1 mM MgCI2/0.1 mM ZnClZ/l mM spermidine (250 pl) and adding calf intestinal alkaline phosphatase (0.1 unit). After 30 min at 37 "C, a second aliquot of phosphatase was added and incubation was continued for an additional 30 min. The reaction was adjusted to 10 mM EDTA/0.5% SDS and heated to 68 "C for 15 min. Both restriction digests were separated by electrophoresis on a preparative 1% agarose gel and the fragments containing the multiple binding sites were electroeluted and ligated. This new construct, pKB67-22, was used to generate the plasmid pKB67-44 by repeating the same 2- fold amplification protocol. pKB67-44 was used to generate the plasmid pKB67-88.

Large Scale Preparation of pKB67-88 DNA-One-liter cultures of HBlOl containing the plasmid pKB67-88 were grown to saturation (20 h) and the plasmid was isolated by a modification of the alkali lysis procedure (28). After centrifugation at 4000 X g for 15 min, the bacterial pellet was washed once with 25 mM Tris-HC1 (pH 8.0)/10 mM EDTA/l% glucose (100 ml) and then resuspended in 40 ml of the same buffer. Lysozyme (100 mg) was added and after 5 min at 23 "C, the bacteria were lysed by the addition of 0.2 M NaOH/l% SDS (80 ml). The pellets were solubilized and 5 M potassium acetate (pH 5.2) (60 ml) was added. After 10 min a t 4 "C, the precipitate was removed by centrifugation a t 5000 X g for 30 min. The supernatant was poured through two layers of cheesecloth and an equal volume of isopropyl alcohol was added to precipitate nucleic acid, The precipi-

pKB67-88.

1400 D N A Recognition Site Affinity Chromatography

tate was collected by centrifugation a t 5000 X g for 30 min and dissolved in 100 mM Tris-HCI (pH 8.0)/1 mM EDTA (15 ml). CsCl was added to a final density of 1.55 g/ml. Ethidium bromide was added to a final concentration of 800 pg/ml. Form I plasmid DNA was isolated by two successive CsCl gradient equilibrium centrifuga- tions and subsequent dialysis against 10 mM Tris-HC1 (pH 8.0)/1 mM EDTA. Approximately 500 pg of form I DNA were isolated per liter of culture medium.

Purification of Nuclear Factor I

Buffers-The buffers used in the purification of NF-I contained the protease inhibitors pepstatin A, chymostatin, and antipain a t a concentration of 1 pglml. The composition of Buffer W is 137 mM NaC1/10 mM Na2HP04/2 mM KHZP04/2.7 mM KC1/0.5 mM MgC12. Buffer H is 25 mM HEPES (pH 7.5)/5 mM KCl/1 mM MgC12/1 mM DTT/1 mM PMSF. Buffer E is 25 mM HEPES (pH 7.5)/10% sucrose/ 0.01% Nonidet P-40/1 mM DTT/1 mM PMSF. Buffer D is 25 mM HEPES (pH 7.5)/40% glycerol/O.Ol% Nonidet P-40/1 mM DTT/2 mM EDTA/O.l mM PMSF. Buffer S is 25 mM HEPES (pH 7.5)/20% glycerol/O.Ol% Nonidet P-40/1 mM DTT/1 mM EDTA/O.l mM PMSF.

Preparation of DNA-celluloses-DNA was adsorbed to cellulose according to the method of Alberts and Herrick (29) with the following modifications. The nonspecific DNA-cellulose was prepared from high molecular weight E. coli DNA (30). The specific affinity matrix was prepared from pKB67-88 DNA linearized with PstI. DNA (1 mg/ ml) was mixed with cellulose (0.5 g/ml DNA) and air-dried for 48 h followed by lyophilization for 12 h. The matrices were hydrated in Buffer S containing 2 M NaCl and stored as a frozen slurry (-20 "C). The amount of DNA bound to cellulose (1 mg of DNA/ml of packed matrix) was estimated by AZM1 measurements of the column effluent during the packing and equilibration steps.

Preparation of HeLa Nuclear Extract-S-3 HeLa cells were propagated at 37 "C in suspension culture in Eagle's minimal essential medium supplemented with 5% horse serum. Each liter of cells was grown to a density of 4-5 X lo5 cells/ml and collected by centrifugation a t 3000 X g for 5 min and washed twice with 15 ml of Buffer W. The washed cell pellets were frozen a t -70 "C. A total a t 6 X 10" cells (120 g) were used in the purification. Each gram of HeLa cells was thawed at 4 "C and resuspended in 5 ml of Buffer H containing 0.2% Nonidet P-40. Cells were completely disrupted by 10 strokes with a tight fitting dounce homogenizer and nuclei were collected by centrifugation at 1000 X g for 5 min. The nuclear pellet was washed once with 5 ml of Buffer H containing 0.01% Nonidet P-40 and once with 5 ml of Buffer E. Nuclei were resuspended in 2.0 ml of Buffer E containing 0.35 M NaCl and incubated on ice for 60 min. The residual nuclei were removed by centrifugation a t 10,000 X g for 30 min and an equal volume of Buffer D was added to the supernatant.

E. coli DNA-cellulose Chromatography-The diluted pool of activity from the Bio-Rex 70 column (430 ml, 550 mg) was loaded onto an E. coli DNA-cellulose column (60 ml, 2.5 X 1 2 cm) that had been pre- equilibrated with 200 mM NaCl in Buffer s. The matrix was washed with 200 mM NaCl in Buffer S (200 ml) and the DNA binding activity was eluted with a linear gradient from 200 to 500 mM NaCl in Buffer S (300 ml). The gradient elution was followed by a 2 M NaCl step elution. The peak of specific DNA binding activity eluted between 280 and 350 mM NaC1. Fractions were pooled (75 ml) and diluted with an equal volume of Buffer S.

pKB67-88 DNA-cellulose Chromatography-The diluted eluate from the E. coli DNA-cellulose column (62.5 mg, 75 ml) was loaded onto the specific DNA-cellulose column (5 ml, 1 X 6.3 cm) that had been pre-equilibrated with 200 mM NaCl in Buffer S. The column was washed with 200 mM NaCl in Buffer S (20 ml) and proteins were eluted with a linear gradient from 200 to 500 mM NaCl (30 ml). The specific DNA binding activity was recovered in the 2 M NaCl step elution (5.28 ml, 2.1 mg). This eluate was diluted with 9 volumes of Buffer S and reapplied to the same pKB67-88 DNA-cellulose column that had been re-equilihrated with 200 mM NaCl in Buffer S. The column was washed with 0.2 M NaCl (10 ml) followed by step elutions a t 450 mM NaCl (20 ml) and 2 M NaCl (20 ml). The specific DNA binding activity eluted with the 2 M NaCl step (4.28 ml, 1.1 mg). The eluate was dialyzed against 100 mM NaCl in Buffer S and stored at -70 "C.

Assays

Nitrocellulose Filter Binding Assay-The DNAs used in the parallel ntrocellulose filter binding assays were pKP45 and pKR67. The plasmid pKR67 contains the specific recognition sequence for NF-I and the plasmid pKP45 contains only vector sequences that serve as nonspecific DNA. Plasmids were linearized with EcoRI and labeled a t their 3' termini (4.0 X lo4 cpm/fmol) by incubating with [cY-~'P] dATP and [cY-~'P]~TTP (3000 Ci/mmol) in the presence of Micrococ- cus luteus polymerase (28). The standard filter binding assay used in the purification of NF-I was performed in parallel with labeled pKP45 and pKR67. Each assay (50 pl) contained 25 mM HEPES (pH 7.5)/ 150 mM NaC1/5 mM MgC1,/1 mM DTT/2% glycerol/5 pg of BSA/5 pg of sheared E. coli DNA/O.l nM 32P-DNA. Protein fractions were diluted (1:50-200) in Buffer S containing 25 mM NaCl and 5 pl of the dilution were added to reaction mixtures containing 32P-pKR67 or 32P-pKP45. The binding assays were incubated at 4 "C for 30 min and then filtered a t a rate of 25 ml/h through nitrocellulose membrane mounted on a Schleicher and Schuell Minifold apparatus. Each sample was washed once with 0.5 ml of 25 mM HEPES (pH 7.5)/150 mM NaC1/2% glycerol/5 mM MgC12/1 mM DTT. Filters were dried and radioactive DNA bound to the filter was quantitated by liquid scintillation counting. Each assay was performed in duplicate and the average values were plotted. Duplicate samples varied by less than 5%.

The competition nitrocellulose filter binding assay was performed using a partially purified preparation of NF-I as previously described (11) with the following modifications. Radioactive DNA was prepared as described previously for the standard nitrocellulose filter binding assays. The reaction mixtures contained 0.1 nM 32P-pKR67 and form I plasmid DNA was used as competitor.

pTP-dCMP Complex Formation in Vitro-Cytoplasmic extract from Ad5-infected cells was prepared as previously described (2). The standard in uitro initiation reaction (25 pl) contained 25 mM HEPES (pH 7.5)/5 mM MgC12/1 mM DTT/4 mM ATP/40 pg/ml aphidicolin/ 0.15 PM [ C Y - ~ ~ P I ~ C T P (3000 Ci/mmol)/50 ng of Ad DNA-protein complex/30 pg of Ad-infected cytoplasmic extract. Various HeLa fractions were added and the reaction was incubated at 37 "C. After 60 min, reactions were terminated by incubation at 70 "C for 5 min, and subsequently digested with micrococcal nuclease (15 units) a t 37 "C for 30 min. Protein was precipitated by adding one-third volume of 2 mg/ml deoxycholate/50% trichloroacetic acid and collected by centrifugation. The precipitate was solubilized in 30 pl of SDS-PAGE sample buffer and 1 N NH,OH was used to adjust the pH to 6.8. Samples were electrophoresed on a 30 X 7.5 X 0.15-cm 8% SDS- polyacrylamide gel. After electrophoresis, the gel was dried and the radioactivity was detected by exposure against Kodak XAR-5 film with the enhancement of a DuPont Lightening-Plus intensifying screen.

DNase Z Footprinting-The plasmid pKR67 (20 pg) was linearized by digestion with EcoRI and both 3' and 5' termini were radioactively labeled (28). The 3' termini were labeled (2.1 X lo4 cpm/fmol) by incubating with [ c Y - ~ ' P ] ~ A T P a n d [ c Y - ~ * P ] ~ T T P (3000 Ci/mmol) in the presence of Klenow fragment from DNA polymerase I. The 5' termini were labeled (1.5 X lo4 cpm/fmol) by incubating with [Y-~'P] ATP (5000 Ci/mmol) in the presence of T4 polynucleotide kinase after treatment with calf intestinal alkaline phosphatase. Both 5' and 3' labeled DNAs were cleaved with BamHI and the appropriate fragments were isolated by electroelution after electrophoresis on an 8% polyacrylamide gel.

Protein (Fraction V) was bound to the gel purified fragments (5 fmol) at 4 "c for 30 min in a reaction (50 pl) containing 25 mM HEPES (pH 7.5)/150 mM NaC1/5 mM MgC12/1 mM DTT/5 pg of BSA/5 pg of sheared E. coli DNA. DNase I (0.5 unit) was added and after 40 s at 23 "C, the reaction was terminated by phenol extraction. DNA was ethanol precipitated and resuspended in sample buffer containing 85% formamide/l5 mM NaOH/l mM EDTA/O.l% brom- phenol blue/O.l% xylene cyanol. Samples were incubated at 100 "C for 3 min and electrophoresed on a 0.4-mm 20% polyacrylamide/8 M urea gel as described by Maxam and Gilbert (31). G + A and C + A sequencing reactions for each fragment were performed by a modification of the Maxam and Gilbert protocol (32) and the cleavage products were electrophoresed in parallel lanes. Radioactivity was detected by wet gel exposure to Kodak XAR-5 film with a Lightening- Plus intensifying screen at -70 "C.

Peptide Mapping by Limited Proteolysis-The method of limited proteolysis (33) in conjunction with two-dimensional electrophoresis (34) was performed with the following modifications. Fraction V (100


p1) was dialyzed against 25 mM HEPES (pH 7.5)/20% glycerol/O.Ol% Nonidet P-40/100 mM NaC1/1 mM EDTA to remove dithiothreitol. Prior to the iodination of NF-I, an Iodo-Bead was incubated with 1 mCi of NaIz5I in the presence of 25 mM HEPES (pH 7.5)/100 mM NaC1/0.01% Nonidet P-40/1 mM EDTA (65 pl). After 5 min a t 23 "C, 5 pg of dialyzed Fraction V was added and incubation was continued for 2 min. Removal of the Iodo-Bead and the addition of equal volume 1 M 2-mercaptoethanol terminated the reaction. Unincorporated lz51 was removed by precipitation of protein with one-third volume of 2 mg/ml deoxycholate/50% trichloroacetic acid. The precipitate was solubilized in SDS-PAGE sample buffer and adjusted to pH 6.8 by the addition of 1 N NH,OH. 1251-labeled protein (0.5 pg) was electrophoresed through a 10% SDS-polyacrylamide tube gel (0.3 X 15 cm). After electrophoresis, the tube gel was soaked for 60 min in 125 mM NaCl (pH 6.8)/0.1% SDS/1 mM EDTA and then layered across the t.op of a 15% SDS-polyacrylamide slab gel (20 X 20 X 0.15 cm). The tube gel was sealed in place with 1% agarose prepared in sample buffer and overlayed with 0.5 ml of Staphylococcus aureus V8 protease (2 pg/ml) prepared in sample buffer. After electrophoresis for 6 h a t 10 V/cm, the gel was dried and autoradiographed with an intensifying screen a t -70 "C.

Glycerol Gradient Sedimentation-Density gradient centrifugation was performed according to the method of Martin and Ames (35)

diluted with 50 p1 of 25 mM HEPES (pH 7.5)/900 mM NaC1/0.01% with the following modifications. Fraction V (50 pl; 12.5 pg) was

Nonidet P-40/1 mM DTT/1 mM EDTA/O.l mM PMSF and layered onto a linear 15 to 30% glycerol gradient (4.8 ml) prepared in Buffer S containing 500 mM NaC1. A parallel glycerol gradient was loaded with Fraction V (25 ng) and a mixture of protein standards (100 pg of catalase, 11.3 S; 100 pg of aldolase, 8.27 S; 100 pg of BSA, 4.22 S; 100 pg of ovalbumin, 3.55 S; 100 pg of chymotrypsinogen, 2.54 S). This mixture was adjusted to 100 pl with a final buffer concentration of 25 mM HEPES (pH 7.5)/10% glycero1/500 mM NaC1/0.01% Non- idet P-40/1 mM EDTA/1 mM DTT. After centrifugation in a Beck- man SW 50.1 rotor a t 45,000 rpm for 25 h (4 "C), the gradients were fractionated from the bottom of the tube. Fractions (100 p1) were assayed for specific DNA binding activity and analyzed by SDS- polyacrylamide gel electrophoresis. Protein from each fraction was precipitated by the addition of 33 ~1 of 2 mg/ml deoxycholate/50% trichloroacetic acid and solubilized in SDS-PAGE sample buffer. Polypeptides were visualized by silver staining after electrophoresis on a 10% SDS-polyacrylamide gel.

Sephacryl S-200 Gel Filtration-Gel filtration samples (100 pl) were applied to a 38-ml (1 X 48.5 cm) Sephacryl S-200 column equilibrated in Buffer S with 500 mM NaCl and developed at a flow rate of 1 ml/h. Standards (blue dextran 2000; catalase, 52.2 A; aldolase, 48.1 A; alcohol dehydrogenase, 46 A; BSA, 35.5 A; ovalbumin, 30.5 A; chymotrypsinogen, 20.9 A; cytochrome c, 17 A; RNase A, 16.4 A; thymidine) were prepared in Buffer S with 500 mM NaCl and monitored during elution by both spectrophotometric absorption a t 280 nm and SDS-polyacrylamide gel electrophoresis. Fraction V (2.5 Gg) was adjusted to 500 mM NaCl in Buffer S and chromat.0- graphed on the Sephacryl S-200 column. The eluate was assayed for specific DNA binding activity.

Protein Assay-Protein concentrations were determined according to the method of Bradford (36). Bovine y-globulin was used as the standard.

SDS-Polyacrylamide Gel Electrophoresis-SDS-polyacrylamide gel electrophoresis was performed as described by Laemmli (37). Sample buffer contained 50 mM Tris-HC1 (pH 6.8)/10% glycerol/0.3 M 2- mercaptoethanol/Z% SDS/0.005% phenol red. The gel standards ( M r ) were myosin (205,000), @-galactosidase (116,000), phosphorylase b (97,400), BSA (66,000), ovalbumin (45,000), and carbonic anhydrase (29,000). Silver staining was performed as described by Morrissey (38).

Materials-Plasmid DNA was prepared using standard procedures (28) unless otherwise specified. S3 HeLa cells were supplied as frozen cell pellets from the MIT Cell Culture Center (Cambridge, Mass.). Pepstatin A, chymostatin, antipain, SDS-PAGE standards, alcohol dehydrogenase (yeast), and tris(hydroxymethy1)amino methane (Trizma base) were obtained from Sigma. Bio-Rex 70 (200 to 400 mesh). acrylamide, bisacrylamide, cellulose (Cellex 410), and the protein assay kit were from Bio-Rad. BglII linkers, T4 polynucleotide kinase, T4 DNA ligase, calf intestinal alkaline phosphatase, Sephac- ryl S-200, and gel filtration standards were from Pharmacia (P-L Biochemicals). NACS-37 resin, restriction enzymes, Klenow fragment, and Nonidet P-40 were from GIBCO-Bethesda Research Lab-

oratories. Radioactive isotopes were from Amersham Corp. HEPES, free acid, was from Calbiochem-Behring. Dithiothreitol and sedimentation (gel filtration) standards were from Boehringer Mannheim. M. luteus DNA polymerase was from Miles Laboratories. BA85 nitrocellulose membrane was from Schleicher and Schuell. DNase I (DPRF) was from Worthington. Iodo-Beads were from Pierece Chemical Co. Dialysis tubing (12,000 M, cutoff) was from Spectrum Medical In- dustries. Betafluor scintillation mixture was from National Diagnos- tics. All other chemicals were reagent grade or higher.

RESULTS

Construction of a Multi-Ad Origin Plasmid-We have used DNA recognition site affinity chromatography for the purification of NF-I. The feasibility of this approach for the purification of sequence specific DNA binding proteins was suggested by the studies of Herrick (26) and Oren et al. (27). Moreover, the observations of Oren et al. indicated a direct correlation between the average affinity of the protein for a DNA affinity matrix and the proportion of immobilized DNA that represents specific binding sites. In the present study we maximized the ratio of specific to nonspecific DNA binding sites on the affinity matrix by engineering a plasmid that contains multiple copies (88) of the NF-I binding site. By amplifying the number of binding sites in a plasmid, we also reduced the molar amount of plasmid that would be required to prepare an affinity matrix of a given capacity.

The multiple binding site plasmid was constructed by in- serting copies of the NF-I recognition sequence into a vector that contained only the essential DNA sequences required for propagation in E. coli. To avoid the possibility that deletions would result from homologous recombination between the reiterated sequences, we have used the RecA- host HBIO1. However, even RecA- E. coli have been shown to delete sequences that contain a %fold rotational symmetry longer than 8 bp (39, 40). Consequently, all ligated copies of the binding site were arranged in a direct head to tail orientation. To assure the appropriate configuration of each binding site, we have developed a strategy for cloning stable multiple repeats of a specific sequence (Figs. 1 and 2).

The NF-I binding site used in the amplification protocol was contained within the terminal 67 bp of the adenovirus genome. This 67-bp sequence which constitutes the entire origin of adenovirus DNA replication (1 1, 12) was obtained from the deletion mutant pMDCdl67 and subcloned between the EcoRI and BamHI sites in the plasmid pKP45, a derivative of pBR322 that contains a deletion from 677-2364. This subclone was designated pKR67. BglII linkers were inserted at the EcoRI site of pKR67, and the resulting plasmid (pKB67) contained a BglII site flanked on either side by EcoRI sites. Cleavage of pKB67 with BglII and BamHI re- leased a 73-bp fragment that contained the 67-bp origin sequence from adenovirus. This 73-bp fragment served as the basic repeat unit for the construction of the multiple binding site plasmid (Fig. 1). Since cleavage with BamHI and BglII produces fragments that possess complementary 5' termini, incubation of the 73-bp fragment in the presence of T4 ligase yields three types of joints: BamHI/BamHI, BglII/BglII, and BamHI/BglII. Inclusion of restriction enzymes BamHI and BglII in the ligation mixture results in cleavage of the BamHI/ BamHI and BglII/BglII joints. The BglIIIBamHI hybrid joint between fragments is not recognized by either restriction enzyme. Consequently, the resulting ligation products contain the 73-bp fragments oriented in a direct head to tail configuration (Fig. 1). The number of direct copies that can be cloned by this method is limited by the tendency for concatemers of increasing size to undergo intramolecular circularization. Us- ing this protocol, we have constructed a plasmid that contains

1402 DNA Recognition Site Affinity Chromatography

B g l l l

I I 2 3 I O I I

1

FIG. 1. Construction of the multiple NF-I binding site plasmid pKB67-11. The plasmid pKB67-11 which contains 11 direct repeats of the NF-I binding site was constructed from the plamsid pKB67. The plasmid pKB67 is a derivative of the plasmid pKR67 which contains nucleotides 1 to 67 of the Ad2 genome inserted between the EcoRI site and the BamHI site of the vector pKP45 (11). To obtain pKB67, a BglII oligonucleotide linker was inserted at the EcoRI site of pKR67. The multiple direct repeats of the NF-I binding site were constructed by cleavage of pKB67 with BamHI and BglII, purification of the 73-bp fragment that contained the NF-I binding site (arrow), and incubation of the fragment with BamHI, BglII, and ligase to generate concatemers organized in a direct head to tail configuration. The concatemers were reinserted between the BglII and BamHI sites of the parental plasmid. The resulting recombinants were propagated in HBlOl and subsequently screened for intact BamHI and BglII sites. The largest concatamer detected by restriction analysis in the initial screen contained 11 direct repeats of the 73-bp fragment. This plasmid was designated pKB67-11.

11 direct repeats of the adenovirus terminal 67 bp (pKB67- 11).

The multicopy insert that contained 11 direct repeats was subsequently amplified to 22 direct repeats using the protocol shown in Fig. 2. This method is generally useful for the %fold amplification of any sequence flanked by different restriction sites that possess complementary 5' termini when cleaved. Two-fold amplification of pKB67-11 was accomplished by digesting pKB67-11 with PstI and either BamHI or BglII. The PstIIBamHI fragment that contained the multicopy insert and most of the @-lactamase gene was ligated to the PstI/ BglII fragment that contained the multicopy insert and the plasmid origin of DNA replication. This plasmid (pKB67-22) contained 22 direct copies of the 73-bp sequence. Repeated 2- fold amplifications of the multicopy plasmids in this manner resulted in the construction of pKB67-88, a plasmid that contains 88 copies of the NF-I binding site. The direct head to tail orientation of each 73-bp repeat was verified by cleavage of pKB67-88 with EcoRI. Analysis of the cleavage products revealed the presence of only unit length 73-bp fragments and not the 146-bp fragment expected from cleavage of an indirect repeat (data not shown). In addition, the repeat units were tested for their ability to bind NF-I. A competition nitrocellulose filter binding assay (11) demonstrated that NF- I bound pKB67-88 with an apparent affinity that was 100- fold greater than its affinity for pKR67 DNA (Fig. 3). This result indicated that NF-I was capable of recognizing each of the 88 binding sites in pKB67-88.

The 88 direct repeats in pKB67-88 were stably propagated in HB101; however, the addition of chloramphenicol prior to the isolation of plasmids resulted in deletions within these

' pKB67-44

c pKB67 - 88

FIG. 2. Construction of the plasmid pKB67-88 by 2-fold amplification of the multiple direct repeats. The multiple direct repeats in the plasmid pKB67-11 were amplified 2-fold by cleaving pKB67-11 with PstI followed by BamHI or BglII. The PstIIBamHI and the PstIIBglII fragments containing the concatemers were isolated and ligated together. The appropriate recombinant containing 22 tandem repeats (pKB67-22) was identified by restriction analysis after transformation of HBlOl and ampicillin selection. Two additional rounds of amplification resulted in the construction of pKB67- 88, a plasmid that contained 88 copies of the NF-I binding site.

I ' ' ' " " ' 1 ' ' """I ' ' """I ' ' ""r

0.001 0 .01 0 . 1 1 . 0 Competitor D N A (nM)

FIG. 3. Competition nitrocellulose filter binding assays with NF-I binding sequences in pKR67 and pKB67-88. The number of NF-I binding sites in the plasmids pKR67 and pKB67-88 were compared using a competition nitrocellulose filter binding assay as described under "Experimental Procedures." Fixed concentrations of NF-I and 32P-labeled pKR67 were incubated with varying concentrations of unlabeled competitor DNA (form I). The concentration of NF-I bound to 32P-pKR67 at each competitor concentration (CD) was normalized to the concentration of 32P-pKR67 bound to protein in the absence of competitor (CO). The fraction bound (CD/CO) was calculated for the following competitor DNAs: the vector pKP45 (closed circles), pKR67, containing one copy of the Ad origin (open circles), and pKB67-88, containing 88 copies of the Ad origin (closed boxes).

repeated sequences. For this reason, plasmid DNA was purified from bacterial cultures grown to saturation without chloramphenicol amplification.

Purification of Nuclear Factor I-A nitrocellulose filter binding assay was used to detect DNA binding activity during the purification. The assay mixture contained a 1000-fold


excess of nonradioactive sheared E. coli DNA that served as competitor for nonspecific DNA binding proteins in crude nuclear extract and partially purified fractions. In order to correlate DNA binding activity with specific NF-I binding activity, we have determined the levels of both specific and nonspecific DNA binding activity in each protein fraction. This was accomplished by performing parallel nitrocellulose filter binding assays with radioactive specific DNA (pKR67) and radioactive nonspecific DNA (pKP45). The NF-I specific binding activity was calculated by subtracting the nonspecific binding ffom the total binding obtained with pKR67. The usefulness of this approach is demonstrated by the Bio-Rex 70 elution profile (Fig. 4A). Despite high levels of nonspecific binding, the fractions containing the specific NF-I binding activity were easily detected (Fig. 4B).

Column Chromatography-HeLa nuclear extract was loaded onto the high capacity cationic exchange resin Bio- Rex 70. This step removed 88% of the loaded protein, significantly reducing the amount of DNA-cellulose matrix required for subsequent purification steps. In addition, Bio-Rex 70 chromatography resulted in a 100% recovery of specific DNA binding activity with a corresponding 8.7-fold purification of NF-I (Table I). The specific DNA binding activity coeluted with an activity that enhanced the in vitro initiation of adenovirus DNA replication (Fig. 4C). The initiation assay monitors the formation of a covalent linkage between the preterminal protein (pTP) and [a-"'PIdCTP (3-7). Reaction products are electrophoresed on an SDS-polyacrylamide gel and the radioactive pTP-dCMP complex is detected by autoradiography. This initiation activity and the specific DNA

' binding activity would be expected to co-purify if the activities were the properties of the same protein.

The activity from the Bio-Rex 70 column was bound to E. coli DNA-cellulose and recovered by a 200 to 500 mM NaCl gradient elution. This step resulted in the co-elution of NF-I with DNA binding proteins that had similar affinity for nonspecific DNA, effectively removing high affinity nonspecific DNA binding proteins that could potentially contaminate subsequent purification by the DNA recognition site affinity matrix (Fig. 5A). E. coli DNA-cellulose chromatography resulted in a 6.5-fold purification and an 83% recovery of specific DNA binding activity (Table I). In addition, as observed with the Bio-Rex 70 elution, the peak of DNA binding activity coincided with the activity that enhanced the initiation of adenovirus DNA replication (Fig. 5B).

The specific DNA binding activity was loaded onto pKB67- 88 cellulose, the recognition site affinity matrix, and the column was developed using the same elution conditions that were described for the previous nonspecific DNA-cellulose matrix. The bulk of the protein eluted from the pKB67-88 DNA-cellulose column at the same position in the gradient as it eluted from the nonspecific DNA matrix. However, the specific DNA binding activity was shifted to the 2 M NaCl elution step. An identical shift was observed for the in vitro complementing activity (Fig. 6B). Elution from the DNA recognition site affinity matrix resulted in a 25-fold purification with an 80% recovery of activity (Table I). Reapplication of this fraction to the affinity matrix and subsequent elution provided an additional 1.7-fold purification (Table I). The affinity-purified NF-I was dialyzed and stored at -70 "C without detectable loss of specific binding activity after 6 months. Furthermore, repeated freezing and thawing of the affinity-purified fraction did not diminish the specific DNA binding activity.

Characterization of NF-I-DNA Interactions-The properties of affinity-purified NF-I were compared to the properties

Fraction Number

C abcd , . l , l . . , . I . , . . I . . , . I . . . . I - . . . I

10 20 30 40 50 6p . ?-*** MpTP-dCMP 2- Ef"f+ / , ."" - - "t*.

"r , j.. ~ .". FIG. 4. Fractionation of HeLa nuclear extract by Bio-Rex

70 chromatography. HeLa nuclear extract was prepared as described under "Experimental Procedures" and loaded onto a Bio-Rex 70 column a t 200 mM NaC1. The column was developed with a linear gradient between 200 and 600 mM NaC1. The elution position of NF- I DNA binding activity was determined by parallel nitrocellulose filter binding assays. The difference in the amount of radioactivity bound to nitrocellulose filters in the presence of 32P-labeled specific (pKR67) and nonspecific (pKP45) DNAs represented specific NF-I binding activity. Additionally, the elution of NF-I-dependent Ad- DNA replication activity was assayed by the formation of pTP-dCMP initiation complexes. A , the DNA binding activity was detected by assaying aliquots (0.1 p1) of the column eluate with "P-labeled pKP45 (open squares) and pKR67 (closed triangles). B, the profile of specific NF-I DNA binding activity (closed circles) was calculated by subtracting the DNA binding activity observed with nonspecific DNA from the binding activity associated with specific DNA. Fractions 16 through 36 were pooled for subsequent purification. The protein concentrations (open circles) were determined by the Bradford dye assay. C, the stimulation of pTP-dCMP complex formation was assayed as described under "Experimental Procedures." Reaction mixtures contained cytoplasmic extract from Ad5-infected HeLa cells, Ad-DNA protein complex (except in lane c ) , and [(u-~'P]~CTP as the only deoxynucleoside triphosphate. The pTP-dCMP complexes were analyzed by SDS-polyacrylamide gel electrophoresis followed by autoradiography. Lane a, no addition of protein from uninfected cells; lane b, addition of uninfected crude nuclear extract (1 PI); lane c, addition of uninfected crude nuclear extract with deproteinated Ad- DNA as template; lane d , flow-through fraction; lanes 2-62, elution fractions from the Bio-Rex 70 column.

previously described for NF-I purified by conventional chromatography (11, 19, 20). DNase I protection analysis of NF-I bound to radioactively labeled pKR67 revealed a footprint within the adenovirus origin of replication (Fig. 7). Affinity- purified NF-I protected a region from nucleotides 21 to 44 on the 5' labeled strand and nucleotides 19 to 42 on the 3' strand. This protected region closely approximates the previously


TABLE I Affinity purification of nuclear factor I

Fraction Total protein Volume Specific activity" Purification Yield

w ml X I 0-3 -fold % I. HeLa Nuclear Extractb 4590 900.0 3.1 1.0 100

11. Bio-Rex 70 550 215.0 27.1 8.7 104 111. E. coli DNA-cellulose 65.2 75.0 181.0 58.4 83 IV. pKB67-88 DNA-cellulose I 2.1 5.25 4510.0 1455 67 V. pKB67-88 DNA-cellulose I1 1.1 4.28 7517.0 2425 57

Specific 32P-DNA bound (fmol)/mg protein. _" 6 X 10" (120 g) HeLa cells.

- 7

+ 6

5 a 0 4

c 3

v I 0

X

E

73

3

: 2

61 a

10 20 30 40 50 60 70

* MpTP-dCMP

I

FIG. 5. Chromatography of NF-I on E. coli DNA-cellulose. The Bio-Rex 70 elution fractions that contained the specific DNA binding activity were pooled, diluted to 200 mM NaCl, and loaded onto an E. coli DNA-cellulose column as described under "Experi- mental Procedures." The column was developed with a linear gradient between 200 and 500 mM NaCl followed by a 2 M NaCl step elution. The elution profiles of the specific DNA binding activity and the pTP-dCMP stimulatory activity were determined. A, the profile of specific DNA binding activity, as determined by parallel nitrocellulose filter binding assays, is shown by the closed circles. Aliquots (0.05 pl) were incubated with 32P-labeled pKR67 and pKP45 as described under "Experimental Procedures." Fractions 16 to 32 were pooled for further purification. The protein concentrations, as determined by the Bradford dye assay, are shown by the open circles. B, fractions were assayed for the stimulation of pTP-dCMP complex formation as described under "Experimental Procedures." Lane a, no addition of protein from uninfected cells; lane b, addition of uninfected crude nuclear extract; lune c, flow-through fraction; lanes 2-66, elution fractions from the E. coli DNA-cellulose column.

identified NF-I binding site. Adjacent to the protected sequences, a region of enhanced DNase I cleavage is observed on the 3' strand between nucleotides 50 and 59 and on the 5' strand between nucleotides 46 and 56 (Fig. 7, brackets). This NF-I-dependent sensitivity to DNase I has not been observed previously.

The binding reaction was further characterized by Scat- chard analysis. For purposes of this analysis, the interaction between NF-I and DNA was considered to be a simple bimolecular reaction. A fixed amount of protein was incubated to equilibrium with various DNA concentrations and the per- centage of DNA that bound specifically was determined by the nitrocellulose filter binding assay. This analysis resulted

10 20 30 40 50 60 70 F r a c t i o n Number

FIG. 6. Purification of NF-I by DNA recognition site affinity chromatography. The fractions containing specific DNA binding activity from the E. coli DNA-cellulose column were pooled, diluted to 200 mM NaCl, and loaded onto a pKB67-88 DNA-cellulose column as described under "Experimental Procedures." The column was developed with a linear gradient between 200 and 500 mM NaCl followed by a 2 M NaCl step elution. A, the bulk of the protein (open circles) eluted from the recognition site DNA affinity column at a position similar to its elution position from the E. coli DNA-cellulose column. The specific DNA binding activity (closed circles) eluted at 2 M NaCl. Fractions 58 to 66 were pooled and rechromatographed on the same column. B, fractions were assayed for their ability to stimulate the formation of the pTP-dCMP initiation complex. Lane a, no addition; lune b, addition of uninfected crude nuclear extract; lunes 2-68, fractions from the pKB67-88 DNA-cellulose column.

in a calculated dissociation constant of 2.1 x lo-" M for the interaction between NF-I and the Ad5 origin of replication (Fig. 8).

Physical Characterization of NF-I-SDS-polyacrylamide gel electrophoresis and silver staining revealed a population of polypeptides that bound preferentially to the first pKB67- 88 DNA-cellulose column (Fig. 9e). These polypeptides ranged in molecular weight from 66,000 to 32,000 with the major polypeptides between 66,000 and 52,000. After a second application to the pKB67-88 affinity matrix, the minor high molecular weight protein contaminants were diminished without significant loss of the major polypeptides or the binding activity (Fig. sf). Similar polypeptides were identified when a previous preparation of NF-I (12) that had been chromato- graphed on DEAE-cellulose, phosphocellulose, single- stranded DNA-cellulose, and hydroxylapatite was subjected to E. coli DNA-cellulose and pKB67-88 cellulose chromatography (Fig. 9g). In addition, these polypeptides were shown to co-sediment in a glycerol gradient with the peak of specific DNA binding activity (Fig. 10). These data strongly suggest that this population of polypeptides represents the specific DNA binding activity.


A a b c d e f g h

" "

0.0"- """

- "*"" """. ""0" """"

]50-59

1 42

19

i i k I m n o ~

"

B N F I FOOTPRINT

S'CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGT J ' G T A G T A G T T A T T A T A T G G A A T A A 4 8 ( ; C I * * C T T m C T A m C C C C C A C C T C A

i0 2d 30 40 I 50 60

I , M I N I M A L O R I G I N - OPTIMAL ORIGIN '

I

FIG. 7. DNase I protection of the Ad5 origin of replication by affinity-purified NF-I. A , the 67-bp EcoRI/BarnHI fragment of pKR67 that contains nucleotides 1 to 67 of the Ad2 genome was 'labeled with 32P at the EcoRI site as described under "Experimental Procedures." The 3'-labeled fragment (a- f ) and the 5'-labeled fragment (i-n) were incubated with increasing amounts of affinity-purified NF-I. The reaction mixtures were treated with DNase I and electrophoresed on a 20% acrylamide-urea sequencing gel. A + G (g, 0) and A + C (h, p ) sequencing reactions of the labeled fragments were run in parallel lanes to identify the sequence protected by NF- I. Lanes a and i, input DNA without DNase I digestion; lunes b and j , no protein added; lunes c and k , 1 ng of NF-I added; lunes d and 1, 5 ng of NF-I added; lunes e and m, 25 ng of NF-I added; lunes f and n, 125 ng of NF-I added. B, the terminal 60 bp of the Ad2 genome contains four blocks of nucleotide sequence (underlined) that are conserved among several human adenovirus serotypes (I). The sequence protected by NF-I (brackets) includes conserved sequences that have been identified as the consensus recognition sequence for NF-I (TGGA/CNNNNNGCCAA) (21-25). Two other conserved sequences are immediately adjacent to the boundaries of the NF-I footprint.

The structural relationship between the major polypeptides in Fraction V was examined by limited proteolysis and peptide analysis. lZ5I-Labeled NF-I (Fig. 9h) was subjected to SDS- polyacrylamide tube gel electrophoresis followed by proteolysis during electrophoresis in the second dimension. Limited proteolysis with S. aurem V8 protease revealed similar peptide patterns for the major polypeptides between M, = 66,000 and 52,000 (Fig. 11, arrows). The data suggest that the major polypeptides in Fraction V share a similar primary sequence. There are several possible explanations for the observed mul- tiplicity of polypeptides with specific DNA binding activity. The simplest explanation is that some proteolysis occurred during purification. Although we cannot rule out this possibility, numerous protease inhibitors were included at every step in the purification as a precaution. Other explanations for the multiple polypeptides observed include heterogeneity in the modification of a protein (e.g. phosphorylation, glyco- sylation) and the possibility that these proteins represent multiple gene products that recognize the same or a closely

[Bound DNA] (pM)

FIG. 8. Scatchard analysis of the interaction between NF-I and the Ad2 binding site. The affinity of NF-I for the Ad2 binding site was determined by Scatchard analysis. The plasmid, pKR67, labeled with 32P at the EcoRI site, was incubated a t concentrations of 15.5, 31, 50, 125, and 250 PM with a fixed amount of NF-I (0.25 ng) without the addition of nonspecific competitor DNA. Binding of NF-I to labeled nonspecific DNA could not be detected in control experiments performed under the identical assay conditions. The concentration of DNA-protein complexes ( D E ) was determined by the nitrocellulose filter binding assay. Each point represents the average of three experimental assays. Assuming that the interaction between NF-I and its recognition site (Ad2 origin) is a simple bimolecular reaction, the following expression holds a t equilibrium:

(PT/&) - (DB/KD) (DB/DF). The free DNA concentration ( D p ) was calculated by subtracting the concentration of bound DNA (Ds) from the total input DNA concentration. The experimentally determined slope (-1/KD) resulted in a calculated dissociation constant of 2.1 X lo-" M. The concentration of total protein (PT) was calculated to be 3.6 X lo-" M or approximately 0.1 ng for a protein with a molecular mass of 55,000 kDa.

97.4" 116- --I

- -

29"

FIG. 9. SDS-polyacrylamide gel electrophoresis of the purification fractions. Protein (4 pg) from each step in the purification was electrophoresed on a 10% SDS-polyacrylamide gel as described under "Experimental Procedures." After electrophoresis, the polypeptides were visualized by silver staining. Lane a, molecular weight standards; lane b, fraction I, crude HeLa nuclear extract; lune c, fraction 11, Bio-Hex 70 eluate; lane d , fraction 111, E. coli DNA- cellulose eluate; lune e, fraction IV, pKB67-88 DNA-cellulose eluate I; lane f, fraction V, pKB67-88 DNA-cellulose eluate 11; luneg, pKB67- 88 DNA-cellulose eluate from a preparation of NF-I that was partially purified by conventional chromatography prior to fractionation on E. coli and pKB67-88 DNA-cellulose columns (Ref. 11, see "Results"); lune h, 0.5 pg of 1251-labeled fraction V (see "Experimental Proce- dures").

related sequence or serve as NF-I subunits. The subunit composition and shape of NF-I in solution

were determined from a calculation of the native molecular weight and frictional ratio according to the method of Siege1

1406 DNA Recognition Site Affinity Chromatography

A I " " I ' ' " I " " I ' ' ' ~ I - 9 .

2 5 -

x 4 -

-

- E .

0 3 - a

c 2 -

-

U

3 0 -

10 20 30 40 50 BOTTOM F r a c t ~ o n Number TOP

B

205- .I&. I. I . -.L 1"

116- 97.4

I

r' 4 5

- "- 29

FIG. 10. Identification of polypeptides associated with NF- I binding activity by glycerol gradient sedimentation. Affinity- purified NF-I was subjected to glycerol sedimentation as described under "Experimental Procedures." A, the sedimentation position of NFlI specific DNA binding activity was determined by nitrocellulose filter binding assays on aliquots (0.05 pl) from each fraction (100 pl) . B, fractions (100 111) were analyzed by SDS-polyacrylamide gel electrophoresis followed by silver staining as described under "Experi- mental Procedures."

and Monty (41). The parameters required for these calcula- tions include the sedimentation coefficient and the Stokes radius for NF-I. Glycerol gradient analysis provided a sedimentation coefficient of 4.0 and a Stokes radius of 33 A was determined by S-200 analytical gel filtration (Fig. 12). Assum- ing a partial specific volume of 0.725 cm3/g, we have calculated a native molecular mass for NF-I of 55 kDa with a frictional ratio of 1.3. In conjunction with the denatured molecular weight determined by SDS-polyacrylamide gel electrophoresis, the data suggest that NF-I existed as a globular monomer when analyzed in a buffer that contained 0.5 M NaC1. This salt concentration was chosen to minimize the amount of nonspecific interactions during glycerol gradient sedimentation and gel filtration. Although shown to be a monomer under the described assay conditions, the possibility exists that NF-I could form a higher order complex under different conditions or when bound to its recognition sequence.

DISCUSSION

Regulation of fundamental cellular processes, such as gene expression and DNA replication, is generally mediated by sequence-specific DNA binding proteins (11, 12, 42-47). In prokaryotic and viral systems the identification and characterization of such regulatory proteins has been greatly facilitated by the availability of powerful genetic approaches to complement conventional biochemical methods. In eukaryotic systems, genetic methods are less well developed, although the application of recombinant DNA procedures has made it possible to identify with relative ease cis-acting sequences involved in regulation. The identification and purification of

97:4 66 d5 $9 M, x 1 0 3

FIG. 11. Peptide mapping of the affinity-purified NF-I by limited proteolysis and two-dimensional gel electrophoresis. The relationship between the major polypeptides in the affinity- purified NF-I preparation was assessed by partial proteolysis followed by a comparison of the resulting peptides as described under "Exper- imental Procedures." Iz5I-Labeled affinity-purified NF-I was first electrophoresed on a 10% SDS-polyacrylamide tube gel and then overlayed on a 15% SDS-polyacrylamide slab gel either in the absence ( A ) or presence ( B ) of S. aurew V8 protease. After electrophoresis, the radioactivity was visualized by autoradiography. In the absence of protease (A) , the polypeptides electrophoresed in both dimensions according to their molecular weight. In the presence of protease, the polypeptides between M, 66,000 and 52,000 were digested to peptides that have similar mobility (arrows).

the proteins that specifically recognize such sequences are important steps toward understanding genetic regulatory mechanisms in eukaryotes. In this report we have described a rapid, high yield purification scheme for NF-I (DNA recognition site affinity chromatography) that is generally applicable to other sequence-specific DNA binding proteins. This method is useful for the isolation of nuclear regulatory proteins that are present in low abundance and requires only that the recognition sequence be located within a restriction fragment suitable for amplification (Figs. 1 and 2).

DNA recognition site affinity chromatography entails two essential steps. In the first step, the cell extract containing the binding protein is first enriched by passage over a nonspecific DNA affinity matrix. This step fractionates the specific DNA binding protein with other DNA binding proteins that have similar affinity for nonspecific DNA. Purification of the binding protein is then accomplished by passage over the DNA recognition site affinity matrix. The success of this purification step depends on the relative affinity of the protein for specific DNA compared to nonspecific DNA. In addition, the extent of purification and the yield depend on the proportion of immobilized DNA sequences that are specific recognition sequences. An affinity matrix with a high ratio of specific to nonspecific sequences is prepared by cloning the binding site between two restriction sites that provide complementary termini when cleaved (e.g. BamHI, BglII), amplifying the sequence (Figs. 1 and 2), and immobilizing the plasmid on cellulose. Even if the matrix is maximized for specific DNA sequences, fractionation by DNA recognition site affinity chromatography may still result in only a partially purified preparation. However, additional purification may be


ta

\

A 10 20 30 40

BOTTOM F r a c t i o n Number TOP

0 . 9 7

I

0.3 u 20 30 40 50 60

S t o k e ' s Radius (cm X 10')

FIG. 12. Determination of the native molecular weight and frictional ratio of NF-I. Affinity-purified NF-I was subjected to analytical glycerol gradient sedimentation and S-200 Sephacryl gel filtration as described under "Experimental Procedures." A , the sedimentation position of NF-I was determined by the standard nitrocellulose filter binding assay. The sedimentation positions of the marker proteins (catalase, 11.3 S; aldolase, 8.27 S; BSA, 4.22 S; ovalbumin, 3.55 S; chymotrypsinogen, 2.54 S) were determined by analyzing each fraction on SDS-polyacrylamide gels followed by silver staining. B, the void volume (V, = 14.7 ml) and the included volume (Vi = 34.3 ml) of the S-200 Sephacryl column were determined by the elution positions of blue dextran 2000 and thymidine, respectively. The elution position of marker proteins (catalase, 52.2 A; aldolase, 48.1 A; yeast alcohol dehydrogenase, 46 A; BSA, 35.5 A, ovalbumin 30,5 A; chymotrypsinogen, 20.9 A; cytochrome c, 17 A; RNase A, 16.4 A) were determined by AzW and verified by SDS-polyacrylamide gel electrophoresis. The elution position of NF-I was determined by the nitrocellulose filter binding assay. (&)'I3 was calculated as previously described (41). A native molecular weight of 55,000 with a frictional ratio of 1.3 was calculated according to the method of Siegal and Monty (41).

obtained by repeated chromatography of the protein fraction on the nonspecific and specific DNA affinity matrices.

Using a DNA recognition site affinity matrix, we have purified a sequence-specific DNA binding protein 2400-fold with a 57% recovery from crude nuclear extract. Moreover, an activity from uninfected HeLa cells that enhances the in vitro initiation of adenovirus DNA replication co-purified with the sequence-specific DNA binding activity. Thus, the purified protein has all the biochemical properties previously ascribed to NF-I.

SDS-polyacrylamide gel electrophoresis of the most purified fraction followed by silver staining revealed several major polypeptides with molecular weights between 52,000 and 66,000. Similar silver-stained polypeptides were observed when a crude preparation of NF-I was fractionated over four additional columns prior to chromatography on E. coli DNA- cellulose and pKB67-88 DNA-cellulose. Moreover, the specific DNA binding activity has been shown to co-migrate with these polypeptides during glycerol gradient sedimentation. Analysis of the affinity-purified NF-I by limited proteolysis with V8 Staphylococcus protease suggests a structural similar- ity between the major polypeptides, but the basis for this

relationship has not been determined. Although the heterogeneity of these polypeptides could be explained by the proteolysis of NF-I during the purification, a more intriguing possibility is that these proteins are products of a gene family that encodes several site-specific DNA binding proteins that recognize a similar sequence.

The molecular weight estimate that we have obtained for NF-I is not in agreement with a previous study (19). Nagata et al. (19) reported the presence of a major polypeptide of 47kDa in partially purified fractions containing NF-I activity. A polypeptide of this molecular weight was not observed in preparations of NF-I that we have purified by recognition site affinity chromatography. Since the purity of the latter preparations is more than 10-fold greater than that obtained by Nagata et al., it seems likely that the 47-kDa protein represented a contaminant or possibly a proteolytic product of NF- I.

The sequence-specific DNA binding properties previously ascribed to NF-I are identical to the properties of the affinity- purified protein(s) (11, 19, 20). Affinity-purified NF-I binds the adenovirus origin of DNA replication with a dissociation constant of 2.1 X lo-" M. By comparing NF-I binding sites from various sources, our laboratory, as well as others, has identified a consensus recognition sequence (21-25). The can- nonical binding site TGGA/CNNNNNGCCAA is characterized by a region of dyad symmetry (TGG . . . CCA) separated by a required spacing of 7 bp. Previous studies have shown that prokaryotic site-specific DNA binding proteins that recognize sequences with dyad symmetry bind as dimers to these sequences (41). Although gel filtration and glycerol sedimentation studies indicate that NF-I exists as a monomer, the protein may form a multimeric complex when bound to its symmetrical recognition sequence.

The NF-I binding site within the Ad2 origin of replication is contained within sequences which are conserved among certain human adenovirus serotypes (Ad2, Ad3, Ad5, Ad7, Ad12, Ad18, Ad31) and the Simian adenovirus SA7 (Fig. 7C). (1). Two of the four conserved regions comprise the recognition site for NF-I and the two remaining conserved sequences could contain binding sites for other replication proteins. Rijnders et al. (48) have reported that the complex formed between the viral encoded preterminal protein and DNA polymerase binds preferentially to the 14-bp conserved sequence from positions 9 to 22 in the replication origin. This sequence coincides with the minimal origin required for adenovirus replication in vitro.

The mechanism whereby bound NF-I enhances the efficiency of initiation is not known. NF-I could promote the formation of active initiation complexes by interacting directly with other replication proteins, possibly increasing the affinity of these proteins for the conserved sequences within the origin. This possibility is suggested by the juxtaposition of the NF-I footprint to both the minimal origin sequence and the conserved sequence between nucleotides 44 and 50. Alternatively, NF-I could function to perturb (e.g. unwind) the DNA helix within the origin and promote strand displace- ment. We have observed a region of enhanced DNase I cleavage between base pairs 46 and 59 which are adjacent to the 26-bp sequence protected by NF-I. This NF-I-dependent hy- persensitivity to DNase I may reflect such a perturbation in the DNA helix.

The affinity-purified NF-I should be useful for the further characterization of the mechanisms involved in adenovirus DNA replications, as well as the role of NF-I in cellular metabolism. These studies will be facilitated by the use of polyclonal antibodies that we have generated against the


affinity-purified NF-I. In addition, these antibodies should be valuable reagents for identifying the NF-I gene(s).

Acknowledgments-We thank Dr. Dan Rawlins for helpful discus- sions concerning the construction of pKB67-88. We also thank Dr. Gary Ketner, Dr. Edward O’Neill, Dr. Mark Bolanowski, Dr. Dan Rawlins, Dr. Harvey Ozer, Dr. Steve Desiderio, and Ronald Wides for their thorough reading of this manuscript. We are grateful to Marcia Bolanowski for excellent secretarial assistance in preparing the manuscript.

REFERENCES 1. Kelly, T. J., Jr. (1984) in The Adenouiruses (Ginsberg, H. S., ed)

2. Challberg, M. D., and Kelly, T . J., Jr. (1979) Proc. Natl. Acad.

3. Challberg, M. D., Desiderio, S. V., and Kelly, T. J., Jr. (1980)

4. Challberg, M. D., Ostrove, J. M., and Kelly, T. J., Jr. (1982) J.

5. Lichy, J. H., Horwitz, M. S., and Hurwitz, J . (1981) Proc. Natl.

6. Pincus, S., Robertson, W., and Rekosh, D. M. K. (1981) Nucleic

7. Tamanoi, F., and Stillman, B. W. (1982) Proc. Natl. Acad. Sci.

8. Tamanoi, F., and Stillman, B. W. (1983) Proc. Natl. Acad. Sci.

9. van Bergen, B. G. M., van der Ley, P. A., van Driel, W., van Mansfeld, A. D. M., and van der Vliet, P. C. (1983) Nucleic Acids Res. 11, 1975-1989

10. Challberg, M. D., and Rawlins, D. R. (1984) Proc. Natl. Acad. Sci.

11. Rawlins, D. R., Rosenfeld, P. J., Wides, R. J., Challberg, M. D., and Kelly, T. J., Jr. (1984) Cell 37, 309-319

12. Guggenheimer, R. A., Stillman, B. W., Nagata, K., Tamanoi, F., and Hurwitz, J . (1984) Proc. Natl. Acad. Sci. U. S. A. 81,3069- 3073

13. Lally, C., Dorper, T., Groger, W., Antoine, G., and Winnacker,

14. Hay, R. T. (1985) EMEO J. 4, 421-426 15. Enomoto, T., Lichy, J. H., Ikeda, J.-E., and Hunvitz, J. (1981)

Proc. Natl. Acad. Sci. U. S . A. 78, 6779-6783 16. Lichy, J. H., Field, J., Honvitz, M. S., and Hurwitz, J. (1982)

Proc. Natl. Acad. Sci. U. S. A. 79, 5225-5229 17. Stillman, B. W., Tamanoi, F., and Mathews, M. B. (1982) Cell

3 1,613-623 18. Ostrove, d . M., Rosenfeld, P. J., Williams, J., and Kelly, T. J., Jr .

(1983) Proc. Natl. Acad. Sci. U. S. A. 80, 935-939 19. Nagata, K., Guggenheimer, R. A,, Enomoto, T., Lichy, J. H., and

Hurwitz, J. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 6438- 6442

20. Nagata, K., Guggenheimer, R. A,, and Hurwitz, J . (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 6177-6181

Vol. 19, pp. 271-308, Plenum Press, New York

Sci. U. S. A. 76,655-659

Proc. Natl. Acad. Sci. U. S. A. 77, 5105-5109

Virol. 41, 265-270

Acad. Sci. U. S. A. 78, 2678-2682

Acids Res. 9, 4919-4935

U. S. A. 79, 2221-2225

U. S. A. 80,6446-6450

U. S. A. 81, 100-104

E:L. (1984) EMBO J. 3,333-337

21. Siebenlist, U., Hennighausen, L., Battey, J., and Leder, P. (1984) Cell 37, 381-391

22. Borgmeyer, U., Nowock, J., and Sippel, A. E. (1984) Nucleic Acids Res. 12, 4295-4311

23. Nowock, J., Borgmeyer, U., Puschel, A. W., Rupp, R. A. W., and Sippel, A. E. (1985) Nucleic Acids Res. 13, 2045-2061

24. Hennighausen, L., Siebenlist, U., Danner, D., Leder, P., Rawlins, D., Rosenfeld, P., and Kelly, T . J., Jr. (1985) Nature 314, 289- 292

25. Gronostajski, R. M., Adhya, S., Nagata, K., Guggenheimer, R. A,, and Hurwitz, J. (1985) Mol. Cell. Biol. 5, 964-971

26. Herrick, G. (1980) Nucleic Acids Res. 8, 3721-3728 27. Oren, M., Winocour, E., and Prives, C. (1980) Proc. Natl. Acad.

Sci. U. S. A. 77, 220-224 28. Maniatis, T., Fritsch, E. F., and Sambrook, J. (eds) (1982) Mo-

lecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

29. Alberts, B., and Herrick, G. (1971) Methods Enzymol. 21, 198- 217

30. Miura, K. (1967) Methods Enzymol. 12A, 543-555 31. Maxam, A. M., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U.

32. Bencini, D. A., O’Donovan, G. A,, and Wild, J. R. (1984) Bio-

33. Cleveland, D. W., Fischer, S. G., Kirschner, M. W., and Laemmli,

34. Liu, L. F., and Miller, K. G. (1981) Proc. Natl. Acad. Sci. U. S.

35. Martin, R. G., and Ames, B. N. (1961) J. Biol. Chem. 236, 1372-

36. Bradford, M. M. (1976) Anal. Eiochem. 72, 248-254 37. Laemmli, U. K. (1970) Nature 227, 680-685 38. Morrissey, J. H. (1981) Anal. Biochem. 117,307-310 39. Collins, J. (1981) Cold Spring Harbor Symp. Quant. Biol. 45,

40. Lilley, D. M. J. (1981) Nature 292, 380-382 41. Siegel, L. M., and Monty, K. J . (1966) Biochim. Biophys. Acta

42. Pabo, C., and Sauer, R. T. (1984) Annu. Reu. Biochem. 53, 293- 321

43. Flint, S. J., and Broker, T. R. (1981) in The Molecular Biology of Tumor Viruses (Tooze, J., ed) pp. 140-145, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

44. Fuller, R. S., Funnell, B. E., and Kornberg, A. (1984) Cell 38,

45. Roberts, J. D., and McMacken, R. (1983) Nucleic Acids Res. 11,

46. Bogenhagen, D. F. (1985) J. Biol. Chem. 260,6466-6471 47. Gidoni, D., Dynan, W. S., and Tjian, R. (1984) Nature 312,409-

413 48. Rijnders, A. W. M., van Bergen, B. G. M., van der Vliet, P. C.,

and Sussenbach, J. S. (1983) Nucleic Acids Res. 11,8777-8789 49. Pearson, G. D., and Wang, K. (1985) Nucleic AcidsRes. 13,5173-

5187 50. Leegwater, P. A. J., van Driel, W., and van der Vliet, P. C. (1985)

EMBO J. 4, 1515-1521 51. de Vries, E., van Driel, W., Tromp, M., van Boom, J., and van

der Vliet, P. C. (1985) Nucleic Acids Res. 13,4935-4952

S. A. 74, 560-564

Techniques 2, 4-5

U. K. (1977) J. Biol. Chem. 252, 1102-1106

A. 78,3487-3491

1379

409-416

112,346-362

889-900

7435-7452

purification of nuclear factor i by dna recognition site affinity

Documents