pitx2 artigo arritmia

PITX2 Insufficiency Leads to Atrial Electrical andStructural Remodeling Linked to Arrhythmogenesis

Ana Chinchilla, PhD; Houria Daimi, PhD; Estefana Lozano-Velasco, BS; Jorge N. Dominguez, PhD;Ricardo Caballero, PhD; Eva Delpon, PhD; Juan Tamargo, MD, PhD; Juan Cinca, MD, PhD;

Leif Hove-Madsen, PhD; Amelia E. Aranega, MD; Diego Franco, PhD

BackgroundPitx2 is a homeobox transcription factor that plays a pivotal role in early left/right determination duringembryonic development. Pitx2 loss-of-function mouse mutants display early embryonic lethality with severe cardiacmalformations, demonstrating the importance of Pitx2 during cardiogenesis. Recently, independent genome-wideassociation studies have provided new evidence for a putative role of PITX2 in the adult heart. These studies haveindependently reported several risk variants close to the PITX2 locus on chromosome 4q25 that are strongly associatedwith atrial fibrillation in humans.

Methods and ResultsWe show for the first time that PITX2C expression is significantly decreased in human patients withsustained atrial fibrillation, thus providing a molecular link between PITX2 loss of function and atrial fibrillation. Inaddition, morphological, molecular, and electrophysiological characterization of chamber-specific Pitx2 conditionalmouse mutants reveals that atrial but not ventricular chamber-specific deletion of Pitx2 results in differences in theaction potential amplitude and resting membrane potential in the adult heart as well as ECG characteristics ofatrioventricular block. Lack of Pitx2 in atrial myocardium impairs sodium channel and potassium channel expression,mediated in part by miRNA misexpression.

ConclusionsThis study thus identifies Pitx2 as an upstream transcriptional regulator of atrial electric function, theinsufficiency of which results in cellular and molecular changes leading to atrial electric and structural remodelinglinked to arrhythmogenesis. (Circ Cardiovasc Genet. 2011;4:269-279.)Key Words: Pitx2 arrhythmia atrial fibrillation gene regulation polymorphism transcription factors

Pitx2 is a homeobox transcription factor that plays apivotal role in early left/right determination during em-bryonic development, downstream of the nodal/lefty signal-ing pathway.1 The expression of Pitx2 is confined to the leftside of the embryo within the lateral plate mesoderm. Withfurther development, it continues to be mainly confined to theleft side in different organs, such as the stomach and theheart.2,3 Pitx2 loss-of-function mouse mutants displayed earlyembryonic lethality with severe cardiac malformations,47demonstrating the importance of Pitx2 during cardiogenesis.

Clinical Perspective on p 279Recent genome-wide association studies have suggested

new roles for Pitx2 in the adult heart.810 These authors haveindependently reported several risk variants on chromosome4q25 that are strongly associated with atrial fibrillation (AF)in distinct human populations. AF-associated risk variants areadjacent to PITX2, and although these studies810 do not

provide any experimental evidence that links regulation ofPITX2 expression/activity to the risk variants, it is plausiblethat modulation of the expression and/or activity of PITX2 inthe adult heart have the potential to play a role in AF.

In the present study, we have confirmed the high preva-lence of these genetic variants in a small cohort of AF patientsand furthermore we demonstrate for the first time thatPITX2C expression is significantly decreased in human pa-tients with sustained AF, thus providing a molecular linkbetween loss of function of PITX2 and AF. In addition, wereport herein morphological, molecular, and electrophysio-logical characterization of chamber-specific Pitx2 conditionalmouse mutants. Deletion of Pitx2 in the atrial chambersresults in viable offspring. Electrophysiological studies inPitx2 atrial chamberspecific adult hearts revealed differ-ences in the resting membrane potential, action potentialamplitude, and conductive disturbances as demonstrated byECG measurements. Furthermore, lack of Pitx2 in the adult

Received June 10, 2010; accepted April 7, 2011.From the Department of Experimental Biology, University of Jaen, Jaen, Spain (A.C., H.D., E.L.-V., J.N.D., A.E.A., D.F.); the Department of

Pharmacology, Complutense University of Madrid, Madrid, Spain (R.C., E.D., J.T.); the Cardiology Department, Hospital de Sant Pau, Institute ofBiomedical Research IBB, Autonomous University of Barcelona, Barcelona, Spain (J.C.); and the Cardiovascular Research Centre CSIC-ICCC, Hospitalde la Santa Creu i Sant Pau, Barcelona, Spain (L.H.-M.).

The online-only Data Supplement is available at http://circgenetics.ahajournals.org/cgi/content/full/CIRCGENETICS.110.958116/DC1.Correspondence to Diego Franco, PhD, Department of Experimental Biology, University of Jaen, 23071 Jaen, Spain. E-mail [email protected] 2011 American Heart Association, Inc.Circ Cardiovasc Genet is available at http://circgenetics.ahajournals.org DOI: 10.1161/CIRCGENETICS.110.958116

269 by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from

atria alters sodium and potassium channel expression, cor-roborating the electrophysiological findings. Thus, we pro-vide evidence that Pitx2 is an upstream transcriptional regu-lator of distinct signaling pathways that provide cellular,molecular, and electrophysiological substrates linked to atrialarrhythmogenesis.

MethodsHuman Tissue and DNA SamplesAtrial myocardial tissue samples were obtained from patients under-going cardiac surgery. The atrial samples were classified as patientswith (AF) and without (no AF) a recorded history of AF. Detailedinformation regarding tissue processing is provided in the online-only Data Supplement. The study conforms to the principles outlinedin the Declaration of Helsinki.

Genomic DNA samples from 47 patients diagnosed of having AFand 100 healthy donors with no cardiac structural and/or functionaldiseases were obtained from the Spanish National DNA Bank(BNADN, Salamanca). Polymerase chain reaction (PCR) amplifica-tion of both single nucleotide polymorphisms (SNPs) (rs2200733and rs13143308) was carried out using flanking oligonucleotides, asdetailed in online-only Data Supplement Table 1, followed by directsequencing. This study was approved by the Ethics Committees ofthe Spanish National DNA Bank (BNADN, Salamanca) and of theUniversity of Jaen, and the investigation conforms to the principlesoutlined in the Declaration of Helsinki.

Transgenic Mouse Lines, Breeding Strategy, andMouse GenotypingThe Pitx2floxed, NppaCre, and Mlc2vCre transgenic mouse lineshave been previously described.5,11,12 Generation of conditionalatrial (NppaCre) and ventricular (Mlc2vCre) mutant mice wasperformed by intercrossing hemizygous Cre deletor mice withhomozygous Pitx2floxed mice, which resulted in atrial-specific(NppaCrePitx2/) and ventricular (Mlc2vCrePitx2/) Pitx2mutant mice, respectively. DNA for PCR screening was extractedfrom adult ear and/or tail samples and from the yolk sac in embryos.Screening of Cre and Pitx2floxed alleles was routinely done usingused specific primers, as detailed in online-only Data SupplementTable 1. Further details are provided as in the online-only DataSupplement. This investigation conforms to the Guide for the Careand Use of Laboratory Animals published by the US NationalInstitutes of Health.

Quantitative Reverse TranscriptasePCR AnalysesTissue sample isolation and processing for RNA isolation wereperformed using standard procedures. Reverse transcriptase (RT)-PCR was performed in the Mx3005Tm QPCR System with anMxPro QPCR Software 3.00 (Stratagene) and SYBR Green detec-tion system. Detailed information regarding mRNA and microRNAquantitative (q)RT-PCR analyses are provided in the online-onlyData Supplement.

ECG Recordings andElectrophysiological MeasurementsMice were anesthetized with 2 mg/kg Ketamine (Parker-Davis)intraperitoneally. ECG recordings were registered and analyzedusing a digital acquisition and analysis system (Power Laboratory/4SP; www.adinstrument.com). Transmembrane action potentialswere recorded in isolated left and right atria of male control mice andatrial-specific Pitx2 conditional mice (n5 per group) and in thinpapillary muscles from male control mice and ventricular-specificPitx2 conditional mice (n5 per group) through glass microelec-trodes filled with 3 mol/L KCl (tip resistance, 8 to 15 mol/L) usingprocedures described previously.13,14 Further details are provided inthe online-only Data Supplement.

Cell Culture and Transfection AssaysHL-1 mouse immortalized atrial myocardial cells were used to assaymicroRNA-1 gain-of-function experiments as well as Pitx2c gain-and loss-of-function assays. Transfection experiments were per-formed using standard condition as detailed in the online-only DataSupplement.

Statistical AnalysesqRT-PCR data statistical analyses were performed using unpairedStudent t test. Probability values 0.05 were considered statisticallysignificant and are stated on each corresponding figure legend.Deviation from the Hardy-Weinberg equilibrium was tested byFisher exact test. General linear models were carried out for testingthe genotype dependence on the independent age and group vari-ables, as detailed in the online-only Data Supplement Methods.Allele frequencies were estimated from genotype frequencies bygene counting. Further detail information regarding the statisticalanalyses is provided in the online-only Data Supplement.

Resultsrs2200733 and rs13143308 Correlate With AFWe performed a direct resequencing approach to study thefrequency of 2 SNPs previously associated with AF8 in a smallcohort of Caucasian patients with AF. A total 47 patients (25men and 22 women) with paroxysmal or permanent AF wererecruited for the study (online-only Data Supplement Table 2).Thirty patients presented isolated AF; 17 patients were alsodiagnosed with cardiomyopathy and/or valvulopathy. Agesranged from 38 to 90 years (6811 years); 100 patients (44 menand 56 women) without any cardiac structural or electrophysi-ological diagnosis were recruited as the control population.Control ages ranged from 43 to 69 years (526 years) (online-only Data Supplement Table 3). rs2200733 (C/T or T/T) wasobserved in 20 of 47 (42%) AF patients and 22 of 100 (22%)control patients (odds ratio [OR], 2.607; 95% confidence inter-val [CI, 1.158 to 5.908; Fisher exact test; P0.01; Table 1).rs13143308 (T/T or T/G) was observed in 26 of 47 (55%) AFpatients and was present in 10 of 100 (10%) control patients(OR, 10.900; 95% CI, 4.325 to 29.594; Fisher exact test;P0.001; Table 1) (online-only Data Supplement Figure 1).Thus, the data demonstrate a highly significant prevalence ofrs2200733 (C/T or T/T) and rs13143308 (T/T or T/G) in patientswith AF compared with control subjects. No significant differ-ences were obtained related to age for rs2200733 (C/T or T/T) orfor rs13143308 (T/T or T/G), respectively, using general linearmodels. Furthermore, an increased frequency of rs2200733 (C/Cor C/T) but not of rs13143308 is obtained if patients aresubdivided into isolated AF (rs2200733, 16/30; 53%) and AFpatients with valvulopathy and/or cardiomyopathy (rs2200733,4/17; 23%), although none of them reached statistical significance.

PITX2c Expression Is Impaired in PatientsWith AFTo test if AF is linked to changes in the expression levels ofPITX2, we analyzed the expression levels of PITX2C, themajor PITX2 isoform expressed in the adult heart, in rightand left atrial appendage biopsies of human patients diag-nosed with AF compared with samples from patients withouta history of AF (no AF) (online-only Data Supplement Table4). Importantly, PITX2C expression, as revealed by qRT-PCR, is decreased in right atria of AF patients (n5) as

270 Circ Cardiovasc Genet June 2011

by guest on April 2, 2015http://circgenetics.ahajournals.org/Downloaded from

compared with control subjects (n5; Figure 1). Similarly,PITX2C expression is also decreased in left atria of AFpatients (n4) compared with control subjects (n4; Figure1) (online-only Data Supplement Table 5). Importantly,ENPEP, gene coding for glutamyl aminopeptidase A, whichis located in the vicinity of PITX2 in chromosome 4q25,display randomized expression levels in AF patients (online-only Data Supplement Figure 2). Thus, these data provide forthe first time evidence of an association between loss offunction of PITX2 and AF in human patients.

Atrial and Ventricular Chamber-Specific Pitx2Deletion Leads to Chamber-Specific DefectsTo obtain a suitable model of Pitx2 loss of function, we havegenerated conditional tissue-specific Pitx2 mutant mice byintercrossing a Pitx2 floxed mouse line5 with 2 distinct Credeletor mouse lines, which rendered atrial-specific (NppaCre)11and ventricular-specific (Mlc2vCre)12 Pitx2 mutant models,respectively. Deletion of Pitx2 within the atrial chambers usingNppaCre and deletion of Pitx2 in the ventricular chambers usingMlc2vCre resulted in viable chamber-specific homozygous

Pitx2-deleted mice. qRT-PCR analyses of Pitx2 expression inthe atrial chambers and the ventricular chambers revealed thatPitx2b and Pitx2c transcript levels were reduced approximately60% (online-only Data Supplement Figure 3), respectively,whereas Pitx2a expression was undetectable. Thus, these con-ditional Pitx2 mice represent Pitx2 loss-of-function deficiencymodels within the atrial and ventricular chambers. Within thepresent study, we have centered our attention on the atrial-specific Pitx2 mouse mutant.

Adult NppaCrePitx2/ mutant mice display moderateenlargement of the atrial chambers with myocardial wallthinning, whereas the ventricular chambers display an overtincrease in size and volume (Figure 2A through 2C), which isalso characterized by a mild increase in the interventricularseptum and left ventricular free wall thickness (Figure 2Dthrough 2G). Increased fibrous tissue deposition is detectablewithin the ventricular but not the atrial chambers (Figure 2Hthrough 2M), in line with procollagen qRT-PCR analyses(Figure 2N through 2O).

To investigate whether such morphological defects werepresent in atrial-specific Pitx2 conditional mouse mutants during

Table 1. SNP Genotypes in AF Patients

AF Type Sex

TotalIsolated With CM/VM Male Female

rs2200733

AF patients

C/C 14/30 (47%) 13/17 (76%) 17/25 (68%) 10/22 (45%) 27/47 (57%)

C/T 14/30 (47%) 3/17 (18%) 9/25 (36%) 8/22 (17%) 17/47 (36%)

T/T 2/30 (6%) 1/17 (6%) 1/25 (4%) 2/22 (9%) 3/47 (5%)

Control subjects

C/C NA NA 35/44 (79%) 43/56 (77%) 88/100 (88%)

C/T NA NA 9/44 (21%) 13/56 (33%) 22/100 (22%)

T/T NA NA 0/44 (0%) 0/56 (0%) 0/100 (0%)

rs13143308

AF patients

G/G 13/30 (42%) 8/17 (50%) 11/25 (44%) 10/22 (45%) 21/47 (45%)

G/T 13/30 (42%) 6/17 (37%) 10/25 (40%) 9/22 (41%) 19/47 (40%)

T/T 5/30 (16%) 2/17 (13%) 4/25 (16%) 3/22 (13%) 7/47 (15%)

Control subjects

G/G NA NA 42/44 (95%) 48/56 (86%) 90/100 (90%)

G/T NA NA 2/44 (5%) 8/56 (14%) 10/100 (10%)

T/T NA NA 0/44 (0%) 0/56 (0%) 0/100 (0%)

Isolated AF

Paroxysmal Permanent

rs2200733 AF patients C/T or T/T 16/27 (59%) 1/3 (33%)

rs13143308 AF patients G/T or T/T 17/27 (62%) 1/3 (33%)

Age

5170 y 7190 y

rs2200733 AF patients C/T or T/T 11/16 (68%) 5/11 (45%)

rs13143308 AF patients G/T or T/T 13/16 (81%) 4/11 (36%)

CM indicates cardiomyopathy and VM, valvulopathy.

Chinchilla et al Pitx2 Insufficiency Leads to Atrial Arrhythmogenesis 271


embryonic development, control (NppaCrePitx2flox/flox) andmutant (NppaCrePitx2/) mouse embryos were generated,collected at distinct developmental stages, and morphologi-cally analyzed. Lack of Pitx2 in the developing atrial myo-cardium partially impaired cardiac development because asubset (7/22; 30%) of E13.5 NppaCrePitx2/ mouseembryos displayed enlarged and thinner atrial chambers, asillustrated in Figure 3A through 3H), but no other morpho-genetic defects were observed. Atrial length but not widthwas significantly larger in NppaCrePitx2/ as comparedwith NppaCrePitx2flox/flox embryos at this stage, as reflectedin Figure 3I. Enlarged atrial chambers, in both the right andleft atria, become more patent at fetal (5/10 at E15.5; 50%and 12/15 at E17.5; 80%) stages and was characterized bya thinner myocardial wall as compared with wild-type age-matched control mice (Figure 3E through 3H). No ventriculardefects are observed in NppaCrePitx2/ embryos duringdevelopment and thus ventricular defects are likely to besecondary to atrial chamber dysfunction.

Because Pitx2 expression in the developing atria is con-fined to the left atrial chamber, we explored the expressionprofile of several cardiac markers in the left atrial appendagesof NppaCrePitx2/ mutant embryos as compared withage-matched control mice. In line with previous reports,15Bmp10 expression was highly upregulated in the left atrialchambers. In addition, a significant increase on Nkx2.5expression was observed. On the contrary, Gata6, Mef2c, andNppa transcript levels were downregulated, whereas islet-1and Gata4 displayed no significant differences (Figure 3J).

Atrial-Specific Pitx2-Deficient Mice DisplayElectrophysiological DefectsTo address potential electrophysiological changes in themutant mice, we analyzed the ECG recordings and actionpotentials of adult Pitx2 chamber-specific mutants. ECGrecordings were similar between nontransgenic control adultmice (data not shown), NppaCre (Figure 4A), andNppaCrePitx2flox/flox (Figure 4C) adult mice, displaying inall cases rhythmic ECG recordings. However, 40% (4/10) ofNppaCrePitx2/ mutants display impaired ECG record-ings characteristic of an atrioventricular (AV) node block(Figure 4B). In addition, p waves are missing in most (5/6;85%) of the remaining adult NppaCrePitx2/ mutantmice (Figure 4D). Morphological examination of the ventric-ular conduction system in NppaCrePitx2/ mutants dem-onstrates that the sinoatrial node (data not shown) and theventricular conduction system is properly organized (Figure4J through 4M), yet the AV node and bundle of His displayreduced fibrous tissue insulation (Figure 4J through 4K).

In addition, we studied the electrophysiological propertiesof dissected right and left atrial samples corresponding to theNppaCrePitx2 background (control and mutants) and leftventricular samples of control and conditional mutants cor-responding to the Mlc2vCrePitx2 background. The character-istics of action potentials were recorded on multicellularpreparations, and the results are summarized in Table 2. Leftatria from NppaCrePitx2-deficient mice displayed a signifi-cantly more depolarized resting membrane potential (RMP)(83.84.2 versus 87.02.7 mV) and a smaller actionpotential amplitude (109.80.6 versus 114.11.8 mV) thanthose from control littermate control mice (P0.05). Thedepolarization of the RMP would suggest that the absence ofPitx2 correlates with a decrease in the expression and/orfunction of the channels that generate the ionic currentsinvolved in the control of the resting membrane potential, forinstance, the inward rectifier current (IK1). Furthermore, thisdepolarization may inactivate the Na channels responsibleof the AP upstroke explaining the reduced action potentialamplitude observed in Pitx2-deficient mice. It is interesting tonote that the effects observed are chamber-specific becausesignificant differences were apparent only in the left atria.

Molecular Determinants of theElectrophysiological Measurements inAtrial-Specific Pitx2-Deficient Mouse MutantsTo further investigate the molecular substrates underlying thedecreased action potential amplitude and the depolarizedRMP in the left atria of NppaCrePitx2/ adult hearts, we

Figure 1. PITX2C qRT-PCR analysis in AF patients. A, PITX2Cexpression in right atrial biopsies from AF patients and no-AFpatients. In 4 of 5 comparisons (80%), PITX2C expression isdecreased approximately 80% to 90% in AF patients as com-pared with no-AF patients. B, PITX2C expression in left atrialbiopsies from AF patients and no-AF patients. In 3 of 4 (75%)comparisons, PITX2C expression is similarly decreased (approx-imately 80% to 90%) in AF patients as compared with no-AFpatients. C, GAPDH normalization against PPIA, which displayno differences between AF and no-AF patients in left atria (n4),serving as internal control. Similar results were obtained for rightatrial (n5) samples. *P0.05, **P0.01.



compared the expression of the major determinants of sodiumcurrent (INa) and the inward rectifier current (IK1) by qRT-PCR. As shown in Figure 4C and 4D, Scn5a and Scn1bexpression was severely impaired in the both left and rightatrial chambers, with milder or no changes in the ventricularchambers of NppaCrePitx2/ adult hearts. Similarly Kcnj2,

Kcnj12, and Kcnj4 expression was severely reduced in the leftatrial myocardium but not ventricular chambers (Figure 4Ethrough 4G). Consistent with these findings, Western blotanalysis showed that Kir2.1 (Kcnj2) and Nav1.5 (Scn5a)channel expression is decreased in the atrial chambers ofNppaCrePitx2/ mice (Figure 4L).

Figure 2. Morphological remodeling of adult atrial-specific Pitx2 conditional mutants. Whole-mount ventral views (A) and isolated leftatria (B and C) corresponding to adult NppaCrePitx2flox/flox (A and B) and NppaCrePitx2/ (A and C) hearts, respectively. Observethe increased heart size in NppaCrePitx2/ compared with control NppaCrePitx2flox/flox hearts. Left atria (la) size is significantlyenlarged in NppaCrePitx2/ (B) compared with control NppaCrePitx2flox/flox (C) hearts. Dashed lines in C represent the overlay ofthe left atria dimensions illustrated in B. Four-chambered views of adult NppaCrePitx2flox/flox (D) and NppaCrePitx2/ (E) hearts areshown. Note that atrial-specific Pitx2 mutants (E) display enlarged atrial and ventricular chambers and thickening of the interventricularseptum (IVS) (double arrows) compared with control (D) and right ventricular (rv) lumen is significantly dilated (asterisk, E). Transversalhistological sections of adult ventricular NppaCrePitx2floxed/floxed (F) and NppaCrePitx2/ (G) chambers illustrate a significant IVSthickness (double arrows). Red sirius staining of atrial (H through K) and ventricular (L and M) histological sections ofNppaCrePitx2flox/flox (H, J, and L) and NppaCrePitx2/ (I, K, and M) adult hearts demonstrate increased fibrosis in the ventricular(arrows, M) but not the atrial chambers in atrial-specific Pitx2 conditional mutants. qRT-PCR analyses of Col1a1 (K) and Col3a1 (L) expres-sion in NppaCrePitx2flox/flox (black bars) and NppaCrePitx2/ (white bars) adult hearts are shown. *P0.05, **P0.01.



Pitx2 Modulates miR-1 Expression, TherebyControlling IK1 but Not INa ComponentsTo further understand the regulatory role of Pitx2 on ionchannel expression, we tested whether lack of Pitx2 in theadult left atrial chambers impairs microRNA expression.miR-1 qRT-PCR analyses of adult NppaCrePitx2/ leftatrial myocardium demonstrate a significant increase ofmiR-1 expression (Figure 5A). Thus, these results support arole for Pitx2 in repressing miR-1 expression, which in turn,can regulate Kcnj2 expression.16 However, it is unknownwhether Scn5a and Scn1b can also be modulated by miR-1.

We therefore overexpressed miR-1 in HL-1 atrial cardiomyo-cytes, which resulted in decreased Gja1 and Kcnj2 transcriptslevels (Figure 5B), in line with previous reports,16 but did notmodify Scn5a and/or Scn1b expression (Figure 5B). Tofurther investigate if Pitx2 directly regulates miR-1 expres-sion and/or Scn5a expression, we transiently transfectedHL-1 atrial adult cardiomyocytes with Pitx2c. Overexpres-sion of Pitx2c resulted in decreased miR-1 and increasedScn5a and Scn1b expression (Figure 5C). Furthermore, Pitx2silencing decreased Scn5a and Scn1b expression in HL-1cells (Figure 5D).

Figure 3. Morphological remodeling ofembryonic atrial-specific Pitx2 condi-tional mutants. Transversal histologicalsections of E13.5 (A and B) and E17.5(C through H) embryonic hearts corre-sponding to NppaCrePitx2flox/flox (A, C,E, and G) and NppaCrePitx2/ (B, D,F, and H) embryos illustrate a significantatrial chamber enlargement (A throughD) and myocardial thinning (E throughH). F, Mean dorso-ventral length (doublearrows in A through D) of the right atrial(ra) and left atrial (la) appendages in mul-tiple E13.5 transversal sections demon-strate a statistically significant increasein length in atrial-specific Pitx2 condi-tional mutants (black bars) comparedwith control (white bars). F, Expressionlevels of Nkx2.5, Bmp10, Gata6, Mef2c,Nppa, Islet-1, and Gata4 in E17.5 leftatrial appendages corresponding toatrial-specific Pitx2 conditional mutants(white bars) compared with control(black bars). *P0.05, **P0.01,***P0.001.



Figure 4. Electrophysiological and molecular remodeling of adult atrial-specific Pitx2 conditional mutants. Shown are representativeECG recordings (A through D) of adult NppaCre (n5) (A), NppaCrePitx2flox/flox (n10) (C), and NppaCrePitx2/ (B and D) hearts,respectively. Observe that in control mice (NppaCre and NppaCrePitx2flox/flox), conserved R-R intervals are recording, and in allcases a p wave can be distinguished (arrows, A and C). In 40% (4/10) of the atrial-specific conditional mutant mice (NppaCrePitx2/), anAV block ECG pattern can be observed, as delineated by arrowheads in B and B, whereas in the remaining atrial-specific conditionalmutant (6/10), in all but one, a p wave (arrow) was frequently missing (asterisks), as illustrated in D and D, and irregular R-R intervalswere also recorded (D, double arrows). E through I correspond to qRT-PCR expression analyses of Scn5a (E), Scn1b (F), Kcnj2 (J),



DiscussionAF is the most common cause of arrhythmogenesis in thehuman population, yet, the genetic cause of AF remainselusive.1719 Point mutations in potassium or sodium channelgenes have been associated with familial AF but account foronly a small AF fraction.1923 Recent genome-wide associa-tion studies810 have reported several risk variants on chro-mosome 4q25, adjacent to PITX2 gene, which are associatedwith AF. Although these studies do not provide any experi-mental evidence that links regulation of PITX2 expression/activity to the risk variants, it has been suggested that PITX2might be the causative link. In the present study, we demon-strate that 2 SNPs, rs2200733 and rs13143308, are highlyprevalent in a cohort of Spanish patients with AF, supportingprevious findings from other populations. In addition,rs2200733 is more prevalent in patients with isolated AF ascompared with patients with AF and other cardiac structuraldefects, providing a potential role for SNP genotyping as astratification tool as recently suggested.24 The mechanisms bywhich these SNPs regulate PITX2 function, however, remainunknown.

At the transcriptional level, we demonstrate for the firsttime in this study that PITX2C is significantly decreased inhuman patients with sustained AF, thus providing a molecularlink between PITX2 loss of function and AF. We have alsogenerated chamber-specific conditional Pitx2 mouse mutants,which display a 60% reduction of Pitx2 expression in thechamber myocardium, thus providing an experimental modelof Pitx2 insufficiency. Such incomplete Pitx2 deletion mightbe attributed to incomplete and/or patchy Cre recombinationin the atrial chamber myocardium.11 Importantly, Cre recom-bination (NppaCre) is mainly restricted to the atrial append-age myocardium, with some weak and patchy expression inthe AV node (V. Christoffels, personal communication) butexcluding the sinoatrial and pulmonary veins myocardium.11Lack of Pitx2 expression in the atrial myocardium leads to aprogressive enlargement of the atrial chambers, which isconsistent with the increased proliferation rate in the leftcompared with the right atrium already observed from earlydevelopmental stages.25 Furthermore, Bmp10 is highly up-

regulated in the left atrial chambers,15 supporting a role ofPitx2 controlling atrial chamber dimensions, because overex-pression of Bmp10 plays a crucial role regulating physiolog-ical hypertrophy.26 Thus, these findings support the hypoth-esis that selective upregulation of Bmp10 in the atrialmyocardium, mediated by Pitx2, leads to increase cell pro-liferation and thus larger atrial chambers. Critically, atrialdilatation has been widely reported as a putative mechanismtriggering the onset and maintenance of arrhythmogenicprocesses, including AF, in the adult heart.27

At the functional level, atrial deletion of Pitx2 leads to ionchannel remodeling events, which have been previouslylinked to familiar cases of AF,21,28 supporting the notion thatPitx2 acts upstream of these AF-prone pathways. In context,Wang et al29 have recently reported that Pitx2 plays importantrole inhibiting sinoatrial pacemaker activity in the left atrium,thus providing susceptibility to atrial arrhythmias. Impor-tantly, our atrial-specific deletion of Pitx2 provides evidenceof ion channel remodeling within the atrial chamber myocar-dium independent of altering sinoatrial node function. Spe-cifically, we show that Pitx2 loss of function leads todownregulation of Scn5a and Scn1b. Genetic studies haverevealed that point mutations in SCN5A and SCN1B areassociated with familiar cases of AF,28 and Scn5a loss-of-function mouse mutants also display increased atrial suscep-tibility to atrial arrhythmogenesis.30 Surprisingly, lack ofPitx2 expression in atrial myocardium leads to downregula-tion Kcnj2, Kcnj4, and Kcnj14 expression, in contrast to theproarrhythmogenic pattern of expression observed in hu-mans,31 although loss of the resting membrane potential hasbeen also associated with atrial electric remodeling and AF.32

Atrial chamber-specific Pitx2 conditional mutants alsodisplay conductive disturbances, such as an AV block.Importantly, P-wave recording is frequently missing in theNppaCRe-Pitx2flox/flox (control) and NppaCrePitx2/atrial chamber-specific Pitx2 conditional mutants, demon-strating too an atrial chamber dysfunction. Curiously, themorphological characteristics and anatomic location of thesinoatrial node and the ventricular conduction system ofatrial-chamber specific conditional mutants is unaltered, yet

Figure 4 (Continued). Kcnj12 (H), and Kcnj4 (I) in right atrium (RA), left atrium (LA), and ventricular (V) chambers corresponding toatrial-specific adult Pitx2 conditional hearts (white bars) as compared with control mice (black bars). Histological sections of theAV conduction system of adult NppaCrePitx2flox/flox (J and L) and NppaCrePitx2/ (K and N) hearts are stained with picro-sirius (J and K) and Mallory trichrome (L and M). Western blot analyses (N) of Nav1.5 and Kir2.1 expression correspond to adultNppaCrePitx2flox/flox (wt) and NppaCrePitx2/ (Pitx2/) hearts. -Tubulin served as internal loading control. O, Semiquantitativeillustration of Nav1.5 protein expression normalized to -tubulin expression corresponding to control mice as compared with atrial-specific Pitx2 mutants. *P0.05, **P0.01.

Table 2. Electrophysiological Measurements in Atrial Chamber-Specific Pitx2 Insufficient Mice

Preparation Pitx2 Conditional RMP, mV APA, mV Vmax, V/s APD20, ms APD50, ms APD90, ms

Left atria (n5) NppaCrePitx2flox/flox 87.02.7 114.11.8 174.08.7 7.31.4 23.33.5 72.28.9

NppaCrePitx2/ 83.84.2* 109.80.6* 170.014.8 7.30.8 24.32.6 89.710.0

Right atria (n5) NppaCrePitx2flox/flox 86.42.9 111.71.1 160.08.6 6.81.0 25.62.7 93.07.5

NppaCrePitx2/ 85.41.7 111.52.0 164.013.4 9.12.2 31.75.6 102.38.8

Ventricular papillarymuscle (n5)

Mlc2vCrePitx2flox/flox 85.32.1 116.41.7 190.014.9 8.81.7 37.05.8 145.114.6

Mlc2vCrePitx2/ 86.23.0 114.02.5 186.08.7 14.62.5 40.23.8 124.87.8

APA indicates action potential amplitude; APD, action potential duration; and Vmax, maximum upstroke velocity.



there is reduced insulation of the AV node and bundle ofHis.33 Thus, it is plausible that such AV block might becaused by Pitx2 deficiency in the AVN (Cre recombination),leading to sodium channel impairment, which in turn canunderlie AV block, as previously proposed in mice andhumans.34 Importantly, AV block is an independent riskfactor for AF in humans,28,35 and the observation of AV blockin our mouse mutant model further implicates Pitx2 in thedevelopment of atrial proarrhythmogenic substrates.

Atrial dilation and ion channel remodeling are highlylinked events. However, it is unclear whether Pitx2 directlyregulates these ion channels or whether this might be caused

by remodeling due to atrial chamber dilation. Our resultsprovide for the first time evidence that lack of Pitx2 results inimpaired expression of sodium (INa) and potassium (IK1)channel expression in atrial but not the ventricular chambers,consistent with the altered electrophysiological propertiesrecorded in the left but not right adult Pitx2-deficient atrialmyocardium. Moreover, our Pitx2 gain- and loss-of-functionexperiments in vitro provide direct evidence that ion channelremodeling triggered by Pitx2 is independent of atrial cham-ber dilation. In addition, we demonstrate that Pitx2 can alsomodulate IK1 channel expression indirectly, through regula-tion of miR-1,36 whereas Scn5a regulation appears to be

Figure 5. Pitx2-mediated microRNA molecular pathway. A, qRT-PCR analyses of microRNA miR-1 expression in adultNppaCrePitx2flox/flox (control) and NppaCrePitx2/ (Pitx2/) hearts. Observe that miR-1 expression is increased approximately2-fold in atrial-specific mutant mice as compared with control mice. B, qRT-PCR analyses of Scn5a, Scn1b, Gja1, Kcnj2, Kcnj12, andKncj4 expression corresponds to miR-1 overexpression in HL-1 atrial cardiomyocytes. Overexpression of miR-1 leads to a significantdecrease in the expression of Gja1, Kcnj2, and Kcnj4, in line with previous reports,14 whereas Scn5a, Scn1b, and Kcnj12 display nosignificant differences. C, qRT-PCR analyses of Pitx2c, miR-1, Scn5a, and Scn1b expression in Pitx2c-transfected HL-1 atrial cardio-myocytes. Overexpression of Pitx2c leads to downregulation of miR-1 and enhanced expression of Scn5a and Scn1b. D, qRT-PCRanalyses of Pitx2b, Pitx2c, Scn5a, and Scn1b expression in Pitx2 siRNA-transfected HL-1 atrial cardiomyocytes. Silencing of Pitx2cleads to downregulation of Scn5a and Scn1b. *P0.05, **P0.01.



directly exerted by Pitx2. Thus, together these data supportthe notion that impaired Pitx2 expression leads to reduced ionchannel expression and function, thereby providing cellularand molecular substrates for the onset of arrhythmogenicevents. Unfortunately, the size limits of the murine heartmakes this model unsuitable to decipher if ion channelremodeling caused by impaired Pitx2 expression is sufficientto induce AF, and resolution of this issue will have to wait forthe generation of Pitx2 loss of function in larger animalmodels.

In conclusion, we provide the first direct evidence for arelationship between impaired Pitx2 function and distinct cellu-lar, molecular, and electrophysiological pathways (Figure 6) canprovide increased susceptibility to induce and/or promote atrialarrhythmogenesis, supporting the notion that Pitx2 acts hierar-chically upstream of these AF-prone pathways.

AcknowledgmentsWe thank Phil Gage (University of Michigan Medical School, AnnHarbor, MI), Vincent Christoffels (Heart Failure Research Center,Academic Medical Centre, Amsterdam, The Netherlands), and Ken-neth Chien (University of California, San Diego, CA) for reagents,Antonio Caruz and Francisco J. Esteban for expert counseling andsupport on statistical analyses of genotype data, and Robert Kelly forcritical reading of the manuscript. We also thank the SpanishNational Bank of DNA (BNADN, Salamanca) for their valuablesupply of AF and control DNA samples (grant AL-09-0026). Wethank the Department of Surgery, Hospital de Sant Pau, for providingtissue samples. Technical assistance of Berta Ballester and collabo-ration of the Cardiac Surgery Team at Hospital Sant Pau in providingand handling human atrial samples is greatly appreciated.

Sources of FundingThis work was partially supported by the VI European UnionIntegrated Project Heart Failure and Cardiac Repair, LSHM-CT-2005-018630 to Dr Franco; a grant from the Junta de AndalucaRegional Council to Dr Franco (CTS-1614); a grant from the Juntade Andaluca Regional Council to Dr Aranega (CTS-03878); andgrants from the Ministry of Science and Innovation of the SpanishGovernment to Dr Franco (MICINN BFU2009-11566) and to DrAranega (MICINN BFU-2008-01217). This work was partiallysupported by the Spanish national network REDINSCOR (RD006/0003/0000) on heart failure, coordinated by Dr Cinca, and transla-tional CNIC grant 2009/08 to Drs Franco, Caballero, and Hove-Madsen. This work was partially supported by grants from Ministryof Health and Consume (PI08/665 and HERACLES RD06/009network) of the Spanish Government to Dr Tamargo; a grant from

the Complutense University of Madrid to Dr Caballero; a transla-tional CNIC grant (CNIC-13) to Drs Tamargo and Caballero; and theMinistry of Science and Education (SAF2008-04903) to Dr Delpon.This work was partially supported by a grant from the University ofJaen (UJA2009/12/11) to Dr Dominguez.

DisclosuresNone.

References1. Burdine RD, Schier AF. Conserved and divergent mechanisms in

left-right axis formation. Genes Dev. 2000;14:763776.2. Schweickert A, Campione M, Steinbeisser H, Blum M. Pitx2 isoforms:

involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate left-rightasymmetry. Mech Dev. 2000;90:4151.

3. Campione M, Steinbeisser H, Schweickert A, Deissler K, van Bebber F,Lowe LA, Nowotschin S, Viebahn C, Haffter P, Kuehn MR, Blum M.The homeobox gene Pitx2: mediator of asymmetric left-right signaling invertebrate heart and gut looping. Development. 1999;126:12251234.

4. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-FukuiY, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S,Yokoyama M. Mouse Pitx2 deficiency leads to anomalies of the ventralbody wall, heart, extra- and periocular mesoderm and right pulmonaryisomerism. Development. 1999;126:57495758.

5. Gage PJ, Suh H, Camper SA. Dosage requirement of Pitx2 for devel-opment of multiple organs. Development. 1999;126:46434651.

6. Lu MF. Pressman C, Dyer R, Johnson RL, Martin JF. Function of Riegersyndrome gene in left-right asymmetry and craniofacial development.Nature. 1999;401:276278.

7. Lui C, Liu W, Lu MF, Brown NA, Martin JF. Regulation of left-rightasymmetry by thresholds of Pitx2c activity. Development. 2001;128:20392048.

8. Gudbjartsson DF, Arnar DO, Helgadottir A, Gretarsdottir S, Holm H,Sigurdsson A, Jonasdottir A, Baker A, Thorleifsson G, Kristjansson K,Palsson A, Blondal T, Sulem P, Backman VM, Hardarson GA, PalsdottirE, Helgason A, Sigurjonsdottir R, Sverrisson JT, Kostulas K, Ng MC,Baum L, So WY, Wong KS, Chan JC, Furie KL, Greenberg SM, Sale M,Kelly P, MacRae CA, Smith EE, Rosand J, Hillert J, Ma RC, EllinorPT, Thorgeirsson G, Gulcher JR, Kong A, Thorsteinsdottir U, StefanssonK. Variants conferring risk of atrial fibrillation on chromosome 4q25.Nature. 2007;448:353357.

9. Kaab S, Darbar D, van Noord C, Dupuis J, Pfeufer A, Newton-Cheh C,Schnabel R, Makino S, Sinner MF, Kannankeril PJ, Beckmann BM,Choudry S, Donahue BS, Heeringa J, Perz S, Lunetta KL, Larson MG,Levy D, MacRae CA, Ruskin JN, Wacker A, Schomig A, WichmannHE, Steinbeck G, Meitinger T, Uitterlinden AG, Witteman JC, RodenDM, Benjamin EJ, Ellinor PT. Large scale replication and meta-analysisof variants on chromosome 4q25 associated with atrial fibrillation. EurHeart J. 2009;30:813819.

10. Ellinor PT, Lunetta KL, Glazer NL, Pfeufer A, Alonso A, Chung MK,Sinner MF, de Bakker PI, Mueller M, Lubitz SA, Fox E, Darbar D, SmithNL, Smith JD, Schnabel RB, Soliman EZ, Rice KM, Van Wagoner DR,Beckmann BM, van Noord C, Wang K, Ehret GB, Rotter JI, Hazen SL,Steinbeck G, Smith AV, Launer LJ, Harris TB, Makino S, Nelis M, MilanDJ, Perz S, Esko T, Kottgen A, Moebus S, Newton-Cheh C, Li M,Mohlenkamp S, Wang TJ, Kao WH, Vasan RS, Nothen MM, MacRaeCA, Stricker BH, Hofman A, Uitterlinden AG, Levy D, Boerwinkle E,Metspalu A, Topol EJ, Chakravarti A, Gudnason V, Psaty BM, RodenDM, Meitinger T, Wichmann HE, Witteman JC, Barnard J, Arking DE,Benjamin EJ, Heckbert SR, Kaab S. Common variants in KCNN3 areassociated with lone atrial fibrillation. Nat Genet. 2010;42:240244.

11. de Lange FJ, Moorman AF, Christoffels VM. Atrial cardiomyocyte-specific expression of Cre recombinase driven by an Nppa gene fragment.Genesis. 2003;37:14.

12. Chen J, Kubalak SW, Chien KR. Ventricular muscle-restricted targetingof the RXRalpha gene reveals a non-cell-autonomous requirement incardiac chamber morphogenesis. Development. 1998;125:19431949.

13. Vaquero M, Caballero R, Gomez R, Nunez L, Tamargo J, Delpon E.Effects of atorvastatin and simvastatin on atrial plateau currents. J MolCell Cardiol. 2007;42:931945.

14. Barana A, Amoros I, Caballero R, Gomez R, Osuna L, Lillo MP,Blazquez C, Guzman M, Delpon E, Tamargo J. Endocannabinoids andcannabinoid analogues block cardiac hKv1.5 channels in a cannabinoidreceptor-independent manner. Cardiovasc Res. 2010;85:5667.

Figure 6. Pitx2-mediated signaling pathways in the developingand adult heart. Schematic representation of the Pitx2-mediatedsignaling pathways is revealed by the morphological, electro-physiological, and molecular analysis of atrial chamber-specificPitx2 conditional mutants.



15. Tessari A, Pietrobon M, Notte A, Cifelli G, Gage PJ, Schneider MD,Lembo G, Campione M. Myocardial Pitx2 differentially regulates the leftatrial identity and ventricular asymmetric remodeling programs. Circ Res.2008;102:813822.

16. Yang B, Lin H, Xiao J, Lu Y, Luo X, Li B, Zhang Y, Xu C, Bai Y, WangH, Chen G, Wang Z. The muscle-specific microRNA miR-1 regulatescardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. NatMed. 2007;13:486491.

17. Postma AV, Dekker LR, Soufan AT, Moorman AF. Developmental andgenetic aspects of atrial fibrillation. Trends Cardiovasc Med. 2009;19:123130.

18. Campuzano O, Brugada R. Genetics of familial atrial fibrillation.Europace. 2009;11:12671271.

19. Damani SB, Topol EJ. Molecular genetics of atrial fibrillation. GenomeMed. 2009;1:5456.

20. Chen YH, Xu SJ, Bendahhou S, Wang XL, Wang Y, Xu WY, Jin HW,Sun H, Su XY, Zhuang QN, Yang YQ, Li YB, Liu Y, Xu HJ, Li XF, MaN, Mou CP, Chen Z, Barhanin J, Huang W. KCNQ1 gain-of-functionmutation in familial atrial fibrillation. Science. 2003;299:251254.

21. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, Zhou Q, YangY, Liu Y, Liu B, Zhu Q, Zhou Y, Lin J, Liang B, Li L, Dong X, Pan Z,Wang R, Wan H, Qiu W, Xu W, Eurlings P, Barhanin J, Chen Y. AKir2.1 gain-of-function mutation underlies familial atrial fibrillation.Biochem Biophys Res Commun. 2005;332:10121019.

22. Olson TM, Alekseev AE, Liu XK, Park S, Zingman LV, BienengraeberM, Sattiraju S, Ballew JD, Jahangir A, Terzic A. Kv1.5 channelopathydue to KCNA5 loss-of-function mutation causes human atrial fibrillation.Hum Mol Genet. 2006;15:21852191.

23. Ellinor PT, Nam EG, Shea MA, Milan DJ, Ruskin JN, MacRae CA.Cardiac sodium channel mutation in atrial fibrillation. Heart Rhythm.2007;5:99105.

24. Husser D, Adams V, Piorkowski C, Hindricks G, Bollmann A. Chro-mosome 4q25 variants and atrial fibrillation recurrence after catheterablation. J Am Coll Cardiol. 2010;55:747753.

25. Lozano-Velasco E, Chinchilla A, Martnez-Fernandez S, Hernandez-Torres F, Navarro F, Lyons GE, Franco D, Aranega AE. Pitx2c modulatescardiac-specifictranscription factors networks in differentiating cardio-myocytes from murine embryonic stem cells. Cells Tissues Organs.March 9, 2011. [Epub ahead of print].

26. Chen H, Yong W, Ren S, Shen W, He Y, Cox KA, Zhu W, Li W,Soonpaa M, Payne RM, Franco D, Field LJ, Rosen V, Wang Y, Shou W.Overexpression of bone morphogenetic protein 10 in myocardiumdisrupts cardiac postnatal hypertrophic growth. J Biol Chem. 2006;281:2748127491.

27. Camm AJ, Luscher TM, Serruys PW. ESC Textbook of CardiovascularMedicine. 2nd edition. Oxford University Press, Oxford; 2009.

28. Tfelt-Hansen J, Winkel BG, Grunnet M, Jespersen T. Inherited cardiacdiseases caused by mutations in the Nav1.5 sodium channel. J CardiovascElectrophysiol. 2010;21:107115.

29. Wang J, Klysik E, Sood S, Johnson RL, Wehrens XHT, Martin JF. Pitx2prevents susceptibility to atrial arrhythmias by inhibiting left-sidedpacemaker specification. PNAS. 2010;107:97539758.

30. Dautova Y, Zhang Y, Sabir I, Grace AA, Huang CL. Atrial arrhythmo-genesis in wild-type and Scn5a/delta murine hearts modelling LQT3syndrome. Pflugers Arch. 2009;458:443457.

31. Kharche S, Garratt CJ, Boyett MR, Inada S, Holden AV, Hancox JC,Zhang H. Atrial proarrhythmia due to increased inward rectifier current(I(K1)) arising from KCNJ2 mutation-a simulation study. Prog BiophysMol Biol. 2008;98:186197.

32. Mary-Rabine L, Albert A, Pham TD, Hordof A, Fenoglio JJ Jr, Malm JR,Rosen MR. The relationship of human atrial cellular electrophysiology toclinical function and ultrastructure. Circ Res. 1983;52:188199.

33. Suarez-Penaranda JM, Munoz JL, Rodrguez-Calvo MS, Ortz-Rey JA,Concheiro L. The pathology of the heart conduction system in congenitalheart block. J Clin Forensic Med. 2006;13:341343.

34. Ge J, Sun A, Paajanen V, Wang S, Su C, Yang Z, Li Y, Wang S, Jia J,Wang K, Zou Y, Gao L, Wang K, Fan Z. Molecular and clinical char-acterization of a novel SCN5A mutation associated with atrioventricularblock and dilated cardiomyopathy. Circ Arrhythm Electrophysiol. 2008;1:8392.

35. Miura M, Yamagishi H, Morikawa Y, Matsuoka R. Congenital long QTsyndrome and 2:1 atrioventricular block with a mutation of the SCN5Agene. Pediatr Cardiol. 2003;24:7072.

36. Girmatsion Z, Biliczki P, Bonauer A, Wimmer-Greinecker G, Scherer M,Moritz A, Bukowska A, Goette A, Nattel S, Hohnloser SH, Ehrlich JR.Changes in microRNA-1 expression and IK1 up-regulation in humanatrial fibrillation. Heart Rhythm. 2009;6:18021809.

CLINICAL PERSPECTIVEAtrial fibrillation (AF) is the most frequent cardiac arrhythmia, leading to a high risk of mortality and morbidity. Thoughits prevalence is high, genetics of AF has remained rather elusive, with sporadic reports on point mutations in a wide varietyof ion channelencoding genes. Recently, genome-wide association studies have unraveled genetic variants (associatedwith AF risk) that are located close to the homeobox transcription factor PITX2 in a large proportion of AF patients. Inthe present investigation, we corroborated these findings in a small cohort of AF patients. We also provided evidence thatPITX2 is downregulated in AF patients and experimentally demonstrated that Pitx2 insufficiency results in cellular andmolecular changes leading to atrial electrical and cellular remodeling linked to atrial arrythmogenesis. Thus, these findingsprovide insights into signaling pathways that are implicated in the pathogenesis of AF.



SUPPLEMENTALMATERIAL

Supplementary Materials & Methods

Human tissue and DNA samples

Atrial myocardial tissue samples were obtained from patients

undergoing cardiac surgery. Specimens were obtained from the right

or left atria just prior to atrial cannulation for cardiopulmonary bypass.

After excision, samples were rapidly frozen in liquid nitrogen and

stored at -80C until analyzed. The atrial samples were classified as

patients with atrial fibrillation (AF) and without (No AF) a recorded

history of AF. Although the atrial tissue samples consisted of tissue

that would normally be discarded during surgery, permission to be

used in this study was obtained from each patient. The study was

approved by the Ethical Committee of the Hospital de la Santa Creu i

Sant Pau (Barcelona) and the investigation conforms with the

principles outlined in the Declaration of Helsinki.

Genomic DNA samples from 47 patients diagnosed of having atrial

fibrillation and 100 healthy donors with no cardiac structural and/or

functional diseases were obtained from the Spanish National DNA

Bank (BNADN, Salamanca). This study was approved by the Ethical

Committees of the Spanish National DNA Bank (BNADN, Salamanca)

and of the University of Jan and the investigation conforms with the

principles outlined in the Declaration of Helsinki.

Transgenic mouse lines and breeding strategy

The Pitx2floxed, NppaCre and Mlc2vCre transgenic mouse line have

been previously described (5, 11, 12). Generation of conditional atrial

(NppaCre) and ventricular (Mlc2vCre) mutant mice was performed by

intercrossing hemizygous Cre deletor mice with homozygous

Pitx2floxed mice. Double heterozygous were selected by PCR and

subsequently crossed with homozygous Pitx2floxed mice,

respectively, yielding to controls (Cre-) (i.e. Mlc2vCre-Pitx2flox/flox and

NppaCre-Pitx2flox/flox, respectively), heterozygous Cre+/floxed (i.e.

Mlc2vCre+Pitx2fl/- and NppaCre+Pitx2fl/-, respectively) and

homozygous Cre+/floxed (i.e. Mlc2vCre+Pitx2-/- and NppaCre+Pitx2-/-,

respectively). Since homozygous mice were viable to adulthood in

both conditional deletions, mice have been bred into a pure C57Bl/6J

genetic background, and offspring from mouse lines matting were

routinely screened for the presence of the Pitx2 floxed allele and the

Cre sequence as previously reported (15). This investigation conform

the Guide for the Care and Use of Laboratory Animals published by

the US National Institutes of Health.

Mouse genotyping

DNA for PCR screening was extracted from adult ear and/or tail

samples and from the yolk sac in embryos. Screening of Cre and

Pitx2 floxed alleles was routinely done using used specific primers as

detailed in Supplementary Table 1. Cycling conditions for Cre were as

follows; 5 min at 95C, 35 cycles of 30s at 95C, 30s at 60C and 90s

at 72C, and for Pitx2 as follows; 5 min at 95C. 40 cycles of 30s at

95C, 30s at 60C and 90s at 72C, followed by a final extension step

of 10 min at 72C, respectively. PCR products were separated in

standard agarose electrophoresis and classified according to the

expected band size.

Anatomical and histological analyses

Mice were sacrificed by cervical dislocation, after ECG recordings

(see below). Adult hearts were carefully dissected and briefly rinse in

Ringers solution and photographed. Samples processed for

histochemistry and immunohistochemistry were fixed overnight in

freshly made sterile 4% paraformaldehyde. Samples processed for

RNA isolation were immediately snap-frozen in liquid nitrogen and

stored at -80C until used. Staged wild-type control and chamber-

specific Pitx2 conditional embryos (E13.5, E15.5 and E17.5) were

carefully dissected from uterus of time-controlled pregnant females,

briefly rinse in sterile PBS and processed accordingly, Adult and

embryonic samples processed for histochemistry and

immunohistochemitry were dehydrated through graded ethanol steps

and embedded in paraplast. Sections were cut at 10 m and

processed for hematoxylin and eosin, Mallorys thrichrome and/or

picrosirius staining.

mRNA Isolation and Reverse Transcription

Embryonic hearts (E17.5) were dissected from pregnant tissue-

specific conditional mutants. Neonatal (3 weeks) and adult

Mlc2vCrePitx2 and Nppa-CrePitx2 conditional mutants were also

obtained. For NppaCrePitx2 (NppaCre-Pitx2flox/flox and NppaCre+Pitx2-

/-, respectively) mouse mutants we carefully separately dissected the

left atrial chambers, the right atrial chambers and the ventricular

chambers, and stored in liquid nitrogen. For MlcvCrePitx2 (Mlc2vCre-

Pitx2flox/flox and Mlc2vCre+Pitx2-/-, respectively), only the ventricular

chambers were dissected and stored in liquid nitrogen.

RNA extraction was performed using six E17.5 pooled left, right

atrial or ventricular samples of embryonic NppaCrePitx2 conditional

mutants, respectively, corresponding on each case to either control

(NppaCre-Pitx2flox/flox) or homozygous (NppaCrePitx2-/-) mutants. For

Mlc2vCrePitx2 three pooled ventricular myocardium samples of

Mlc2vCre+Pitx2-/- and their corresponding controls (Mlc2vCre-Pitx2 flox/flox) were used. RNA extraction of adult hearts was performed using

three pooled left atrial samples NppaCre Pitx2 conditional mutants

(NppaCre-Pitx2flox/flox and NppaCre+Pitx2-/-, respectively) and a single

ventricular myocardium sample of Mlc2vCrePitx2 conditional mutants

(Mlc2vCre-Pitx2flox/flox and Mlc2vCre+Pitx2-/-, respectively). Total RNA

was isolated using Trizol (Roche) according to manufactures

guidelines and DNase treated using RNase-Free DNase (Roche) for

1h at 30C. In all cases, at least three distinct pooled samples were

used to perform the corresponding qRT-PCR experiments.

First strand cDNA was synthesized at 50C for 1h using 1 g of

RNA, oligo-dT primers and Superscript III Reverse Transcriptase

(Invitrogen) according to manufactures guidelines Negative controls

to assess genomic contamination were performed for each sample,

without reverse transcriptase, which resulted in all cases in no

detectable amplification product.

qRT-PCR (mRNA)

RT-PCR was performed in Mx3005Tm QPCR System with a MxPro

QPCR Software 3.00 (Stratagene) and SYBR Green detection

system. Reactions were performed in 96-well plates with optical

sealing tape (Cultek) in 20 L total volume containing SYBR Green

Mix (Finnzymes) and the corresponding cDNA. Two internal controls,

mouse actin and GAPDH, were used in parallel for each run. Amplification conditions were as follows: denaturisation step of 95C

for 10 min, followed by 40 cycles of 95C for 30s, 60C for 30s, 72C

for 30s; with final elongation step of 72C for 10 min. All primers were

designed to span exon-exon boundaries using online Primer3

software Primer3input (primer3 www. cgi v 0.2) as provided in Table 1. No amplifications were observed in PCR control reactions containing only water as the template. Each PCR reaction was

performed at least three times to obtain representative averages. The

Livak method was used to analyze the relative quantification RT-PCR

data (37) and normalized in all cases taking as 100% the wild-type

(control) value, as previously described (38).

qRT-PCR (microRNA)

miR-1 microRNA qRT-PCR was performed using Exiqon LNA

microRNA qRT-PCR primers and detection kit according to

manufacturers guidelines. All reactions were always run in triplicates

using 5S as normalizing control, as recommended by the

manufacturer. SyBR Green was used as quantification system on a

Stratagene Q-Max 2005P qRT-PCR thermocycler. Relative

measurements were calculated as described by Livak & Schmittgen

(37) and control measurements were normalized to represent 100%,

as previously described (38).

Electrophysiological measurements

Transmembrane action potentials were recorded in isolated left and

right atria of male NppaCre-Pitx2flox/flox and NppaCre+Pitx2-/- mice

(n=5, per group), and in thin papillary muscles from male Mlcv2Cre-

Pitx2flox/flox and Mlc2vCre+Pitx2-/- mice through glass microelectrodes

filled with 3 M KCl (tip resistance, 8-15 M) using procedures described previously (13,14). Multicellular preparations were perfused

with a modified Tyrodes solution of the following composition: NaCl

125, KCl 5.4, CaCl2 1.8, MgCl2 1.05, NaHCO3 24, NaH2PO4 0.42 and

glucose 11. The solution was bubbled with 95% O2 and 5% CO2

(pH=7.4) and maintained at a temperature of 35C. The microelectrode was connected via Ag-AgCl wire to high-input

impedance, capacity-neutralizing amplifiers (model 701; WPI, New

Haven, CT, USA). Driving stimuli were rectangular pulses (1-2 ms in

duration) delivered from a multipurpose programmable stimulator (CS-

220; Cibertec SA, Madrid, Spain). Action potentials were stored in a

computer by use of Acknowledge software. The following parameters

of the transmembrane action potential were measured: resting

membrane potential (RMP), amplitude (APA) and action potential

duration (ADP) measured at the 20% (APD20), 50% (APD50), and 90%

(APD90) level of repolarization. The preparations were driven at 3 Hz

and a period of 1 h was allowed for equilibration, during which a

stable impalement was obtained.

ECG recordings

Mice were anesthetized with 2mg/Kg Ketamine (PARKE-DAVIS, S.L.)

intraperitoneally. Electrocardiogram (ECG) recordings were registered

and analyzed using a digital acquisition and analysis system (Power

Lab/4SP; www.adinstrument.com). Dual Bio Amplifier was connected

to the ECG Lead Switch Box to enable recording of standard lead

configurations. For routine screening, surface ECG (lead II) were

recorded from needle electrodes that were inserted subcutaneously in

the limbs and tape secured. The signal is acquired for about 10

minutes using Chart 4.2.3 software. When recordings were finished,

the limb electrodes are removed and mice were allowed to recover

and returned to their cage. The signal averaged ECG waveform and

the 1st derivate were analyzed using SAECG (signal-averaged

electrocardiogram) extension for Chart 4 software (AD Instruments).

Cell culture and microRNA-1 transfection assays

HL-1 mouse immortalized atrial myocardial (39) cells were used to

assay microRNA-1 gain-of-function experiments. HL-1 cells (6*105

cells per dish) were culture under appropriate cell culture condition

(39) and plated 30mm culture dishes. Pre-miR-1 were transfected

with lipofectamine 2000 (Invitrogen) into HL-1 cells at 5 mmol

according to manufacturers guidelines, respectively. Negative

controls included non transfected cells as well as FAM-labeled pre-

miR negative control transfected cells, which also allow evaluation of

the transfection efficiency. In all cases, transfection efficiencies were

greater than 50%, as revealed by observation of FAM-labeled pre-

miR transfection. After 4 hours transfection, HL-1 cells were culture in

appropriate cell culture media as reported by Claycomb et al. 1998.

Cells were collected 24h (pre-miR treatment) after transfection.

Negative control and transfected cells were collected and processed

for RNA isolation using Trizol-base standard protocols. RNA quality

and integrity was evaluated using a Nanodrop spectrophotometer and

cDNAs were retro-transcribed accordingly. qRT-PCR measurement of

several mRNA transcripts was evaluated as described above. Control

measurements levels were normalization represent 100%, as

previously described (38).

Cell culture, Pitx2c overexpression and siRNA transfection assays

HL-1 cells (6*105 cells per well) were transfected with CMV-Pitx2c

construct at two distinct plasmid concentrations (2 and 4 g/well) using lipofectamine 2000 (Invitrogen), according to manufacturers

guidelines. Cells were harvested for 48 hours and processed for RNA

isolation as previously described. Transfection efficiency was

evaluated by assessment of CMV-EGFP transfected cells, which

resulted in all cases in more that 60% transfected cells. In addition, in

all cases, Pitx2c quantitation was evaluated by qRT-PCR, which

resulted in 5 to 8-fold increase.

HL-1 cells (6*105 cells per well) were transfected with siRNA-Pitx2

(Sigma), at different concentrations, 25nM and 50nM, using the

Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) following

the suppliers protocol. 105 cells per well were seeded and transfected

in serum free conditions for 5 hr, after that cells were collected at 24h.

siRNA efficiency was measured as percentage of Pitx2 expression

levels as compared to non-transfected controls. In all cases, silencing

of Pitx2 was higher than 70-80%.

Immunofluorescence staining and confocal analysis

Embryonic hearts (E16.5) were extracted from chamber-specific

conditional and control pregnant females, respectively. Adult hearts

from chamber-specific Pitx2 conditional and controls were also

collected. For immunofluorescent experiments, embryos and isolated

adult hearts were fixed overnight in 4% paraformaldehyde in PBS,

dehydrated in increasing ethanol steps and embedded in paraplast.

Tissues samples were sectioned at 10 m and mounted in 3-

aminopropyl-triethoxy-silane (AAS) coated slides.

Tissue slides were deparaffinised at 65C during 30 min,

hydrated through decreasing graded ethanol steps, and briefly rinsed

in bidest water. Unspecific bindings were blocked for 30 min in

TBSA_BSAT (10 mM Tris, 0,9% NaCl, 2% bovine serum albumin,

0,1% Triton X-100, 0,02% sodium azide) at room temperature.

Subsequently tissue sections were incubated overnight with the

corresponding primary antibody (1:100) diluted in TBSA-BSAT. The

antibodies used were: rabbit anti desmin (D8281; Sigma), anti-hcn4

(APC-052, Alomone) and anti-Nav1.5 (ASC-005, Alomone). The

excess of primary antibody was removed by a brief rinse in TBSA-

BSAT. Thereafter, the sections were incubated in darkness with the

corresponding anti-rabbit Cy2-conjugated (Jackson Lab, USA) or anti-

mouse TRITC-conjugated (DAKO) secondary antibodies (1:100)

respectively, during 5 hours. Sections were washed in TBSA-BSAT,

rinsed in PBS and incubated in DRAQ-5TM (Red Fluorescent Cell-

Permeable DNA probe, from Biostatus Limited, UK) diluted (1:1000)

in PBS for 10 min. The excess of DRAQ-5TM was removed by a wash

in PBS, briefly rinsed in water, dehydrated and mounted in DPX. The

specificity of the primary antibody was assessed by lack of primary

antibody incubation which resulted in all cases in no detectable signal.

The samples were conserved in total darkness until analysed. Images

were obtained using a Leica Laser Scanning Confocal Microscope

and further edited using Adobe Photoshop software (version 7.0).

Western blotting

Adult hearts from either wild type (NppaCre-Pitx2flox/flox) or homozygous

(NppaCre+Pitx2-/-) mutants, were collected, processed accordingly and

stored in liquid nitrogen. Total protein extraction of was done using single

hearts. These samples were lysated in a small volume of 1 ml RIPA buffer

(50mM Tris pH 8,2, 1mM EDTA, 0,1% p/v Triton X-100, 1mM PMSF,

cocktail protease) using sonication. Protein quantitation was performed

using standard Commassie Protein Assay (Pierce). 10mg of total protein

was loaded in homogeneous 12,5% SDS-PAGE gels. Gels were blotted

onto nitrocellulose and probed against Kir2.1 (ab-80969-500, Abcam) or

Nav1.5 (ASC-005, Alomone) while -tubuline was used as internal loading control (T-5168, Sigma). Primary antibody incubation was performed at

1:200, 1:100 and 1:14000, respectively. Corresponding secondary anti-

rabbit or anti-mouse antibodies (1:10000 dilution) were used to reveal

Kir2.1, Nav1.5 and -tubuline, respectively. Signal detection was performed using ECL Plus (GE).

Statistical analyses

qRT-PCR data statistical analyses were performed using unpaired Student

t- test. p values

1; p-values were obtained directly using the hypergeometric distribution.

Allele frequencies were estimated from genotype frequencies by gene

counting. The study was analyzed as a case/ control study comparing the

allele frequency of both SNPs in the atrial fibrillation (47) and control (100)

groups. The odds ratio (OR) [95% CI] for both SNPs associated with

genotype was estimated from logistic regression analysis adjusted for AF

type (isolated vs associated) and atrial fibrillation/control. A p-value

A ENEP (right atrium)

200

250

* *

**100

150

200

**0

50

1 2 3 4 5 6 7 8 9 10 11 12NoAF AF NoAF AF NoAF AF NoAF AF NoAF AF NoAF AF

** **

B ENEP (left atrium)

200

250 ***

100

150

200 *

*

0

50

1 2 3 4 5 6 7 8 9 10 11 12NoAF AF NoAF AF NoAF AF NoAF AF NoAF AF NoAF AF

** ** ***

Chinchilla et al., Supplementary Figure 2

A rs2200733 (CT)

C/C C/T T/T

B rs13143308 (GT)

G/G G/T T/T


A BNppaCrePitx2 Mlc2vCrePitx2

A B

100

120

* *du

n

i

t

s

80

* **

r

m

a

l

i

z

e

d

40

60

n

o

20

01 2 3 4 5Pitx2b Pitx2c Pitx2b Pitx2c


Supplementary Table 1 Mouse qRT-PCR Oligonucleotide sequence Cre Forward ATCTTCCAGGCGCACCATTGCCCCTGT Cre Reverse TGACGGTGGGAGAATGTTAATCCATATTGG Pitx2 Forward TCGTGTCTTAAAAGGATGTGTTTCTTC Pitx2 Reverse TTCTGGAGGGTTTTCTTGTTCTAG Gapdh Forward TCCTGGTATGACAATGAATACGGC Gapdh Reverse TCTTGCTCAGTGTCCTTGCTGG Gusb Forward ACGCATCAGAAGCCGATTAT Gusb Reverse ACTCTCAGCGGTGACTGGTT Nkx2.5 Forward AGGTACCGCTGTTGCTTGAA Nkx2.5 Reverse CAAGTGCTCTCCTGCTTTCC Pitx2b Forward GATAACCGGGAATGGAGACC Pitx2b Reverse GTCTTTCTGGGGCAGAGTTG Pitx2c Forward GCCCACATCCTCATTCTTTC Pitx2c Reverse CCTCACCCTTCTGTCACCAT Nppa Forward TCT CAG AGG TGG GTT GAC CT Nppa Reverse CCT GTG TAC AGT GCG GTG TC Bmp10 Forward TCAAGACGCTGAACTTGTCG Bmp10 Reverse GTTCAGCCATGACGACCTCT Kcnj2 Forward GGTGTCAGCGCAAACAGTTGC Kcnj2 Reverse AGAGATGGATGCTTCCGAGA Kcnj12 Forward GACAGAAACAGCATCCACCA Kcnj12 Reverse GTGTATGCACCTTGCCATTG Kcnj4 Forward AGACCCTCCTCGGACCTTAC Kcnj4 Reverse AGACGTTACACTGGCCGTTC Gja1 Forward ACAGCGAAAGACTGTT Gja1 Reverse TTTGACTTCACCAAGG Scn1b Forward TGC TCA TTG TGG TGT TGA CC Scn1b Reverse CCT GGA CGC CTG TAC AGT TT Scn5a Forward GGA GTA CGC CGA CAA GAT GT Scn5a Reverse ATC TCG GCA AAG CCT AAG GT Mhl7 Forward TGCTTTATTCCCACCT Mhl7 Reverse AGTCCCAGGTAAGCTG Mef2c Forward GGGGTGAGTGCATAAGAGGAG Mef2c Reverse AGAAGAAACACGGGGACTATGGG Mlc2a Forward AAGCCATCCTGAGTGCCTTCCG Mlc2a Reverse GGTGTCAGCGCAAACAGTTGC Mlc2v Forward CCT CTC TGC TTG TGT GGT CA Mlc2v Reverse AAA GAG GCT CCA GGT CCA AT Col1a1 Forward CACCTGGTCCACAAGGTTTC Col1a1 Reverse ACCATCCAAACCACTGAAGC Col3a1 Forward AATGGCTCACACAAAG Col3a1 Reverse CACCTGAAGGCGTGTT

Gata4 Forward GCAGCAGCAGTGAAGAGATG Gata4 Reverse GCGATGTCTGAGTGACAGGA Gata6 Forward CTACACAAGCGACCACCTCA Gata6 Reverse CCAGAGCACACCAAGAATCC islet-1 Forward TCCCATCCCTAAGCAC islet-1 Reverse ACCAATTGTCCACCAT siRNA Pitx2 sense GUC CAU ACA AUC UCC GAU AdTdT siRNA Pitx2 antisense UAU CGG AGA UUG UAU GCA CdTdT Human SNP genotyping Oligonucleotide sequence rs2200733 Forward ACTAGCAAGCCCTCCAGGTT rs2200733 Reverse GCAAACCACTGCCCTAAGAG rs13143308 Forward TGGGGGATGGACCAGTATAA rs13143308 Reverse TTGCCAGAAGAGCTTCAGTATG Human qRT-PCR Oligonucleotide sequence PITX2A Forward GGCGTGTGTGCAATTAGAGA PITX2A Reverse GGTCCACACAGCGATTTCTT PITX2B Forward TCGAGTTCACGGACTCTCCT PITX2B Reverse GAGCTGCTGGCTGGTAAAGT PITX2C Forward CTTTCCGTCTCCGGACTTTT PITX2C Reverse CGCGACGCTCTACTAGTCCT GAPDH Forward AGCCACATCGCTCAGACAC GAPDH Reverse AACCATGTAGTTGAGGTCAATGAA PPIA Forward TCGAGTTGTCCACAGTCAGC PPIA Reverse TTCATCTGCACTGCCAAGAC ENEP Forward TTTCTCCTGCTCCAGCTTGT ENEP Reverse AGAAACCTTGGCCGAATTG

Supplementary Table 2 Sex Age Diabetes Systole

BP Dyastole

BP HTA FA type Isolated/CM rs2200733 rs13143308

1 Male 72 NO 100 65 NO Paroxysmal CM T/T G/G 2 Male 64 NO 160 100 NO Paroxysmal Isolated C/T T/G 3 Female 58 NO 146 80 YES Paroxysmal Isolated C/C T/T 4 Female 75 NO 128 78 NO Paroxysmal Isolated C/T T/G 5 Female 64 NO 147 74 YES Paroxysmal Isolated C/T T/G 6 Male 81 NO 128 95 YES Paroxysmal CM C/C T/G 7 Male 75 NO 155 65 YES Paroxysmal Isolated C/C T/T 8 Female 73 YES 162 95 YES Paroxysmal Isolated T/T G/G 9 Female 70 NO 90 58 YES Paroxysmal Isolated C/C G/T

10 Female 60 YES 160 88 YES Paroxysmal Isolated C/T G/T 11 Female 72 NO 130 80 YES Paroxysmal Isolated C/C G/G 12 Male 46 NO 138 96 NO Paroxysmal Isolated C/C G/G 13 Male 58 NO 130 84 NO Paroxysmal Isolated C/T G/T 14 Male 68 YES 135 66 YES Paroxysmal CM C/C G/G 15 Male 74 NO 129 80 YES Permanent Valvulopathy C/T G/T 16 Female 65 YES 110 77 NO Permanent Isolated C/C T/T 17 Male 73 NO 136 102 YES Permanent CM C/C G/T 18 Female 78 YES 125 72 YES Paroxysmal Isolated C/C G/G 19 Male 52 NO 132 75 YES Paroxysmal Isolated C/C G/T 20 Female 58 NO 123 80 NO Paroxysmal Isolated C/T G/G 21 Female 81 NO 144 93 YES Paroxysmal Isolated C/T G/T 22 Male 59 YES 131 79 YES Paroxysmal Isolated C/T G/T 23 Male 65 NO 130 80 NO Paroxysmal Isolated C/T G/T 24 Male 78 NO 134 74 YES Paroxysmal CM C/C G/G 25 Male 60 NO 98 62 NO Paroxysmal Isolated C/C G/G 26 Male 65 NO 152 89 YES Paroxysmal Isolated C/T G/T 27 Female 78 YES 167 97 YES Paroxysmal CM C/C G/G 28 Female 74 NO 140 70 YES Paroxysmal CM C/T G/T 29 Male 85 NO 131 79 NO Permanent CM C/C G/G 30 Male 77 NO 110 85 YES Permanent CM C/C G/G 31 Male 75 YES 127 68 YES Permanent Isolated C/T G/G 32 Male 57 NO 98 71 YES Paroxysmal CM C/C T/T 33 Male 76 NO 118 69 YES Permanent CM C/C G/G 34 Male 57 NO 136 81 YES Paroxysmal Isolated C/T T/T 35 Female 86 NO 181 86 YES Permanent CM C/C G/T 36 Female 59 YES 136 78 YES Paroxysmal Isolated C/T G/G 37 Female 86 NO 120 70 YES Paroxysmal Isolated C/C G/G 38 Female 77 NO 123 100 YES Paroxysmal CM C/C T/T 39 Male 38 NO 119 82 YES Paroxysmal Isolated C/C T/T 40 Female 90 NO 153 81 NO Paroxysmal Isolated T/T G/G 41 Male 63 NO 137 89 YES Paroxysmal Isolated C/T G/T 42 Male 43 NO 119 88 YES Paroxysmal Isolated C/C G/G 43 Female 83 YES 115 62 YES Permanent CM C/T G/G 44 Female 77 NO 118 97 NO Paroxysmal Isolated C/C G/T 45 Female 78 NO 147 86 YES Paroxysmal Isolated C/C G/G 46 Male 77 NO 116 61 NO Permanent CM C/C G/T 47 Male 81 NO 139 67 NO Permanent CM C/C G/G

Supplementary Table 3 Sex Age rs2200733 rs13143308 Sex Age rs2200733 rs13143308

1 Male 61 C/C G/G 61 Male 52 C/T G/G 2 Male 53 C/C G/G 62 Female 53 C/C G/G 3 Male 59 C/C G/G 63 Male 51 C/C G/G 4 Female 49 C/C G/T 64 Male 54 C/T G/G 5 Male 53 C/C G/G 65 Male 52 C/T G/G 6 Female 55 C/C G/G 66 Female 56 C/T G/G 7 Male 59 C/T G/G 67 Male 54 C/C G/G 8 Female 69 C/T G/T 68 Female 44 C/T G/G 9 Male 57 C/C G/T 69 Male 58 C/C G/G

10 Male 53 C/C G/G 70 Male 53 C/T G/G 11 Male 45 C/T G/T 71 Female 52 C/C G/G 12 Female 61 C/C G/T 72 Male 48 C/C G/G 13 Female 49 C/C G/T 73 Male 58 C/C G/G 14 Female 47 C/C G/T 74 Female 44 C/C G/G 15 Male 63 C/C G/T 75 Male 51 C/C G/G 16 Female 55 C/T G/T 76 Female 54 C/C G/G 17 Male 64 C/T G/G 77 Female 55 C/C G/G 18 Female 56 C/T G/G 78 Male 53 C/C G/G 19 Female 43 C/C G/G 79 Male 63 C/C G/G 20 Female 43 C/C G/G 80 Female 51 C/C G/G 21 Female 56 C/T G/T 81 Female 48 C/C G/G 22 Female 46 C/C G/G 82 Female 43 C/C G/G 23 Male 50 C/C G/G 83 Male 56 C/C G/G 24 Female 51 C/C G/G 84 Male 52 C/C G/G 25 Female 49 C/C G/G 85 Male 52 C/C G/G 26 Male 65 C/C G/G 86 Female 45 C/C G/G 27 Female 50 C/C G/G 87 Female 54 C/C G/G 28 Female 57 C/C G/G 88 Male 58 C/C G/G 29 Female 43 C/C G/G 89 Female 62 C/C G/G 30 Female 45 C/C G/G 90 Female 45 C/C G/G 31 Female 45 C/T G/G 91 Male 58 C/C G/G 32 Female 56 C/T G/G 92 Male 51 C/C G/G 33 Female 52 C/C G/G 93 Male 64 C/C G/G 34 Female 47 C/C G/G 94 Female 58 C/C G/G 35 Male 65 C/T G/G 95 Male 49 C/C G/G 36 Male 45 C/T G/G 96 Female 44 C/C G/G 37 Female 57 C/C G/G 97 Male 53 C/C G/G 38 Male 45 C/C G/G 98 Male 64 C/C G/G 39 Male 56 C/C G/G 99 Male 55 C/C G/G 40 Female 57 C/C G/G 100 Female 53 C/C G/G 41 Female 62 C/C G/G 42 Female 57 C/T G/G 43 Female 44 C/T G/G 44 Male 60 C/T G/G 45 Female 52 C/C G/G 46 Male 66 C/C G/G 47 Female 45 C/T G/G 48 Male 52 C/C G/G 49 Female 56 C/C G/G 50 Female 50 C/C G/G 51 Female 44 C/C G/G 52 Female 59 C/C G/G 53 Female 51 C/C G/G 54 Male 57 C/C G/G 55 Male 51 C/C G/G 56 Female 45 C/C G/G 57 Female 49 C/C G/G 58 Male 53 C/C G/G 59 Female 54 C/C G/G 60 Female 44 C/T G/G

Supplementary Table 4

Sex Age Diabetes Hypertension FA/ No AF Surgery Biopsies1 Male 51 NO YES sinus rythmn Valve replacement LA 2 Male 58 NO YES sinus rythmn Heart transplatation LA 3 Female 79 YES YES sinus rythmn Valve replacement LA 4 Female 78 NO NO sinus rythmn Valve replacement LA 5 Female 61 NO NO permanent AF Valve replacement LA 6 Male 75 NO YES permanent AF Valve replacement LA 7 Female 74 YES YES permanent AF Bypass LA 8 Male 75 YES NO permanent AF Valve replacement LA 9 Male 15 NO NO sinus rythmn Valve replacement RA

10 Male 67 NO NO sinus rythmn Valve replacement RA 11 Male 18 NO NO sinus rythmn Valve replacement RA 12 Male 54 NO NO sinus rythmn Valve replacement RA 13 Female 74 NO NO sinus rythmn Valve replacement RA 14 Female 67 NO YES permanent AF Valve replacement RA 15 Male 71 NO YES permanent AF Valve replacement RA 16 Male 58 YES NO paroxysmal AF Valve replacement RA 17 Female 58 NO NO permanent AF Valve replacement RA 18 Female 65 NO NO permanent AF Valve replacement RA

Supplementary Table 5

delta CT (PITX2C/PPIA) right atrium mean SD NoAF #1 RA 10,84 1,27 AF #1 RA 14,72 2,43 NoAF #2 RA 8,74 0,54 AF #2 RA 14,26 0,89 NoAF #3 RA 6,4 1,61 AF #3 RA 13,35 1,48 NoAF #4 RA 10,83 1,49 AF #4 RA 15,52 1,49 NoAF #5 RA 20,45 1,12 AF #45 RA 12,75 0,65 left atrium mean SD NoAF #1 LA 6,73 0,81 AF #1 LA 9,25 0,44 NoAF #2 LA 8,51 1,13 AF #2 LA 16,35 0,49 NoAF #3 LA 7,28 0,27 AF #3 LA 20,83 0,01 NoAF #4 LA 17,58 0,92 AF #4 LA 7,92 0,86

Supplementary Figure 1 Chromatograms of SNPs (rs2200733 and

rs13143308) sequencing.

Supplementary Figure 2 qRT-PCR analyses of ENPEP in right

(panel A) and left (panel B) atrial samples of NoAF and AF patients.

Observe that expression of ENPEP displays in approximately 50% of

cases a significant decrease of expression in AF patients as

compared to NoAF, whereas in the remaining 50% displays no

significant changes or increased expression in AF patients as

compared to AF. Thus, ENPEP expression in right and left atrial

samples seems to be independent of AF.

Supplementary Figure 3 qRT-PCR analyses of Pitx2b and Pitx2c

expression in atria (NppaCrePitx2) and ventricular (Mlc2vCrePitx2)

chamber-specific conditional Pitx2 mouse mutants corresponding to

E16.5 atrial and ventricular chambers, respectively. Relative

expression of Pitx2b and Pitx2c, in age-matched control negative

littermates (black bars), as compared to conditional mutants (white

bars). Control levels are normalized to 100%. Observe that Pitx2b and

Pitx2c are decreased between 60 to 80% in both atrial and ventricular

chamber-specific Pitx2 conditional mutants.

Supplementary Table 1. Oligonucleotide sequences used for qRT-

PCR expression analyses, SNPs (rs2200733 and rs13143308)

genotyping and Pitx2 siRNA silencing.

Supplementary Table 2. Clinical data and rs2200733 and

rs13143308 genotype corresponding to the AF cohort of patients

Supplementary Table 3. Clinical data and rs2200733 and

rs13143308 genotype corresponding to the control cohort of patients.

Supplementary Table 4. Clinical data corresponding to the AF and

No AF cohorts used for PITX qRT-PCR analyses in the atrial biopsies.

Supplementary Table 5. Mean values of the delta Ct value between

PITX2C levels and PPIA levels in NoAF and AF right and left atrial

qRT-PCR analyses. SD, standard deviation.

Diego FrancoCaballero, Eva Delpn, Juan Tamargo, Juan Cinca, Leif Hove-Madsen, Amelia E. Aranega and

Ana Chinchilla, Houria Daimi, Estefana Lozano-Velasco, Jorge N. Dominguez, RicardoArrhythmogenesis

Insufficiency Leads to Atrial Electrical and Structural Remodeling Linked toPITX2

Print ISSN: 1942-325X. Online ISSN: 1942-3268 Copyright 2011 American Heart Association, Inc. All rights reserved.

Dallas, TX 75231is published by the American Heart Association, 7272 Greenville Avenue,Circulation: Cardiovascular Genetics

doi: 10.1161/CIRCGENETICS.110.9581162011;4:269-279; originally published online April 21, 2011;Circ Cardiovasc Genet.

http://circgenetics.ahajournals.org/content/4/3/269World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circgenetics.ahajournals.org/content/suppl/2011/04/21/CIRCGENETICS.110.958116.DC1.htmlData Supplement (unedited) at:

http://circgenetics.ahajournals.org//subscriptions/is online at: Circulation: Cardiovascular Genetics Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer information about this process is available in therequested is located, click Request Permissions in the middle column of the Web page under Services. FurtherCenter, not the Editorial Office. Once the online version of the published article for which permission is being

can be obtained via RightsLink, a service of the Copyright ClearanceCirculation: Cardiovascular Geneticsin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


pitx2 artigo arritmia

Documents

expression of pitx2

importance of pitx2

pitx2 insufficiency

pitx2 locus

lack of pitx2

pitx2 loss of function

putative role of pitx2

atrial myocardium