phosphatidylcholine-speciﬁc phospholipase c and ... · phosphatidylcholine-speciﬁc...

INFECTION AND IMMUNITY, Nov. 2003, p. 6591–6606 Vol. 71, No. 110019-9567/03/$08.00�0 DOI: 10.1128/IAI.71.11.6591–6606.2003

Phosphatidylcholine-Specific Phospholipase C and SphingomyelinaseActivities in Bacteria of the Bacillus cereus Group

A. P. Pomerantsev, K. V. Kalnin,† M. Osorio,‡ and S. H. Leppla*National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892-4350

Received 10 April 2003/Returned for modification 13 June 2003/Accepted 10 August 2003

Bacillus anthracis is nonhemolytic, even though it is closely related to the highly hemolytic Bacillus cereus.Hemolysis by B. cereus results largely from the action of phosphatidylcholine-specific phospholipase C (PC-PLC) and sphingomyelinase (SPH), encoded by the plc and sph genes, respectively. In B. cereus, these genes areorganized in an operon regulated by the global regulator PlcR. B. anthracis contains a highly similar cereolysinoperon, but it is transcriptionally silent because the B. anthracis PlcR is truncated at the C terminus. Here wereport the cloning, expression, purification, and enzymatic characterization of PC-PLC and SPH from B. cereusand B. anthracis. We also investigated the effects of expressing PlcR on the expression of plc and sph. In B.cereus, PlcR was found to be a positive regulator of plc but a negative regulator of sph. Replacement of the B.cereus plcR gene by its truncated orthologue from B. anthracis eliminated the activities of both PC-PLC andSPH, whereas introduction into B. anthracis of the B. cereus plcR gene with its own promoter did not activatecereolysin expression. Hemolytic activity was detected in B. anthracis strains containing the B. cereus plcR geneon a multicopy plasmid under control of the strong B. anthracis protective antigen gene promoter or in a straincarrying a multicopy plasmid containing the entire B. cereus plc-sph operon. Slight hemolysis and PC-PLCactivation were found when PlcR-producing B. anthracis strains were grown under anaerobic-plus-CO2 orespecially under aerobic-plus-CO2 conditions. Unmodified parental B. anthracis strains did not demonstrateobvious hemolysis under the same conditions.

In the Bacillus genus, the Bacillus cereus group of spore-forming soil bacteria (Bacillus cereus, Bacillus thuringiensis, Ba-cillus anthracis, and Bacillus mycoides) is one of the most tax-onomically ambiguous groups. All four species have beenplaced in Bacillus subgroup 1 based on their large cell widthsand certain characteristics of their spores, which do not distendthe sporangium (30). DNA studies also grouped these Bacillusspecies because they all have AT-rich genomes. B. cereus andB. thuringiensis are highly polymorphic, whereas B. anthracis isviewed as monomorphic (14, 19). Phylogenetic analyses basedon sequence and enzyme electrophoresis data also revealedthat while B. cereus and B. thuringiensis are very similar, B.anthracis could be considered systematically rather distinct(40). In contrast to B. cereus and B. thuringiensis, B. anthracis ispenicillin sensitive, produces a polypeptide capsule, is nonhe-molytic, and does not produce phospholipase C. In addition, itproduces the lethal and edema toxins. However, analysis of theB. anthracis genome (with the TIGR database at http://www.ti-gr.org) reveals the presence of structural genes for penicillinresistance and hemolytic activities: two �-lactamase genes cor-responding to the type I and type II �-lactamases of B. cereusand orthologues of the B. cereus hemolytic genes producingphosphatidylcholine-specific phospholipase C (PC-PLC),phosphatidylinositol-specific phospholipase, sphingomyelinase(SPH), and cereolysin O (25; Y. Chen, J. Succi, and T. M.

Koehler, abstr. Proc. 4th Int.Workshop Anthrax, Annapolis,Md., 2001). All of these genes are silent in B. anthracis. Clon-ing of the type I �-lactamase gene into Escherichia coli andBacillus subtilis conferred penicillin resistance to both recipientbacteria (Chen et al., Proc. 4th Int. Workshop Anthrax). Thissuggested that some additional regulatory factor required for�-lactamase production in B. cereus is not present in B. anthra-cis.

An interesting observation has been the fact that the 16-bppalindrome known to be the target of the positive transcrip-tional regulator PlcR (1) is located upstream of every B. an-thracis hemolysis-related gene (25). PlcR, the pleiotropic reg-ulator of extracellular virulence factors, is active both in B.cereus and in B. thuringiensis. It activates transcription of atleast 15 genes encoding secreted proteins, including phospho-lipases, proteases, and two enterotoxin complexes (10). Ex-pression of the plcR gene is autoregulated and activated at theonset of the stationary phase. The putative PapR protein pro-duced from the short open reading frame (orf2) located down-stream of the plcR gene probably activates PlcR expression (1,22, 27, 39). Expression of PlcR at the onset of the stationaryphase is also dependent on the growth medium and is con-trolled by the transition state regulator Spo0A (23). Thus,hemolytic activity is greatly reduced in strains of B. cereus andB. thuringiensis with mutations in plcR (�plcR) (34). Recentevidence shows that an oligopeptide permease is also requiredfor expression of the plcR regulon (11). The plcR gene ispresent in, and probably restricted to, all members of the B.cereus group. However, while the B. cereus and B. thuringiensisPlcR proteins appear to be functionally equivalent, the B.anthracis PlcR protein is truncated and does not operate as atranscriptional activator (1). Expression of the B. thuringiensis

* Corresponding author. Mailing address: National Institute of Al-lergy and Infectious Diseases, National Institutes of Health, Bethesda,MD 20892-4350. Phone: (301) 594-2865. Fax: (301) 480-0326. E-mail:[email protected].

† Present address: Acambis, Cambridge, MA 02139.‡ Present address: Center for Biologics Research and Review, U.S.

Food and Drug Administration, Bethesda, MD 20892.

6591

on July 18, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

PlcR in B. anthracis organisms resulted in the transcriptionalactivation of genes that are only weakly expressed in the ab-sence of PlcR. The transcriptional activation was also evidentfrom increased enzyme activity, including that of PC-PLC (25).It has been reported recently (20) that B. anthracis hemolyticgenes, including plc and sph, are induced by strictly anaerobicconditions, suggesting that alternative regulatory mechanismscome into play under such conditions.

Here we compare the activities of the PC-PLC and SPHenzymes of B. anthracis and B. cereus and some aspects of theirregulation. For this purpose, the four structural genes werecloned and purified as His-tagged derivatives from an E. coliT7 expression system. We also investigated the kinetics of PlcRsynthesis in B. cereus strain 569 and in a PlcR-deficient deriv-ative. The latter was obtained through a single crossover be-tween the chromosomal plcR gene and a plasmid-borne geneencoding the truncated PlcR protein from B. anthracis. Con-sistent with previous observations, inactivation of PlcR greatlydecreased PC-PLC and SPH expression in B. cereus. The func-tional B. cereus plcR gene was introduced into B. anthracis bymeans of several different plasmids in which plcR was undercontrol of its own promoter or a strong, constitutive promoter.This technique allowed us to study the dynamics of recombi-nant PlcR synthesis in B. anthracis and its influence on PC-PLCand SPH activities. We also compared PC-PLC and hemolyticactivities of several B. anthracis and B. cereus strains grown onagar containing lecithin or sheep or human blood under aer-obic, aerobic-plus-CO2, and anaerobic-plus-CO2 conditions.

MATERIALS AND METHODS

Growth conditions. E. coli strains were grown in Luria-Bertani (LB) broth (35)and used as hosts for cloning and protein production. Media were supplementedwith 1 mM isopropyl-�-D-thiogalactopyranoside (IPTG; Sigma-Aldrich, St.Louis, Mo.) for induction of expression of T7-lac promoter plasmids. L agar wasused for the selection of transformants and for the estimation of the hemolyticproperties of isolated enzymes. B. anthracis and B. cereus strains were grown inbrain heart infusion (BHI) medium and in LB medium. Solid media were sup-plemented with 5% fresh sheep or human blood for determinations of hemolyticactivity or with 0.02% L-�-phosphatidylcholine (lecithin; Sigma-Aldrich) for de-terminations of PC-PLC activity. The following antibiotics were purchased fromSigma-Aldrich and added to media when appropriate to give the indicated finalconcentrations: ampicillin (100 �g/ml), erythromycin (5 �g/ml), kanamycin (10�g/ml), and tetracycline (5 �g/ml). SOC medium (Quality Biologicals, Inc.,Gaithersburg, Md.) was used to grow cells during transformation.

Anaerobic and/or CO2-enriched conditions were produced in a jar systemusing BBL GasPak Plus Anaerobic System Envelopes with palladium catalyst orBBL GasPak CO2 System Envelopes (Becton Dickinson Microbiology Systems,Sparks, Md.) These produce gaseous environments containing 4 to 10% CO2 andeither anaerobic or aerobic conditions. The GasPak dry methylene blue anaer-obic indicator was used to confirm establishment of an anaerobic environment.BHI agar supplemented with 5% sheep or human blood was used in theseexperiments for estimating hemolytic activity. Specific medium containing 37 g ofBHI medium, 0.01 g of resazurin (sodium salt; Sigma-Aldrich, St. Louis, Mo.) 50ml of egg yolk suspension (Sigma-Aldrich), and 14 g of agar per liter (7) was usedin these experiments for estimating PC-PLC activity. Suspensions of the B.anthracis Sterne, Sterne 34F2deltaT (SdT), and SdT2 strains and the B. cereus569 and 541 strains were prepared with an A600 close to 0.25, and 3 �l of eachsuspension was inoculated on plates which were then incubated at 37°C for 48 hunder aerobic or anaerobic (with or without CO2) conditions.

DNA isolation and manipulation. The preparation of plasmid DNA from E.coli, the transformation of E. coli, and recombinant DNA techniques werecarried out by standard procedures (35). E. coli XL2-Blue and SCS110 compe-tent cells were purchased from Stratagene, Inc., La Jolla, Calif. Recombinantplasmid construction was carried out in E. coli XL2-Blue.

Plasmid DNA from B. anthracis and B. cereus organisms was isolated accord-ing to the Plasmid Protocol: Purification of Plasmid DNA from Bacillus subtilis

(QIAGEN Inc., Valencia, Calif.). Chromosomal DNA from B. anthracis and B.cereus organisms was isolated with a Wizard Genomic Purification Kit (Promega,Madison, Wis.) in accordance with the protocol for isolation of genomic DNAfrom gram-positive bacteria (Promega). B. cereus cells were electroporated withplasmid DNA from E. coli as described elsewhere (13). B. anthracis cells wereelectroporated with unmethylated plasmid DNA isolated from E. coli SCS110.Electroporation-competent cells were prepared as previously described (28).Restriction enzymes, T4 ligase, Klenow fragment, and alkaline phosphatase werepurchased from MBI Fermentas (Vilnius, Lithuania) or New England Biolabs(Beverly, Mass.). Taq polymerase kits were purchased from TaKaRa Shuzo Co.,Ltd. (Otsu, Japan) or Invitrogen/Life Technologies (Rockville, Md.). The Gene-Ruler DNA Ladder Mix from MBI Fermentas was used for determination ofDNA fragment length. All constructs were verified by DNA sequencing.

Strain construction. Strains, plasmids, and their relevant characteristics arelisted in Table 1. Oligonucleotide primers are listed in Table 2. The B. cereus plcRmutant was constructed by replacement of the plcR coding sequence with the B.anthracis truncated plcR (�plcR) coding sequence by means of single-crossovertechnology (42). Briefly, the antisense B. anthracis �plcR flanked by two SmaIrestriction sites was cloned into the EcoRV site of vector pYJ335, which containsa hybrid xylose-tetracycline-controlled promoter (17). The resulting plasmidpYJ335-anti-plcR was electroporated into B. cereus cells with selection for eryth-romycin resistance. Transformants were selected at 37°C on BHI agar containingerythromycin and lecithin. Bacteria from the edges of the colonies were repeat-edly passed on new plates and screened for disappearance of the halo around thegrowing cells. Halo-negative colonies were analyzed by PCR to verify that single-crossover recombination events had occurred. Separately, clones containing theextrachromosomal plasmid pYJ335-anti-plcR were examined for the ability ofthe tetracycline-controlled antisense transcript to down regulate expression (17).For this purpose, B. cereus 569(pYJ335-anti-plcR) was grown with shaking inBHI medium and erythromycin at 37°C to an A600 of 0.2 to 0.3. Cultures weredivided, and different concentrations of tetracycline (0 to 1,000 ng/ml) wereadded. Each culture was plated after 3 h onto BHI agar plates containing lecithinor sheep blood, erythromycin, and corresponding concentrations of tetracycline.Colonies were examined for halos or zones of hemolysis.

Plasmid-free B. anthracis strain Ames 33 was selected as a spontaneous roughvariant of the pXO2-containing B. anthracis Ames 34 strain as described else-where (12). The strain was confirmed to be free of pXO2 by PCR.

DNA cloning and sequencing. The plc-sph regions from B. cereus and B.anthracis were obtained as 2.1-kb DNA fragments by PCR using primers A1 andA2 (Table 2). Similarly, the plcR-papR regions of both species were obtained as1.37-kb DNA fragments by PCR using primers P1 and P2. The fragments iso-lated from SeaKem agarose gels (Rockland, Maine) were cloned into the vectorpCR2.1-TOPO (Invitrogen, Carlsbad, Calif.) Nucleotide sequencing of thecloned fragments was performed by the dideoxy chain termination techniquewith a Taq dye primer cycle sequencing kit. M13 reverse and forward primerswere used initially; primers complementary to the determined sequences weresubsequently used.

The NCBI BLAST and FASTA programs (http://www.ncbi.nlm.nih.gov/) wereused for homology searches in the GenBank and Swiss-Prot databases. B. an-thracis genome nucleotide sequence data from the Institute for Genomic Re-search (http://www.tigr.org/) were used for comparison.

A DNA fragment encoding the entire plcR-papR region of B. cereus 569 wasPCR amplified with primers P3 and P4, cut with BamHI and PstI, and insertedinto the same sites of plasmid pUTE29, provided by Theresa Koehler (21). Thesame fragment was blunted with Klenow fragment and cloned into the EcoRVsite of vector pYJ335 (17). The resulting pUTE29-plcR-papR and pYJ335-plcR-papR plasmids were transformed into several B. anthracis strains (Table 1).

Plasmid pSJ115, a shuttle vector that expresses anthrax toxin lethal factor fromthe anthrax toxin protective antigen (PA) promoter (28), was used for construc-tion of plasmids pSW4 and pAE5. For this purpose, the NdeI site at position 212of plasmid pSJ115 was eliminated, and a PCR fragment was amplified fromplasmid pSJ115 with primers B1 and B2, restricted with BglII and BamHI, andinserted into the same sites of pSJ115. The resulting plasmid pSW4 contained theB. anthracis PA gene promoter (without the PA signal peptide gene sequence)immediately preceding the unique NdeI site. The unique BamHI and NdeI sitesof plasmid pSW4 allowed directional cloning of a PCR fragment containing theB. cereus plcR gene amplified with the primer R1-R2. The resulting plasmidpAE5 was introduced into several different B. anthracis strains (Table 1).

Expression and purification of His-tagged enzymes. For the expression ofmature forms of B. anthracis and B. cereus PC-PLC and SPH as their His6-taggedderivatives, DNA fragments containing added NdeI and XhoI sites were ampli-fied with primers AP1-AP2 (for both B. anthracis and B. cereus PC-PLC), AS1-AS2 (B. anthracis SPH), and CS1-AS2 (B. cereus SPH) by Platinum TaqDNA

6592 POMERANTSEV ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

TABLE 1. Plasmids and strains used in this study

Plasmid or strain Relevant characteristic(s)a Source orreference

PlasmidpCR 2.1-TOPO Cloning vector; Apr Kmr InvitrogenTOPO-antAB 2.1-kb PCR fragment (A1-A2 primers) containing plc and sph genes of B. anthracis

cloned into pCR2.1-TOPOThis work

TOPO-cerAB 2.1-kb PCR fragment (A1-A2 primers) containing plc and sph genes of B. cereuscloned into pCR2.1-TOPO

This work

TOPO-ant(plcR-papR) 1.37-kb PCR fragment (P1-P2 primers) containing �plcR and papR genes of B.anthracis cloned into pCR2.1-TOPO

This work

TOPO-cer(plcR-papR) 1.37-kb PCR fragment (P3-P4 primers) containing plcR and papR genes of B.cereus cloned into pCR2.1-TOPO

This work

pET-15b Expression vector for E. coli NovagenpET-15b-antA 740-bp PCR fragment (AP1-AP2 primers) encoding mature B. anthracis PC-PLC This workpET-15b-cerA 740-bp PCR fragment (AP1-AP2 primers) encoding mature form of B. cereus PC-

PLCThis work

pET-15b-antB 920-bp PCR fragment (AS1-AS2 primers) encoding mature form of B. anthracisSPH

This work

pET-15b-cerB 920-bp PCR fragment (CS1-AS2 primers) encoding mature form of B. cereus SPH This workpUTE29 Vector for gene replacement in B. anthracis; Apr in E. coli; Tcr in B. anthracis 21pUTE29-plcR-papR 1.38-kb BamHI-PstI B. cereus DNA fragment from TOPO-cer (plcR-papR) This workpSJ115 Encodes anthrax toxin lethal factor (lef) behind signal sequence of anthrax

protective antigen (pag), in shuttle plasmid; Apr in E. coli; Kmr in B. anthracis28

pSJ115a pSJ115 having NdeI site at bp 212 eliminated This workpSW4 pSJ115a with both lef gene and signal sequence of pag deleted This workpAE5 pSW4 containing 858-bp PCR fragment (R1-R2 primers) encoding B. cereus plcR

geneThis work

pAE5::IS10 pAE5 with IS10 inserted into plcR gene This workpOB12 pE194 vector containing plc-sph operon of B. cereus BKM-B164; Emr in B.

anthracis29

pYJ335 Vector expressing antisense from Tet-inducible promoter; Apr in E. coli; Emr in B.cereus

17

pYJ335-anti-plcR pYJ335 containing 691-bp PCR fragment (BAP1-BAP2) of B. anthracis �plcRcloned in antisense orientation

This work

pYJ335-plcR-papR pYJ335 containing 1.38-kb fragment of B. cereus DNA from pUTE29-plcR-papRcloned in sense orientation

This work

StrainB. anthracis

Ames 34 pXO1� pXO2� strain similar to �Ames-1 12Ames 33 pXO1� pXO2� Ames 34 derivative strain This workUM44-1C9 pXO1� pXO2� Plasmid-cured UM44-1 strain 2Sterne 34F2 pXO1� pXO2� 16Sterne 34F2 DeltaT (SdT) Sterne 34F2 cured of pXO1; therefore pXO1� pXO2� 16SdT1 SdT(pUTE29-plcR-papR); Tcr; does not produce intracellular PlcR, nonhemolytic

strainThis work

SdT2 SdT(pAE5); Kmr; produces intracellular PlcR; weakly hemolytic This workSdT3 SdT(pAE5::IS10); Kmr; does not produce intracellular PlcR; nonhemolytic This workSdT4 SdT electroporated with pOB12; Emr; hemolytic This work

B. cereus569 Wild strain; produces extracellular PC-PLC 32540 569 electroporated with plasmid pYJ335-anti-plcR; produces extracellular PC-PLC This work541 540 with integrated plasmid pYJ335-anti-plcR; �PlcR; does not produce

extracellular PC-PLCThis work

6A3 B. cereus Frankland and Frankland NRRL-569 BGSCb

6A5 B. cereus Frankland and Frankland ATCC 14579 BGSCB. thuringiensis

4A2 Wild-type isolate, serotype 1 BGSC4B1 Wild-type isolate, serotype 2 BGSC

E. coliXL2-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F� proAB lacIqZ�M15 Tn10

(Tcr) Amy Cmr]Stratagene

SCS110 rpsL (Smr) thr leu endA thi-l lacY galK galT ara tonA tsx dam dcm supE44D (lac-proAB) [F� traD36 proAB lacIqZDM15]

Stratagene

BL21 (DE3) E. coli B; F� ompT hsdS(rB� mB

�) dcm� Tetr gal (DE3) endA Hte Stratagene

a Apr, ampicillin resistant; Kmr, kanamycin resistant; Tcr, tetracycline resistant; Emr, erythromycin resistant; NRRL, Agricultural Research Service CultureCollection; ATTC, American Type Culture Collection.

b BGSC, Bacillus Genetic Stock Center.

VOL. 71, 2003 PHOSPHOLIPASE C AND SPHINGOMYELINASE IN B. CEREUS 6593


.org/D

ownloaded from

http://iai.asm.org/

Polymerase High Fidelity (Invitrogen/Life Technologies). The fragments wereisolated from agarose gels and inserted into the corresponding restriction sites ofvector pET-15b (Novagen, Madison, Wis.) The resulting plasmids (Table 1) wereintroduced into E. coli BL21(DE3). The proteins with His6 tags at the N terminiwere purified from 1 liter of IPTG-induced cultures grown in LB medium at37°C. Protein purification by elution with imidazole from nickel-nitrilotriaceticacid His-Bind resin was performed essentially as recommended by the manufac-turer (QIAGEN Inc.). Sodium dodecyl sulfate-polyacrylamide gel electrophore-sis (SDS-PAGE) was used to analyze the purity of the proteins.

PC-PLC and SPH enzymatic assays. Bacteria were grown in BHI broth at37°C. Aliquots of growing cultures were centrifuged for 15 min at 6,500 � g. Thesupernatants and cell pellets were frozen in dry ice. The proteins from selectedsupernatants were concentrated with Centriprep YM-10 units (Amicon, Inc.,Beverly, Mass.) and stored at �20°C until used. Concentrations of the proteinsin the samples were determined with BCA protein assay reagent (Pierce Bio-technology, Rockford, Ill.).

The activities of the PC-PLC and SPH enzymes of the samples were deter-mined with, respectively, the Amplex Red phosphatidylcholine-specific phospho-lipase C assay kit and the Amplex Red sphingomyelinase assay kit (MolecularProbes, Eugene, Oreg.). For measurement of PC-PLC, each reaction mixturecontained 200 �M Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), 1U of horseradish peroxidase/ml, 4 U of alkaline phosphatase/ml, 0.1 U of cholineoxidase/ml, 0.5 mM lecithin, and 20 to 100 mU of PC-PLC/ml in 50 mM Tris-HCl(pH 7.4)–140 mM NaCl–10 mM dimethylglutarate–2 mM CaCl2. (Enzyme unitsare defined by the kit manufacturer, and except for horseradish peroxidase, 1 Uof enzyme produces 1 �mol of product per min under optimal conditions.) Formeasurement of SPH, each reaction mixture contained 50 �M Amplex Red

reagent, 1 U of horseradish peroxidase/ml, 4 U of alkaline phosphatase/ml, 0.1 Uof choline oxidase/ml, 0.25 mM sphingomyelin, and 0.2 to 1.0 mU of SPH/ml in0.1 M Tris-HCl–10 mM MgCl2 (pH 7.4). Reaction mixtures were incubated inthe dark at 37°C for 30 to 60 min. Fluorescence was measured with a Wallac 1420VICTOR 96-well plate reader (Perkin Elmer, Boston, Mass.) with excitation at530 nm and emission at 590 nm. The activity of unknowns was compared to thatof the standard enzyme supplied with the kit to calculate milliunits per micro-gram of total protein.

PlcR antisera preparation. The multiple antigen peptides (MAPs) technique(4) was used for the production of antibodies to PlcR. Sequences of linearpeptides corresponding to the carboxyl and amino termini of PlcR and havingfavorable antigenic indices were selected with the JaMBW computer program(41) as LEKLGYDETESEEAY (C-PlcR) and EIYNKVWNELKKEEY (N-PlcR), respectively. The peptides were synthesized with their N termini attachedto a branched poly-L-lysine core sequence, with eight peptide chains incorpo-rated in each molecule. Synthesis was performed by the Center for BiologicsEvaluation and Research core facility, Food and Drug Administration, Bethesda,Md.

Rabbits were immunized with a total of 10 mg of each MAP, administered infour equal doses over a 75-day period, with a final bleeding at day 89 (performedby Covance Research Products Inc., Denver, Penn.). The antisera were tested byenzyme-linked immunosorbent assay (ELISA). Briefly, 96-well plates (Greiner,Monroe, N.C.) were coated overnight at 4°C with 100 �l of MAP at 10 �g/ml in10 mM potassium phosphate buffer, pH 9.0. All steps thereafter were performedwith 100 �l per well. After the samples were washed with buffer (0.1% gelatin in10 mM Tris-HCl [pH 8.0]–50 mM NaCl), serially diluted rabbit sera were addedand incubated overnight at 4°C. After repeated washings of the samples, goat

TABLE 2. Primers used in this study

Primer 5�–3� Sequencea (location) Relevant property Restrictionsites

A1 GTATTCATTCATTATATTCACTGTG (180 bp before plc start codon) Used to amplify plc and sph from 5�A2 CTACTTCATAGAAATAGTCGCCT (C-end of sph) Used to amplify plc and sph from 3�P1 GGATAAAAAAGACCGAGTGTAATG Used to amplify plcR and papR

from 5�P2 CGTTTGGAGGTTACTCCAC Used to amplify plcR and papR

from 3�P3 GCTAGGATCCGGGCAAAGAAGACCGAATGTA Used to amplify �plcR and papR

from 5�BamHI

P4 GGGCTGCAGGACGTTTGGATGTTACTCCAT Used to amplify �plcR and papRfrom 3�

PstI

AP1 GGGCATATGTCTGCTGAAGATAAACATAAA Used to amplify B. anthracis and B.cereus Pc-Plc genes (matureforms) from 5�

NdeI

AP2 GCTACTCGAGTTAACGATCTCCGTACGTATCAAA Used to amplify B. anthracis and B.cereus Pc-Plc genes (matureforms) from 3�

XhoI

AS1 GGGCATATGGCAGATACGTCTACAGATCAA Used to amplify B. anthracis Sphgene (mature form) from 5�

NdeI

AS2 GCTACTCGAGCTACTTCATAGAAATAGTCGCCT Used to amplify B. anthracis and B.cereus Sph genes (mature forms)from 3�

XhoI

CS1 GGGCATATGGCAGAAGCATCTACAAATCAA Used to amplify B. cereus Sph gene(mature form) from 5�

NdeI

B1 GCAATCAGATCTTCCTTCAGGT Used for pSW4 construction BglIIB2 GGGGGATCCCATATGCGTTCTCCTTTTTGTAT Used for pSW4 construction BamHI, NdeIR1 GATCCATATGCACGCAGAGAAATTAGGAAGTG Used to amplify B. cereus plcR gene

from 5�NdeI

R2 CCCGGGATCCTTATTTCTTCATTTTTTTCATAAA Used to amplify B. cereus plcR genefrom 3�

BamHI

BAP1 GGGGGGCCCGGGTATAGTGGGATGGTGAGTAAG Used to amplify B. anthracis �plcRfrom 5�

SmaI

BAP2 GGGGGGCCCGGGAATAGCTTTATTTGCATGACA Used to amplify B. anthracis �plcRfrom 3�

SmaI

ISp1 CTGATGAATCCCCTAATGAT Inner primer used to amplify IS105� region

ISp2 TTTTAGGTGACGGGTGGTGAC Inner primer used to amplify IS103� region

a Restriction enzyme recognition sites are underlined.



.org/D

ownloaded from

http://iai.asm.org/

anti-rabbit immunoglobulin G-horeseradish peroxidase (sc-2054; Santa CruzBiotechnology Inc., Santa Cruz, Calif.) was added at a final concentration of 0.2�g/ml. After incubation for 1.5 h at room temperature (20 to 25°C), plates werewashed thoroughly. Finally, the wells were incubated with 1 mg of ABTS sub-strate [2,2�-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid; Sigma-Aldrich] perml in 100 mM potassium phosphate (pH 5.0)–0.003% H2O2 and the absorbanceat 405 nm was measured.

Western immunoblotting of PlcR. The frozen bacterial cell pellets werethawed, suspended in ice-cold phosphate-buffered saline (PBS; 0.15 M NaCl–10mM sodium phosphate [pH 7.5]), added to prechilled FastPROTEIN BLUEtubes and homogenized with glass beads by using a FastPrep FP120 instrument(Qbiogene; BIO 101 Systems, Carlsbad, Calif.) at a speed of 6.0 for two 30-speriods. After homogenization, the tubes were centrifuged for 15 min at 20,000� g, and the supernatants were transferred to new tubes for protein determina-tion. Equal amounts of each sample (50 to 100 �g of protein) were separated onSDS-polyacrylamide (10 to 20%) gels (Novex precast gels; Invitrogen). TheMultiMark multicolored standard (Invitrogen) was used as a molecular weightmarker. The separated proteins were transferred to nitrocellulose membrane(PROTRAN B85; Schleicher & Schuell) in a Novex transfer unit (Invitrogen).PlcR was detected in most cases with a 1:3,000 dilution of rabbit serum 1451,directed to the C-terminal peptide LEKLGYDETESEEAY, because this serumwas more specific (see Fig. 5). The blot was developed with a 0.2-�g/ml concen-tration of horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G(sc-2054; Santa Cruz Biotechnology) and an enhanced chemiluminescence sub-strate (SuperSignal; Pierce Biotechnology).

Nucleotide sequence accession numbers. The nucleotide sequences compris-ing the B. cereus 569 genes were submitted to GenBank, with plc and sphsubmitted under accession number AY195600 and plcR and papR submittedunder accession number AY195601.

RESULTS

Nucleotide sequence comparisons of plc, sph, plcR, and papRgenes. We cloned and sequenced the plc and sph genes from B.anthracis strain UM44-1C9 and B. cereus 569 and comparedthese sequences with previously published sequences of B.anthracis and B. cereus. The plc-sph region sequence deter-mined for B. anthracis UM44-1C9 exactly matched that of theB. anthracis Ames strain, available from TIGR at http://www.tigr.org, and was nearly identical to that of B. anthracis strainA2012 (31) (GenBank accession number AAAC01000001).However, the B. anthracis plc and sph genes differ slightly fromthose of B. cereus, especially in the promoter regions (Fig. 1).The sequence of the putative 16-bp PlcR-binding site upstreamof the B. anthracis plc start codon contains T instead of G at thefourth position, and therefore it deviates from the perfectpalindrome (TATGnAnnnnTnCATA, where n is any of thefour nucleotides, A, G, C, or T) found in most B. cereus and B.thuringiensis plc genes (1). A possible PlcR-binding site wasfound just 5 bp upstream of the start codon of the B. anthracissph gene, overlapping the ribosome binding site. Although thissequence also differs from the canonical PlcR binding sitesequence (G instead of A at the sixth position), the samesequence is found in the sph genes of B. cereus strain SE-1 (18)and strain BKM-B164 (8). A very similar 19-bp TATGTTATGTACCTCCATA sequence was found at the same distance (5bp) upstream of the sph start codons of B. cereus strains 569,GP-4 (9), and IAM 1208 (45). However, in all these B. cereusstrains, this sequence is located on the cDNA strand.

The B. anthracis plc gene �35 and �10 promoter elements(TAGAAA and TATTCT, respectively) were found to be iden-tical to those of all reported B. cereus plc genes. The B. an-thracis sph gene �35 and �10 promoter sequences (TTAAAAand TAGAGT, respectively) were identical to the correspond-ing sequences of sph genes from B. cereus SE-1 (18) and BKM-

B164 (8). However, the B. anthracis �35 sequence differedfrom the TTGAAA sequence reported for B. cereus 569, B.cereus IAM 1208 (45), and B. cereus GP-4 (9).

The PC-PLC and SPH proteins of B. anthracis are predictedto be very similar in sequence and structure to those of B.cereus. The genes encode signal peptides (24 amino acids [aa]for PC-PLC and 27 aa for SPH) and a 14-aa propeptide forPC-PLC. A conserved ribosome binding site, GGAGG, is lo-cated upstream of the initiation codons for PC-PLC (ATG)and SPH (GTG). The primary structure of the mature B.anthracis PC-PLC protein (245 aa) is almost identical to thestructures of the proteins of B. cereus SE-1 (18) and B. cereusBKM-B164 (8), differing by only two substitutions: H156Y andD174E. On the other hand, the B. cereus 569 mature PC-PLCprotein also differed from that of B. cereus GP-4 (9) by twosubstitutions, T29K and D244N. The mature B. anthracis SPHprotein (306 aa) differs from the B. cereus SE-1 (18) and B.cereus BKM-B164 (8) proteins by six substitutions. The SPHprotein of B. cereus 569 differs from that of B. cereus GP-4 (9)by only 5 aa. The SPH proteins of B. cereus 569 and B. cereusGP-4 have more than 30 aa differences from the very similarSPH proteins of B. anthracis and B. cereus strains SE-1, BKM-B164, and IAM 1208. In particular, the NIRIMITLIIIQ se-quence at the C-terminal end (from position 277 to 299) of theSPH protein is specific for only the B. cereus 569 and GP-4strains.

The nucleotide sequences of the plcR and papR genes fromB. anthracis UM44-1C9 and B. cereus 569 were aligned withpublished sequences of these genes from B. thuringiensis 407(22), B. cereus ATCC 14579 (27), B. anthracis 9131 (1), and B.anthracis Ames (TIGR database). No differences were foundamong the nucleotide sequences of this region in the B. an-thracis Ames, 9131, and UM44-1C9 strains. The PlcR operonstructures of B. cereus 569, B. cereus 14579, and B. thuringiensis407 are the same, consisting of the two genes, plcR andpapR, which encode polypeptides of 285 aa (complete PlcRof B. cereus) or 212 aa (truncated PlcR of B. anthracis) and48 aa (PapR), respectively. Both the plcR and papR genescontain perfect 16-bp PlcR palindromes upstream of theATG initiation codons. The amino acid sequences of thevarious PlcR and PapR polypeptides are rather varied. Forexample, in B. cereus 569, 16 unusual amino acids werefound for PlcR and 5 were found for PapR compared to theother Bacillus strains discussed here. Interestingly, theunique C-terminal KFMKKMKK sequence of B. cereus 569PlcR contains two MKK repeats, and this tripeptide se-quence is also at the N terminus of PapR.

B. anthracis and B. cereus PC-PLC and SPH enzymes havesimilar activities. The enzymes expressed in E. coli were pu-rified as His6-tagged proteins and analyzed by SDS-PAGE.The electrophoretic mobilities of the purified proteins corre-sponded well to the calculated molecular mass values of 28kDa for PC-PLC and 34 kDa for SPH (Fig. 2A). The catalyticactivity of the enzymes was largely as expected, with both SPHproteins having sphingomyelinase activity (Fig. 2B) and bothPC-PLC enzymes hydrolyzing phosphatidylcholine (Fig. 2C).There were no significant differences between the enzymesfrom B. anthracis and B. cereus. However, it was notable thatthe SPH enzymes were also able to cleave phosphatidylcholine(Fig. 2C). The recombinant enzymes exhibited hemolytic prop-



.org/D

ownloaded from

http://iai.asm.org/

FIG. 1. Sequence alignment of the promoter regions for plc and sph genes of B. anthracis strain UM44-1C9 (B.a.) and B. cereus (B.c.) strainsSE-1, BKM-B164, GP-4, and 569. Putative PlcR binding sites are located upstream of A �35 and �10 sequences for the plc gene and downstreamof the sph A �35 and �10 sequences. Consensus sequences of regulatory elements are indicated in bold type under the corresponding alignedsequences. Gray areas indicate nucleotide sequence differences.

6596


.org/D

ownloaded from

http://iai.asm.org/

erties like those of the extracellular enzymes from B. cereus (3).Thus, sheep erythrocytes were lysed by SPH but not by PC-PLC (Fig. 2D). Combining the enzymes did not appreciablyenhance lysis over that caused by SPH alone.

Role of PlcR in control of PC-PLC activity. To analyze therole of PlcR in controlling the expression of PC-PLC, we con-structed a vector expressing tetracycline-inducible antisense toplcR (Fig. 3A). Introduction of this plasmid, pYJ335-anti-plcR,into B. cereus 569 and induction on agar plates containingtetracycline, lecithin, and erythromycin gave colonies of theresulting B. cereus strain 540 that had normal halos due toPC-PLC hydrolysis of lecithin. Thus, the antisense appearedunable to effectively repress PlcR action. Plasmid pYJ335-anti-plcR could be recovered from this Ermr, PC-PLC-positive bac-terium, demonstrating that it was extrachromosomal (Fig. 3B,panel 2).

However, repeated passages of B. cereus strain 540 on BHIagar with lecithin and erythromycin allowed selection of avariant strain, B. cereus 541, containing a single crossover eventthat introduced the plasmid into the chromosome (Fig. 3A).Four passages on BHI agar, with samples taken each time fromthe edge of the growing area, were needed to obtain this halo-and plasmid-negative B. cereus 541 clone (Fig. 3C). This strainalso grew faster on solid medium than either of the parentalstrains, 569 and 540. PCR analysis of DNA from this cloneconfirmed introduction of plasmid pYJ335-anti-plcR into theplcR gene (Fig. 3B). Introduction of plasmid pUTE29-plcR-papR (described in the next section) into B. cereus 541 restoredthe hemolytic properties of B. cereus (data not shown). Thesedata confirm that PlcR is required to activate PC-PLC expres-sion in B. cereus.

Presence of B. cereus plcR-papR operon in B. anthracis is notsufficient to induce PC-PLC activity. To test the hypothesisthat lack of hemolysis by B. anthracis is due to the C-terminaltruncation of the PlcR protein, we sought to complement thisdefect. Plasmid pYJ335 was used again but this time to expressthe B. cereus plcR-papR operon as an inducible sense tran-script. Plasmid pYJ335-plcR-papR was introduced into B. an-thracis Ames 33 and SdT with erythromycin selection. Theresulting transformants were grown and passed repeatedly onplates containing sheep blood or lecithin and erythromycin andin the presence and absence of tetracycline. The presence oftetracycline did not cause the colonies to produce amounts ofPC-PCL and SPH that were sufficient to generate hemolyticzones or halos. Even after four passages, colonies with hemo-lytic zones or halos did not appear.

The fragment containing the complete B. cereus plcR operonwas also inserted into plasmid pUTE29, which has been usedpreviously in B. anthracis (21, 33). The resulting pUTE29-plcR-papR plasmid was electroporated into B. anthracis strains SdTand UM44-1C9. Transformants were selected on tetracycline-containing medium supplemented with sheep blood or lecithin.The plasmid was reisolated from the B. anthracis transfor-mants, and the restriction digest patterns of the isolated plas-mid were compared with those of the plasmid used for theelectroporation. No differences were found in the patterns orin the nucleotide sequences of the fragment containing theplcR and papR genes. However, even in this case, colonies withhemolytic zones or halos did not appear (Fig. 3C). The resultswith the pYJ335 and PUTE29 constructs suggest that regu-lated artificial promoters and the B. cereus endogenous pro-moters do not produce sufficient amounts of the PlcR andPapR proteins or that other regulatory factors are needed forPlcR transcriptional activation in B. anthracis.

FIG. 2. Molecular and functional properties of recombinant B. an-thracis and B. cereus PC-PLC and SPH. (A) SDS-PAGE of the proteinspurified from E. coli, stained with Coomassie blue R-250. Mr, molec-ular mass marker. (B and C) SPH and PC-PLC activities of the fourrecombinant phospholipases. The order of the samples is the same asin panel A. (D) Ability of PC-PLC, SPH, and a 1:1 mixture of theseproteins to lyse sheep red blood cells. Each well was filled with 20 �lof a 0.5-mg/ml solution of enzyme. Wells with both phospholipaseswere filled with 20 �l of each enzyme.



.org/D

ownloaded from

http://iai.asm.org/

FIG. 3. Inactivation of B. cereus 569 plcR gene. (A) Scheme of plasmid pYJ335-anti-plcR integration into plcR gene of B. cereus 569chromosome. The truncated antisense-oriented B. anthracis plcR gene (�plcR) was recombined with the B. cereus 569 chromosomal plcR gene sothat the only intact plcR, at the right end, lacks a promoter. PCR primers used in analysis include P1 and P2 (external primers matchingchromosomal DNA), M13f and M13r (internal primers that match only the pYJ335-antisense plasmid), and BAP1 and BAP2 (primers that belongto chromosomal and plasmid DNAs). (B) DNA analysis of recombinant strains. Panel 1, PCR fragments from the left end of the inserted plasmid;panel 2, plasmid content of B. cereus 569 derivatives having integrated (B. cereus 541) and extrachromosomal (B. cereus 540) pYJ335-anti-plcRplasmids. The arrow (panel 2) indicates a band of plasmid pYJ335-anti-plcR. Other bands are endogenous B. cereus 569 plasmids. Panel 3, PCRfragments from the right end of the inserted plasmid. Mr, molecular mass marker. (C) Hemolysis of B. cereus 541 is weaker than that of B. cereus569 (panel I). B. cereus 541 does not hydrolyze lecithin (panel II).

6598


.org/D

ownloaded from

http://iai.asm.org/

Expression of PlcR from a strong promoter in B. anthracisinduces weak hemolysis of sheep blood. As an alternative wayto complement the defective plcR gene in B. anthracis, weconstructed plasmid pAE5 (Fig. 4) containing B. cereus plcRunder control of the B. anthracis PA gene promoter (withoutthe PA signal sequence). This plasmid was transformed into B.anthracis SdT, and following plating on BHI plates containingkanamycin and sheep blood, only four slightly hemolytic colo-nies (designated SdT2) were found among hundreds of non-hemolytic transformants (designated SdT1). The same isolateswere not hemolytic when plated on LB agar containing sheepblood. Restriction analysis showed that plasmids isolated fromthe hemolytic SdT2 colonies were identical to the originalpAE5. However, plasmids isolated from the nonhemolyticSdT1 colonies demonstrated insertion of additional DNAwithin the plcR gene. Determination of the nucleotide se-quence of the inserted DNA showed that it belonged to the 3�terminal IS10 element of Tn10 (5). Repeated transformationsof B. anthracis by the two plasmids showed that the efficiencyof transformation by pAE5 was much lower than that of plas-mid pAE5::IS10 carrying the inactivated plcR gene. PCR anal-ysis of E. coli XL2-Blue and SCS110 chromosomal DNAs andof chromosomal DNAs from the B. anthracis Ames 33, UM44-1C9, and SdT strains demonstrated that only E. coli XL2-Bluechromosomal DNA contains an IS10 element. (Primers ISp1and ISp2 were used for PCR detection of IS10 DNA.) Thisresult clearly indicated that strong expression of an active PlcRis toxic to B. anthracis. Consistent with this interpretation, wenoted that the hemolytic activity of two of the four B. anthracishemolytic clones containing plasmid pAE5 disappeared duringrepeated passages on BHI agar containing sheep blood andantibiotic, whereas the other two appeared stable.

Characterization of rabbit polyclonal antisera to PlcR. Toallow detection and quantitation of PlcR expression, we pre-

pared antisera by immunization with synthetic peptides match-ing N- and C-terminal regions of the protein. The N-terminalsequence selected is present in both B. anthracis and B. cereusPlcR proteins, whereas the C-terminal sequence would recog-nize the B. cereus protein but not the truncated B. anthracisprotein (Fig. 5A). An ELISA showed that the resulting serareact strongly to the corresponding peptides (A405, 2 at a1:3,000 dilution) (Fig. 5B) and do not interact with the heter-ologous antigen (A405, �0.2 at a 1:3,000 dilution). Both anti-sera reacted with a band of the size expected for B. cereus PlcR(34 kDa) in extracts from B. anthracis SdT2 (SdT with pAE5).The C-PlcR antisera reacted only with this band, whereas theN-PlcR antiserum also reacted with additional proteins ofhigher molecular weight from both SdT2 and SdT (Fig. 5C).Neither antibody detected a band corresponding to �PlcR ofB. anthracis (calculated molecular mass of 25.4 kDa), suggest-ing that the truncated B. anthracis PlcR polypeptide either isnot expressed or is unstable. The demonstrated specificity ofthe C-PlcR antiserum for the B. cereus plcR gene allowed itsuse in the characterization of PlcR expression presented be-low.

PlcR expression in B. cereus 569 at onset of stationary phasecorrelates with induction of PC-PLC activity and repression ofSPH activity. Growth curves demonstrated that B. cereus 569grew in BHI broth without a lag phase whereas B. cereus 541(PlcR negative) experienced a short lag (Fig. 6A, left panel).This lag was small but was observed in repeated experimentsand is consistent with the report that a B. cereus ATCC 14579�plcR strain grew more slowly than its wild-type parent (10).Western blotting showed that the PlcR protein appeared in B.cereus 569 grown in BHI medium only after 6 to 7 h, reachinga maximum at 9 h (Fig. 6B, left panel), a time that probablycorresponds to the onset of the stationary phase (23). Similarly,PC-PLC activity reached a maximum at 7 to 8 h (Fig. 6C, leftpanel). Interestingly, PC-PLC activity increased gradually inthe period from 3 to 7 h, in contrast to the sharp increasedescribed for plcA transcriptional activation in B. thuringiensis(22). On the other hand, SPH activity increased at the begin-ning of the exponential phase of growth (Fig. 6D, left panel).This activity decreased later and disappeared completely by 9 hwhen the stationary phase was reached. B. cereus strain 541, inwhich plcR was disrupted, showed no production of PlcR pro-tein by Western blot analysis (data not shown) and no induc-tion of PC-PLC or SPH activity (Fig. 6C and D, left panels).

PlcR expression in B. anthracis causes only weak expressionof PC-PLC and SPH. The growth rates of the parental B.anthracis SdT and of the weakly hemolytic pAE5 transformant,SdT2, were indistinguishable (Fig. 6A, right panel). Bothstrains grew with a lag phase of about 2 h. Expression of thefull size B. cereus PlcR protein from the PA promoter ofplasmid pAE5 in B. anthracis SdT2 took place from the begin-ning of the exponential phase of growth in BHI medium (Fig.6B, right panel). The production of the protein in B. anthracisSdT2 was more extensive than that in B. cereus 569 and incomparison almost independent of time. On the other hand,although the activities of the PlcR-regulated enzymes PC-PLCand SPH in SdT2 increased with time, the peak activity levels(Fig. 6C and D, right panels) never reached values equal tothose of B. cereus 569. These data indicate that the molecularmechanisms of PlcR action are different for these two bacteria.

FIG. 4. Genetic and restriction map of plasmid pAE5. The plcRgene of B. cereus 569 is under control of the B. anthracis protectiveantigen gene promoter. The signal peptide of the protective antigengene was eliminated in order to retain PlcR inside the cell. The loca-tion of the inserted IS10 found in pAE5::IS10 is indicated by the arrow.H-T-H, helix-turn-helix motif of PlcR.



.org/D

ownloaded from

http://iai.asm.org/

The parental B. anthracis SdT strain produced no PlcR protein(data not shown), and the PC-PLC or SPH activities werenegligible (Fig. 6C and D, right panels).

Growth of B. anthracis producing PlcR under aerobic-plus-CO2 or under anaerobic-plus-CO2 conditions slightly inducesboth its PC-PLC and hemolytic activities. Recent studies em-ploying reverse transcription-PCR reported that B. anthracisSterne 34F2 hemolysin-related genes including plc and sphwere induced under strictly anaerobic conditions (20). We ex-amined whether the same was true for B. anthracis SdT2 andincluded experiments in which plates were grown in aerobicand CO2-enriched environments. The parental B. anthracisSterne and SdT strains and B. cereus strains 569 and 541 wereused for comparison. Under aerobic conditions (Fig. 7, Aero-bic), only B. cereus strain 569 demonstrated high PC-PLC andhemolytic activities for both sheep and human blood. B. an-thracis SdT2 and B. cereus 541 slightly lysed sheep blood but

did not hydrolyze lecithin or lyse human blood. The remainingB. anthracis strains were inactive even for sheep blood (Fig. 7,Aerobic). Growth in an aerobic-plus-CO2 environment ap-peared to increase PC-PLC and hemolytic activities in B. an-thracis SdT2, and some activity was seen in B. cereus 541. Theother strains did not demonstrate PC-PLC activity in the aer-obic-plus-CO2 atmosphere. Under anaerobic-plus-CO2 condi-tions, we found that B. cereus strain 569 retained PC-PLC andhemolytic activities, although the levels of both activities wereless than those under aerobic-plus-CO2 conditions. However,comparisons are difficult because all strains grew less vigor-ously in the anaerobic atmosphere, as Klichko et al. (20) alsoobserved. Very low PC-PLC and hemolytic activities werefound for the PlcR-producing SdT2 strain, and no activitieswere found for the other B. anthracis strains. B. cereus 541induced some hemolytic activity for sheep blood (Fig. 7, An-aerobic � CO2). We repeated all the assays shown in Fig. 7

FIG. 5. PlcR antiserum characterization. (A) B. cereus 569 PlcR amino acid sequence. The N-PlcR peptide immunogen corresponds to aa 93to 107, and the C-PlcR peptide corresponds to aa 246 to 260. The vertical arrow indicates the site at which the B. anthracis PlcR protein istruncated. (B) ELISA reactivity of N-PlcR and C-PlcR antiserum at 1:3,000 dilutions on plates coated with either the N-PlcR peptide (left graph)or the C-PlcR peptide (right graph). (C) Western blot of whole-cell proteins from B. anthracis SdT (lane 1) and B. anthracis SdT2 (lane 2).Membranes were treated with N-PlcR antiserum (serum 1447) or C-PlcR antiserum (serum 1451) at a 1:2,000 dilution. Mr, position of externalmolecular mass marker.



.org/D

ownloaded from

http://iai.asm.org/

with separate plates for every strain and growth condition andobtained equivalent results.

Extracellular factors increase PlcR activation in B. anthra-cis. Studies of B. thuringiensis and B. cereus showed that pep-tides derived from PapR promote gene activation by PlcR (39).We examined whether the same was true of B. anthracis bytesting whether extracellular materials from several B. cereusand B. thuringiensis strains could activate the PC-PLC activityof B. anthracis SdT2. Growing B. cereus 6A5 and B. thuringien-sis 4A2 (serotype 1) and B. thuringiensis 4B1 (serotype 2) nextto SdT2 did confer on it the ability to hydrolyze lecithin (Fig.8). Presumably, B. cereus strain 6A5 and B. thuringiensis strainsof serotype 1 and 2 produce extracellular peptides derivedfrom PapR that can be processed to pentapeptides having a

Leu in the N terminus, whereas other strains have a Met or Valin this position and therefore yield inactive peptides (39).However, in our experiments, B. cereus strain 6A3 also acti-vated the PC-PLC activity of B. anthracis SdT2, even though itspentapeptide has a Met in the N terminus (Fig. 8).

Expression of hemolytic enzymes by B. anthracis containingplc and sph on a multicopy plasmid. In previous work, it wasshown that introduction of the multicopy plasmid pOB12 car-rying B. cereus plc and sph genes into B. anthracis led to pro-duction of PC-PLC and SPH (29). It is now recognized that B.anthracis �PlcR is not active (1), and our experiments con-firmed that B. anthracis has no detectable PlcR (Fig. 6). Thatfact is of interest because hemolysis and PC-PLC production inB. anthracis strains carrying pOB12 did not require specific

FIG. 6. Growth, PlcR production, and enzyme activities for B. cereus and B. anthracis strains. (A) Growth curves for strains incubated at 37°Cin BHI broth. OD, optical density. (B) Western blot analyses of whole-cell proteins from B. cereus 569 (left panel) and B. anthracis strain SdT2(right panel) with C-PlcR antiserum 1451 as described above. No PlcR production was found for B. cereus 541 or B. anthracis SdT (not shown).(C and D) PC-PLC (C) and SPH (D) activities of extracellular proteins. Equal amounts of extracellular protein (2 to 10 �g for PC-PLC and 0.1to 0.5 �g for SPH) were assayed by the Red Amplex reagents. Maximum root-mean-square deviations did not exceed 10% for the PC-PLC andSPH determinations. Filled square, B. cereus 541; filled diamond, B. cereus 569.



.org/D

ownloaded from

http://iai.asm.org/

FIG. 7. Hemolysis and lecithinase production by B. anthracis and B. cereus strains grown for 48 h at 37°C in aerobic, aerobic-plus-CO2, oranaerobic-plus-CO2 atmospheres. Lecithin (left) column shows agar plates containing egg yolk suspension (full recipe given in Materials andMethods), and sheep blood (center) and human blood (right) columns show agar plates with 5% sheep and human blood, respectively. On eachof the nine plates, B. anthracis strains SdT2, SdT, and Sterne were spotted in the top horizontal row and B. cereus strains 541 and 569 were spottedin the vertical column. The arrangement of strains on all plates is that shown in the upper left panel.



.org/D

ownloaded from

http://iai.asm.org/

media and were detected on LB medium, whereas B. anthracisstrain SdT2 requires BHI broth for the expression of cereol-ysins. To further examine this observation, enzyme activity andPlcR production were determined for B. cereus 569 and B.

FIG. 8. Spot tests showing that both B. cereus and B. thuringiensisrelease activators of B. anthracis SdT2 PC-PLC production. For eachtest, 5 �l of B. cereus or B. thuringiensis overnight culture was spottedon LB agar containing lecithin between spots of B. anthracis SdT andSdT2. The top illustration demonstrates growth of B. anthracis strainsSdT2 and SdT on LB agar with 5% sheep blood. Bacteria were grownon the plates for 24 h at 37°C.

FIG. 9. PlcR production and PC-PLC and SPH activities of B.anthracis SdT2, B. cereus 569, and B. anthracis SdT4. The strains weregrown for 16 h in LB broth at 37°C. Production of PlcR was deter-mined by Western blot analysis of whole-cell proteins with C-PlcRantiserum as described above. The PC-PLC and SPH activities ofculture supernatants of the same three strains were determined asdescribed in the legend to Fig. 6.



.org/D

ownloaded from

http://iai.asm.org/

anthracis strains SdT2 and SdT4 (SdT with pOB12) aftergrowth for 16 h in LB broth (Fig. 9, bottom). Although a highlevel of PlcR production was found in the SdT2 sample, noPC-PLC or SPH activity was detected. PC-PLC activity wasdetected in both the SdT4 and B. cereus 569 samples, whereasSPH activity was found only in the SdT4 sample. Obviously, noproduction of full-length PlcR was found in the sample ofstrain SdT4 (Fig. 9, top). PC-PLC activation in B. cereus 569 atthe stationary phase of growth, along with the loss of SPHactivity at the onset of the stationary phase, confirmed ourhypothesis about the dual role of PlcR as an activator of PC-PLC expression and as an inhibitor of SPH expression. How-ever, it is not yet clear what regulates PC-PLC and SPH pro-duction in the SdT4 strain.

DISCUSSION

In this study, we have shown that the chromosomally locatedB. anthracis plc and sph genes are almost identical in sequenceto their B. cereus orthologues and encode functionally activeproteins with activities equal to the proteins from B. cereus.Sheep erythrocytes were lysed by both B. anthracis and B.cereus SPH but not by PC-PLC, probably owing to their highcontent of sphingomyelin (45 to 53%) and low content ofphosphatidylcholine (3 to 4%). The auxiliary phosphatidylcho-line hydrolysis activity found for SPH may contribute to he-molysis. However, it was found that the cooperative actions ofB. cereus PC-PLC and SPH were needed to lyse human eryth-rocytes (3), which contain almost ten times more phosphati-dylcholine (31%) and two times less sphingomyelin (25%). Ithas also been shown that the synergistic action of B. cereusPC-PLC and SPH is required to produce the maximum rate oflysis for human but not for ruminant or swine erythrocytes (3).

The presence of almost identical plc and sph structural genesencoding the same functional proteins in B. anthracis and B.cereus highlights the differences in gene regulation that mustaccount for their contrasting hemolytic abilities. In a recentstudy of the role of PlcR, the B. thuringiensis plcR-papR operonwas introduced into B. anthracis and found to induce expres-sion of genes containing PlcR binding sites (25), which includeplc and sph. Unfortunately, no information was presentedabout the genetic structure of the genes introduced into B.anthracis. In contrast, the introduction that we describe here ofthe B. cereus plcR-papR genes into B. anthracis did not activateexpression of hemolytic genes, in particular, plc, even thoughwe confirmed that the plasmid was intact in the recipientstrain. Perhaps the greater activation seen in the previous workis due to differences in plasmid copy number or in the ability ofvarious culture media to support PlcR action.

Because the B. cereus plcR gene is positively self-regulatedand may require some additional host factor for regulation(22), we decided to produce this protein in B. anthracis underthe control of a strong constitutive promoter. High intracellu-lar expression of PlcR was achieved in B. anthracis by using thePA promoter (28). However, overexpression of the proteinappeared to be deleterious to B. anthracis, because nearly alltransformants contained an expression plasmid in which anIS10 element had disrupted the plcR gene. Less than 1% of thepAE5 transformants were hemolytic. Direct comparisonshowed that a plasmid containing the disrupted plcR trans-

formed B. anthracis at a much higher transformation efficiencythan a plasmid with intact plcR. It is probably not surprisingthat overexpression of a broadly acting transcriptional regula-tor would be deleterious.

It is well known that a significant number of clones in thepublic databases are contaminated by the mobile genetic ele-ment IS10, owing to the use of Tn10 in the construction ofbacterial strains (15). We used the E. coli XL2-Blue strain,which apparently was the source for the IS10 inserted intoplasmid pAE5. Although the frequency of insertions was prob-ably low in E. coli, around 10�4 per cell per bacterial genera-tion (37), this was easily detected because the B. anthracisrecipient selected for plasmid with inactivated plcR.

A BLAST search of the PlcR sequence showed that theN-terminal portion of the protein is homologous with morethan 30 bacterial transcriptional regulators belonging to thePBSX family (44), including the 112-aa transcriptional repres-sor RtsR of Vibrio cholerae (43) and the 111-aa SinR protein ofthe B. subtilis repressor-antirepressor complex (24). PlcR alsocontains an approximately 70-aa conservative helix-turn-helixmotif. This DNA-binding property of PlcR may explain itstoxicity when overexpressed in B. anthracis. It is important tomention that the uncharacterized 65-aa pXO1-40 polypeptideof B. anthracis contains the same helix-turn-helix motif (26).The data presented previously showed an incompatibility be-tween the PlcR- and AtxA-controlled regulons (25). Perhapspolypeptide pXO1-40 may also be involved in incompatibilitywith PlcR.

Although a high level of recombinant B. cereus PlcR pro-duction was achieved in the B. anthracis SdT2 strain, only weakPC-PLC and SPH activities were found in this recombinantstrain. This suggests that expression of PlcR-dependent genesmay require some additional factor. Expression of this factormay be induced by growth in an aerobic-plus-CO2 atmosphere,because both the PC-PLC and hemolytic activities of B. an-thracis SdT2 were increased by CO2 compared to the levelsunder simple aerobic conditions. Growth under anaerobic-plus-CO2 conditions did not cause any of the B. anthracisstrains to induce hemolysis of sheep or human blood cells,whereas B. cereus strain 569 retained activity for sheep orhuman cells under the same conditions. It is also possible thatan activating factor is provided by BHI medium, explaining thehemolytic activity observed for the SdT2 strain in the BHImedium (Fig. 7) that is not observed in LB medium (Fig. 8). Asimilar effect of BHI medium on the hemolytic activity of B.anthracis was found recently (36).

A relatively small amount of PlcR is synthesized in B. cereus,but this amount nevertheless initiates strong expression of PC-PLC. Maximal expression of this enzyme occurred at the onsetof the stationary phase, when production of PlcR was still low(Fig. 6). For the plc gene, the PlcR binding site is locatedupstream of the promoter (Fig. 1), suggesting that PlcR canserve as an activator. The increase in PC-PLC activity paral-leling PlcR intracellular content demonstrates that PlcR servesas authentic activator for B. cereus 569 plc gene expression. Thegradual increase of PC-PLC activity in comparison with thesudden rise of activity found previously for phospholipase A ofB. thuringiensis (22) could be explained by the dual PC-PLCand SPH activities detected for the mature form of the SPHprotein of B. cereus (Fig. 2).



.org/D

ownloaded from

http://iai.asm.org/

There are some data indicating that B. cereus SPH is able tohydrolyze not only phosphatidylcholine (38) but also phos-phatidylethanolamine and phosphatidylserine (6). It has beenshown also that the PC-PLC proteins of both native and re-combinant B. cereus are capable of hydrolyzing sphingomyelinbut at rates that are 200-fold lower than for SPH (3). Appar-ently, this low activity is not sufficient to induce hemolysis ofsheep erythrocytes, in which the major phospholipid is sphin-gomyelin (Fig. 2).

An especially intriguing finding in our work was the evidencethat PlcR may be acting to inhibit SPH expression in B. cereus569. Thus, SPH activity completely disappeared when produc-tion of PlcR was most evident and when the activity of PC-PLCreached its maximal value (Fig. 6). It is possible that an extra-cellular protease, possibly one whose expression is activated byPlcR, acts to destroy SPH or damage its activity. The latterwould be consistent with the detection by gel electrophoresis ofthe SPH protein in the supernatant of B. cereus ATCC 14579at the onset of the stationary phase (10). Another possibleexplanation for the absence of SPH activity at the onset of thestationary phase of growth is that PlcR may act as a repressorof sph. Because a convincing PlcR binding site is located on thecomplementary strand between the sph start codon and pro-moter, and overlapping the ribosome binding site, it is possiblethat PlcR could block sph transcription in B. cereus 569. How-ever, the absence of SPH expression in B. cereus 541, the PlcRknockout strain, clearly shows that this activator also plays apositive role in stimulating sph transcription. The positive roleof PlcR in SPH expression may be indirect, because no con-sensus PlcR binding site was found upstream of sph. Thus,PlcR may have both positive and negative roles in SPH expres-sion.

The PlcR-independent expression of the plasmid-encodedB. cereus plc and sph genes in B. anthracis strain SdT4 suggeststhat several factors could be involved in the regulation of plcand sph. First, the copy number of plc and sph would be higherfor the plasmid-encoded genes. Insertion of the plasmid intothe chromosome and subsequent amplification of these genescould be activating transcription of the plc and sph withoutPlcR, as has been previously reported (29). DNA topology isalso important because the binding of many proteins to DNAis profoundly affected by DNA bending, twisting, and super-coiling. Because these parameters are different for plasmid andchromosomal DNAs, some steric factor could be involved inthe presentation of plc and sph promoters for interaction withtranscriptional complexes. It is not clear now what kind ofprotein or cofactors might be part of this complex. Clearly,more work is needed to elucidate the exact mechanism of plcand sph regulation in the B. anthracis and the B. cereus and B.thuringiensis strains.

ACKNOWLEDGMENTS

We thank Theresa Koehler for providing plasmid pUTE29, YinduoJi for plasmid pYJ335, Robert Boykins for assistance with MAP pep-tides, MJ Rosovitz for advice, and Violetta Kivovich and Dana Hsu forassistance with some experiments.

REFERENCES

1. Agaisse, H., M. Gominet, O. A. Okstad, A. B. Kolsto, and D. Lereclus. 1999.PlcR is a pleiotropic regulator of extracellular virulence factor gene expres-sion in Bacillus thuringiensis. Mol. Microbiol. 32:1043–1053.

2. Battisti, L., B. D. Green, and C. B. Thorne. 1985. Mating system for transferof plasmids among Bacillus anthracis, Bacillus cereus, and Bacillus thuringien-sis. J. Bacteriol. 162:543–550.

3. Beecher, D. J., and A. C. Wong. 2000. Cooperative, synergistic and antago-nistic haemolytic interactions between haemolysin BL, phosphatidylcholinephospholipase C and sphingomyelinase from Bacillus cereus. Microbiology146:3033–3039.

4. Briand, J. P., C. Barin, M. H. Van Regenmortel, and S. Muller. 1992.Application and limitations of the multiple antigen peptide (MAP) system inthe production and evaluation of anti-peptide and anti-protein antibodies.J. Immunol. Methods. 156:255–265.

5. Chalmers, R., S. Sewitz, K. Lipkow, and P. Crellin. 2000. Complete nucle-otide sequence of Tn10. J. Bacteriol. 182:2970–2972.

6. Chan, E. C., C. C. Chang, Y. S. Li, C. A. Chang, C. C. Chiou, and T. Z. Wu.2000. Purification and characterization of neutral sphingomyelinase fromHelicobacter pylori. Biochemistry 39:4838–4845.

7. de Vasconcellos, F. J., and L. Rabinovitch. 1995. A new formula for analternative culture medium, without antibiotics, for isolation and presump-tive quantification of Bacillus cereus in foods. J. Food Protection 58:235–238.

8. Gavrilenko, I. V., G. E. Baida, A. V. Karpov, and N. P. Kuz’min. 1993.Nucleotide sequence of phospholipase C and sphingomyelinase genes fromBacillus cereus BKM-B164. Bioorg. Khim. 19:133–138.

9. Gilmore, M. S., A. L. Cruz-Rodz, M. Leimeister-Wachter, J. Kreft, and W.Goebel. 1989. A Bacillus cereus cytolytic determinant, cereolysin AB, whichcomprises the phospholipase C and sphingomyelinase genes: nucleotide se-quence and genetic linkage. J. Bacteriol. 171:744–753.

10. Gohar, M., O. A. Økstad, N. Gilois, V. Sanchis, A.-B. Kolstø, and D. Lere-clus. 2002. Two-dimensional electrophoresis analysis of the extracellularproteome of Bacillus cereus reveals the importance of the PlcR regulon.Proteomics 2:784–791.

11. Gominet, M., L. Slamti, N. Gilois, M. Rose, and D. Lereclus. 2001. Oligopep-tide permease is required for expression of the Bacillus thuringiensis plcRregulon and for virulence. Mol. Microbiol. 40:963–975.

12. Green, B. D., L. Battisti, T. M. Koehler, C. B. Thorne, and B. E. Ivins. 1985.Demonstration of a capsule plasmid in Bacillus anthracis. Infect. Immun.49:291–297.

13. Grones, J., and J. Turna. 1995. Transformation of microorganisms with theplasmid vector with the replicon from pAC1 from Acetobacter pasteurianus.Biochem. Biophys. Res. Commun. 206:942–947.

14. Helgason, E., O. A. Økstad, D. A. Caugant, H. A. Johansen, A. Fouet, M.Mock, I. Hegna, and A.-B. Kolstø. 2000. Bacillus anthracis, Bacillus cereus,and Bacillus thuringiensis—one species on the basis of genetic evidence.Appl. Environ. Microbiol. 66:2627–2630.

15. Hill, F., C. Gemund, V. Benes, W. Ansorge, and T. J. Gibson. 2000. Anestimate of large-scale sequencing accuracy. EMBO Rep. 1:29–31.

16. Ivins, B. E., J. W. Ezzell, Jr., J. Jemski, K. W. Hedlund, J. D. Ristroph, andS. H. Leppla. 1986. Immunization studies with attenuated strains of Bacillusanthracis. Infect. Immun. 52:454–458.

17. Ji, Y., A. Marra, M. Rosenberg, and G. Woodnutt. 1999. Regulated antisenseRNA eliminates alpha-toxin virulence in Staphylococcus aureus infection. J.Bacteriol. 181:6585–6590.

18. Johansen, T., T. Holm, P. H. Guddal, K. Sletten, F. B. Haugli, and C. Little.1988. Cloning and sequencing of the gene encoding the phosphatidylcholine-preferring phospholipase C of Bacillus cereus. Gene 65:293–304.

19. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R.Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus vari-able-number tandem repeat analysis reveals genetic relationships withinBacillus anthracis. J. Bacteriol. 182:2928–2936.

20. Klichko, V. I., J. Miller, A. Wu, S. G. Popov, and K. Alibek. 2003. Anaerobicinduction of Bacillus anthracis hemolytic activity. Biochem. Biophys. Res.Commun. 303:855–862.

21. Koehler, T. M., Z. Dai, and M. Kaufman-Yarbray. 1994. Regulation of theBacillus anthracis protective antigen gene: CO2 and a trans-acting elementactivate transcription from one of two promoters. J. Bacteriol. 176:586–595.

22. Lereclus, D., H. Agaisse, M. Gominet, S. Salamitou, and V. Sanchis. 1996.Identification of a Bacillus thuringiensis gene that positively regulates tran-scription of the phosphatidylinositol-specific phospholipase C gene at theonset of the stationary phase. J. Bacteriol. 178:2749–2756.

23. Lereclus, D., H. Agaisse, C. Grandvalet, S. Salamitou, and M. Gominet.2000. Regulation of toxin and virulence gene transcription in Bacillus thu-ringiensis. Int. J. Med. Microbiol. 290:295–299.

24. Lewis, R. J., J. A. Brannigan, W. A. Offen, I. Smith, and A. J. Wilkinson.1998. An evolutionary link between sporulation and prophage induction inthe structure of a repressor:anti-repressor complex. J. Mol. Biol. 283:907–912.

25. Mignot, T., M. Mock, D. Robichon, A. Landier, D. Lereclus, and A. Fouet.2001. The incompatibility between the PlcR- and AtxA-controlled regulonsmay have selected a nonsense mutation in Bacillus anthracis. Mol. Microbiol.42:1189–1198.

26. Okinaka, R. T., K. Cloud, O. Hampton, A. R. Hoffmaster, K. K. Hill, P.Keim, T. M. Koehler, G. Lamke, S. Kumano, J. Mahillon, D. Manter, Y.Martinez, D. Ricke, R. Svensson, and P. J. Jackson. 1999. Sequence and



.org/D

ownloaded from

http://iai.asm.org/

organization of pXO1, the large Bacillus anthracis plasmid harboring theanthrax toxin genes. J. Bacteriol. 181:6509–6515.

27. Okstad, O. A., M. Gominet, B. Purnelle, M. Rose, D. Lereclus, and A. B.Kolsto. 1999. Sequence analysis of three Bacillus cereus loci carrying PIcR-regulated genes encoding degradative enzymes and enterotoxin. Microbiol-ogy 145:3129–3138.

28. Park, S., and S. H. Leppla. 2000. Optimized production and purification ofBacillus anthracis lethal factor. Protein Expr. Purif. 18:293–302.

29. Pomerantsev, A. P., N. A. Staritsin, Y. Mockov, and L. I. Marinin. 1997.Expression of cereolysine AB genes in Bacillus anthracis vaccine strain en-sures protection against experimental hemolytic anthrax infection. Vaccine15:1846–1850.

30. Priest, F. G. 1993. Systematics and ecology of Bacillus, p. 3–16. In A. L.Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and othergram-positive bacteria: biochemistry, physiology, and molecular genetics.American Society for Microbiology, Washington, D. C.

31. Read, T. D., S. L. Salzberg, M. Pop, M. Shumway, L. Umayam, L. Jiang, E.Holtzapple, J. D. Busch, K. L. Smith, J. M. Schupp, D. Solomon, P. Keim,and C. M. Fraser. 2002. Comparative genome sequencing for discovery ofnovel polymorphisms in Bacillus anthracis. Science 296:2028–2034.

32. Reddy, A., L. Battisti, and C. B. Thorne. 1987. Identification of self-trans-missible plasmids in four Bacillus thuringiensis subspecies. J. Bacteriol. 169:5263–5270.

33. Saile, E., and T. M. Koehler. 2002. Control of anthrax toxin gene expressionby the transition state regulator abrB. J. Bacteriol. 184:370–380.

34. Salamitou, S., F. Ramisse, M. Brehelin, D. Bourguet, N. Gilois, M. Gominet,E. Hernandez, and D. Lereclus. 2000. The plcR regulon is involved in theopportunistic properties of Bacillus thuringiensis and Bacillus cereus in miceand insects. Microbiology 146:2825–2832.

35. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

36. Shannon, J. G., C. L. Ross, T. M. Koehler, and R. F. Rest. 2003. Charac-terization of anthrolysin O, the Bacillus anthracis cholesterol-dependentcytolysin. Infect. Immun. 71:3183–3189.

37. Shen, M. M., E. A. Raleigh, and N. Kleckner. 1987. Physical analysis of Tn10-and IS10-promoted transpositions and rearrangements. Genetics 116:359–369.

38. Sillence, D. J., and D. Allan. 1998. Utilization of phosphatidylcholine andproduction of diradylglycerol as a consequence of sphingomyelin synthesis.Biochem. J. 331:251–256.

39. Slamti, L., and D. Lereclus. 2002. A cell-cell signaling peptide activates thePlcR virulence regulon in bacteria of the Bacillus cereus group. EMBO J.21:4550–4559.

40. Ticknor, L. O., A.-B. Kolstø, K. K. Hill, P. Keim, M. T. Laker, M. Tonks, andP. J. Jackson. 2001. Fluorescent amplified fragment length polymorphismanalysis of Norwegian Bacillus cereus and Bacillus thuringiensis soil Isolates.Appl. Environ. Microbiol. 67:4863–4873.

41. Toldo, L. I. 1997. JaMBW 1.1: Java-based Molecular Biologists’ Workbench.Comput. Appl. Biosci. 13:475–476.

42. Vagner, V., E. Dervyn, and S. D. Ehrlich. 1998. A vector for systematic geneinactivation in Bacillus subtilis. Microbiology 144:3097–3104.

43. Waldor, M. K., E. J. Rubin, G. D. Pearson, H. Kimsey, and J. J. Mekalanos.1997. Regulation, replication, and integration functions of the Vibrio choleraeCTXphi are encoded by region RS2. Mol. Microbiol. 24:917–926.

44. Wood, H. E., K. M. Devine, and D. J. McConnell. 1990. Characterisation ofa repressor gene (xre) and a temperature-sensitive allele from the Bacillussubtilis prophage, PBSX. Gene 96:83–88.

45. Yamada, A., N. Tsukagoshi, S. Udaka, T. Sasaki, S. Makino, S. Nakamura,C. Little, M. Tomita, and H. Ikezawa. 1988. Nucleotide sequence and ex-pression in Escherichia coli of the gene coding for sphingomyelinase ofBacillus cereus. Eur. J. Biochem. 175:213–220.

Editor: J. T. Barbieri



.org/D

ownloaded from

http://iai.asm.org/

phosphatidylcholine-speciﬁc phospholipase c and ... · phosphatidylcholine-speciﬁc...

Documents