notch pathway blockade in human glioblastoma stem cells ... · notch pathway blockade in...
TRANSCRIPT
![Page 1: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/1.jpg)
Notch Pathway Blockade in Human Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage
Commitment
by
Erick Ka Ming Ling
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Erick KM Ling 2012
![Page 2: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/2.jpg)
ii
Notch Pathway Blockade in Glioblastoma Stem Cells Defines
Heterogeneity and Sensitivity to Neuronal Lineage Commitment
Erick Ka Ming Ling
Doctor of Philosophy
Laboratory Medicine and Pathobiology University of Toronto
2011
Glioblastoma is the commonest form of brain neoplasm and among the
most malignant forms of cancer. The identification of a subpopulation
of self-renewing and multipotent cancer stem cells within glioblastoma
has revealed a novel cellular target for the treatment of this disease. The
role of developmental cell signaling pathways in these cell populations
remains poorly understood. Herein, we examine the role of the Notch
signaling pathway in glioblastoma stem cells. In this thesis we have
demonstrated that the canonical Notch pathway is active in glioblastoma
stem cells and functions to inhibit neuronal lineage commitment in a
subset of patient derived glioblastoma stem cells in vitro. Gamma
secretase (γ-secretase) small molecule inhibitors or dominant-negative
co-activators inhibit glioblastoma stem cell proliferation and induce
neuronal lineage commitment in a fashion that synergizes with Wingless
pathway activation via GSK-3β blockade. Our data suggest that subsets
of patient samples show a Notch gene expression profile that predicts
their abilities to undergo neuronal lineage differentiation in response to
![Page 3: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/3.jpg)
iii
γ-secretase small molecule inhibitors. Additionally, the data suggests
that Notch may perturb the relative fractions of cells undergoing
symmetric division, in favour of asymmetric division, limiting clonal
expansion from single cells. These data may have important implications
for treating human glioblastoma, and suggest that in addition to
inhibition of proliferation, influencing lineage choice of the tumor stem
cells may be a mechanism by which these tumors may be
pharmacologically inhibited.
![Page 4: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/4.jpg)
iv
Acknowledgments
The work required to complete the text and figures contained within this thesis is, without a
doubt, the most difficult challenge I have ever undertaken. The completion of this document and
the growth of my character would not have been possible without the influence of so many
talented and patient individuals. Thank you Peter for giving me the privledge of tackling cancer
and teaching me how to be a man of science. Thank you Ian for being critical, teaching me to
accept criticism and making me better with it. Thank you Leanne, Ryan, Lilian, Phedias, Kevin,
Caroline and Renee for being part of my fondest and most cherished moments.
Mom and Emily, I could not have finished this without your unwavering love and support. For
my Father especially, this achievement is as much yours as it is mine. You have showed me the
importance of hard work and dedication. I love you all and will always aim to make you proud.
To my loving wife Nancy who has always stood by my side. We did it! It would have been
impossible to do this without you. When any challenge seems too difficult or when any barrier
seems insurmountable, you have been with me to help me through it. I really am the luckiest
man in the world.
Finally, for all those who are afflicted by cancer: you provided me with the motivation to chip at
this complex problem. I am honored to have the privledge of working with you and look
forward to the day when the solution is found.
Thank you.
![Page 5: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/5.jpg)
v
LIST OF ABBREVIATIONS ABCG2 - ATP-binding cassette sub-family G member 2 AML – Acute Myeloid Leukemia Ach –Acetylcholine AD – Alzheimer’s disease AMP– Adenosine Monophosphate APC – Adenomatous Polyposis Coli APH-1 – Anterior Pharynx-defective 1 APP – Amyloid Precursor Protein ATRA – All trans retinoic acid Bax - Bcl2-Associated-X-Protein BDNF–Brain Derived Neurotrophic Factor bHLH – Basic Helix Loop Helix BIO - 6-bromoindirubin-3'-oxime BMP – Bone morphogenetic protein BSA – Bovine Serum Albumin BTE- Basic Transcription Element BTSC – Brain Tumor Stem Cell C – Carboxyl terminus CBF-1- C Promoter-binding factor 1 CD – Cluster of Differentiation CDK – Cyclin Dependent Kinase CNTF – Ciliary Neurotrophic Factor CNS – Central Nervous System CSL – CBF-1/Suppresor of Hairless/Lag-1 D - dextrorotatory DAPI – 4',6-diamidino-2-phenylindole DAPT - N-f-L-alanyl-2-phenyl]glycin e-1,1-dimethylethyl ester Dll – Delta Like DMEM – Dubelcco’s Modified Eagle Medium DMSO – Dimethyl Sulfoxide DNA – Deoxyribonucleic Acid DN-MAML – Dominant negative mastermind like dNTP – Deoxyribonucleotide triphosphate DRD2 – Dopamine receptor D2 e – embryonic day ECD – Extracellular Domain EC50 – Half maximal effective concentration EDTA – Ethylene diamine tetra-acetic acid ED50 – Half maximal effective dose EGF – Epidermal Growth Factor eGFP – enhanced Green Fluorescent Protein ER – Endoplasmic Reticulum ES – Embryonic Stem Cell FACS – Fluoresence activated cell sorting FAP – Familial Adenomatous Polyposis FBS – Fetal Bovine Serum
![Page 6: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/6.jpg)
vi
FBW7 - F-box and WD repeat domain-containing 7 FGF (bFGF) – Basic fibroblast growth factor FITC – Fluorescein Isothiocyanate GABA – γ-aminobutyric acid GBM – Glioblastoma multiforme GFAP – Glial Fibrilary Acidic Protein Gli – Glioma associated oncogene zinc-finger protein G-NS – Glioblastoma Stem Cell GRIA1 – Glutamate receptor 1 γS – γ-Secretase γSI – γ-Secretase inhibitor GSK-3β – Glycogen synthase kinase 3 beta HD – Heterodimerization Domain HDAC – Histone Deacetylase HEPES – (4-(2-hydroxyethl)-1-1piperazineethansulfonic acid) Hh - Hedgehog HRP – Horseradish peroxidase HSC – hematopoietic stem cell HTS – High throughput screening INP – Intermediate Neural Precursors Jag – Jagged KLF - Krüppel-Like Family L - Levorotatory LIF – Leukemia inhibitory factor LDA – Limiting Dilution Analysis Mash1 - Human Achaete-Scute homologue 1 Ms - mouse MAML – Mastermind like MAPK – Mitogen-activated protein kinase MB - Medulloblastoma mRNA – Messenger Ribonucleic Acid MTT - 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide N – Amine terminus NICD – Notch intracellular domain NGS – Normal goat serum NGF- Neuronal growth factor NLS – Nuclear Localization Signal NMDA – N-methyl-D-aspartic acid NOD-SCID - Non-obese diabetic severe combined immunodeficiency NS – Neural Stem NSAID – Non-steroidal anti-inflammatory drug NSC – Neural Stem Cell NSE – Neuron Specific Enolase P - Phosphate P53 – Tumor protein 53 PBS – Phosphate buffered saline PCR – Polymerase Chain Reaction PEN2 – Presenilin enhancer 2
![Page 7: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/7.jpg)
vii
PEST – Proline-Glutamic Acid-Serine-Threonine domain PFA - Paraformaldehyde PI – Propidium Iodide PLO – Poly-L-ornithine PTEN - phosphatase and tensin homolog RAM – RBP-jK Associated Molecule Rb - Retinoblastoma RBP-jκ – Recombination signal-binding protein for immunoglobulin kappa-J region. RNA – Ribonucleic acid RT – Reverse Transcriptase RT-PCR – Reverse transcriptase polymerase chain reaction SDS-PAGE - sodium dodecyl sulfate polyacrylamide gel electrophoresis SGZ – Subgranular zone SVZ – Subventricular zone Sox - (sex determining region Y)-box T-ALL – T-lineage acute lymphoblastic leukemia TBST – Tris-Buffered Saline Tween-20 TLE1 – Transducin-Like Enhancer of Split 1 TH – Tyrosine Hydroxylase VZ – Ventricular zone WHO – World health organization Wnt – Wingless integration-1 WT – Wild Type
![Page 8: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/8.jpg)
viii
Table of Contents
ACKNOWLEDGMENTS................................................................................................ IV
TABLE OF CONTENTS .............................................................................................. VIII
LIST OF TABLES......................................................................................................... XII
CHAPTER 1.....................................................................................................................1
1 INTRODUCTION ...........................................................................................1
1.1 Cancer ..................................................................................................................................................1 1.1.1 Brain Cancer ..........................................................................................................................................1 1.1.2 Cancer Biology ......................................................................................................................................1
1.2 Cell Signaling.......................................................................................................................................2 1.2.1 Notch Signaling Pathway ......................................................................................................................2 1.2.2 Non-canonical signaling and crosstalk ..................................................................................................7
1.3 Stem Cells and Cancer Stem Cells .....................................................................................................9 1.3.1 Normal neural stem and progenitor cells ...............................................................................................9 1.3.2 Notch Signaling in Stem Cells.............................................................................................................10
1.4 Cancer Stem Cells .............................................................................................................................11 1.4.1 Brain Tumor Stem Cells ......................................................................................................................14 1.4.2 Notch in cancer and cancer stem cells. ................................................................................................15 1.4.3 The Function of Notch Brain Cancer and Brain Cancer Stem Cells....................................................16
1.5 Specific Aims......................................................................................................................................17
CHAPTER 2...................................................................................................................19
2 USING NOTCH PATHWAY BLOCKADE TO DEFINE HUMAN GLIOMA STEM CELL HETEROGENEITY AND SENSITIVITY TO NEURONAL LINEAGE DIFFERENTIATION.......................................................................................................19
![Page 9: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/9.jpg)
ix
2.1 Introduction.......................................................................................................................................19 2.1.1 Glioblastoma Multiforme ....................................................................................................................19 2.1.2 Rationale..............................................................................................................................................20
2.2 Results ................................................................................................................................................20 2.2.1 Primary Patient Glioma Express Notch Receptors and Ligands..........................................................20 2.2.2 Adherent Cancer Stem Cell Cultures are Highly Homogeneous and Express Primitive Stem Cell
Markers. ..............................................................................................................................................23 2.2.3 Tumor Precursor Lines Express Notch Receptors and Ligands...........................................................26 2.2.4 Notch receptors are activated in Glioma NS lines ...............................................................................28 2.2.5 Notch Pathway antagonism decreases cell proliferation......................................................................30 2.2.6 γ-Secretase inhibitor prevents activated Notch1 nuclear localization and inhibits the propagation of
canonical Notch signal transduction....................................................................................................35 2.2.7 Glioblastoma NS lines downregulate primitive markers in the absence of Notch signals...................42 2.2.8 Notch blockade promotes neuronal lineage differentiation .................................................................47 2.2.9 Neuron like cells are negative for neurotransmitter synthesis genes ...................................................53 2.2.10 Hierarchical clustering of signaling pathway genes reveals differential expression of Notch
components between tumor lines. .......................................................................................................56 2.2.11 Treatment of glioblastoma stem cells with γ-secretase inhibitor increases tumor latency...................60 2.2.12 Gene expression between Responsive and Non-responsive NS tumor lines. ......................................64 2.2.13 Activation of the wingless signaling pathway sensitizes glioblastoma stem cells to Notch blockade
induced differentiation. .......................................................................................................................67 2.2.14 Neuronal precursors treated with γSI and BIO are less proliferative...................................................71 2.2.15 Notch antagonist and Wnt agonists synergistically reduce in-vivo engraftment and tumor growth. ...75
2.3 Discussion...........................................................................................................................................80 2.3.1 The Notch-Hes Axis as a Therapeutic Target......................................................................................80 2.3.2 Modulating Canonical and Non-Canonical Elements of the Notch pathway ......................................82 2.3.3 Functional Synergism in BTSCs..........................................................................................................84 2.3.4 Clinical Implications............................................................................................................................88
Materials and Methods .............................................................................................................................................95 2.3.5 Primary Patient Samples......................................................................................................................95 2.3.6 Tissue Culture......................................................................................................................................95 2.3.7 Vectors and Transfection.....................................................................................................................96 2.3.8 Immunocytochemistry .........................................................................................................................96 2.3.9 Semi-Quantitative and Real Time PCR ...............................................................................................97 2.3.10 Flow Cytometry...................................................................................................................................97 2.3.11 Animals................................................................................................................................................98
![Page 10: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/10.jpg)
x
2.3.12 Microarray Data and Analysis .............................................................................................................98
CHAPTER 3...................................................................................................................99
3 SYMMETRIC VERSUS ASYMMETRIC SELF RENEWAL IN CANCER STEM CELLS. ...............................................................................................................99
3.1 Introduction.......................................................................................................................................99
3.2 Results ..............................................................................................................................................102 3.2.1 Self-renewing BTSCs persist in γSI treated cultures. ........................................................................102 3.2.2 Notch blockade restrains stem cell self-renewal and simultaneously pushes lineage commitment...106
3.3 Discussion.........................................................................................................................................113 3.3.1 Replating Assay.................................................................................................................................118 3.3.2 Limiting Dilution Analysis ................................................................................................................118 3.3.3 Differentiation Protocol .....................................................................................................................118 3.3.4 Lineage Trees ....................................................................................................................................118
CHAPTER 4.................................................................................................................119
4 NOTCH1 RECEPTOR MUTATIONS IN BRAIN TUMOR STEM CELLS ..119
4.1 Introduction.....................................................................................................................................119
4.2 Results ..............................................................................................................................................120 4.2.1 Sequence analysis of the Notch1 heterodimerization and PEST domain in CNS tumors..................120
4.3 Discussion.........................................................................................................................................122
4.4 Materials and Methods ...................................................................................................................125 4.4.1 Genomic DNA extraction ..................................................................................................................125 4.4.2 Nested Polymerase Chain Reaction...................................................................................................125 4.4.3 Sequencing.........................................................................................................................................125
CHAPTER 5 GENERAL DISCUSSION.......................................................................126
5.1. Targeting Notch in Brain Cancers.................................................................................................126 5.1.1. Cancer Stem Cells are Controversial .................................................................................................126
![Page 11: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/11.jpg)
xi
5.1.2. Cancer Stem Cells as a Therapeutic Target .......................................................................................127 5.2. Notch and the Cancer Niche ..............................................................................................................128 5.2.1. Insight from Neurodegenerative Disease Treatment .........................................................................130 5.2.2. Therapeutic Specificity ......................................................................................................................131 5.2.3. Forcing lineage choice as a treatment for cancer ...............................................................................132 5.2.4. Glioblastoma prevention....................................................................................................................133
5.3. Origins and mechanisms of brain tumors .....................................................................................134 5.3.1. A neural stem cell as the cancer stem cell .........................................................................................134 5.3.2. Symmetrical versus asymmetrical self-renewal in neural stem cells and cancer stem cells ..............135 5.3.3. Cancer as a caricature of development ..............................................................................................136
5.4. Future Direction ..............................................................................................................................139 5.4.1. How can we target non-neurogenic glioblastoma? ............................................................................139 5.4.2. Targeting Notch in CNS tumors ........................................................................................................140
REFERENCES ............................................................................................................141
![Page 12: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/12.jpg)
xii
List of Tables Table 2-1 ....................................................................................................................................... 24
Table 2-2 ....................................................................................................................................... 66
Table 3-1 ..................................................................................................................................... 109
Table 4-1 ..................................................................................................................................... 124
List of Figures Figure 1-1........................................................................................................................................ 5
Figure 1-2........................................................................................................................................ 6
Figure 1-3........................................................................................................................................ 8
Figure 1-4...................................................................................................................................... 13
Figure 2-1...................................................................................................................................... 22
Figure 2-2...................................................................................................................................... 25
Figure 2-3...................................................................................................................................... 27
Figure 2-4...................................................................................................................................... 29
Figure 2-5...................................................................................................................................... 32
Figure 2-6...................................................................................................................................... 33
Figure 2-7...................................................................................................................................... 34
Figure 2-8...................................................................................................................................... 37
Figure 2-9...................................................................................................................................... 38
Figure 2-10.................................................................................................................................... 39
Figure 2-11.................................................................................................................................... 40
Figure 2-12.................................................................................................................................... 41
Figure 2-13.................................................................................................................................... 44
Figure 2-14.................................................................................................................................... 45
Figure 2-15.................................................................................................................................... 46
Figure 2-16.................................................................................................................................... 49
Figure 2-17.................................................................................................................................... 50
Figure 2-18.................................................................................................................................... 51
Figure 2-19.................................................................................................................................... 52
Figure 2-20.................................................................................................................................... 55
Figure 2-21.................................................................................................................................... 62
Figure 2-22.................................................................................................................................... 63
Figure 2-23.................................................................................................................................... 69
![Page 13: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/13.jpg)
xiii
Figure 2-24.................................................................................................................................... 70
Figure 2-25.................................................................................................................................... 73
Figure 2-26.................................................................................................................................... 74
Figure 2-27.................................................................................................................................... 77
Figure 2-28.................................................................................................................................... 78
Figure 2-29.................................................................................................................................... 79
Figure 2-30.................................................................................................................................... 87
Figure 3-1.................................................................................................................................... 101
Figure 3-2.................................................................................................................................... 104
Figure 3-3.................................................................................................................................... 104
Figure 3-4.................................................................................................................................... 105
Figure 3-5.................................................................................................................................... 110
Figure 3-6.................................................................................................................................... 111
Figure 3-7.................................................................................................................................... 112
Figure 4-1.................................................................................................................................... 121
Figure 5-1.................................................................................................................................... 138
Supplemental Figure 1 .................................................................................................................. 90
Supplemental Figure 2 .................................................................................................................. 91
Supplemental Figure 3 .................................................................................................................. 92
Supplemental Figure 4 .................................................................................................................. 93
Supplemental Figure 5 .................................................................................................................. 94
Supplemental Figure 6 ................................................................................................................ 116
Supplemental Figure 7 ................................................................................................................ 117
![Page 14: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/14.jpg)
1
Chapter 1
1 Introduction
1.1 Cancer
1.1.1 Brain Cancer
Cancer is one of the leading causes of mortality in North America and only second to accidents
in the death of children1. In Canada, over 40% of women and 45% of men will develop some
form of cancer in their lifetime with approximately 1 in 4 Canadians succumbing to this disease2.
Among the new cases of cancer reported in Canada in 2009, 1.5% of these were brain
neoplasms. Mortality from this disease represented 2.3% of all Canadian cancer deaths and
results in a dismal death to case ratio (0.67) which is exceeded by few other cancers. Malignant
brain tumors also have the highest death to case ratio in childhood cancers (0.30). Despite initial
responses to treatment, many of these tumors recur, leaving only few long term survivors3. In
particular, glioblastoma multiforme (GBM), the most common malignant primary brain tumor in
adults, has a 2 year survival of less than 10%. As well, histologically benign brain tumors of the
glial lineage can confer a poor prognosis in cases where growth occurs in surgically inaccessible
areas. In addition, it is well known that longer term survivors of this disease, particularly
children and young adults, often suffer from the adverse side effects of aggressive chemotherapy
and radiation. Our poor understanding of the cellular and molecular mechanisms governing this
cancer is one of the limiting factors in the development of new strategies to treat this disease.
1.1.2 Cancer Biology
Cell divisions are regulated by a chorus of cellular processes. Tumor suppressors such as P53
and Rb, function to prevent tumor cell division in part by inhibiting regulators of the cell cycle
and by integrating with the molecular controls regulating programmed cell death. Conversely,
oncogenes such as EGFR, facilitate cell cycle progression, migration and survival. Lesions
(point mutations, translocations, deletions, epigenetic alterations) in these genes can lead to a
state where cells acquire one or more of the classic oncogenic properties, such as: 1. Evading
apoptosis, 2. Self-sufficiency in growth signals, 3. Insensitivity to anti-growth signals, 4.
Sustained angiogenesis, 5. Limitless replicative potential, and finally, 6. Tissue invasion and
![Page 15: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/15.jpg)
2
metastasis4. While these individual characteristics do not necessarily confer pathological
properties, the accumulation of loss-of-function mutations in tumor supressors5 and gain-of-
function mutations in oncogenes support the development of a full blown malignant neoplasm
which possesses all of the hallmarks of cancer enumerated above. The development of effective
therapies against all forms of cancer will hinge on the understanding, and ultimately control of,
cellular processes which regulate these characteristics.
1.2 Cell Signaling Many of the cell signaling pathways critical for normal organismal and tissue development are
now recognized as contributors to neoplastic transformation. Notch, Sonic Hedgehog and
Wingless pathways amongst others, all have fundamental functions in developmental patterning
and regulation of post-developmental homeostasis. These pathways are known to be active in
many cancers, such as those occurring in the brain, gastrointestinal, and lung6. Defining the role
of these pathways in growth and propagation of cancer will likely help identify new targets for
therapeutic interventions.
1.2.1 Notch Signaling Pathway
Over the past several decades the Notch signaling pathway has emerged as one of the most
important pathways implicated in development, stem cell biology and cancer. Due to the
diversity of actions, and complexity of signaling mechanisms, the exact role for Notch in many
biological processes remains incompletely understood. The study of a Drosophila melanogaster
mutant with Notched wings led Thomas Hunt Morgan in 1916 and subsequently D. F. Poulson in
1937, to identify insufficiency at the Notch locus as a cause of the improper wing development7.
Since then, it has been revealed that Notch is a key regular in all facets of Drosophila growth,
including (but not limited to) wing, eye, oocyte and neural development. Studies in
Caenorhabditis elegans and Drosophila have shown that Notch regulates cell fate decisions
through a process termed ‘lateral specification’8. In the developing Drosophila neuroblast,
signaling between adjacent neural progenitors with stochastic differences in cell surface Notch
receptor and ligand expression represses neuronal differentiation in the Notch activated cell and
inhibits adjacent cells from adopting the same fate9. In 1991, the first human Notch gene was
identified and, in the same study, linked to human cancer10. It is now clear that Notch signals are
highly conserved across many organisms and serve a diverse set of functions including
![Page 16: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/16.jpg)
3
developmental patterning, stem-cell maintenance and differentiation, all of which are regulated
in a complicated context-dependent specificity.
In mammals, there are four Notch receptor homologues (Notch1-4)(Figure 1-1). The precursor
of each receptor is manufactured in the endoplasmic reticulum, exported to the golgi for
posttranslational modification by fringe glycosylases11 and further processed by furin like
proteases12. Notch receptors are then exported and assembled at the cell surface into a
heterodimeric transmembrane receptor that is maintained in a stabile conformation by Ca2+
ions13,14. In the absence of ligand the receptor assumes a conformationally inactive state
whereby the cleavage site in the heterodimerization domain is protected from activation. The
signaling cascade is initiated when the mature receptor comes into physical contact with one of
five canonical ligands (Jagged1, 2, Delta-like1, 3, 4) expressed on the cell surface of an adjacent
cell. Despite the large combination of potential ligand and receptor interactions, specificity is
dictated by glycosylation of the receptor11,15. Ligand-receptors interactions are mediated through
the extracellular EGF-like motifs in Notch and initiate internalization of ligand into the ligand-
presenting cell. Ligand internalization is thought to generate physical force which assists in
deforming the tertiary structure of the receptor, displacing extracellular Ca2+ ions13,16 and
unmasking receptor cleavage sites. At this point, TNF-α-converting-enzyme (TACE) cleaves
Notch at the newly exposed S2 cleavage site within the heterodimerization domain17. At the
intracellular face of the plasma membrane, γ-secretase cleaves the intracellular domain18.
Composed of the subunits nicastrin19,20, presenilin21,22,23, presenilin enhancer 2 (PEN2) 24, and
anterior pharynx-defective 1 (APH-1)24, and regulated by modifying proteins such as
TMP2125,26, γ-secretase cleaves the Notch receptor at the S3 cleavage site. The released Notch
intracellular domain (NICD) translocates into the nucleus where it binds to the Jκ recombination
signal-binding protein (RBP-Jκ/CBF-1/CSL) and recruits co-activators such as Mastermind-Like
(MAML)27. This transcriptional activation complex disrupts RBP-jκ complexes containing co-
repressors such as N-CoR28,29. The RBP-Kκ/co-activator complexes binds to promoter elements
and regulate transcription of target genes that include basic helix loop helix transcription factors
(bHLH), primarily Hes1, Hes5, and Hes related proteins (Hey and Herp)7. The bHLH
transcription factors, in turn, form dimeric and heterodimeric complexes which have the capacity
to function as either transcriptional activators or repressors30. The resulting effect of Notch
signaling is therefore highly context dependent and varies from tissue to tissue (Figure 1.2).
![Page 17: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/17.jpg)
4
While the Notch signaling pathway was one of the first to be identified, it has yet to be fully
defined. The Delta and Serrate ligands have been studied for decades31, however, novel Notch
ligands such as weary (Wry) are still being discovered. Drosophila weary mutations contribute to
cardiomyopathy32. Additionally, longstanding components have been found to function through
previously underappreciated mechanisms. For example, negative regulation of receptor activity
can occur via cis-inhibition of Notch by Delta in development of Drosophila photoreceptors33,34.
In the murine brain, Epidermal growth factor-like domain 7 has been identified as a secreted
factor that binds to the ligand binding domain of Notch, antagonizing receptor function in neural
stem cells35. Even the long held views of receptor activation may require rethinking with the
recent discovery that Notch1 is capable of forming homodimers36. These findings underscore
how much remains to be discovered with respect to Notch signaling and its role in development.
![Page 18: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/18.jpg)
5
Figure 1-1
Structure of the four known mammalian Notch receptors. All Notch receptors have an N-
terminal extracellular domain, which consists of multiple EGF repeats and three cysteine rich
Lin-12 repeat (LNR) domains37. These regions are responsible for direct ligand interaction and
function to shield cleavage sites from ligand-independent activation, respectively. Ligand
binding initiates proteolytic cleavage of the receptor at the heterodimerization domains (HD).
Subsequent downstream signaling is dependent on cytoplasmic domain sequences. Nuclear
localization sequences (NLS) are required for nuclear shuttling38, whereas the ankyrin (ANK)
domains mediate protein-protein interactions with various transcriptional co-activators39,40.
Importantly, RBP-jK binding occurs at the ‘RBP-jK associated module’ (RAM)41. Ultimately,
proline-glutamic acid-serine-threonine (PEST) rich sequences in the C-terminus are responsible
for activated receptor degradation42.
![Page 19: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/19.jpg)
6
Figure 1-2
Schematic of the canonical Notch signaling pathway. Notch receptors are activated by direct
contact of ligands presented on the plasma membrane of adjacent cells. Pathway activation is
regulated at many levels including the ligand, receptor and nucleus. Receptor modulation
includes cis-delta-like 3 interactions, Numb degradation, γ-secretase regulators and others.
Ligands are regulated by a class of proteins call neuralized, which endocytose and ubiquitinate
ligands on the ligand presenting cell. Finally, proteins such as FBW7 assist in the turnover of
activated Notch. In the absence of receptor activation, target gene expression is suppressed by
co-repressors in the cell nucleus. Ligand binding unmasks target sites for TACE proteolysis
within the extracellular domain and γ-secretase proteolysis within the transmembrane domain.
The liberated intracellular domain translocates to the nucleus where it binds RBP-jK and MAML
to induce transcription of downstream basic helix-loop-helix transcription factors and other
target genes.
![Page 20: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/20.jpg)
7
1.2.2 Non-canonical signaling and crosstalk
As a result of the decades of study and increasing technical sophistication of biochemical assays
to detect active Notch signaling, there is a growing appreciation for the idea that signaling
pathways link together to form networks with considerable power to integrate across multiple
membrane inputs. Defining these networks is a prerequisite for the rational development of
novel anti-cancer drugs. Interestingly, there is growing evidence to demonstrate crosstalk
between Wnt and Notch pathways and their integration within a common network in
development and oncogenesis. For example, β-catenin, a fundamental player of the canonical
Wnt pathway (Figure 1-3), is capable of binding to and stabilizing the activated domain of
Notch43. Curiously, the NICD co-activator MAML1 has recently been shown as a binding
partner and transcriptional co-activator of the β-catenin mediated TCF/LEF complex44. MAML
also binds to and regulates P53 signaling45, showing that some of the fundamental players in
Notch signaling are more involved with cell homeostasis than previously thought. Conversely,
some cell cycle regulators have been discovered to extensively modulate Notch. HIF-1α, a
global regulator of oxygen homeostasis, binds to and stabilizes the Notch intracellular domain in
C2C12 myogenic cell lines, suppressing differentiation and supporting an undifferentiated
state46. Further, HIF-1α may even upregulate components of γ-secretase, leading to activation of
the receptor in hypoxic environments47. In addition, non-bHLH targets of the RBP-jK activation
complex have been identified and are important to consider in neural stem cell biology. For
example, Notch can directly regulate expression of Brain Lipid Binding Protein (BLBP)48,
ABCG249 and Nestin50 genes. Clearly, direct crosstalk between signaling pathways and many of
the non-canonical downstream targets of Notch have important implications for disease and
development.
![Page 21: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/21.jpg)
8
Figure 1-3
Schematic summary diagram of canonical Wingless signaling. A) In the absence of
activating ligands, β-catenin is bound and phosphorylated by the destruction complex which
includes GSK-3β, APC and Axin51. B) Binding of ligands to the frizzled receptor and LRP
induces a cascade of events, which promote association of Axin with LRP, thereby disrupting the
destruction complex. Subsequently, β-catenin accumulates in the cytoplasm, translocates to the
nucleus, and binds to TCF/LEF. Binding of TCF/LEF to β-catenin dismantles the transcriptional
repressor complex, nucleates assembly of a transcriptional activation complex and induces
transcription of downstream targets.
![Page 22: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/22.jpg)
9
1.3 Stem Cells and Cancer Stem Cells
1.3.1 Normal neural stem and progenitor cells
Seminal experiments conducted by James Till and Ernest McCulloch in 1963 identified a
population of hematopoietic cells, which were capable of self-renewal, giving rise to spleen
colonies in irradiated mice52. These experiments identified hematopoietic stem cells as the blood
borne cellular element capable of reconstituting an immune compromised host. The discovery of
a stem cell compartment in blood led to similar discoveries in the gut53, skin54, mammary gland55
and other tissues56. Despite evidence to demonstrate the existence of a proliferative population
in brains of songbird canaries57, dogma persisted that the brain lacked regenerative potential. In
1992, Reynolds and Weiss cultured a population of cells from striata of 3 to 18 month old mice.
When grown at clonal densities with the mitogens, epidermal growth factor (EGF) and fibroblast
growth factor (FGF), non-adherent spheroid colonies grew, which contained cells positive for the
intermediate filament Nestin and negative for neuronal and glial markers. Additionally these
cells were found to be capable of self-renewal, generating clonally derived spheres possessing
the same primitive properties. Furthermore, neurosphere initiating cells were capable of multi-
lineage differentiation, with single cells differentiating into neuronal-specific enolase (NSE)
positive neurons or glial fibrillary acidic protein (GFAP) positive astrocytes58. This study
demonstrated the existence of neural stem cells in the brain. Since then, our understanding of
neuroanatomy revolving around NSCs has developed significantly. Postnatal neural stem cells
are situated in at least two regions of the brain: the subventricular zone (SVZ) of the lateral
ventricles and the subgranular layer of the dentate gyrus59. In the SVZ, elegant studies by
Doetsch, et al., demonstrated that a population of GFAP positive cells termed type-B astrocytes
are uniquely capable of regenerating migratory neuroblasts and immature precursors following
chemical ablation of cells lining the lateral ventricles60. In murine models, neural stem cells
have now been demonstrated to play an active role in postnatal olfactory development61,62 and
neuroprotective functions following brain trauma63,64,65,66 thus dispelling the long held dogma
that the brain is a postmitotic organ. Indeed, populations of proliferative cells, which contribute
to neurogenesis, have been identified in the adult human brain67. These cells may function in
memory formation68 and may even compose a human equivalent of the murine rostral migratory
stream69.
![Page 23: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/23.jpg)
10
1.3.2 Notch Signaling in Stem Cells
Notch signaling is a key regulator of embryonic and postnatal central nervous system
development. Isolation of the Notch1 or Hes5 positive cell populations from the developing
mouse forebrain enriches for cells with a greater clonogenic ability, suggesting a role in neural
stem cells70,71. Consistent with these findings, knockout of pathway elements such as Notch1
and Notch2 result in widespread CNS cell death and embryonic lethality at E10, a period of rapid
neurological expansion72. Knockout mice deficient for RBP-jK or presenilin are incapable of
forming secondary or tertiary neurospheres in culture73 and neural stem cells isolated from Hes1-
/- and Hes5-/- double knockouts have similar self renewal impairments74. Conversely, over
expression of Notch175 or Notch376 in the murine brain induces radial glial phenotypes and
astroglial cell fate specification. Over expression of Notch2 inhibits differentiation in the
cerebellum by promoting proliferation of cerebellar granule neuron precursors77, and over
expression of Hes1 and Hes5 in the telencephalon maintains neural stem cells in an
undifferentiated state74. In the postnatal murine brain, RNA in-situ hybridization analysis of
Notch receptors and ligands reveals strong expression within the subventricular zones and
subgranular layers of the dentate gyrus78, regions known to harbor neural stem cells60, suggesting
that Notch signaling, in addition to its developmental roles may be required to regulate postnatal
NSCs. Indeed, it has been demonstrated that Notch regulates self renewal of murine neural stem
cells in post-natal animals putatively through Jagged1 signaling79. Mechanisms of NSC self
renewal are being developed as it is now understood that Notch may co-operate with other
signaling pathways such as EGFR80.
While Notch signals are required to promote self renewal and expansion of neural stem cells, it
also provides instructive signals for lineage cell fate decisions in neural precursors. Expression
of Notch receptors and ligands is critical for neuronal and astrocytic patterning in the E11.5 mid-
gestational telencephalon81. Regulation of cell fates occurs partly through Hes1 and Hes5, Notch
targets known to inhibit downstream pro-neural transcription factors, leading to a block in
neuronal lineage differentiation and promotion of glial lineage specification. Ectopic expression
of activated Notch in the postnatal murine forebrain result in expansion of the radial glial
putative stem cell compartment at the expense of differentiated neurons75. Conversely, blockade
of Notch signaling with pharmacologic inhibitors of γ-secretase induces neuronal lineage
differentiation in endothelial co-culture experiments82 and human fetal slice cultures83. Notch
![Page 24: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/24.jpg)
11
also signals through the non-canonical ligand F3/Contactin, to promote oligodendrocytes
differentiation84,85,86. Interestingly, the discovery that Hes proteins are regulated in an oscillatory
mechanism, where adjacent neural precursors express varying levels of Notch targets genes yet
retain primitive characteristics87 demonstrates that many nuances regarding Notch in neural stem
cells have yet to be defined. Paradoxically, Notch signaling has also been shown to function in
terminally differentiated cells88,89. Notch signals are critical for maintenance of post-mitotic
neurons and are responsible for neuronal maturation and dendrite formation. Clearly, the Notch
pathway is a multifaceted signaling mechanism with important functions at all levels of the stem
cell hierarchy.
1.4 Cancer Stem Cells Central to the development of novel therapies is an understanding of how a disease state is
maintained. Some of the first reports to shed light upon heterogeneity of cancer were highly
unethical experiments conducted by Southam and Brunschwig in 1961. Through the dissociation
of human tumors and re-injection of cell suspensions sub-cutaneously into the same patients,
they observed that tumor formation occurred at a low frequency90. Further studies of murine
myeloma demonstrated that the efficiency of in-vivo spleenic colony formation was very low91.
While the idea that only a unique population of cells with tumorigenic potential was
postulated92,93, the stochastic hypothesis that most or all the cells in the tumor had equivalent,
albeit low, tumorigenic potential retained prominence for almost four decades (Figure 1-4).
The concept of cancer clones existing as a functional tumor hierarchy was firmly put forward in
the studies by Lapidot and Dick in 1994, and by Bonnet and Dick in 1997. In these studies on
acute mylogenous leukemia (AML), Lin-/CD34+/CD38- cells prospectively isolated from patient
samples were observed to possess the unique capability to recapitulate the disease in-vivo upon
transplantation into NOD/SCID mouse models94. This population of leukemic cells possessed
the capacity to replenish the entire repertoire of aberrant cell types found in the original patient
cancer; demonstrating the capability for hierarchical organization94. Furthermore, this work
provided evidence to support the idea that the leukemogenic event occurs in primitive
hematopoietic stem cells. Subsequent studies in a number of solid tumors have mirrored these
results. For example, a study by Al-Hajj, et al., characterized a population of CD44+/CD24-
cells isolated from patient breast cancers that were uniquely capable of forming tumors when
![Page 25: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/25.jpg)
12
serially passaged in NOD/SCID mice. Secondary tumors reconstituted the phenotypically mixed
population of cells found within the original patients tumor95. The demonstration that both
hematopoietic and solid cancers are driven by unique and relatively rare populations has led to
characterization of cancer stem cells in many different cancer types. Thus far, cancer stem cells
(CSCs) have now been identified in prostate96, brain97,98, colon99,100, pancreas101, mesenchyme102,
skin103,104, ovaries105, head & neck106 and lung56 malignancies.
![Page 26: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/26.jpg)
13
Figure 1-4
Stochastic and hierarchical models of cancer growth. A) The stochastic model of cancer
growth proposes that each cell within a malignancy has a small but equal capacity to give rise to
neoplasia in-vivo. B) In contrast, the cancer stem cell hypothesis suggests that not all cells
within a tumor are capable of propagating the malignancy. In this model, only a subpopulation
of cells has the ability to self-renew and give rise to the phenotypic heterogeneity found within
the cancer
![Page 27: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/27.jpg)
14
1.4.1 Brain Tumor Stem Cells
Pathologists have long recognized on histologic analysis of primary samples of glioblastoma that
these tumors contained cells with a primitive appearance, often mixed with more differentiated
cells. With the discovery of culture conditions that show a capacity to maintain viable
proliferating populations of stem cells from the normal brain, Singh, et al., successfully cultured
a population of cells from human tumors (medulloblastoma and glioma) that formed clonally
derived tumorspheres. These Nestin positive sphere derived cells had the ability to self-renew
and could generate Nestin negative, β-III-tubulin (BIIIT) positive neurons and Nestin negative,
GFAP positive astrocytes upon serum induced differentiation107. Furthermore, these
characteristics were only found in primary brain tumor cells expressing the cell surface antigen
CD133. CD133 was previously identified as a marker used to enrich for spherogenic
populations from the human fetal brain, as well to also identify populations of normal human
hematopoietic stem cells. Importantly, only CD133+ human glioblastoma cells were capable of
tumor initiation in vivo,. Upon orthotopic injection of as few as 102 cells into the brains of
NOD-SCID mice, the CD133+ population was capable of engrafting and forming a tumor that
recapitulated the original patient phenotype. Conversely, the CD133- population was not
capable of generating spheres in-vitro and injection of several orders of magnitude more cells in-
vivo did not result in tumor formation97. The tumors that arose recapitulate the same phenotype
as the original patient’s tumor and were capable of regenerating disease upon serial
transplantation, demonstrating cardinal features of in-vivo self-renewal capability.
The existence of a cancer stem cell population in brain cancer and others, may explain why many
malignancies are difficult to treat. Since only small numbers of cancer stem cells are required to
propagate disease, removing the bulk of the malignant cells but sparing small numbers of CSCs
may leave small populations of cells capable of regrowing the tumor, leading to clinical relapse.
Perhaps the existence of CSCs may explain why many cancers recur despite aggressive
chemotherapy treatment. Anti-mitotic drugs such as 5-fluorouracil108 inhibit rapidly dividing
cells, and thus by virtue of their mechanism of action, target the large numbers of precursors
which are rapidly dividing but limited in self-renewal, thus sparing CSCs which retain unlimited
self-renewal but which may be more relatively quiescent. In addition to this passive resistance,
CSCs may possess a more active resistance to drugs. One of the hallmarks of stem cells is
expression of ATP-binding cassette (ABC) transporters. Hematopoetic stem cells express high
![Page 28: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/28.jpg)
15
levels of the efflux pump ABCG2, which is down regulated in more mature blood cells109.
Indeed, this property has been utilized to prospectively isolate stem cells from bone marrow110,
muscle111 and other tissues based on the ability of pump-expressing cells to efflux fluorescent
dyes. The physiological function of these transporters, also known as multidrug resistance
genes, is to transport hydrophilic and hydrophobic compounds across the cell membrane as well
as playing important roles in blood-brain and blood-testis barriers112. However, expression of
transporters in CSCs has also been theorized to be the cause of significant drug resistance as
many common drugs are actively effluxed by these pumps. Indeed, elevated pump expression
has been detected in CSCs of brain113, breast114, lung114 and mesenchymal tumors102. Another
common strategy in targeting cancer is the use of radiation to induce DNA damage and cell death
in areas of cancer growth. Remarkably, cancer stem cells may also possess DNA damage repair
mechanisms that enable them to be particularly resilient to conventional radiation treatments115.
Thus, current strategies may only target bulk cells and spare the cancer stem cells which possess
long term self-renewal ability. Understanding molecular mechanisms and cellular requirements
that regulate cancer stem cells will be of critical importance for development of effective and
specific therapies.
1.4.2 Notch in cancer and cancer stem cells.
Considering the degree of resistance to traditional therapies, there has been a strong impetus to
identify molecular mechanisms critical to growth of cancer stem cells that may confer
vulnerability when targeted by anti-cancer treatments. One pathway that has been implicated in
multiple tumors and more recently in CSCs is the Notch pathway. Aberrant Notch signaling is
associated with a number of neoplasms116. In particular, Notch has a significant role in the
pathogenesis of T-cell acute lymphoblastic leukemia by virtue of genetic rearrangements and
mutations (T-ALL). First identified in 1991 by Ellisen, et al., a translocation on chromosomes 7
and 9 caused a breakpoint in an intron of the Notch1 gene resulting in fusion of the 3’ end of
Notch1 to the TCRβ locus10. This translocation resulted in expression of a constituatively
activated intracellular domain (ICD) fragment of Notch1. The contribution of Notch1 to the
pathogenesis of T-ALL was further demonstrated in 2004 when Weng, et al., showed that over
50% of T-ALL samples harboured mutations in the heterodimerization (HD) and/or PEST
domains of Notch1117. Point mutations found in the HD domain are thought to increase
sensitivity of the receptor to activation, while PEST domain mutations increase the half-life of
![Page 29: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/29.jpg)
16
activated Notch. Ultimately, both mutations cause ectopic activation of Notch1 during T- versus
B-cell lineage choice of hematopoietic progenitors. Under normal circumstances, Notch1
inactivation supports development of B-cells at the expense of T-cells118,119 while activation of
the receptor supports the opposite120. Most T-ALL leukemic cells are arrested at the CD4+CD8+
double-positive stage of development and committed to the αβ lineage suggesting that ectopic
Notch1 pathway activation occurs during maturation of hematopoietic precursors112. The role of
Notch in this hematopoietic neoplasm is relatively well characterized, however, while Notch1
functions as an oncogene in the blood117,10 and brain121, it serves the opposite role, as a tumor
suppressor, in some forms of skin, lung and cervical cancers122,123,124. In addition to its direct
contribution to oncogenesis, Notch activation also regulates tumor angiogenesis125,126. From the
first report of Notch in T-ALL over 19 years ago, the Notch signaling pathway is now implicated
in development of many solid and hematopoietic cancers.
1.4.3 The Function of Notch Brain Cancer and Brain Cancer Stem Cells
Active Notch signaling has been implicated across all spectrums of central nervous system
neoplasms. Benign tumors of the choroid plexus can be initiated in mouse models by over
expression of Notch3 and human tumors have been found to possess elevated levels of
Notch2127. In medulloblastoma, the aggressive pediatric cerebellar tumor, the role of Notch is
more controversial. In some mouse models, active Notch signaling is required for the
development and/or propagation of spontaneous medulloblastoma within Patched heterozygous
mice128,129,130. Yet other models of murine medulloblastoma point to a Notch independent role.
Here, RBP-jκ knockout models did not prevent the generation of aggressive tumors in
mice131,132. Despite the controversy in model systems, Notch receptor activity has been identified
in human medulloblastoma with Notch2 possessing oncogenic properties in these cerebellar
tumors133. Within gliomas, a spectrum of tumors with glial characteristics, activated Notch1 was
detected in primary patient samples of oligoastrocytomas, anaplastic astrocytoma, glioblastoma
and serum derived glioblastoma cells lines121,134. Dysregulated expression of Notch1 through
disruption of the negative microRNA regulator miRNA-146a may lead to uncontrolled
signaling135. It is postulated that many of these cancers may signal through canonical Notch
ligands. Jagged1 signaling is active downstream of the developmental regulator inhibitor of
differentiation 4 (ID4)136 and knockdown of Dll1 was effective in preventing the growth of
serum derived cell lines121, all suggesting that these canonical binding partners are activated.
![Page 30: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/30.jpg)
17
Considering the diverse and context dependent roles of Notch in normal tissue development and
homeostasis, the precise role for this signaling pathway in the pathogenesis of glioblastoma is far
from clear.
With the identification of tumor initiating cells, efforts to identify key signaling pathways have
intensified. In medulloblastoma, Fan and colleagues reported that proliferation of a serum
derived medulloblastoma stem cell lines can be reduced with γ-secretase inhibitors137, an effect
that is rescued by ectopic expression of Notch2-ICD. Interestingly, Notch1 antagonized the
oncogenic effects of activated Notch2 in these tumors, suggesting that Notch receptors have
discrete and unique functions.
Several groups have demonstrated that in-vitro and in-vivo growth of glioblastoma derived
neurospheres can be blocked by administration of γ-secretase inhibitor (γSI) and this effect is
Notch specific138,139,140. In these studies, pharmacologic inhibitors attenuated the formation of
glioma derived neurospheres derived from established lines and low passage cultures.
Implantation of γSI impregnated beads along with glioblastoma stem cells lead to reduced tumor
formation in orthotopic models. Targeting Notch in stem cells may also be an effective
mechanism to sensitize BTSCs to current anti-neoplastic strategies. High rates of recurrence are
thought to be due, in part, to inherent radioresistance of cancer stem cells115. Blockade of Notch
signaling in glioma has been shown to reduce tumorigenicity by sensitizing cancer stem cells to
radiation therapy141,142. This preliminary body of knowledge has lead to a push to understand the
contribution of Notch to glioma stem cell self-renewal and differentiation.
Herein, we propose that cancer stem cells, which drive growth of human brain cancer, are
regulated by Notch signaling. Activation of the Notch receptor is required for self-renewal and
also functions to suppress differentiation of cancer stem cells. Notch pathway antagonism may
therefore be an effective strategy to treat brain tumors.
1.5 Specific Aims The objective of this thesis is to identify the function and significance of Notch signaling in
human brain tumor stem cells derived from glioblastoma. My objectives are summarized in the
chapters following.
![Page 31: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/31.jpg)
18
Aim 1: Establish whether Notch components are expressed in glioblastoma. We will determine
whether pathway antagonism using genetic and pharmacologic blockade is a feasible strategy to
target the CSC. We will characterize the functional effect of Notch blockade in-vitro and in-
vivo.
Aim 2: Elucidate a cellular mechanism of Notch pathway mediated tumorigenesis.
![Page 32: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/32.jpg)
19
Chapter 2
2 Using Notch Pathway Blockade to Define Human Glioma Stem Cell Heterogeneity and Sensitivity to Neuronal Lineage Differentiation.
2.1 Introduction
2.1.1 Glioblastoma Multiforme
Glioblastoma is the most frequent primary brain neoplasm and most malignant. Found mainly in
adults between the ages of 45-75 and localized most commonly in cerebral hemispheres, this
class of tumor accounts for 12-15% of all intracranial tumors. Histologically, this disease
presents as a poorly differentiated and highly mitotic entity. Prognosis is very poor, with mean
survival of 9.5 months for patients under 50 years of age with progressively worse prognosis for
older patients3. Treatment strategies involve surgical resection, radiation and chemotherapy.
Even with high doses of temozolomide, often described as one of the few successes in
glioblastoma treatment options, mean survival is only extended by 60 days143. Despite surgical
resection, recurrence is frequent and often in close proximity to the original tumor site144.
With considerable phenotypic heterogeneity, is it possible to use genetic profiling to identify
vulnerabilities? This approach has been useful for the treatment of some malignancies. For
instance approximately 30% of invasive ductal breast cancer exhibit over expression of ErbB2
(Her2)145, a discovery that has lead to use of humanized monoclonal antibodies against this
variant of cancer, which results in significantly increased 1-year survival in patients with this
disease146. Thus under the pretense of creating individualized therapies, there has been a great
effort to understand the genetics and susceptibility markers behind this disease. Great efforts
have been undertaken to genotype large cohorts of glioblastoma. A large screen of 91 bulk
tumor samples revealed that NF1, EGFRvIII and PI(3)K are recurring instigators in a large
proportion of tumors147. However, the identification of cancer stem cells in GBM suggests that
one must consider the role and genomic profile of these particular tumor cells to obtain a more
realistic picture of the molecular drivers of brain tumor growth.
![Page 33: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/33.jpg)
20
Our laboratory has previously demonstrated that brain tumors are maintained by a rare
subpopulation of cancer cells, which retain stem-like properties, and we have also established
methods for their culture in vitro. Unlike the majority of cells isolated from primary tumors,
CSCs are uniquely capable of self-renewing in-vitro and in-vivo to give rise to tumors in murine
models, which recapitulate human disease97. Preliminary reports have suggested that many of
the signaling pathways which regulate normal neural stem cells, may have a similar function in
regulating the self renewal of cancer stem cells. Amongst these putative regulatory pathways,
the role of Notch signaling in CSCs remains an oft implicated player. Based on the knowledge
of the phenotypic diversity surrounding glioblastoma multiforme, we dissected the role of
signaling pathways in glioblastoma stem cells with the objective of elucidating novel targets for
chemotherapy.
2.1.2 Rationale
Developmental signaling pathways are known to play an important part in normal neural stem
cell maintenance and expansion148. Among these pathways, the Notch signaling pathway has
been shown to regulate neural stem cell self renewal73,149 as well as to regulate
gliogenesis150,151,152,76 and the morphology of mature neurons153,154. These apparently opposing
functions (or context dependency) are integrated with the finding that GFAP positive radial glial
stem cells are Notch positive155,75,83. Glioblastoma stem cells derived from patient tumors
possess self-renewal and proliferative properties similar to that of normal NSCs97,107,98.
Therefore, we will investigate whether Notch pathway mechanisms regulate similar roles in stem
and lineage characteristics of glioblastoma stem cells.
2.2 Results
2.2.1 Primary Patient Glioma Express Notch Receptors and Ligands
Studies have illustrated Notch receptor expression in bulk brain tumors121 and therefore we
initially validated Notch receptor and downstream pathway expression in our primary patient
samples. Semi-quantitative PCR of mRNA isolated from bulk primary patient tumors shows that
glioblastoma express Notch1, Notch2 and Notch3 receptors. Immunohistochemistry in paraffin
embedded primary patient tumor samples and scoring for nuclear localization show that all
![Page 34: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/34.jpg)
21
tumors express nuclear Notch1 (15/15), 83% (26/31) express nuclear Hes1 protein and 87%
(27/31) express Hes5 protein (Figure 2-1).
![Page 35: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/35.jpg)
22
Figure 2-1
Notch components are expressed in primary patient tissue. RNA was isolated from unsorted
primary tumor tissue. A) Patient 144 and Patient 179 express Notch1, Notch2, Notch3, Jagged1
and Hes1 by semi-quantitative RT-PCR. B,C,D) Representative immunohistochemistry from
Patient 309 illustrating nuclear localization (brown) of Notch1, Hes1 and Hes5 in paraffin
embedded bulk tumor tissues. Primary patient samples were 4% paraformaldehye fixed and
paraffin embedded. Localization of protein expression was resolved with peroxidase staining
and counterstained with hematoxylin.
![Page 36: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/36.jpg)
23
2.2.2 Adherent Cancer Stem Cell Cultures are Highly Homogeneous and Express Primitive Stem Cell Markers.
Since we have identified Notch pathway component expression in at least a few bulk tumors, we
were then interested to study the pathway in more detail in the cell population, which drives
tumor growth. To obtain enriched populations of cancer stem cells from human glioblastoma,
we needed to turn to culture systems, particularly those that retain tumorigenic potential in vivo.
One of the potential methods to study this population is the neurosphere culture system. While
an important tool that has been used since the mid 1990’s, neurosphere culture have limitations.
Neurospheres culture conditions do not support the long term growth of tumor cells and tend to
lose replating activity after 5 passages, limiting their usefulness for many mechanistic studies. In
addition, due in part to the complex three-dimensional aspect of sphere colonies, more
differentiated cells are localized to the nutrient deficient and spatially restricted centre while
primitive stem-like cells are favored at the nutrient accessible and spatially unrestricted surface
of the colony156. Therefore spheres contain mixed cell populations and cannot be considered as
pure cancer stem cell cultures. To circumvent these technical limitations, we cultured freshly
dissociated glioblastoma samples on laminin/poly-L-ornithine coated surfaces. The cells, grown
in 2D culture, have a much higher degree of morphologic and phenotypic homogeneity, reduced
spontaneous cell death and a greater success rate forming cell lines in-vitro with long term
passage potential157. In contrast to neurosphere cultures, NS cultures contain few cells that
express markers of differentiation like β-III-Tubulin (βIIIT) and express high percentages of
primitive markers such as CD133, CD44, CD15130, Nestin and Sox2 (Table 2-1) (Figure 2-5).
GFAP is expressed at low levels, perhaps highlighting its role as both a neural stem cell marker
in addition to marking differentiated astrocytes60. The adherent culture system therefore is an
excellent tool to asses the genomic and functional differences that exist between normal neural
stem cells and glioblastoma stem cells. Indeed, while the NS system is permissive for
homogeneous stem cell cultures each line retains some unique characteristics such as cell
morphology, primitive marker expression signature and lineage marker expression upon
differentiation. Relative to human fetal neural stem cells, glioblastoma stem cells often have
abnormal nuclear morphology and exhibit varied cell morphologies ranging from bipolar
(G179NS) to flat (G144NS). Each glioblastoma NS line exhibits a unique profile in flow
cytometry reflecting diverse differences in cell size, granularity and surface marker expression
![Page 37: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/37.jpg)
24
(Fig 2-5), (Table 2-1). Additionally, each line exhibits fundamentally unique characteristics
upon in-vitro differentiation (Supplementary Figure-1), rates of in-vivo tumorigenesis and
histologic appearance157.
Since we have a robust and versatile system to expand cancer stem cells, we can characterize
glioblastoma stem cells and identify factors that sensitize these cells to pharmacologic
intervention and other forms of treatments.
Stem Cell
Line
CD133(%) CD15(%) CD44(%)
HF240NS 98.1±1.6 13.6±4.8 94.0±10.8
G144NS 74.8±13.6 8.1±7.6 91.4±16.6
G179NS 65.4±18.4 57.0±21.9 90.8±12.8
GliNS1 94.7±2.9 82.1±22.5 n/a
Table 2-1
CD133/CD15/CD44 percentage cell populations in established NS lines. Glioma NS lines are
highly enriched for CD133 relative to neurosphere cultures. Mean expression of CD133 from
NS lines is 78.3±14.9%, a significant enrichment over 18.3±22.6% found in unmatched
neurospheres (n=3). Interestingly, other markers such as CD15 demonstrate marked variability,
underscoring the heterogeneity between tumors. n/a = not assayed.
![Page 38: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/38.jpg)
25
Figure 2-2
Glioblastoma stem cell lines express stem cell markers and exhibit morphologic
heterogeneity. Nestin and Sox2, primitive markers commonly expressed in stem cells, are
expressed when cultured with EGF/FGF. Immunofluoresence staining of cells shows filamentous
cytoplasmic Nestin and nuclear Sox2. Quantitative FACS demonstrates the variability of CD133
and CD15 expression among cell lines. Scale bar 50μm
![Page 39: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/39.jpg)
26
2.2.3 Tumor Precursor Lines Express Notch Receptors and Ligands
Since expression of Notch receptors and ligands in bulk tumor tissue may not be representative
of the primitive stem like population, we conducted RT-PCR to assay for receptor and ligand
mRNA expression. Expression by semi-quantitative PCR showed that both human fetal
(HF240NS, HF286NS, HF289NS) and tumor (GliNS1, G166NS, G179NS) lines express Notch1,
Notch2 and Notch3 receptors as well as the Jagged1 ligand. The downstream target Hes1 was
expressed in all lines. Interestingly, Hes5 was expressed in HF240NS, HF286NS, HF289NS,
and G179 but was detected in low abundance in GliNS1 and G166NS. We have demonstrated
that Notch components and downstream targets are expressed in glioblastoma NS lines
suggesting that the pathway is active and may have a role in regulating CSCs.
![Page 40: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/40.jpg)
27
Figure 2-3
Semi-quantitative RT-PCR of Notch components in human fetal stem cell and glioblastoma
stem cell lines. All lines express Notch1, Notch2, Notch3, Hes1 and Jagged1. Hes5 is detected
in HF240NS, HF286NS, HF289NS and G179NS. Hes5 is expressed in low abundance in
GliNS1 and G166NS.
![Page 41: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/41.jpg)
28
2.2.4 Notch receptors are activated in Glioma NS lines
We have shown that Notch 1-3 transcripts are expressed in human NS lines. To further delineate
the functional relevance of Notch expression in cancer stem cells, we probed receptor expression
by immunofluorescence staining of the various glioblastoma stem cell cultures. Of the four
mammalian Notch homologues, data from the literature has shown that Notch1 is critical in the
maintenance of murine NSCs. Hitoshi and colleagues demonstrated that Notch1-/- murine
forebrains were incapable of forming neurospheres and that forced expression of NICD1 was
sufficient to rescue NSC self-renewal73. Therefore, we looked for Notch1 receptor activation
and nuclear localization with immunofluorescence microscopy in HF240NS, G144NS and
G179NS lines. We first validated our antibodies with EDTA induced constitutive Notch
activation14 and also with ectopic expression of activated Notch138 (Figure 2-9) by looking for
nuclear localization of activated Notch1. Under proliferative conditions with EGF/FGF,
glioblastoma lines demonstrate a high percentage of activated Notch1 positive nuclei (Figure 2-
4). Scoring random fields of nuclei double positive for DAPI and NICD1, HF240NS was
89±7%, G144NS was 87±3% and G179NS was 91±8% positive. G144NS, which contains
multinucleated cells, demonstrated positive staining in all nuclei. NICD1 negative cells, a
minority in these stem cell cultures, were often morphologically indistinguishable from the
NICD1 positive cells and occured in low cell density and high cell density areas. Importantly, at
lower cell densities, cells would also express NICD despite appearing to lack contacts with
adjacent cells, indicating that expression was cell autonomous, at least in part, not dependent on
contact with neighbouring cells. Since immunocytochemistry is a snapshot of fixed and
permeabilized cells, these observations may suggest that NS cells are capable of cell autonomous
self Notch activation. Another possibility is that due to motility, these cells were activated by
transient contact with other cells before the fixation.
![Page 42: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/42.jpg)
29
Figure 2-4
Nuclear localization of activated Notch1 in human fetal and glioblastoma stem cell lines.
Endogenous activated Notch1 can be detected in fixed cultures by immunofluorescence staining.
Consistent with the mechanism of Notch activation, the fluorescent signal is localized to the
nucleus. Scale bar 100μm.
![Page 43: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/43.jpg)
30
2.2.5 Notch Pathway antagonism decreases cell proliferation.
We have shown that NS lines express mRNA of Notch components and show nuclear
localization of the activated Notch1 receptor. Since Notch has a fundamental role in murine self
renewal, we hypothesize that blockade of Notch signals will reduce glioblastoma stem cell self
renewal and cell proliferation. Utilizing a pharmacologic inhibitor of Notch, we challenged
glioblastoma stem cell lines with an effective γ-secretase inhibitor L-685,458. We previously
demonstrated that this compound is more effective than the γSI DAPT158 in reducing the sphere
forming ability of human fetal neurospheres (Supplementary Figure-2).
Culture of glioblastoma stem cell lines and a control human fetal neural stem cell line with γSI
induced dose dependent reductions in proliferation that could be monitored by the reduction of
tetrazolium (MTT) into insoluble formazan crystals by mitochondria in active cells. Averaged
together, NS lines exhibited a mean EC50 of 4.6±2.5μM which is over 9-fold lower than that of
the cell line U87 (EC50=40.6μM), a serum cultured glioma line documented to have growth
regulated independently of Notch signaling134 (Figure 2-5). Of five NS lines profiled (G144NS,
G179NS, GliNS1, G174NS, and G166NS); G174NS was the most sensitive line with an EC50 of
0.9μM. G179NS possessed the highest EC50 of 7.4μM.
Since mitochondrial metabolism may not always adequately reflect cell numbers in-vitro, we
utilized real-time microscopy to observe the effect of Notch inhibitor in real-time. Consistent
with MTT, GliNS1 treated with γSI underwent fewer cell divisions compared with control.
Using an Incucyte video microscope (Essen Bioscience), we measured the surface area of the
microscope field occupied by cells. Automated tracking software determined that glioblastoma
stem cells cultured with vehicle achieved 43% confluence in 16 days. These control cells were
highly motile and made contact with adjacent cells over the course of the observation period.
The high motility may explain the activity of Notch signaling among cells apparently lacking
ligand presenting partners. In contrast, cultures plated at an identical starting density in 6μM or
10μM γSI achieved 25% and 18% confluence respectively in the same period of time. GliNS1
treated with γSI adopted a dramatic change in cell morphology and motility. After 7 days in
culture, the cells became less motile and projected bipolar processes. After 14 days, the
morphologic changes in the cells were more dramatic, the cells aggregated into adherent
spheroid colonies and extended long filamentous processes that resembled the axons of mature
![Page 44: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/44.jpg)
31
neurons (Figure 2-6). Thus, the presence of γ-secretase inhibitor definitively reduced cell
proliferation and induced morphologic cell changes resembling differentiation.
We have demonstrated the efficacy of pharmacologic inhibitors in modulating glioblastoma stem
cell proliferation and altering cell morphology. γ-secretase is responsible for processing several
cell surface receptor proteins. A few of the characterized targets are Notch, CD44159, ErbB4160
and Ryk161. To investigate the possibility that we were more strongly affecting other γ-secretase
dependent cell surface receptors, we used a more specific molecular targeting strategy to block
Notch signaling downstream of the γ-secretase stage of the pathway by inhibiting the RBP-jK
activation complex. Mastermind-like 1 (MAML) is a crucial co-activator in the binding
interaction between NICD and RBP-jK162,163. We used a dominant negative variant of this
protein (a generous gift from Dr. Jon Aster). As a pan-Notch inhibitor, Dominant Negative-
MAML (DN-MAML) binds activated Notch but is unable to assemble the transcriptional
activation unit with RBP-jK. GliNS1 transfected with DN-MAML-GFP and sorted for viable
GFP positive cells were cultured in NS conditions to probe the effect of DN-MAML on doubling
time and confluence. Tracking transfected cells by Incucyte over a period of 14 days showed a
proliferative impairment conferred by Notch blockade (Fig 2-7). GFP sorted vector control cells
approached 63% confluence whereas DN-MAML transfected cells reached 23% confluence in
the same 16 day observation period. Here, we have shown that pharmacologic antagonists of the
γ-secretase complex and downstream dominant-negative pathway specific inhibitors induce a
robust blockade of glioblastoma stem cell proliferation in vitro.
![Page 45: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/45.jpg)
32
Figure 2-5
Dose response analysis of NS lines cultured for 7 days with γSI. A) Structure of L-685,458, a
potent γ-secretase inhibitor which acts as a transition state analogue in the catalytic region of the
holoenzyme. B) All cell lines demonstrate sensitivity to low doses of γSI in proliferation assays.
Average EC50 for all NS lines is 4.6±2.5μM. The EC50 for U87, a serum derived glioma line
that does not possess stem cell characteristics is 40.6μM.
![Page 46: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/46.jpg)
33
Figure 2-6
γSI inhibits growth and alters cell morphology of GliNS1 A) GliNS1 was cultured for 18
days with 6μM γSI. Day 18 culture with 6μM γSI illustrates bipolar morphology and axon-like
processes. Scale Bar 200μm. B) Proliferation of cells is inferred from combined cell surface
area and expressed as a percentage of maximum confluence. 6μM γSI for days impairs growth
of GliNS1 by a factor of 0.58.
![Page 47: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/47.jpg)
34
Figure 2-7
GliNS1 dominant-negative Mastermind-like1 Notch antagonism prevents cell proliferation.
Representative growth curve of DN-MAML-eGFP transiently transfected glioblastoma stem
cells that were machine sorted for GFP. DN-MAML transfected GliNS1 cells proliferate slower
compared to vector transfected eGFP sorted control. Note that the inflections in the curve at 240
and 320 hours are artifacts of growth media replenishment.
![Page 48: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/48.jpg)
35
2.2.6 γ-Secretase inhibitor prevents activated Notch1 nuclear localization and inhibits the propagation of canonical Notch signal transduction.
Since the Notch pathway is active in glioblastoma stem cell cultures (G-NS lines) as
demonstrated by nuclear staining of activated Notch1, we blocked pathway activation by
targeting the γ-secretase complex critical for receptor activation, and demonstrated reduction in
cell proliferation and alteration in cell morphology. In proliferating conditions with EGF/FGF,
normal human fetal NS cell lines and glioblastoma NS lines exhibit punctuate nuclear
immunoflourescence staining pattern when using antibodies specific for activated Notch1. This
staining pattern may be indicative of transcriptionally active sub-nuclear bodies164.
To determine if the reduction in proliferation was due to specific effects on Notch signaling, we
conducted experiments using the inhibitors together with rescue of signaling with downstream
pathway activation. The number of cells that exhibit this activated Notch1 staining pattern was
reduced by 3-fold in HF240NS and G144NS cells cultured in the γSI L-685,458165 for 24hrs
(Figure 2-8AB) to 3 weeks (Figure 2-8CD). This reduction in numbers of positive nuclei is
restored under conditions which promote ligand independent activation, with transduction of the
cells with NICD1 (Figure 2-9). A third cell line, GliNS1, which demonstrates ubiquitous
activation of Notch1 in 95±7% of cells was reduced to 35±22% upon 12hr γSI treatment.
Transfection of NICD1 restored immunoreactivity in 100% of cell nuclei (Figure 2.9 and Figure
2.10).
Canonical Notch pathway components Hes1 and Hes5 were examined by quantitative PCR after
treatment with γSI. While all of the cell lines profiled demonstrated significant reductions in
Hes5 transcript expression after a 10 day exposure, only some of them demonstrated significant
reductions in Hes1 expression (Supplemental Figure-4). Hes1 was undetectable in G174NS, the
cell line most sensitive to γSI in proliferation assays and reduced by approximately 50% in
G166NS. However, Hes1 expression was not affected by antagonist in G179NS or HF240NS.
We examined downstream signaling more closely in GliNS1. Hes5 and Hes1 transcript
expression was robustly diminished more than 20-fold and 6-fold respectively when cultured
with a 24h exposure to γSI (Figure 2-12A). Further, the proneural downstream target of Hes
transcription factors, Ascl1 (Mash1), is increased 4.7-fold with γSI. This finding suggests that
![Page 49: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/49.jpg)
36
the canonical Notch-Hes axis that functions to prevent neuronal differentiation is intact at least in
some glioblastoma stem cell cultures and may serve a role in maintaining a more proliferative
primitive stem cell state. Forced expression of NICD1 in GliNS1 induced a 5-fold increase in
Hes5. Surprisingly, ectopic NICD1 did not significantly increase Hes1 beyond exogenous
expression (Figure 2-12B). This data may suggest that transcription of Hes genes are regulated
independently of each other and that each gene may require a different repertoire of co-activators
that, in this context, may function as a limiting reagent for Hes1. It also suggests that Hes5 may
be the more critical Notch1 target in glioblastoma stem cell populations. Finally, Hes1 and Hes5
expression is protected by NICD1 when challenged by γSI. Hes1 and Hes5 expression is
unaffected by γSI when NICD1 is overexpressed, reinforcing observations that Hes genes are a
target of Notch downstream signaling.
We have demonstrated immunofluorescence localization of activated Notch in glioblastoma stem
cells, but immunoflorescence staining is difficult to quantify. Therefore, we also conducted
analysis by western blot. Using two different antibodies specific for the activated Notch1, we
demonstrate that signaling is abrogated in a dose dependent manner (G166NS). Consistent with
PCR analysis, Hes1 protein persisted in the presence of γSI (Figure 2-11). At the time of this
study, reliable antibodies for Hes5 are not available and therefore we are not able to quantify
Hes5 protein levels by Western.
We continued to recognize that pharmacologic antagonists can have off target effects. To
address this issue, GliNS1 was transiently transfected for DN-MAML-GFP and sorted for GFP+
cells two days post transfection. GFP positive cells had a significant 3-fold reduction in Hes1
and a 6-fold reduction in Hes5 by RT-PCR. There was a concurrent 2-fold increase in Ascl1
expression though this observation did not achieve statistical significance (Figure 2-12C).
Reduced Hes1 and Hes5 transcript expression was observed in all NS lines assayed with Hes5
being more sensitive to pathway blockade (Supplemental Figure 3).
The evidence that we have presented herein suggests that Hes signaling downstream of Notch1 is
active in glioblastoma stem cells. Furthermore, we have presented data to show that Hes5 is a
more specific indicator of Notch1 signaling in cultured glioblastoma stem cells. Hes5
demonstrates greater upregulation upon Notch1 activation and is more sensitive to Notch
blockade compared to Hes1.
![Page 50: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/50.jpg)
37
Figure 2-8
γSI treated cells have a reduction in nuclear activated Notch1. A) G144NS cultured with γSI
for 24hrs (n=3) demonstrates B) over 4-fold reduction in nuclear localization. C) HF240NS
(n=2) cultured with 10μM γSI for 3weeks demonstrate D) over 5-fold reduction in nuclear
localization. Scale bar 50μm. *t-test, P<0.005.
*
*
![Page 51: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/51.jpg)
38
Figure 2-9
Activated Notch1 nuclear localization can be blocked with γSI and rescued with NICD1 in
G144NS glioblastoma line. A&B) γSI robustly blocks intracellular processing and nuclear
localization of Notch1 in the tumor line G144NS after 24hrs of treatment. This is rescued with
ectopic NICD expression. Scale bar 100μm. C) Activated Notch1 is not detected despite
constitutive ligand independent activation with Ca2+ chelators. Scale bar 20μm. *t-test,
P<0.005.
* *
![Page 52: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/52.jpg)
39
Figure 2-10
Activated Notch1 can be blocked with γSI and rescued with NICD. Immunofluorescence
staining of GliNS1 illustrates punctuate nuclear staining with vehicle treatment in 95±7% of
cells. γSI treatment reduces this pattern of staining to 35±22%. NICD1 over expression protects
NICD1 nuclear localization from pharmacologic blockade. Scale bar 100μm. *t-test, P<0.05.
*
![Page 53: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/53.jpg)
40
Figure 2-11
Quantitative Western blot of Activated Notch1 in Glioma lines. A) Notch1 activation is
potently diminished at low concentrations of γSI in G166NS. B) Activated Notch1 protein can
be detected with two different antibodies when cultured in NS media containing EGF/FGF.
Blockade of Notch1 with 6μM γSI for 3 weeks in G166NS can be detected with Val1744
specific antibody and 8925. Despite γSI treatment, Hes1 protein persists.
A
B
![Page 54: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/54.jpg)
41
Figure 2-12
Downstream targets of activated Notch signaling are interrupted with Notch antagonism.
Quantitative RT-PCR conducted in GliNS1 glioblastoma line. A) Transcription of target
helix-loop-helix transcription factors are downregulated upon pharmacologic blockade. B)
Blockade can be circumvented by expression of activated Notch1. C) DN-MAML
downregulates Hes1 and Hes5 targets. * t-test, P<0.05
![Page 55: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/55.jpg)
42
2.2.7 Glioblastoma NS lines downregulate primitive markers in the absence of Notch signals.
We have demonstrated that γSI treated glioblastoma stem cell lines are less proliferative and
have reduced Hes5 expression. Of these treated lines, morphological changes with γSI Notch
blockade were most pronounced in GliNS1. Upon treatment with γSI, this line is characterized
by bipolar morphology and extension of cellular processes. We hypothesized that these cells
were no longer showing stem-like properties and were acquiring differentiated characteristics.
We examined expression of Sox2 and Nestin, markers of neural precursor cells, in four NS lines
treated with vehicle or 6μM γSI for 3 weeks (HF240NS, GliNS1, G166NS, G174NS). We
observed in all of the lines a reduction in nuclear Sox2 and cytoplasmic Nestin filaments by
immunostaining (Figure 2-13).
To demonstrate that these observations were specifically due to blockade of Notch, NICD1
stably transfected GliNS1 (GliNS1-NICD1) was treated with 6μM γSI in culture for 14 days.
GliNS1-Vector vehicle control treated cells are uniformly 99% Nestin/Sox2 double positive.
Upon γSI administration to GliNS1-Vector transduced cells, the Nestin and Sox2 double positive
cell population was abolished (0±1% double positive). Of all the vector transduced cells, 4±4%
were Nestin positive only, 18±18% of these cells were Sox2 positive only and the vast majority
(76±15%) was double negative for both stem cell markers. GliNS1-NICD1 vehicle control
treated cells showed Sox2 and Nestin colocalization in all cells (100±0%). In contrast to vector
controls, enforced NICD1 expression maintained coexpression of both Sox2 and Nestin in γSI
treated GliNS1 cells. 56±6% of cells examined were doubly positive for both primitive markers
demonstrating a rescue of a more primitive stem cell phenotype population (Figure 2-14).
Quantitative western blot of γSI cultures demonstrates that NICD1 protects Nestin expression in
GliNS1 cells. Thus, the existence of the stem like population in the GliNS1 glioblastoma cells
appears to be dependent in part on Notch1 signaling activity.
Rapid cell proliferation is often seen as a hallmark of cancer. To determine whether cell
proliferation was regulated by Notch, we examined whether NICD1 was capable of rendering
glioblastoma stem cells insensitive to the proliferative deficit caused by γSI. Proliferation of
G411NS was diminished to 53±12% of vehicle controls when treated with 7.5μM γSI for 5 days.
The same cells transfected with NICD1 were insensitive to the effects of γSI (99±11% of vehicle
![Page 56: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/56.jpg)
43
control) (Figure 2-15). We have demonstrated that Notch blockade causes glioblastoma stem
cells to loose stem cell marker expression. In normal neural stem cells and embryonic
development, Notch signals are known to be instructive for glial differentiation at the expense of
neurons7,166,82,81. We postulated that changes in cellular morphology following γSI treatment
may be secondary to neuronal lineage differentiation in response to diminished precursor signals.
![Page 57: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/57.jpg)
44
Figure 2-13
Nestin and Sox2 protein expression is reduced upon Notch blockade. A) GliNS1, B)
HF240NS, C)G166NS, D)G174NS lines have a robust decrease in Nestin and Sox2 protein
expression by immunocytochemistry when treated with 6μM γSI. Scale bar 100μm.
![Page 58: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/58.jpg)
45
Figure 2-14
Nestin and Sox2 expression in GliNS1 can be rescued with NICD1. A) Representative image
of GliNS1 pcDNA or NICD transfected cultured for 18 days with 6μM γSI. Nestin and Sox2
expression is retained in GliNS1-NICD1 upon γSI treatment. Scale bar 100μm. B)
Quantification of Nestin and Sox2 by cellular localization. C) Quantitative Western blot of
GliNS1 stably transfected with NICD and treated with γSI.
![Page 59: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/59.jpg)
46
Figure 2-15
NICD1 protects cell proliferation from γSI. MTT proliferation assay of G411NS
supplemented with 7.5μM γSI for 5 days. Proliferation of cells is protected by NICD1. Error
bars ± SEM. * p<0.05, t-test.
*
![Page 60: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/60.jpg)
47
2.2.8 Notch blockade promotes neuronal lineage differentiation
To determine whether glioblastoma stem cells are differentiating because of Notch signaling
blockade, we studied the expression of astrocytic (GFAP) and neuronal lineage (β-III-tubulin)
markers of differentiation in a human fetal NS line and 9 glioblastoma stem cell lines after 2
weeks of treatment in 5μM γSI compared to vehicle controls. At the end of the culture period,
cells were examined for marker expression by immunofluoresence. We quantified expression of
lineage markers by sampling random fields and scoring cells as β-IIIT positive, GFAP positive
or both. Under vehicle control conditions with EGF/FGF, GFAP positive cells are detected in
9/10 stem cell lines. GFAP is protein that marks dual populations: labeling stem cells and also
identifying differentiated astrocytes. In 4/10 cell lines, β-IIIT positive cells can be detected as a
minority population in vehicle treated cultures. The G-NS line with the most numerous cells
acquiring spontaneous neural marker expression is 377NS with 26±13% of cells positive with β-
IIIT. The relatively low expression of neuronal markers in most G-NS lines demonstrates that
EGF and FGF culture conditions maintain a primitive cell phenotype. Supplementing γSI to
EGF/FGF growth conditions, the majority (7/10) of cell lines downregulated GFAP after two
weeks. 5 of 10 lines demonstrated an increase in β-III-tubulin immunoreactivity compared to
vehicle treated cells (HF240NS, G144NS, GliNS1, G377NS)(Figure 2.17). In the remaining
50%, β-IIIT expression was not affected (G166NS, G179NS, G174NS, G361NS, G362NS)
(Figure 2.16). In this group of ‘non-neurogenic’ cells, 3/5 lines downregulated GFAP suggesting
that Notch blockade has functional consequencecs on either the GFAP positive primitive cell or
impacts the astroglial cell fate choice. Very rarely were cells double positive for neuronal and
glial markers in any line. Since Notch is known to be a pro-glial and anti-neuronal stimulus
during developmental, we have demonstrated that some glioblastoma stem cells maintain a
responsiveness to Notch signals that recapitulates neural development.
Since GliNS1 is well characterized157 and demonstrates the highest induction of neuronal lineage
differentiation in response to γSI, this line was chosen for further study. To test our hypothesis
that Notch signaling regulates cell fate decisions in brain tumor stem cells, we transduced
GliNS1 glioblastoma stem cells with NICD1 (or empty vector) and grew the cells in stem cell
conditions with γSI. Consistent with previous results, vector transfected GliNS1 exposed to γSI
increased the numbers of cells showing β-III-tubulin expression by 9-fold (8.5±9.5% vs
![Page 61: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/61.jpg)
48
73.1±7.6%) compared to vehicle treatment and GFAP expressing cells were reduced (10±7% vs
0±0%). Forced expression of NICD1 in vehicle treated GliNS1 cells induced a 5-fold increase in
numbers of GFAP positive cells (10±7% vs 56±22%). Ectopic expression of NICD1 in γSI
treated cells increased the numbers of GFAP (27±7% vs 0±0%) cells and suppressed β-IIIT
(28±13% vs 68±1%) expression compared to vector transfected γSI treated cells, demonstrating
that activated Notch is contributes to the maintenance of a primitive GFAP positive phenotype in
GliNS1 (Figure 2-18). Since transfected cells may be heterogenous with respect to copy number
and transgene expression, some cells may remain sensitive to Notch inhibition.
We then demonstrated that the neuronal lineage commitment was specific to Notch signaling
using DN-MAML. We transfected glioblastoma lines with DN-MAML-GFP and tracked cell
fate for a period of 3 weeks. G144NS and GliNS1, two lines that were observed to exhibit
neuronal differentiation with γSI, were transiently transfected. Cells that maintained DN-
MAML-GFP expression over the observation period acquired neuronal lineage markers and
never expressed GFAP. To contrast these observations, a cell line that did not acquire neuronal
markers with γSI (G166NS), was not positive for neuronal markers in DN-MAML-GFP cells
(Figure 2-19). We have demonstrated that patterns of neuronal marker expression between
different NS lines can be recapitulated with DN-MAML expression, but not all patient derived
glioblastoma stem cell cultures show this ability to generate β-III-Tubulin+ cells with Notch
signaling blockade.
Ultimately, we have demonstrated that blockade of Notch, both at the receptor cleavage and
downstream transcriptional activation is effective in reducing GFAP expression in most (7/10)
cell lines and significantly increases β-III-tubulin expression in 50% (5/10) of cell lines. Herein,
we will refer to HF240NS, GliNS1, G144NS, G377NS and G362NS as ‘neurogenic’ reflecting
the propensity to express neuronal lineage markers in response to Notch antagonism. We will
refer to G166NS, G179NS, G174NS, G361NS and G364NS as ‘non-neurogenic’ to reflect their
resistance to neuronal lineage differentiation in the absence of Notch pathway activation.
Differences between tumor responses to Notch blockade raise the question of whether we are
inducing more mature neuronal differentiation. Further, can the genetic factors which
distinguish neurogenic versus non-neurogenic properties be identified and what are the
functional implications of this observation?
![Page 62: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/62.jpg)
49
Figure 2-16
50% of stem cell lines do not express markers of neuronal lineage differentiation with
pharmacologic Notch blockade. Cell lines were cultured for 2 weeks with 5μM γSI. Cells
were scored as GFAP+, β-IIIT+, or double positive by sampling random fields and visually
localizing marker expression. Scale bar 100μm.
![Page 63: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/63.jpg)
50
Figure 2-17
50% of stem cell lines express markers of neuronal lineage differentiation with
pharmacologic Notch blockade. Cell lines were cultured for 2 weeks with 5μM γSI. Cells
were scored as GFAP+, β-IIIT+, or double positive by sampling random fields and visually
localizing marker expression. Scale bar 100μm.
![Page 64: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/64.jpg)
51
Figure 2-18
NICD1 blocks glial marker expression induced by γSI Notch blockade in GliNS1. i) GliNS1
cells have low basal expression of GFAP and β-IIIT lineage markers. ii) γSI induces neuronal
lineage marker expression in vector transduced cells. iii) NICD1 expression in vehicle treated
cultures upregulates GFAP expression. iv) NICD1 transfected cells treated with γSI express both
GFAP and β-IIIT markers. Quantification by random field cell counting shows that NICD1
renders GliNS1 cells less sensitive to the neurogenic effect of γSI. Scale bar 100μm. Error bars
± SEM.
![Page 65: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/65.jpg)
52
Figure 2-19
DN-MAML Notch blockade induces β-IIIT expression in neurogenic NS lines. GliNS1 and
G144NS neurogenic stem cell lines co-express neuronal lineage markers when transfected with
DN-MAML for 21 days. DN-MAML-GFP GliNS1 do not express glial markers. White
arrowheads are indicative of DN-MAML/β-IIIT double positive cells. G166NS non-neurogenic
line, does not co-express neuronal markers in DN-MAML positive cells. Scale bar 50μm.
![Page 66: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/66.jpg)
53
2.2.9 Neuron like cells are negative for neurotransmitter synthesis genes
Functional neurons can be defined as cells expressing neuronal lineage markers167,
neurotransmitters & neurotransmitter receptors168 and displaying electrophysiological
properties169. We speculated that in-vitro blockade of Notch signals induces functional neuronal
lineage differentiation in neoplastic cells. Since β-III-tubulin is a primitive marker of early
differentiated neurons, we investigated whether Notch blockade can induce the expression of the
mature neurotransmitter receptors, that identify more mature neuronal subtypes, upon neuronal
differentiation170. Using GliNS1, the NS line with the greatest increase in β-III-tubulin positive
cells induced by γSI, we profiled the expression of receptors from the muscarinic, cholinergic,
dopaminergic, glutamatergic and GABA receptor subclasses. After a two week exposure to 6μM
GSI, none of the receptors we profiled were increased in their expression. On the contrary, many
of the neurotransmitter receptors (6/8) across several different classes had significantly
diminished mRNA expression (M3, CHRNA9, GARB2, Gria1, Gria4). The change in gene
expression was most pronounced in CHRNA9 and Gria1 with an undetectable and 10-fold
reduction respectively in gene expression compared to controls. For two receptors, DRD2 and
Gria2, gene expression was unchanged (Figure 2-20). It is possible that the “differentiated”
glioblastoma stem cells reflect additional neurotransmitter subclasses that we did not analyse.
We also did not exhaustively test for other markers that are associated with differentiated
neurons. Another critical point is that a full differentiation may not be possible in neoplastic
cells, which have many genetic and epigenetic alterations affecting cell behavior.
The results presented here show that neurotransmitter receptors are not expressed in γSI treated
cultures. Berninger et al, demonstrated that murine neurospheres differentiated into neurons with
growth factor withdrawal and BDNF administration acquired a default GABAergic neuron fate
in standard differentiation conditions that was reinforced with expression of Mash1171. How is it
then, that our cells do not express these markers? In our experiments, we have differentiated
cancer stem cells with γSI over the course of 7-21 days. In the experiments conducted by
Berninger and colleagues, they demonstrated that murine neural stem cells only demonstrate
functional GABAergic activity in periods between 21-28 days. Murine NS lines are able to
differentiate in 7-12 days172 versus 21-28 days required for human NS line differentiation173.
Therefore, considering that murine models often demonstrate faster growth and differentiation
![Page 67: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/67.jpg)
54
kinetics, it may be possible that human models of neuronal differentiation may also require
longer periods of maturation.
![Page 68: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/68.jpg)
55
Figure 2-20
GliNS1 neurogenic line downregulates neurotransmitter receptors upon Notch blockade.
A panel of neurotransmitter receptors was examined in neurogenic GliNS1 to evaluate neuronal
differentiation. Neurotransmitter receptors are predominantly downregulated when cultured with
γSI for 14days. Quantitative RT-PCR normalized to β-Actin. Error bars ± SEM. t-test,
**P<0.0001, * P<0.05.
![Page 69: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/69.jpg)
56
2.2.10 Hierarchical clustering of signaling pathway genes reveals differential expression of Notch components between tumor lines.
We have shown 44% (4/9) of glioblastoma stem cell lines in EGF/FGF respond to Notch
blockade by upregulating β-III-tubulin protein expression and 56% (5/9) downregulate GFAP
expression without upregulating of β-III-tubulin under the same conditions. Since Notch is
known to regulate lineage choice in neural stem cells, we examined whether patterns of Notch
pathway expression in populations of glioblastoma stem cells may predict the propensity for a
particular line to undergo neuronal lineage differentiation and thus reveal clinically relevant
glioblastoma subtypes. We conducted an analysis of pathway expression data from human fetal
NS lines, glioblastoma NS lines and human adult non-neoplastic cortical resections. Compiling
a list of known stemness genes, canonical and non-canonical Notch pathway elements, we
conducted complete linkage hierarchical clustering analysis using the program Cluster174.
Dendrogram and heat-map plots (Figure 2-21) demonstrate that signaling pathway components
expressed in nine adherent precursor cultures contrast greatly with non-neoplastic adult human
cortex (Figure 2-6BC). Human cortical samples originate from resections of fully differentiated
tissues. Canonical Notch pathway components often associated with stemness (Notch1 and
Hes1) were decreased relative that of NS lines. Cortical samples expressed Notch components
associated with terminal differentiation such as Jagged2 and negative regulators of Notch
signaling such as Numb and Numblike. The expression of Jagged2 in human cerebral cortex and
not precursor cultures is consistent with murine studies showing that the expression of this ligand
is restricted to more differentiated areas of the brain78. To contrast cortical samples, normal and
glioblastoma stem cell lines have high relative expression of Notch2, Hes1 and Jagged1; genes
associated with stemness. Numb and deltex1, known negative regulators of Notch175,176,177 are
relatively under expressed in both normal and glioblastoma NS lines compared to cortical
samples. Notch4, Jagged2, MAML2-3 and HeyL were enriched in cortical samples and indeed,
these components are not known to have defined functions in normal or cancer stem cells.
Interestingly, hierarchical clustering identifies two distinct sub-groups within NS lines. The first
cluster includes all the human fetal lines (HF240NS, HF289NS and HF286NS), GliNS1, GliNS2,
and G144NS. This group includes the class of cell lines which we have previously defined as
‘neurogenic’ based upon the ability to express β-IIIT without Notch signals. The second cluster
included three glioblastoma lines and consisted of G166NS, G179NS and G174NS. This group
![Page 70: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/70.jpg)
57
consisted of cells, which we have previously defined as non-neurogenic based on the inability to
express β-IIIT. To distinguish the genes that differentiated these two groups, inspection of the
heat-map reveals a cluster of genes that were exclusive to neurogenic lines. Notch1, Ascl1
(MASH1) and Dll3 are all highly expressed in neurogenic lines compared to cortical samples and
non-neurogenic lines. Consistent with the transcriptome analysis, Ascl1 expression by real-time
PCR was highest in GliNS1 with over 24-fold expression compared to G179NS, the NS line that
expressed the least amount of Ascl1 (Supplementary Figure-5). One Notch target gene, Hey2,
was exclusive to neurogenic tumors only and was relatively under expressed in HF240NS
despite clustering with the other neurogenic lines. Interestingly, β-IIIT (TUBB3) mRNA is
highly expressed in neurogenic lines. The relative abundance of this transcript but lack of
protein expression with EGF/FGF could indicate that neurogenic lines are primed to differentiate
in the appropriate conditions.
We have demonstrated that Notch component gene expression in-vitro can classify glioblastoma
stem cell lines into two distinct groups. Furthermore, this classification recapitulates the
functional classification based on lineage outcome upon Notch antagonism. Therefore, evidence
presented here strongly supports the hypothesis that lineage potential of glioblastoma stem cell
lines can be predicted via analysis of gene expression. Furthermore, these data raise an
important potential therapeutic question. Can we identify a subset of patient derived populations
of glioblastoma stem cells that may show the potential to differentiate in response to
manipulation of Notch signaling?
![Page 71: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/71.jpg)
58
Non-Neurogenic
Non-Neurogenic
![Page 72: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/72.jpg)
59
Figure 2-21
Hierarchical complete linkage clustering data of Notch pathway genes from 9 NS lines and
5 samples of non-neoplastic human cortex. A) Differences in gene expression between
neurogenic and non-neurogenic NS lines. B) Notch pathway genes, which are elevated in NS
lines relative to human cortex. C) Notch pathway genes, which are decreased in NS lines
relative to human cortex. Red and Green represent expression data higher and lower compared
to the median respectively. Black is median expression.
![Page 73: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/73.jpg)
60
2.2.11 Treatment of glioblastoma stem cells with γ-secretase inhibitor increases tumor latency.
We demonstrated that neuronal lineage differentiation of glioblastoma stem cell lines in-vitro can
be predicted based upon Notch pathway gene expression. To determine whether these neuron-
like cells possess reduced in-vivo self renewal or engraftment, we ex-vivo treated GliNS1
glioblastoma stem cells with 10μm γSI or vehicle for a period of 17 days and orthotopically
injected treated cells into forebrains of NOD/SCID mice (Figure 2-23A). Single cell suspensions
of 100,000 live cells, inspected for viability by trypan blue exclusion, robustly formed tumors in
vehicle control treated mice at a median survival of 90 days. Mice injected with ex-vivo treated
γSI cells still developed tumors but had a significantly (P=0.029, Logrank test) improved median
survival of 115 days, demonstrating that γSI treated cells have increased tumor latency (Figure 2-
23B).
G166NS, a non-neurogenic line that does not acquire neuronal markers, was treated ex-vivo to
determine whether these cell lines are responsive in-vivo in the same manner as the neurogenic
lines. After the ex-vivo treatment and in-vivo orthotopic injection, G166NS vehicle treated
injected mice had a median survival of 172 days, consistent with differential survival from
different patient derived glioblastoma stem cell lines. Mice that were injected with γSI treated
cells had a median survival of 215 days. These survival curves are not statistically significant
(P=0.34, Logrank Test) (Figure 2.25). Taken together these results indicate that neurogenic lines
treated with Notch inhibitors have reduced tumorigenicity or engraftment in-vivo whereas non-
neurogenic lines are not significantly affected, although the numbers in these experiments were
small.
To elucidate the molecular and cellular differences in the tumors that arise in vehicle and γSI
treated cells, we fixed and paraffin embedded the xenografted brain samples for analysis by
immunohistochemistry. Gross examination of the NOD/SCID brains after sacrifice did not
reveal significant phenotypic differences between vehicle and γSI treated tumors. Large frank
tumors of approximately equal size in both cohorts were found intracranially, possessed invasive
properties, and local areas of necrosis consistent with human glioblastoma. In-vivo BrdU labeling
of GliNS1 showed proliferative cells throughout the tumor with no apparent differences between
vehicle and ex-vivo γSI treated cells. Tumors arising from treated and untreated NS lines
![Page 74: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/74.jpg)
61
harbored foci of GFAP and Nestin positive cells. Some regions within the tumor arising from
γSI treated cells expressed β-IIIT, suggesting that a prior Notch blockade can specify lineage
commitment in the developing tumor. As not all the cells in the ex-vivo treated culture
differentiate into β-IIIT positive cells, we suspect that tumors may arise from the non
differentiated glioblastoma cells in the treated culture, or alternatively, that the differentiation is
lost without continued Notch blockade in-vivo. The formation of tumors demonstrates that cells
treated with Notch inhibitors maintain in-vivo self renewal and therefore ex-vivo Notch blockade
alone is insufficient to completely suppress tumorigenicity.
![Page 75: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/75.jpg)
62
Figure 2-21
GliNS1 ex-vivo treated with γSI and transplanted orthotopically. A) Cells were treated ex-
vivo for two weeks and transplanted orthotopically utilizing a sterotactic apparatus. B) Tumor
free survival of mice injected with 100,000 γSI treated cells was longer than mice injected with
100,000 Vehicle treated cells. Mean survival 115 days versus 90 days, p<0.026, Logrank Test.
C) Both vehicle and γSI treated cells are proliferative by BrdU incorporation and express glial
markers throughout the tumor. Tumors arising from γSI treated cells possess tracts of βIIIT
positive cells indicating lineage specification in the absence of continuous Notch blockade.
![Page 76: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/76.jpg)
63
Figure 2-22
G166NS ex-vivo treated with γSI and transplanted orthotopically form tumors in-vivo.
Median survival of vehicle control is 172 days versus 215 days for γSI treated. Logrank Test,
P>0.05.
![Page 77: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/77.jpg)
64
2.2.12 Gene expression between Responsive and Non-responsive NS tumor lines.
We have demonstrated that gene expression of Notch pathway and downstream components in
glioblastoma stem cells correlates with sensitivity to γSI induced neuronal differentiation. Since
there may be genes outside of the Notch pathway that confer γSI sensitive properties in
neurogenic lines, we compared gene expression of neurogenic versus non-neurogenic lines to
evaluate which genes, Notch inclusive, may contribute to neuronal lineage commitment in
glioblastoma. We conducted an unbiased principle component analysis of global gene expression
between the neurogenic group (GliNS1, HF240NS and G144NS) and non-neurogenic group
(G166NS, G179NS and G174NS). Using the data analysis program Partek, we identified genes
that were differentially expressed between the two groups. The analysis returned 1255 probe-
sets representing 879 unique genes with significant (p<0.05) differences between the two groups.
Amongst the most significant hits (Table 2-2), several are relevant to neuronal lineage
commitment and survival. Some are genes relating to mature neuronal phenotypes such as
NMDA receptor regulated-1 like (NARG1L). Expression of Glutamate Receptors (Grik4, Gria3,
Gria4) and γ-Aminobutyric Acid A-receptor α-5 (GABRA5), may explain why some lines are
predisposed to neuronal differentiation as expression of neurotransmitter receptors may prime
cells for neuronal differentiation. Ascl1, a gene studied in our original clustering analysis
(Figure 2-22), is highly elevated in neurogenic lines, as is β-III-tubulin and Sox4, a transcription
factor which is required for the survival of sympathetic neurons in the CNS178. Interestingly,
adenomatous polyposis coli (APC), a fundamental component of the Wnt signaling pathway is
highly expressed in neurogenic lines. This multidomain protein has a critical function in the
regulation of intracellular β-catenin and antagonizes the Wnt signaling pathway179. Our lab
(Brandon et al., unpublished data) and others180,161, 181,182 have demonstrated that activation of the
Wnt pathway is instructive for neuronal lineage differentiation in normal neural stem cells.
Therefore, global analysis of gene expression identifies neural lineage transcripts in neurogenic
lines that show a capacity to differentiate in response to Notch signaling blockade, but may
suggest other potential differentiation strategies.
![Page 78: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/78.jpg)
65
Gene TitleGene
Symbolp-value(GSI Response)
F(GSI Response
)Transcribed locus --- 1.83E-09 574.575RNA binding motif protein 47 RBM47 9.28E-09 398.066periplakin PPL 3.47E-08 294.867secreted protein, acidic, cysteine-rich (osteonectin) SPARC 3.56E-08 293.088asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltran ALG2 6.88E-08 252.083sterile alpha motif domain containing 9-like SAMD9L 8.65E-08 239.17cytochrome b-561 CYB561 9.34E-08 234.997sterile alpha motif domain containing 9-like SAMD9L 1.05E-07 228.714cytochrome b-561 CYB561 1.17E-07 223.117M-phase phosphoprotein 8 MPHOSPH 1.61E-07 207.161NMDA receptor regulated 1-like NARG1L 2.96E-07 180.051NMDA receptor regulated 1-like NARG1L 7.97E-07 142.853glutamate-cysteine ligase, modifier subunit GCLM 3.63E-07 171.674glutamate-cysteine ligase, modifier subunit GCLM 7.21E-07 146.244SRY (sex determining region Y)-box 4 SOX4 7.66E-07 144.164tripartite motif-containing 38 TRIM38 8.89E-07 139.206SRY (sex determining region Y)-box 4 SOX4 6.79E-06 85.6508SRY (sex determining region Y)-box 4 SOX4 1.14E-05 75.5225SRY (sex determining region Y)-box 4 SOX4 1.71E-05 68.2453achaete-scute complex homolog 1 (Drosophila) ASCL1 3.09E-05 58.8635SRY (sex determining region Y)-box 4 SOX4 6.25E-05 49.1503achaete-scute complex homolog 1 (Drosophila) ASCL1 1.14E-04 42.0053bone morphogenetic protein 7 (osteogenic protein 1) BMP7 3.48E-04 31.0058vascular endothelial growth factor A VEGFA 3.50E-04 30.9578vascular endothelial growth factor A VEGFA 5.67E-04 26.9947adenomatous polyposis coli APC 1.39E-03 20.6991glutamate receptor, ionotrophic, AMPA 4 GRIA4 1.83E-03 18.9726neural cell adhesion molecule 1 NCAM1 1.96E-03 18.5867hairy/enhancer-of-split related with YRPW motif 2 HEY2 2.19E-03 17.9276NDRG family member 2 NDRG2 2.38E-03 17.4549NDRG family member 2 NDRG2 2.39E-03 17.4373glutamate receptor, ionotrophic, AMPA 4 GRIA4 3.68E-03 15.1217Notch homolog 1, translocation-associated (Drosophila) NOTCH1 4.20E-03 14.4563SRY (sex determining region Y)-box 4 SOX4 4.56E-03 14.0572CD44 molecule (Indian blood group) CD44 5.04E-03 13.577tubulin, beta 3 TUBB3 5.97E-03 12.7863adenomatous polyposis coli APC 6.13E-03 12.6638homeobox D10 HOXD10 6.22E-03 12.6011tubulin, beta 3 TUBB3 6.32E-03 12.5253adenomatous polyposis coli APC 6.61E-03 12.3268gamma-aminobutyric acid (GABA) A receptor, alpha 5 GABRA5 6.72E-03 12.2545tubulin, beta 2A TUBB2A 6.98E-03 12.0847transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) TCF3 8.28E-03 11.3453deltex 3 homolog (Drosophila) DTX3 8.30E-03 11.3367glutamate receptor, ionotropic, kainate 4 GRIK4 1.10E-02 10.1941glutamate receptor, ionotrophic, AMPA 3 GRIA3 1.14E-02 10.0244glutamate receptor, ionotrophic, AMPA 3 GRIA3 1.82E-02 8.28999solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 2.40E-02 7.34763SRY (sex determining region Y)-box 2 SOX2 2.40E-02 7.34339solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 2.51E-02 7.19198solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 3.68E-02 5.99641Notch homolog 2 (Drosophila) NOTCH2 2.20E-02 7.63262
F(γSI Response)
![Page 79: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/79.jpg)
66
Table 2-2
List of top 53 probe sets most significantly elevated in neurogenic NS lines compared to
non-neurogenic NS lines. Principal component gene analysis between neurogenic and non-
neurogenic cell lines reveals 879 genes that are significantly upregulated in neurogenic lines.
Genes are organized in order of significance.
![Page 80: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/80.jpg)
67
2.2.13 Activation of the wingless signaling pathway sensitizes glioblastoma stem cells to Notch blockade induced differentiation.
Notch signaling is known to regulate CNS development and neuronal differentiation in concert
with other pathways72. Some of these interactions are postulated to function in a regulatory
manner outside of a developmental context. Therefore, inhibiting Notch signaling combined
with activation of other developmental pathways in glioblastoma stem cells may induce a
synergistic response that may render CSC’s more sensitive to differentiation and inhibit self-
renewal. Notch and Wnt have collectively been implicated in the progression of intestinal
adenomas183, colon cancer184 and may crosstalk directly at several points in the signaling
pathway44,43. Existing reports have suggested LiCl inhibition of GSK3β may inhibit cancer stem
cell self-renewal in sphere assays185. Activation of the wingless pathway by administration of
exogenous Wnt ligands or pharmacologic inhibition of negative regulators (Brandon, Dirks et al,
unpublished data) has been shown to induce a neuronal lineage phenotype with upregulation of
downstream Wnt targets. Therefore, we postulated that blockade of Notch in concert with the
activation of Wnt may synergistically inhibit in-vivo growth of glioblastoma stem cells compared
to modulation of either pathway alone. We constitutively activated canonical Wnt signaling
using 6-bromoindirubin-3'-oxime (BIO)186, a potent inhibitor of GSK-3β. GSK-3β is a kinase
which phosphorylates activated β-catenin in the absence of pathway activation to facilitate
recognition by ubiquitin ligases and targeting by the proteosome51 (Figure 1-3).
Using BIO and γSI, we conducted a two-dimensional dose response analysis and assayed GliNS1
for neuronal (β-IIIT) or glial (GFAP) differentiation (Fig 2-26). After one week in culture, we
observed that γSI induced a dose dependent (0-10μM) bipolar morphology and β-IIIT expression
with a corresponding decrease of GFAP expression. Similar dose dependent (0-1μM)
observations were observed with BIO treatment. Combinations of γSI and BIO induced
significant morphologic changes and increased β-III-tubulin expression beyond levels of
individual treatments. 1μM γSI and 1μM BIO had the largest qualitative induction of neuronal
morphology and marker expression with a concurrent repression of astrocytic marker expression.
Therefore, we utilized these concentrations for further characterization of NS lines.
To examine whether synergistic treatment would promote neurogenesis in non-neurogenic lines,
we treated G166NS with a combination of γSI and BIO. The individual compounds and
![Page 81: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/81.jpg)
68
combination treatment were effective in reducing GFAP protein expression but did not increase
expression of neuronal markers upon 1μM BIO and/or 1μM γSI treatment (Figure 2-27). This
demonstrates that despite synergistic activation of Wingless and inactivation of Notch, non-
neurogenic lines remain resistant to neuronal lineage differentiation.
![Page 82: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/82.jpg)
69
Figure 2-23
γSI and BIO synergistically induce neuronal lineage differentiation in GliNS1. GliNS1 was cultured for 7 days with doses of γSI, BIO or a combination of the two compounds. Immunocytochemistry was conducted to visualize protein expression of neuronal and glial marker expression. Scale bar 100μm.
![Page 83: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/83.jpg)
70
Figure 2-24
Non-neurogenic line remains neuronal marker negative with Wnt activation and Notch
blockade. G166NS cultured for one week with 1μM BIO and/or 1μM GSI downregulate
astrocytic markers but do not upregulate neuronal lineage markers. Scale bar 100μm.
![Page 84: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/84.jpg)
71
2.2.14 Neuronal precursors treated with γSI and BIO are less proliferative.
Since neuronal lineage marker expression is prevalent in neurogenic lines treated with
combinations of γSI and BIO, we hypothesized that using dual pathway modulation to force
cancer stem cells into a growth restricted neuronal lineage may be a more viable strategy to treat
glioblastomas in patients. We therefore treated GliNS1 with 1μM γSI and/or 1μM BIO for 1-2
weeks and pulsed with BrdU 24hrs immediately prior to analysis to monitor cells progressing
through S phase. At one week, 46±21% of all cells in BIO/γSI combination treatment expressed
β-III-Tubulin. This was significantly greater than that of individual 1μM GSI (10±5%) and 1μM
BIO (22±10%) treatments alone. A low percentage of vehicle treated cells were β-III-T positive
(5±2%), reflecting the low levels of spontaneous differentiation inherent to the assay (Figure 2-
28). Continued treatment for two weeks increased neuronal marker expression, growth of
bipolar processes and a reduction of numbers of GFAP positive cells (Figure 2-29). 52±25% of
all cells expressed neuronal marker expression in combination treatment versus 1μM GSI
(7±6%), 1μM BIO (14±2%) and vehicle treatment (2±1%). The effect of the combination
treatment is greater than the sum of the individual compounds, suggesting that Notch signaling
inhibition, together with activation of Wnt signaling, synergistically promotes neuronal lineage
differentiation.
The level of BrdU incorporation in cells positive for neuronal markers is much lower than that of
marker negative cells. At one week of γSI/BIO combination treatment, 63±14% of all β-IIIT
positive cells are BrdU negative. At 2 weeks of treatment, 86±4% of β-III-Tubulin positive cells
are BrdU negative and only 7±2% of total cells were double positive. Thus neuronal precursors
expressing neuronal markers have significantly impaired ability to proliferate, which becomes
more pronounced with prolonged Notch/Wnt blockade. This supports the notion that cells with
committed neuronal character are more limited in proliferative potential.
Additionally, we examined expression of glial markers and BrdU incorporation with γSI and/or
BIO. At one week, most of the GFAP positive cells are also BrdU positive, suggesting that cells
at this stage are proliferating glial precursors. This population of cells is unaffected by 1μM γSI
or 1μM BIO but is dramatically reduced to 0±1% when treated with a combination of the two
compounds. At two weeks, individual treatments of γSI and BIO effectively reduce the small
![Page 85: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/85.jpg)
72
percentage (5±1%) of doubly positive GFAP/BrdU cells found in vehicle treated controls to
levels similar to that of combination treatment (Figure 2-29). Thus, combining the two drugs
synergistically diminishes the time required to force neuronal lineage differentiation.
Taken together we conclude that neuronal lineage differentiation may contribute to a
proliferative disadvantage found in neurogenic cell lines. An anti-proliferative effect of
Notch/Wnt modulators is observed in neurogenic lines is likely due to a growth restriction
imposed by cell type to and not due to non-specific toxicity, the proliferative disadvantage
conferred to non-neurogenic cell lines is less well understood. While there is a possibility that
the non-neurogenic lines are restricted due to non-specific toxicity, it is more likely that Notch
antagonists inhibit the proliferation of the glioblastoma stem cells but cannot also engage them in
differentiation as they are hypothesized to have a molecular defect in differentiation.
![Page 86: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/86.jpg)
73
Figure 2-25
Cells possessing neuronal characteristics are less proliferative. GliNS1 cultured with 1μM
γSI, 1μM BIO or both for 1 or 2 weeks and pulsed with BrdU for 24hrs prior to fixation and
immunofluorescence stain. Quantification was conducted by nuclear localization.
![Page 87: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/87.jpg)
74
Figure 2-26
BrdU positive glial precursors are reduced by combined γSI and BIO treatment. GliNS1
glioblastoma line was cultured with 1μM γSI or 1μM BIO and pulsed with BrdU for 24hrs. A)
At one week, most GFAP positive cells are BrdU positive and are eliminated with treated with
γSI and BIO. B) GFAP positive cells are reduced after two weeks of treatment.
A
B
![Page 88: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/88.jpg)
75
2.2.15 Notch antagonist and Wnt agonists synergistically reduce in-vivo engraftment and tumor growth.
We demonstrated that Notch and Wnt blockade synergistically induce neuronal lineage
differentiation, associated with lineage specific reduction in proliferation, therefore we tested
whether these cells have impaired engraftment or proliferation in-vivo. GliNS1 was treated ex-
vivo with vehicle, 1μM γSI, 1μM BIO or a combination of the two drugs for 1 week. We then
orthotopically injected viable cells into the brains of NOD/SCID mice. The median survival of
mice injected with vehicle treated cells in this experiment was 74 days, consistent with previous.
Treatment of cells with 1μM GSI had no difference in survival, as animal survived a median 68
days. Since we previously demonstrated an improvement in host survival when the cells were
treated with 10μm γSI, this data illustrates that a threshold concentration is required to abrogate
tumorigenicity. 1μM BIO treated GliNS cells engrafted had a median survival to 116 days. In
contrast, combination treatment with 1μM BIO and 1μM GSI synergistically and substantially
improved median survival to 182 days (P<0.05, Logrank Test), an improvement of over 2-fold
compared to vehicle treated cells (Figure 2-30A).
While GFAP marker expression is diminished, non-neurogenic lines do not acquire markers of
neuronal lineage commitment with synergistic Notch and Wnt modulation (Figure 2-27).
Nevertheless, we questioned whether synergistic treatment was sufficient to block in-vivo
engraftment and growth a representative glioblastoma cell line from this class of tumors.
G166NS vehicle treated cells injected into NOD/SCID mice had a median survival of 97 days.
1μM γSI and 1μM BIO alone treated cells had a median survival of 66.5 and 89 days
respectively. Treatment of cells with both compounds and orthotopic injection resulted in a
significant (P<0.05, Logrank Test) 1.3-fold increase in median survival to 127 days (Figure 2-
30B).
Comparison of frank tumors in H&E stained paraffin embedded sections shows large intracranial
tumors with brain invasion. Immunostaining of GliNS1-vehicle tumors showed GFAP and β-
III-Tubulin positive cells demonstrating at least some spontaneous differentiation in-situ,
potentially in response to the endogenous neurogenic and gliogenic factors that exist in the brain
milieu. Some GFAP and β-III-tubulin staining was observed in GliNS1-BIO and GliNS1-γSI
cohorts. Interestingly, and importantly, tumors arising from GliNS1-BIO-γSI combination
![Page 89: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/89.jpg)
76
treatment possessed large areas of β-III-tubulin staining suggesting persistent neuronal
differentiation after engraftment. We hypothesize that the more synergistic differentiation may
have lead to the increased survival of the dual modified cells. In addition, G166NS was also
stained for markers of differentiation. Consistent with results observed in-vitro, tumors arising
from these cells possessed very little β-III-tubulin immunoreactivity regardless of ex-vivo Notch
or Wnt modulation. Thus, the biases in lineage fates resulting from pathway modulation in-vitro
with dual pathway modification are preserved in-vivo in the absence of continued pharmacologic
modulation. Dual modification may more firmly lock cells into a differentiated sate that is
maintained cell autonomously after engraftment.
We have shown that a Notch antagonist and a Wnt agonist synergistically improve survival by
delaying tumor growth from both neurogenic and non-neurogenic glioblastoma groups. The
synergistic effect of γSI and BIO is greater in neurogenic tumors (2-fold) compared to non-
neurogenic tumors (1.3-fold), we hypothesize that this reflects the more limited proliferative
potential of glioblastoma cells that are directed into the neural lineage.
![Page 90: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/90.jpg)
77
Figure 2-27
Notch antagonists and Wnt agonists synergistically improve survival of mice injected with
ex-vivo treated cell lines. A) GliNS1 neurogenic line cultured ex-vivo with 1μM γSI and/or
1μM BIO for 1 week. Combination treatment significantly improves survival. Asymptomatic
animals were sacrificed after 270 days. p<0.05, Logrank Test. B) γSI and BIO synergistically
improve survival with G166NS. P<0.05, Logrank Test.
*
*
![Page 91: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/91.jpg)
78
Figure 2-28
GliNS1 glioblastoma NS lines treated ex-vivo with γSI, BIO or combination. Treatment of
tumor lines ex-vivo increases host survival. Examining the expression of lineage markers by
immunofluoresence shows an increase in neuronal marker expression in combined BIO+γSI
treated cells. Star marks the site of the frank tumor.
![Page 92: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/92.jpg)
79
Figure 2-29
G166NS glioblastoma NS line treated ex-vivo with γSI, BIO or combination. Treatment of
tumor lines ex-vivo increases host survival but does not affect gross morphology of tumors.
Non-neurogenic lines do not express neuronal lineage markers with γSI and BIO combination
treatment. Star marks the site of the frank tumor.
![Page 93: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/93.jpg)
80
2.3 Discussion Glioblastomas are a highly malignant and phenotypically diverse class of tumors demonstrating
remarkable heterogeneity from patient to patient. Despite a growing appreciation for the
complex genomic and molecular variability encapsulating this disease, there have been very few
successful clinical treatments. Insight from cancer breakthroughs, such as the use of Imatinib for
CML187,188 and Trastuzumab in breast cancer189,190, illustrated that inhibition of the key tumor
pathway drivers can significantly improve the outcome of patients. In this study, we antagonized
the Notch signaling pathway, inducing neuronal lineage commitment and reducing
tumorigenicity of a cancer initiating population. Furthermore, based upon expression of Notch
and downstream components, we have identified patterns of gene expression in glioblastoma
stem cells that identify subsets of glioblastoma that are more sensitive to neuronal lineage
commitment. These findings provide potential valuable insight in identifying novel
differentiation strategies for glioblastoma stem cells based on analysis of molecular and pathway
specific predictors of differentiation.
2.3.1 The Notch-Hes Axis as a Therapeutic Target
Our lab recently demonstrated that primary patient glioblastoma samples can be expanded in
serum free conditions on a laminin coated surface as an adherent monolayer157, a technique
which greatly facilitates molecular characterization and functional analysis. We manipulated the
Notch pathway using pharmacologic and genetic strategies with the goal of elucidating the
components required to maintain stemness. Our study of downstream Notch targets showed that
we could relieve repression of downstream proneural transcription factors using pharmacologic
antagonists of γ-secretase. Of the multiple downstream targets, our data show that one of the key
factors in regulating lineage fate in CSCs is Hes5 and not Hes1. Hes5 expression is diminished
in all lines upon treatment with γSI (5/5), demonstrating an exquisite sensitivity to Notch
receptor activity. In contrast, Hes1 is much less responsive with only 60% (3/5) of lines
significantly downregulating Hes1 after γSI treatment. Further, Hes5 is more sensitive to ectopic
Notch activation with NICD1 expression than Hes1. The current understanding of bHLH factors
is not completely understood and remains controversial. Of the multitude of Hes transcription
factors, Hes1 and Hes5 have traditionally been viewed as the major downstream targets of Notch
in murine and human neural stem cells74,191. Owing to partial functional redundancy in the
![Page 94: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/94.jpg)
81
context of murine cortical development191, the precise roles for Hes1 and Hes5 has been unclear.
The prevailing paradigm has been that the Notch-Hes1 axis is critical in neurosphere self renewal
whereas Hes5 is a dispensible component82,192. In contrast, a seminal study illustrated that ES
cells and ES sphere colonies derived from RBP-jK-/- mice fail to express Hes5 transcripts but
retain Hes1 expression73 indicating a Notch independent regulatory mechanism. Furthermore,
Notch1-/- and RBP-jK-/- E9.0 murine embryos retain expression of Hes1 and Hes3, but not
Hes5193. Taken together, these studies suggest that Hes5, and not Hes1, is directly regulated by
Notch. In support of this, there evidence that some canonical Notch targets are regulated
independently of the NICD/RBP-jK activation complex. In a study conducted with serum cell
lines, hedgehog signaling can directly regulate Hes1 independent of Notch receptor activation in
C3H/10T1/2 mesodermal and MNS70 neural cells129. In the context of murine postnatal retinal
progenitor cells, activation of hedgehog signaling is a stronger stimulus than activated Notch for
Hes1 expression and occurs independently of RBP-jK194. This suggests that Hes1 may not be an
exclusive Notch target as previously thought. Our study has demonstrated that Hes5 is more
sensitive than Hes1 to Notch blockade and over expression. Therefore, in the cancer stem cell,
Hes5 appears to be regulated by Notch directly whereas Hes1 may be regulated by alternate
pathways and/or Notch. Obviously further deliniation of the relative importance of Hes1 and
Hes5 in glioblastoma stem cells requires further functional analysis of these cells with additional
gain and loss of function experiments.
The persistance of Hes1 expression despite Notch blockade reveals a fascinating possibility into
the potential mechanism of glioblastoma disease recurrence. A seminal study reported that Hes1
maintains the reversibility of cellular quiescence in human fibroblasts and rhabdomyosarcoma by
blocking the effect of Cyclin Dependent Kinase inhibitor p21Cip1 and inducing expression of
TLE1195. In a developmental context, this protective function would intuitively prevent stem and
progenitor cells from undergoing premature quiescence, ensuring that developmental and
homeostatic programs are retained. Likewise, maintenance of Hes1 expression in cancers would
confer a significant survival advantage. Inducing cellular quiescence and terminal differentiation
in cancer is a highly sought after goal for the purposes of treating disease. Our observation that
glioblastoma NS lines retain Notch-independent Hes1 expression illustrates how a normal
protective mechanism may be co-opted by aberrant cancer programming. Indeed, we have
observed that glioblastoma stem cells can be differentiated into less proliferative (potentially
![Page 95: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/95.jpg)
82
more quiescent) neuronal cells in-vitro, yet retain the capacity to generate tumors upon in-vivo
orthotopic transplantation when isolated from the effects of γSI. This could reflect a state of
reversible quiescence or reversible differentiation of glioblastoma stem cells, and could have
important implications for guiding anti-Notch directed therapies (or differentiation therapy
strategies in general) and suggests that maximal therapeutic benefit of these types of therapies
may require active maintenance of differentiation signals to the cancer stem cells. Small
molecule inhibitors196 and anti-Notch receptor antibodies197 are just some pharmacologics that
are currently being developed and tested. However, it may be crucial to also target the pathways
which crosstalk with Hes1 in order to minimize the likelihood of disease recurrence. We have
shown that the wingless pathway is a candidate pathway for combinatorial modulation.
Recently, Schreck et al., demonstrated that Hes1 negatively regulates hedgehog by directly
binding the Gli1 gene in a glioblastoma neurosphere model. Interestingly, blockade of Notch
with γSI resulted in a corresponding increase in Gli1 activity as a result of diminished Hes1
expression198. The result was a compensatory upregulation of Shh activity and was postulated to
protect cancer cells from death. From this preliminary study, combining Notch and Shh
inhibitors was more effective at reducing cell proliferation than individual inhibitors. Ultimately,
simultaneous targeting of multiple signaling pathways implicated in tumorigenesis is likely to be
more efficacious in a clinical setting.
2.3.2 Modulating Canonical and Non-Canonical Elements of the Notch pathway
In our study we compared canonical and non-canonical pathway gene expression in glioblastoma
stem cell lines, fetal NS lines and cerebral cortex. We discovered that Notch2, Hes1 and
Jagged1 expression is relatively increased in normal or tumor stem cells compared to human
cortex. Intriguingly, we uncovered patterns of gene expression which may be predictive of the
differentiation potential for glioblastoma stem cells. Glioblastomas that acquire neuronal
phenotypes in response to Notch blockade have patterns of gene expression similar to human
fetal neural stem cell lines. Importantly, this sensitive group of gliomas can be distinguished
from insensitive gliomas by high relative expression of Ascl1 and Dll3. Ascl1, a transcription
factor whose expression is repressed by the Notch target Hes1/Hes5199,115, is crucial for
reprogramming fibroblasts to functional neurons200 and is critical in neuronal differentiation and
patterning200. Paradoxically, we have shown that Ascl1 is expressed in some EGF/FGF cultured
![Page 96: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/96.jpg)
83
NS lines, conditions which promote self-renewal and inhibit differentiation. Rectifying this
apparent contradiction, Castro et al., recently reported that Ascl1 has direct functions in all stages
of neurogenesis. In addition to regulating genes associated with Notch signaling, cell fate
specification, neuronal differentiation and neurite morphogenesis, Ascl1 was found to control
genes regulating cell proliferation201. The authors show that Ascl1 can bind the promoters of up
to 603 genes responsible of reactivating cell cycle. Transfection of dominant negative-Ascl1 into
neural stem cells resulted in impaired S-phase progression. Interestingly, the authors discovered
that the Ascl1 promoter binding sequence (GTGGGAC) very closely matched that of the
CBF1/NICD co-activator sequence (GTGGGAA). They proposed a model whereby Ascl1
functions to co-activate cell cycle progression genes when Notch is active, but is displaced by
CBF1/co-repressor complex when Notch is inactive. Therefore, in our neurogenic lines,
CBF1/NICD and Ascl1 may function together to promote cell cycle progression/self-renewal
when Notch is active. Notch blockade therefore promotes the transcription of genes relating to
neuronal lineage commitment and maturation.
We wondered whether other transcription factors downstream of Notch contributed to the
prevalence of neurons and relative paucity of astrocytes upon Notch blockade. In our principal
component analysis of neurogenic versus non-neurogenic NS lines, we identified high expression
of Sox4 in neurogenic lines relative to human cortex and non-neurogenic lines. There is
evidence to support the role of this Sry-related HMG-box gene in neuronal commitment and
CNS development. In mouse models of development, over expression of Sox4 under the GFAP
promoter supports normal differentiation of neurons, but induces massive cerebellar defects due
to the developmental failure of Bergman glia202. In this mouse model, apoptosis occurred
extensively in astrocytes. Expression of Sox4 in neurogenic glioblastoma stem cell lines may
conceivably diminish the population of astrocytes when exposed to the neurogenic environment
of γSI treatments. Thus, considering the importance of this transcription factor in a
developmental context, it may serve an important function in neuronal lineage programming in
cancer stem cells, and would likely benefit from further detailed study.
In this study, we directly modulated the activity of Notch receptors using pharmacologic
inhibitors. While our study was being conducted, other groups have demonstrated that the
activity of Notch signaling can be modulated by affecting genes responsible for receptor
transcription and post-translational processing. Ying and colleagues demonstrated that the
![Page 97: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/97.jpg)
84
retinoic acid induced differentiation of glioblastoma neurospheres was dependant on expression
of Krüppel-Like Family 9 (KLF9) transcription factor. KLF9 exerts negative regulatory effect
by direct binding to basic transcription element (BTE) sequences found in the Notch1 promoter.
Underexpressed in glioblastoma intiating cells, ectopic expression induces differentiation and
was sufficient to reduce tumorigenicity in mouse transplant models203. Identifying novel
pharmacologic and genetic mechanisms to perturb Notch signaling will of great importance for
efficiently and terminally antagonizing pathway activity in cancer cells.
2.3.3 Functional Synergism in BTSCs.
To determine whether Notch targeted therapies could be effective in patients we conducted a
proof of concept study using ex-vivo orthotopic models. Mice transplanted with γSI-induced
differentiated neurogenic lines significantly improved survival over transplants with untreated
cells. Non-neurogenic tumor lines treated the same way did not demonstrate an improvement in
host survival, but we acknowledge that numbers of animals tested and numbers of cell lines
tested are small to make the most concrete conclusions. Additionally, we activated the wingless
pathway using pharmacologic inhibitors of GSK-3β in conjunction with Notch blockade and
induced robust neuronal lineage differentiation in neurogenic lines. This combination improved
tumor-free survival of mice transplanted with neurogenic tumor cells. Remarkably, despite the
lack of neuronal differentiation, BIO and γSI combination treatment of non-neurogenic
glioblastoma lines was also effective in significantly prolonging the survival of mice in
orthotopic transplant. It may be possible that BIO and γSI promote the development of a
neuronal marker negative ‘tumor transient amplifying cell’. In the study conducted by Dieter
and colleagues, they demonstrated that colon cancer initiating cells could be subdivided into
three fractions: long term tumor initating cells, transient amplifying cells, and delayed
contributing cells. Of these fractions, transient amplifying tumor cells were only capable of
forming tumors in primary animals. Furthermore, transient amplifying tumor cells were much
less likely to metastasize within the murine host204. In our study, we demonstrated that mice
injected with BIO and γSI treated cells had improved survival compared to injections with
untreated or single treated cells. However, did not test the serial propagation ability of these
tumors. Furthermore, since CNS tumors do not metastasize to distant sites outside the CNS, we
are unable to assess the migratory abilities of putative glioblastoma transient amplifying cells in-
![Page 98: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/98.jpg)
85
vivo. Ultimately, combination treatment may diminish tumorigenicity of non-neurogenic lines
by promoting a transient amplifying cell fate possessing limited self-renewal capabilities.
We demonstrated Wnt pathway activation synergizes with Notch inhibition to activate neuronal
genes and upregulate markers of lineage commitment. How do our results fit into the currently
established mechanisms of crosstalk? Evidence from the literature illustrates both direct and
indirect interactions between the two pathways. Indirectly, some elements of the Notch pathway
are targets of downstream activated Wnt signaling. For instance, the Jagged1 promoter is a
known target of the canonical β-catenin activation complex205,184. Katoh and Katoh
demonstrated that β-catenin can activate Notch signaling by upregulating transcription of
Jagged1. Direct protein-protein interactions can occur between Wnt-Notch and may modulate
activity of both pathways. Activated β-catenin can bind to the intracellular domain of activated
Notch and functions to prolong the half-life of NICD in-vitro206,43. In murine e14.5 neural stem
cell models, β-catenin together with NICD1, participates in the activation of Hes genes to
suppress neuronal differentiation206. Confusingly, studies also demonstrate that negative
regulators of Wnt can potentiate Notch signaling. Paradoxically, the kinase responsible for
marking β-catenin for degradation, GSK-3β, also has the ability to directly phosphorylate
Notch1207 and Notch2208, promoting nuclear localization and activation of downstream Hes
targets. Our data show that blocking GSK-3β in BTSCs can be a potent differentiating signal
and may support a model that GSK-3β is a phosphorylase that potentiates nuclear localization of
activated Notch (Figure 2-30). This context suggests that β-catenin is not required to regulate
proliferation. Also, induction of differentiation via BIO/γSI synergy may be independent of
activated β-catenin protein. To test this hypothesis, experiments confirming the physical
interaction between NICD and GSK-3β, and experiments demonstrating the effect of β-catenin
over expression in G-NS cells are required. The recipricol activity of these pathways is not
without precedent, as this putative model may have implications in memory consolidation in
Wistar rats. Conboy and colleagues demonstrated that Notch signaling in the adult rat
hippocampus was downregulated 12 hours following a passive avoidance training stimulus
consisting of a delinated area of a cage which administered an electric shock209. If the Notch
receptor was activated ectopically in-vivo after the animals completed the training period, the rats
failed to condition to the shock stimulus. Interestingly, diminished Notch activity was associated
with increased Wnt activity measured by GSK-3β phosphorylation and accumulation of
![Page 99: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/99.jpg)
86
activated-β-catenin. The authors hypothesized that in order for proper learned conditioning to
occur, downregulation of Notch was required to allow for neuronal differentiation and neurite
outgrowth. Thus, while learning and memory are poorly understood processes, the findings in
this thesis indicate that physiological mechanisms governing memory may be conserved in
glioblastoma stem cells. Ultimately, our data support the hypothesis that the functional synergy
observed with BIO and γSI is due to recipricol Notch and Wnt pathway activation.
Herein, we have implicated a role for Wnt pathway by identifying upregulation of APC in
neurogenic tumors. We showed that activation of Wnt signaling and simultaneous blockade of
Notch promotes glioblastoma stem cell differentiation. The Wnt pathway is known to contribute
to a number of congenital cancer syndromes, most notably Familial Adenomatous Polyposis
(FAP). Inheritance of germline inactivating mutations within the APC gene induces growth of
numerous (hundreds to thousands) colorectal tumors manifesting as polyps in the second or third
decade of life210. This condition requires aggressive surgical treatment. FAP can also contribute
to a spectrum of CNS tumors. Referred to as Turcot’s Syndrome, these patients were found to
commonly develop medulloblastoma and, less frequently, glioblastoma. While this clinical
condition appears to contradict our findings that Wnt activation may diminish tumor growth, a
study that characterized glioblastoma of Turcot’s Syndrome revealed atypical molecular features
including more defects in mismatch repair and markedly improved outcome compared to
classical glioblastoma211. We did not conduct a full genotype analysis on all the glioblastoma
stem cell lines in this study and therefore FAP carrier status is unknown. While tumor response
to Wnt activation was variable, all of the lines studied showed diminished proliferation
suggesting that Wnt activation was not a proliferative simulus. Whether BIO treatment has the
same effect on CNS tumors of FAP origin is yet to be studied. Thus, synergistic inhibition of
Notch and activation of Wnt will be a useful strategy in some, but maybe not all brain tumors.
![Page 100: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/100.jpg)
87
Figure 2-30
Putative Mechanism of Notch-Wnt Synergy. GSK-3β antagonists combined with γSI induces
neuronal lineage differentiation in neurogenic BTSCs. This interaction could putatively occur
through a positive feedback mechanism where GSK-3β interacts with the activated domain of
Notch.
![Page 101: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/101.jpg)
88
2.3.4 Clinical Implications
The identification of the factors which distinguish neurogenic and non-neurogenic tumors in this
study may be clinically useful for identifying patients which may respond to therapies directed
against the Notch signaling pathway. Philips et al212, demonstrated that bulk tumors could be
grouped into three subclasses: proneural, proliferative and mesenchymal with markers from the
Akt and Notch pathway distinguishing Mesenchymal and Proneural groups respectively. The
proneural class included gliomas ranging from Grade II to Grade IV and tended to consist of
patients younger in age compared to the proliferative and mesenchymal groups (~40 y/o vs ~50
y/o). Verhaak and The Cancer Genome Atlas Research Network213 uncovered similar findings
with respect to glioblastoma subtypes. In their study, molecular genetic classification identified
four distinct glasses of glioma: classical, proneural, neural and mesenchymal. Of the proneural
class, they identified Notch, Ascl1 and Sox genes being highly expressed compared to other bulk
glioma. Our work has demonstrated that cancer stem cells can be prospectively organized based
upon a genetic signature and that the two groups possess functional differences in signaling
pathway dependency that can be exploited with γSI.
Interestingly, Verhaak et al. showed that there were significant differences between clinical
subtypes and response to aggressive chemotherapy regimens. Patients with Grade IV glioma can
be treated with ‘standard’ chemotherapy or ‘aggressive’ chemotherapy. Aggressive strategies
comprise of multiple rounds of high dose chemotherapy plus concurrent radiotherapy and have
been shown to improve gross patient survival. However, when grouped according to the genetic
profile of their glioma, patients with proneural GBMs do not possess any improvement in
mortality when compared to traditional chemo/radiotherapy regimens. Therefore, our work may
suggest a treatment modality in this subclass of GBMs. γSI’s may be a strategy to improve the
survival of patients with the proneural class of glioblastoma.
Therapeutically, functional synergy could minimize adverse drug reactions. Indeed, γSI at high
doses has been documented to induce severe gastric toxicity, the effects of which may be
mitigated by some combinations of adjuvant therapy with the corticosteroid dexamethasone214.
Similarly, while BIO has not yet been approved for the use in human patients, Wnt activation
through Lithium Chloride (LiCl) is an approved clinical treatment for neurological/psychiatric
disorders and thus effectively passes the blood brain barrier and functions in the CNS215. Lower
![Page 102: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/102.jpg)
89
doses of combined drugs which have the same effect as high doses would be effective at
minimizing cost, reducing toxic burden, maximizing therapeutic value and ultimately preserving
patient compliance.
Historically, this differentiation therapy has been successfully applied in the treatment acute
promyelocytic leukemia (APL). All-trans retinoic acid (ATRA) administered to patients with
APL induced differentiation to mature granulocytes and effected a complete remission in a high
percentage of patients216. There is evidence in-vitro to demonstrate that this approach may be
viable in human glioma217. Furthermore, novel methods of targeting the Notch axis have been or
are currently under development. Perhaps like herceptin218, a developing strategy is the use of
antagonistic monoclonal antibodies specific for individual Notch receptors197,197.
Understandably, there is concern that targeting a signaling pathway integral to normal stem cell
homeostasis may cause undesirable side effects. Studies in rats have shown that administration
of γSI via intracranial osmotic pumps improves the performance of test subjects in water maze
challenges219, perhaps reflecting increases in functional neurogenesis as a result of Notch
blockade. However, extrapolation to human subjects should be done with caution as long term
memory or cognitive deficit in these laboratory animals have not been explored. Further, NSCs
are known to mobilize to sites of brain injury and ischemic damage. It is unknown how
plasticity and CNS repair would cope in an environment a depleted of a neural stem cell pool220.
Therefore, uncertainty regarding effects on memory and impaired response to brain ischemia
must be considered in a clinical setting.
Our findings have clear clinical implications. We have prospectively identified characteristics
which predict responsiveness to Notch antagonists. Further development and characterization of
the hits revealed in this study may lead to clinical applications where patient glioma samples
may be screened for Notch1, Ascl1 or Sox4 expression in advance of prescribing a
chemotherapeutic regimen. Information gleaned from patient screens may thus lead to the use of
γ-secretase inhibitors and Wnt agonists to induce neuronal lineage differentiation in susceptible
glioma.
![Page 103: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/103.jpg)
90
Supplemental Figure 1
Growth factor withdrawal of NS lines induces multipotent differentiation..
A) HF240NS human fetal neural stem cells, B) GliNS1 glioblastoma line, C) G144NS
glioblastoma line, D) G166NS glioblastoma line, E) G174NS glioblastoma line, F) G179NS
glioblastoma line. Two-stage growth factor ithdrawal protocol administered over a period of 14-
21 days. Green channel is GFAP. Red channel is β-IIIT. Scale bar 50μm.
![Page 104: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/104.jpg)
91
Supplemental Figure 2
Dose response analysis of the γ-secretase inhibitor L-685,458 and DAPT in human fetal
neurosphere forming assay. Human fetal 6787 was plated at a clonal density of 2000 cells per
well with EGF/FGF and cultured for one week with either vehicle, L-685,458 or DAPT.
Neurospheres were scored based on a minimum 50um diameter.
Neu
rosp
here
s/W
ell
![Page 105: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/105.jpg)
92
Supplemental Figure 3
DN-MAML Notch antagonism reduces expression of downstream Notch targets. G144NS,
a neurogenic group NS line is responsive to DN-MAML Notch blockade. G174NS, a non-
neurogenic NS line is also responsive to DN-MAML Notch blockade. Both lines transiently
transfected and assayed for gene expression 3 days post transfection. *P<0.05
![Page 106: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/106.jpg)
93
Supplemental Figure 4
Downstream bHLH expression in Glioma NS lines and Human Fetal NS after 6uM γSI
treatment. A)HF240NS, B)G166NS, C) G179NS, and D) G174NS treated with 6μM γSI for 10
days have significantly reduced Hes5 expression. Hes1 is not significantly down regulated in A)
HF240NS or C)G179NS lines with pharmacologic Notch blockade. * P<0.05
![Page 107: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/107.jpg)
94
Supplemental Figure 5
Ascl1 transcripts are differentially expressed between NS lines.
Quantitative reverse-transcriptase PCR analysis of Ascl1 transcripts from NS lines cultured in
EGF/FGF. GliNS1 and G144NS neurogenic NS lines express higher levels of Ascl1 transcript
relative to G166NS and G179NS non-neurogenic lines.
![Page 108: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/108.jpg)
95
Materials and Methods
2.3.5 Primary Patient Samples.
Samples were obtained with approval from ethics committee and appropriate patient consent.
Incoming tumor tissue was partitioned for immunohistochemistry, tissue culture and frozen for
archival purposes. Tumor tissue for primary neurosphere culture was mechanically dissociated
and enzymatically digested with 1.33mg/ml trypsin (Sigma), 0.67mg/ml hyaluronidase (Sigma)
and 0.1 mg/ml kynurenic acid (Sigma). The enzyme mix/cell suspension was quenched with
0.7mg/ml ovalbumin and filtered through a 70μm cell strainer to remove debris. Red blood cells
were eliminated from culture by 30-45min density centrifugation with Lympholyte Mammal
(Cederlane). Resulting cell suspension was plated in appropriate cell culture media or frozen for
archival purposes in a 10% DMSO/PBS solution. Primary patient tissue processed form
immunohistochemistry was immediately fixed with 4% paraformaldehyde for
immunohistochemistry. Tissue frozen for archival purposes was snap frozen using liquid
nitrogen and stored in an anonymized database to preserve patient confidentiality.
2.3.6 Tissue Culture
Neurospheres were cultured in serum free conditions with 20ng/ml EGF and 20ng/ml FGF as
previously described97. 50% of the growth media was exchanged every 3-4 days. Neurospheres
were passaged with Accutase (Sigma) when the average diameter of neurospheres exceeded
350μm. Neurosphere limiting dilution assays (LDA) were seeded at an initial density of 20
cells/μl (2000 cells/well) with stepwise 50% dilution down to 0.04 cells/μl (4 cells/well) and
monitored for a period of 7-21 days. The percentage of wells without neurospheres was scored
and plotted against initial seeding density221. The 0.37 intercept was scored as the clonogenic
frequency to reflect the zero term of the poisson equation and density at which there is an
average of only one colony forming cell per well222.
Adherent NS culture172 was conducted on Primeria (Nunc) tissue culture plasticware coated with
0.01% Poly-L-Ornithine (Sigma) and 10ug/ml Laminin (Sigma). Neurocult media (Stem Cells
Technologies) was supplemented with 10ng/μl EGF, 10ng/μl FGF, N2 and B27. Cells were
passaged by enzymatic digestion with Accutase.
![Page 109: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/109.jpg)
96
Glial and neuronal lineage differentiation was induced by a three week growth factor withdrawal.
The media for the first 7 days of differentiation was supplemented with 5ng/ml FGF, N2, B27
and no EGF. Subsequently, the Neurocult media was exchanged with a 1:1 mixture of
Neurobasal:Neurocult, B27 and ¼ N2.
Compounds were added to the culture as necessary with the appropriate vehicle controls. γSI L-
685,458 (EMD) and 6-bromo-3-[(3E)-1,3-dihydro-3-(hydroxyimino)-2H-indol-2-ylidene]-1,3-
dihydro-(3Z)-2H-indol-2-one (EMD) were added to the culture and monitored for proliferation
or morphological changes.
Proliferation assays were conducted with Thiazolyl Blue Tetrazolium Bromide (MTT, Sigma).
A final concentration of 500μg/ml was added to the tissue culture and monitored for the
formation of insoluble purple formazan crystals which were solubilised with 10% SDS/0.1M
HCl and quantified using a spectrophotometer at 575nm.
Live imaging and tracking of cells conducted using Icucyte Cell Tracking Systems (Essen
Biosciences) in standard tissue culture conditions (37ºC) and normoxic environment.
2.3.7 Vectors and Transfection
Notch1 intracellular domain was cloned into the pcDNA3.1 Vector from the Val1744 residue to
the end of the protein. Dominan-negative Mastermind contruct was a generous gift from Dr.
John Aster and is contained within a MigR1 plasmind. Transfections were conducted with
Nucleofector Device (Lonza) according to manufacturer’s protocols.
2.3.8 Immunocytochemistry
Cells cultured as adherent NS were grown on coated coverslips and fixed with methanol or 4%
paraformaldahyde (PFA). Coverslips were permeabilized with 0.1% TritonX100 and blocked
with 5% NGS. Antibodies against activated Notch1 (1:250, abcam8925), Nestin (1:1000,
Ab5922), GFAP (1:500, DAKO), β-III-tubulin (1:500, MAB1637) and Sox2 (1:500, MAB2018),
GFP (1:250, Roche, Cat 11814460001), Hes1 (1:500, A generous gift from Tetsuo Sudo), Hes5
(1:500, AB5708), BrdU (1:250, OBT0030) were used. Appropriate fluorescent-conjugated
secondary antibodies were used at a concentration of 1:500 with copious washing with PBS
between staining phases. Cells were counterstained with 1:1000 DAPI and mounted with
![Page 110: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/110.jpg)
97
fluorescent mounting medium (DAKO). Imaging was conducted with a Leica microscope.
Matched exposures were used to compare images between treatments of the same cell line.
Manual scoring was conducted on randomly selected fields using ImageJ (V1.42q) to mark cells
counted. Cells were scored as ‘positive’ if staining corresponding to filamentous proteins were
localized as discrete fibres in the cytoplasm and ‘negative’ if fibres were not clearly visible.
Cells were scored as ‘positive’ if staining for corresponding nuclear transcription factors were
localized to the nucleus and ‘negative’ if no staining was visually observed.
BrdU incorporation was assayed following a 24hr pulse with 10μM BrdU. Cells were fixed with
4% PFA and denatured with 2M HCl for 20min at room temperature. Following neutralization
with 0.1M Sodium Borate pH 8.5, the coverslips were washed with copious amounts of PBS.
Cells were permeabilized with 0.2% TritonX100 and blocked with 5% BSA. Staining as above.
2.3.9 Semi-Quantitative and Real Time PCR
mRNA from primary patient tumor samples was isolated by Trizol extraction. mRNA from cells
was isolated according to the protocol using RNeasy (Qiagen), treated with DNase (Qiagen) and
quantified using a Nanodrop spectrophotometer. Reverse Transcriptase PCR was conducted
using oligo-dT and Reverse Transcriptor (Roche) according to protocol.
Real-time qPCR was conducted with a Bio-Rad PTC200 and Chromo4-α unit. Sybr Green
mastermix was obtained from Bio-Rad. Primers for Notch1223 F-
GAACCAATACAACCCTCTGC R-AGCTCATCATCTGGGACAGG, Hes1 F-
GAAGGCGGACATTCTGGAAA R-GTTCATGCACTCGCTGAAGC, Hes5224 F-
CGCATCAACAGCAGCATAGAG R- TGGAAGTGGTAAAGCAGCTTC, Sox4 F-
GTGGTACAGGGGCAGTCAGT R- ACACCATCACGATTCCGATT, Hey1 F-
GCTGGTACCCAGTGCTTTTGAG R- TGCAGGATCTCGGCTTTTTCT, Ascl1 F-
TCCCCCAACTACTCCAACGAC R-CCCTCCCAAGCGCACTG and B-Actin225 F-
CATCACCATTGGCAATGAGC R- CGATCCACACGGAGTACTTG.
2.3.10 Flow Cytometry
Cells were resuspended in flow cytometery buffer without EDTA and stained with CD133-APC
(Mylteni Biotech), CD15-FITC, CD44PE for 30min-1hr at 4°C. Cells were spun down, washed
with buffer and counter stained with propidium iodide. Quantitative flow cytometry was
![Page 111: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/111.jpg)
98
conducted using the BD FACScalibur or BD FACscan. Cell sorting was conducted with BD
FACS Aria.
2.3.11 Animals
Orthotopic injections of cells suspended in PBS were conducted with stereotactic head frames
into female NOD/SCID mice. Animals were anesthetized with ketamine/xylazine and supplied
with the analgesic Anafen. A hole in the skull is bored with a needle to facilitate injection. The
co-ordinates originate at the bregma are 1mm anterior, 1mm right and 2mm deep. Injections of
2-3μl are conducted over the course of 30min: 10min injection, 10min to permit diffusion and
10min withdrawal of the needle. The hole in the skull is subsequently filled with bone wax and
the head sutured. Animals were cared for by laboratory animal services, assessed by unbiased
laboratory staff when animals demonstrated significant disease progression and were sacrificed
when recommended.
2.3.12 Microarray Data and Analysis
RNA hybridization, Affymetrix U133 Plus array and data normalization was conducted by Ian
Clarke. Data analysis and statistical analysis was conducted using Partek® software, version 6.3
Copyright © 2008. Complete linkage clustering analysis was conducted with Cluster and
Treeview (Version 1.60)174.
Data analysis, t-tests and Logrank tests were performed using GraphPad Prism version 4.00 for
Windows, GraphPad Software, San Diego California USA.
![Page 112: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/112.jpg)
99
Chapter 3
3 Symmetric Versus Asymmetric Self renewal in Cancer Stem Cells.
3.1 Introduction Self renewal is a property whereby a stem cell undergoes a cell division where at least one of the
daughter cells retains properties identical to the parent cell. Generation of two identical progeny
in a self-renewal event is termed symmetric self-renewal (expansion) whereas generation of one
daughter stem cell and one daughter progenitor or differentiated cell is termed asymmetric self
renewal (maintenance). Thus, symmetric expansion is a process critical for rapid generation of
cell numbers during development and response to injury or tissue repair. Asymmetric self-
renewal is also a process that is tightly regulated during development and is required for proper
developmental patterning. Alternatively, a stem cell is also capable of dividing such that both
daughter cells lose stem cell properties (extinction) becoming progenitors or differentiated cells
lacking long term self-renewal (Figure 3-1). In cancer, one hypothesis of neoplastic growth is
that cancer stem cells arise from normal stem cells where self-renewal has been programmed to
symmetric expansion from asymmetric maintenance. Recently, Lathia and colleagues have
indeed demonstrated that glioblastoma stem cells are generated primarily through symmetric
self-renewal events226. Therefore, identifying the factors that modulate symmetric versus
asymmetric self-renewal is a highly sought goal in cancer prevention and treatment.
Much of our understanding of factors that regulate self-renewal originate from studies of
Drosophila neuroblasts and external sensory organs, a system which is permissive for
characterization due to clear distinctions between stem cells and differentiated cells. In this
system, cell fate decisions are determined by the spatial location of cells relative to the epithelia
and are dictated by apical and basal polarity of the cell. The polarity is marked by three distinct
protein complexes which are asymmetrically segregated into daughter cells. The first complex
Discs Large is composed of Scribble (Scrib), discs large (dlg) and lethal giant larvae (lgl). The
second complex Bazooka is composed of bazooka (baz), Drosophila atypical protein kinase C
(DaPKC) and Drosophila homologue of Partitioning Defective Protein 6 (DmPAR-6). Finally,
the Crumbs group is composed of crumbs(crb) and stardust (sdt)227. These protein complexes
![Page 113: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/113.jpg)
100
function to regulate downstream determinants of cell fate. One of these determinants, Numb, is a
negative regulator of Notch signaling and a direct target of lgl228. Numb is hypothesized to
regulate Notch signaling by recruiting E3 ubiquitin ligases229, promoting Notch receptor
trafficking230 and lysosomal degradation231,175. The absence of Notch signaling in these daughter
cells is thought to induce PIIb cell fate which further divides into a Drosophila neuron and
sheath cell232. Interestingly, many of the components of the Drosophila polarity complexes have
mammalian counterparts, suggesting similar mechanisms of action in higher organisms.
Many components from the Drosophila polarity protein complexes have homologues in
mammalian cells, including mouse and human. Among these proteins, Drosophila Numb has
been discovered to have at least four homologues in mammals. In the murine central nervous
system, the mouse Numb homologue (m-numb) is expressed in neural precursor areas in the
developing and postnatal brain233. Another homologue, Numblike (nbl) was found to have
highest expression in postmitotic neurons234 and functions to antagonize Notch signaling.
Further, there is evidence which shows that Notch receptor signaling is absolutely required for
murine neural stem cell expansion. Notch1-/-, Presenilin1-/- and RBP-jK-/- neural stem cells are
all incapable of forming neurospheres73. Correspondingly, the opposite effect also holds true as
transient activation of Notch receptors in-vivo induces rapid neural stem cell expansion235. Thus,
it is clear that Notch plays an important role in regulating neural stem cell self-renewal.
Despite the understanding of Notch mediated self-renewal in Drosophila and murine models, the
role of Notch in glioblastoma stem cell self-renewal remains poorly understood. Preliminary
reports have demonstrated that persistent γ-secretase inhibition is sufficient to induce apoptosis
and reduce tumorigenicity of glioma neurospheres139 and the data we have presented in Chapter
2 has shown that we can differentiate and prevent CSC engraftment and tumorigenesis.
However, the consequences of Notch inhibition on symmetric versus asymmetric cancer stem
cell self-renewal remains poorly understood. Is Notch required for symmetric expansion and
asymmetric maintenance of CSCs or is it expendable in one of these cell fate choices? Is it
feasible to induce extinction in a population of cancer stem cells by targeting Notch? Herein, we
will attempt to elucidate the role of Notch in CSC self-renewal.
![Page 114: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/114.jpg)
101
Figure 3-1
Self-renewal in stem cells. A stem cell (pink) can undergo three distinct cell fate choices. A)
Two daughter cells are identical in symmetric stem cell self-renewal and causes expansion of the
stem cell pool. B) One daughter cell and one progenitor/differentiated cell progeny (yellow) are
the result of asymmetric stem cell self-renewal and results in stem cell maintenance. C) Stem
cell extinction occurs when a stem cell differentiates to two daughter cells with no self-renewal
ability.
![Page 115: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/115.jpg)
102
3.2 Results
3.2.1 Self-renewing BTSCs persist in γSI treated cultures.
We have demonstrated that Notch antagonism induces neuronal lineage differentiation of neural
stem cells and subsets BTSCs. Interestingly, despite a highly differentiated appearance in-vitro
we found that Notch antagonist treated BTSCs were still capable of forming tumors in-vivo,
albeit with an increased latency. Since disease recurrence is a common facet of glioblastoma, we
hypothesize that a cancer stem cell population may persist in culture despite pharmacological
treatment. If true, a culture of neuronally differentiated BTSCs may demonstrate cardinal stem
cell properties when exposed to a milieu free of inhibitor. To test this hypothesis, we treated
neurogenic NS lines with Notch antagonists and replated the cultures into standard stem-cell
conditions to observe repopulating capabilities. NS lines cultured in 10μM γSI/EGF/FGF for 3
weeks to induce robust neuronal lineage marker expression were passaged in accordance with
standard protocols and replated into proliferative conditions with EGF/FGF without Notch
antagonists. MTT proliferation curves of HF240NS closely mirrored those of control cultures
and at 3 weeks were restored to 95% of control cultures. Similarly, the growth dynamics of
antagonist treated G144NS was also similar to vehicle treated cultures. 3 weeks after replating,
this glioblastoma line demonstrated levels of MTT proliferation that were 83% of control
cultures. The restoration of cell proliferation in the absence of γSI suggests that the proliferative
impairment caused by Notch antagonism is not a permanent effect on all stem cells in the culture
and illustrates a remarkable expansion upon inhibitor withdrawal (Figure 3-2).
We have shown that proliferation can be rapidly restored in the absence of Notch inhibition.
However, the mechanism of proliferation is unclear. Does proliferation occur due to reactivation
of self-renewal in a pool of quiescent stem cells or does it occur due to a rapid burst of
proliferation from progenitors seeded into a new medium? To ascertain whether cells
undergoing transient Notch inhibition cells retain self-renewal, we utilized the limiting dilution
assay, allowing us to determine the number of colony forming cells within a population221,222.
G144NS treated for three weeks with γSI was dissociated and plated into LDA without inhibitor.
The clonogenic frequency of vehicle treated cells was 15.2±8.4 cells/well whereas the γSI treated
cells was 44.9±22.7. While clonogenic frequency is diminished by approximately three-fold, the
observation lacks statistical significance. Nevertheless, these experiments demonstrate that
![Page 116: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/116.jpg)
103
glioblastoma lines treated with Notch antagonists retain self-renewal ability despite prior
expression of differentiated markers in bulk culture, suggesting survival of a clonogenic
population in the absence of Notch (Figure 3-3).
To investigate whether cells that regain self-renewal and proliferation are bona-fide cells with
full stem like properties, we conducted a differentiation assay of cells exposed to γSI and shown
to express differentiated markers in culture. GliNS1, a glioblastoma which demonstrates robust
neuronal differentiation when cultured with γSI for 3 weeks, was examined for multipotentiality
after a recovery period in EGF/FGF. The cells were enzymatically dissociated and plated into
EGF/FGF conditions without γSI to examine whether multi-lineage differentiation is biased
towards a particular lineage or impaired altogether. Surprisingly, GliNS1 treated with γSI for 3
weeks, replated into EGF/FGF without inhibitor and differentiated according to standard
differentiation protocols were capable of both glial and neuronal differentiation (Figure 3-4).
Therefore, despite the acquisition of neuronal lineage markers and reduced proliferation in the
absence of Notch signals, glioblastoma stem cells are still capable of self renewal, proliferation
and multipotentiality when exposed to favorable conditions which promote Notch receptors re-
activation.
![Page 117: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/117.jpg)
104
Figure 3-2
Glioma Stem Cells and Fetal Neural Stem Cells previously treated with Notch inhibitors
proliferate in absence of antagonist. A) HF240NS and B) G144NS neurogenic lines were
dissociated and replated into fresh media with EGF/FGF after culture for 3weeks with γSI. Both
cell lines reacquire proliferative potential when assayed by MTT.
Number of Cells per well
0 100 200 300 400
Per
cent
age
of w
ells
with
out s
pher
es
1
10
100
37% intercept
Vehicle
10uM GSI
Figure 3-3
Limiting dilution assay of γSI treated G144NS cells plated into EGF/FGF without inhibitor
show retention of self-renewal. G144NS glioblastoma retains clonogenic potential despite
treatment with γSI indicating the retention of a self-renewing population in-vitro. Clonogenic
frequency of Vehicle (●) 15.2±8.4 cells/well. γSI treated cells (○) was 44.9±22.7 cells/well.
![Page 118: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/118.jpg)
105
Figure 3-4
Glioma stem cells revert to a multipotent state with removal of γSI. GliNS1 was cultured for
2 weeks in 6μM γSI to induce robust neuronal marker expression. Viable cells determined by
trypan blue exclusion were passaged into fresh media with EGF/FGF without γSI and cultured
for 3 weeks. A loss of neuronal marker expression and the reacquisition of GFAP expression
were noted. These cells were passaged into differentiating conditions for 3 weeks and it was
noted that these cells were fully multipotent. Scale bars 100μm.
![Page 119: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/119.jpg)
106
3.2.2 Notch blockade restrains stem cell self-renewal and simultaneously pushes lineage commitment.
We have observed that despite appearing to be highly differentiated, cancer stem cells retain
multipotentiality and self-renewal in-vitro, and are able to form tumors in-vivo. How is it
possible that a cell population with such a dramatic shift in lineage fate can retain such a robust
stem-like character? These findings may be explained by the observation that while a large
proportion of cells in-vitro are growth restricted and express neuronal markers, a minority are
marker negative and remain proliferative (Chapter 2). Therefore, while quiescent, a population
of cancer stem cells survives and retains stem like properties despite Notch blockade. One
hypothesis is that γSI blocks clonal expansion by shifting symmetric division to asymmetric
division, thereby producing quiescent stem cells and differentiated progeny (Figure 3-6C). In
this scenario, the outcome of a mitotic event is one neuronal precursor daughter cell that is
positive for markers of differentiation, limited in growth potential and susceptible to apoptosis.
The other daughter cell retains self-renewal and multipotentiality such that, when it is passaged
into permissive conditions, it expands to repopulate the cell line in-vitro and in-vivo. To date,
there has been little evidence to support the role of Notch in regulating symmetric/asymmetric
self-renewal transition in glioblastoma stem cells.
Alternatively, another explanation is that there is stochasticity with regard to the sensitivity of
each cell to Notch blockade. With this model, each cell may possess unequal Notch receptor
expression and/or dependence. Therefore, for any given cell line, while the EC50 in L-685,458
may be ~4μM for the cell line as a whole, the actual dose required to inhibit proliferation for
each cell in culture may range from <1μM to >10μM, and therefore, in the experiments that have
been presented, a small but significant population of stem cells will resist differentiation, retain
proliferation and repopulate the culture in-vitro and in-vivo (Figure 3-6B). Finally, another
model is that cells in culture may evolve resistance to the selective pressure of γSI236,237,238. This
would predict that all cell lines have a small possibility to evolve spontaneous resistance to γSI.
Stem cells evolving this resistance would retain self renewal and proliferation despite the
presence of a differentiating stimulus. This could theoretically occur via upregulation of non-
canonical signaling pathways such as c-Jun N-terminal protein kinase (JNK)239 or hedgehog129
modulating downstream Notch components.
![Page 120: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/120.jpg)
107
Testing our hypothesis necessitated the lineage tracking of cells in-vitro in order to score the
relative frequencies of self-renewal events and cell fates. We collaborated with Dr. Eric Jervis &
colleagues240 who developed novel technologies to track cell growth in confined and easily
observable microenvironments. This in-vitro system employs a tissue culture surface seeded
with inert polymer beads of a defined and customizable diameter. Overlaid is an optically clear
coverslip that creates a ‘gap chamber’ between the glass and culture surface. This gap chamber
therefore limits cell growth to a two dimensional plane (Figure 3-5). Growth in a single plane
greatly facilitates video cell tracking and is amenable to standard culture conditions and
pharmacologic manipulations. Furthermore, this system is permissive for cell to cell interactions
and is thus a more faithful representation of a physiologic environment, a distinct advantage over
most isolated single cell tracking modalities. Tracking cells allows the creation of lineage trees
documenting the growth, divisions and cell fate of the glioblastoma stem cell line GliNS1
cultured with and without Notch inhibitors. We cultured GliNS1 glioblastoma stem cells for 7
days in 5μM GSI while recording cell divisions, apoptotic events and changes in cellular
morphology.
Cell divisions were classified based on the fate of daughter cells. Symmetric events were
classified as cell divisions where the two daughter cells retain compact primitive morphologies
and ability to further divide, regardless of subsequent cell fate of second generation cells.
Conversely, asymmetric events were defined as divisions where one daughter cell retained
mitotic potential, whereas the other daughter underwent apoptosis, acquired neuronal
morphology or failed to proliferate (quiescence). Neurons were defined as cells lacking
mobility, acquiring neuronal markers and showing elongated neuronal morphology.
Symmetrical events where all the daughter cells undergo apoptosis are not considered
symmetrical self renewal, but are scored as symmetrical apoptosis.
Lineage trees from control GliNS1 were remarkably symmetrical. Of 39 cells tracked over 7
days, there were 147 mitotic events occurred with an average generation time of 40.9±18.2 hours
resulting in 188 daughter cell observations. Of these divisions, 127 (86%) were classified as
symmetric. While we are currently unable to immunostain for apoptotic markers in this assay
system, cells undergoing programmed cell death exhibited distinctive membrane blebbing, lack
of motility and an undefined nucleus. Spontaneous apoptosis was an infrequent occurrence with
only 14 cells (7.4%) undergoing apoptosis during the observation period. Of these apoptotic
![Page 121: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/121.jpg)
108
cells, 3 pairs underwent apoptosis shortly after dividing. In contrast to these findings, γSI treated
GliNS1 tracked for the same amount of time was observed to have fewer mitotic events. 90 cells
at the start of the observation period underwent a total of 102 mitotitc divisions with an average
generation time of 49.7±21.4 hours giving rise to 198 cells. Of these divisions, there was a
relative decrease in symmetric events, 57 (56%), and an increased proportion of asymmetric
events. 10.8% of cell divisions were asymmetric in vehicle cultured cells versus 30% of
divisions in γSI treated cells. Of the asymmetric events recorded in γSI cultures, 60% of these
asymmetric events (18/30) were biased towards one daughter cell undergoing apoptosis, 33%
(10/30) consisting of one daughter cell acquiring neuronal lineage morphology and finally 6.6%
(2/30) having one daughter cell becoming quiescent after dividing. (Table 3-1) (Figure 3-7).
Via live cell tracking, we clearly demonstrated that blockade of Notch signaling in GliNS1
changes the outcome of mitotic events. This technique is advantageous since it can provide cell
fate information on cells which did not divide. In control cultures, 16/39 cells (41%) did not
divide during the 7-day observation period. Of these cells, 10% (4 of 39 seeded cells) acquired
neuronal characteristics, 23% (9 of 39 seeded cells) were quiescent and 7.6% (3 of 39 seeded
cells) underwent spontaneous apoptosis. In contrast, γSI treated cells were less likely to
experience a mitotic event with 55 cells (61% of total) failing to divide during the observed
period. 11% of these (11 of 90 seeded cells) adopted a neuronal morphology and 34% (31 of 90
seeded cells) underwent spontaneous apoptosis. Interestingly, this tracking system reveals that
while the number of quiescent cells increases with Notch blockade, the proportion of quiescent
cells that differentiate into neurons in this time period does not change appreciably (10%
neuronal cells in vehicle vs. 12% neuronal cells in γSI). These findings suggest that the majority
of neurons observed in culture are daughter cells of a self-renewal event.
We have used a novel cell tracking system to elucidate cell fate decisions of GliNS1 in the
absence of Notch pathway activation. In the 7 day observation period, we have noted that there
are an increased proportion of cells that undergo apoptosis, both before and after mitotic events.
We have observed an approximate three fold increase in asymmetric self renewal and a 1.5 fold
decrease in symmetric self renewal upon Notch blockade. Taken together, these results
demonstrate that expansion of the glioblastoma stem cell population can be blocked with Notch
pathway inhibition.
![Page 122: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/122.jpg)
109
Table 3-1
Summary observation of cell divisions and apoptotic events from GliNS1 lineage tracking.
Cells were tracked over a period of 7 days with vehicle or 5 μM γSI. Total cells are defined as
the number of cells tracked at the end of the observation period. Quiescent cells are defined as
tracked cells which do not undergo a mitotic division during the observation period. Generation
time and percentage asymmetric events are increased upon γSI treatment. Bold number indicate
number of observations.
Vehicle 5μM γSI
Starting number of cells 39 90
Total Cells Tracked at end of observation period
188 198
147 102
127 (86%) 57 (55%)
16 (10%) 30 (29%)
3 (2%) 12 (11%)
Total Divisions
-Symmetric Events
-Asymmetric Events
-Symmetric Apoptosis
-Undefined 1 (1%) 3 (3%)
16 (41%) 55 (61%)
9 (21% of Quiescent) 13 (14% of Quiescent)
4 (10% of Quiescent) 11 (12% of Quiescent)
Total Quiescent Cells
-No Change
-Quiescent Neuronal
-Quiescent to Apoptosis 3 (8% of Quiescent) 31 ( 34% of Quiescent)
Total Apoptosis 14 (7%) 56 (28%)
Total Neurons 7 (4%) 22 (11%)
Average Generation Time 40.9±18.2 hours 49.7±21.4 hours
![Page 123: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/123.jpg)
110
Figure 3-5
Diagram of monolayer cell culture in a confined 3D microenvironment. A) Standard culture
conditions are permissive for cell migration in all 3-dimensions, an aspect which makes cell
tracking difficult due to overlap of cells during videographic filming from above. B) A confined
microenvironment is created with polymer beads of a defined diameter and a culture slide. This
creates a gap under the coverslip which restricts movement of cells in 2-dimensions and greatly
facilitates live cell tracking.
![Page 124: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/124.jpg)
111
Figure 3-6
Stochastic differentiation or asymmetric self-renewal as a result of Notch antagonism. A)
Cancer stem cells cultured in EGF/FGF have unlimited symmetric self-renewal in culture. B)
Stochasticity or evolutionary resistance upon Notch antagonism may allow a small population of
cancer stem cells to retain symmetric-self renewal. The other cells differentiate following a
neuronal lineage and eventually undergo apoptosis or fail to grow after passage. C)
Alternatively, asymmetric self-renewal may occur in all cells in culture.
![Page 125: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/125.jpg)
112
Figure 3-7
Cell division and lineage tracking of GliNS1 glioblastoma stem cells. Representative lineage
trees illustrating GliNS1 cultured in EGF/FGF and tracked over one week. A) Representative
lineage tree of 2 cells cultured in vehicle. B) Representative lineage trees of 3 cells cultured in
5μM γSI. ○=Lost track, ►=Moved out of frame, X=Apoptosis, | =neuronal morphology
![Page 126: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/126.jpg)
113
3.3 Discussion Despite differentiation into BrdU negative, β-IIIT positive neuronal cells in-vitro, glioblastoma
stem cells treated with Notch inhibitors retain a capacity for colony formation in-vitro and brain
tumor formation in-vivo. In-vitro, following γSI withdrawal, these cells are proliferative, colony
forming and possess multilineage capabilities when exposed to favorable conditions. In-vivo,
γSI treated cells formed tumors in orthotopic transplant models, albeit at a longer latency
compared to controls. This suggests that a tumorigenic cancer stem cell population can persist
despite Notch signalling inhibition, possibly from a shift from symmetric to asymmetric self-
renewal. By tracking cell divisions of single glioblastoma stem cells in a 2-D chamber, we
discovered that γSI indeed increased the proportion of cells undergoing asymmetric self-renewal.
In the majority of these asymmetric events, one of the daughter cells underwent apoptosis or
differentiated while the other remained unchanged. We are also able to observe the fate of cells
which do not undergo a cell division. This fraction, which we defined as quiescent, is increased
in the population treated with γSI. This is consistent with the observations made in Chapter 2,
where we demonstrated reduced proliferation with Notch blockade. Furthermore, the fraction of
quiescent cells undergoing apoptosis is elevated. 34% of all quiescent cells eventually die,
representing the majority (55%) of all observed apopotic events. Examining the bulk culture, we
found that over a quarter of all cells ultimately undergo controlled death. Thus, the decrease in
proliferation that we observe with γSI is due to a variety of factors. First, we can see that
without Notch signaling, cells are less likely to divide and are more likely to be quiescent.
Second, of the cells that do divide, there is a shift towards asymmetric self-renewal and even an
increase in double extinction of daughter cells. Finally, cell cycle time is lengthened by almost 9
hours (a factor of 1.2) in treated cells.
We questioned the mechanism of cell culture recovery and tumor formation after the removal of
Notch inhibitors and devised cell tracking experiments to help us elucidate the origins of
recovery. What is remarkable about cancer stem cells treated with Notch inhibitors is that some
cells demonstrate extensive self-renewal capability and flexibility to shift between symmetric
and asymmetric self-renewal. These observations raise intriguing questions regarding the
determinants of self-renewal and the potential of any given cell in culture. For instance, consider
the single cell that is tracked on the extreme right of supplemental figure 5. While there is an
increase in neuronal lineage differentiation and apoptosis, the lineage tree is punctuated with
![Page 127: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/127.jpg)
114
many symmetric events interspersed with asymmetric events. It could be hypothesized that this
clone, if exposed to permissive conditions would be highly tumorigenic. Ultimately, the models
of cell fate decisions outlined in Figure 3-6 likely represent an oversimplification and these
processes require more detailed study. The data presented in this chapter illustrates the
complexity in fate choice and demonstrates that self-renewal in the absence of Notch is a
composite of all the possibilities outlined prior.
The lineage trees provided in this chapter provide functional insight at the single cell level. An
intriguing question that arises is how can one cell avoid terminal differentiation without Notch
activation? In an elegant study, Sang and colleagues showed that Hes1 expression is capable of
protecting serum starved fibroblasts from irreversible senescence and that sustained expression
of this bHLH transcription factor was sufficient to maintain reversible quiescence195. They
showed that terminal myogenic differentiation occurred when Hes1 signaling was blocked with
dominant-negative Hes1 constructs and γSI. Ultimately, they provided evidence to show that
Hes1 binds with and activates Transducing-Like Enhancer of Split 1 (TLE1), which functions as
a co-repressor that recruits Histone Deacetylases (HDAC). In Chapter 2, we have shown that
Hes1 is less sensitive to γSI blockade than Hes5 and that Hes1 expression persists in many NS
lines despite pharmacologic and DN-MAML blockade. Thus we theorize that the persistence of
low levels of Hes1 expression in glioblastoma stem cells is an adaptation, which functions as a
protective mechanism and allows for cell cycle re-entry and the prevention of irreversible
quiescence. Sang et al also showed that Hes1 expression was sufficient to prevent premature
senescence as a result of oncogene activation and that rhabdomyosarcomas express high levels of
the protein. Considering the effect on preventing senescence, it should be of no surprise that
Hes1 plays such an important role in tumorigenesis. Intriguingly however, their observation may
suggest that a tumorigenic lesion could begin in a cell population already expressing Hes1.
We observed an approximate four-fold increase in apoptotic glioblastoma cells in γSI treated
cultures compared to vehicle. Interestingly, evidence in the literature suggests that decision to
undergo apoptosis may be directly regulated by Notch. In a study conducted by Lakshmi and
colleagues, they provided evidence to show that the activated NICD interacts directly with
mitochondrial proteins to suppress the apoptotic cascade241. In a pathway independent of RBP-
jK, they showed that activation of NICD by Jagged1 allows it to bind directly to mitochondrial
surface proteins and leads to inactivation of the proapoptotic Bcl2-Associated-X-Protein (Bax).
![Page 128: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/128.jpg)
115
Intriguingly, beyond canonical mechanisms of receptor activation, the entire canonical
downstream axis was found to be dispensable for the antiapoptotic function. Therefore, the
increases in cell death observed in cell tracking videos are consistent with the mechanism of
Notch mediated proliferation and anti-apoptotic protective effects.
Finally, an important alternative hypothesis that we have not ruled out is that cells expressing
lineage markers may be capable of ‘de-differentiation’: losing lineage marker expression and re-
acquiring stem cell properties upon reactivation of Notch signaling. To explore this possibility,
we would sort γSI treated cells positive for lineage markers and negative for stem cell markers,
and see whether this population is capable of expanding in-vitro or forming tumors in-vivo. The
process of ‘de-differentiation’ is a controversial occurance. With the advent of iPS technology, it
has been proven that some mature cell phenotypes can revert back to a pluri/multipotent cell
state with careful manipulation of defined transcription factors70. However, whether a similar
process can occur in differentiated cancer cells has not been proven.
The data presented in this thesis have identified one of the molecular switches responsible for
regulating symmetric to asymmetric self renewal in glioblastoma stem cells. Ultimately, with
knowledge of key molecular mechanisms controlling tumor growth, we have contributed to the
understanding of glioblastoma growth and disease recurrence. We are optimistic that the
findings presented in this thesis may have implications for the treatment and cure of
glioblastoma.
![Page 129: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/129.jpg)
116
Supplemental Figure 6
Notch antagonism induces asymmetric cell divisions in a glioblastoma stem cells. First
replicate. GliNS1 was cultured for 7 days with vehicle or 5μM γSI. An increase in asymmetric
cell divisions, apoptosis and neuronal morphology was noted. ○=Lost track, ►=Moved out of
frame, X=Apoptosis, | neuronal morphology. Horizontal line indicates point of γSI addition.
![Page 130: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/130.jpg)
117
Supplemental Figure 7
Notch antagonism induces asymmetric cell divisions in a glioblastoma stem cellse. Second
replicate. GliNS1 was cultured for 7 days with vehicle or 5μM γSI. An increase in asymmetric
cell divisions, apoptosis and neuronal morphology was noted. ○=Lost track, ►=Moved out of
frame, X=Apoptosis, | neuronal morphology. Horizontal line indicates timepoint of γSI addition.
![Page 131: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/131.jpg)
118
Materials and Methods
3.3.1 Replating Assay
Cells were cultured in EGF/FGF and γSI for a period of 2 week to induce neuronal lineage
differentiation. After this period, cells were dissociated with Accutase (Sigma) and viable cells
replated into a 96 well plate at a concentration of 2000 cells/well without γSI. Cell proliferation
was measured with MTT as previously described (Chapter 2).
3.3.2 Limiting Dilution Analysis
Cells were cultured according to standard tissue culture protocol in 96 well plates. A starting
concentration of 2000 cells per well was plated in the left-most column and two-step dilutions
conducted down to a single cell per well. After one week in culture, the percentage of wells
without colonies (F0) was plotted against the initial number of cells per well (x). The number of
cells required to form one colony in every well is determined by the 0.37 intercept (F0=e-x) which
is frequency of clonogenic stem cells in the whole population from the Poisson distribution242.
3.3.3 Differentiation Protocol
Cells are cultured on a glass coverslip according to standard culture conditions. Growth factor
withdrawal induced differentiation was induced over a period of 3 weeks. In the first week of
differentiation, the cell are cultured in Neurocult media with the concentration of FGF reduced to
5 ng/ml, N2 growth supplement and 1xB27 growth supplement. Growth factors are further
reduced in the second week of differentiation to a 1:1 mix of Neurocult:Neurobasal media, ¼ N2
and 1xB27.
3.3.4 Lineage Trees
Cells were tracked in real-time as previously described240. Briefly, a cell chamber was created
by overlaying a glass cover-slip over a culture surface populated with polymer beads 7μm in
diameter. Cells cultured under this 7μm gap were then imaged every 6min using a tissue culture
camera. Media exchanges were conducted twice a week and supplemented with the γSI L-
685,458 at a concentration of 5μM or with the equivalent volume of DMSO as a vehicle control.
![Page 132: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/132.jpg)
119
Chapter 4
4 Notch1 Receptor Mutations in Brain Tumor Stem Cells
4.1 Introduction The hypothesis that mutations within proto-oncogenes contributed toward neoplastic
transformation was first demonstrated in 1976 by seminal work by Stehlein et al243, where
normal chicken cells were found to contain sequences related to the src gene identified in avian
sarcoma viruses. Since then, mutations within proto-oncogenes are now understood to be a
major mechanism of transformation. Mutations in the Notch proto-oncogene resulting in
malfunctioning protein and contributing to neoplastic transformation has been described in
hematopoietic neoplasms. Notably, t(7;9)(q34;q34.3) translocations involving the TCR-β gene
and Notch1 gene were discovered to have a major role in T-ALL10. Mechanistically, this
translocation results in a fusion protein that deletes the extracellular domain of Notch1 resulting
in a constitutively active intracellular domain244,245.
Subsequent studies have determined that point mutations within the heterodimerization domains
and intracellular PEST sequences of the Notch1 gene are present in over 50% of all T-ALL
patients117. These mutations function by enhancing NICD cleavage and/or preventing
degradation of the activated receptor. Mutations within the heterodimerization (HD) domain
result in reduced membrane heterodimer stability and result in ligand-independent γ-secretase
processing of the receptor246. Combined with mutations in the PEST domain, the activated
receptor experiences a dramatic increase in half life, leading to precocious activation of
downstream Notch targets. Recently, mutations in Notch1 have also been identified in chronic
lymphocytic leukemia.
With the understanding of the lesion in the Notch pathway, scientists have been able to infer the
role of Notch in hematopoietic lineage decisions and have enabled a greater understanding of the
cell of origin in these cancers. In addition to this, γSI treatment for Notch mutation based T-
ALL is closer to becoming a viable treatment option. Combining γSI treatment and
dexamethasone, already in use to treat T-ALL, has led to promising results in-vitro and in-vivo
suggesting that γSI may be a viable patient treatment214. Therefore, identifying Notch mutations
in other cancers highly desired. To date, the contribution of Notch receptor mutations in other
![Page 133: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/133.jpg)
120
diseases and cancer has been unclear. Some reports have demonstrated that some ependymomas,
CNS tumors arising in the ependyma lining the ventricles, harbor mutations in Notch1247.
However, other common malignancies fail to demonstrate mutations. No mutations have been
discovered in cervical cancers248. Therefore, the identification of Notch mutations in brain
tumors may represent a novel mechanism in the initiation and propagation of this disease and
highlight the Notch pathway as a target for drug therapy in CNS malignancies.
4.2 Results
4.2.1 Sequence analysis of the Notch1 heterodimerization and PEST domain in CNS tumors.
We have utilized primer sequences identical to those used by Weng et al, to profile the
heterodimerization and PEST domains of CNS tumors. This region of the receptor was profiled
exclusively of our screen as it had been revealed that this region harbored mutations in the
majority of Notch1 mutation positive T-ALL samples (43.7%)117. We examined genomic DNA
from archived tumor tissue isolated from 10 medulloblastoma, 38 GBM and 4 ependymoma
samples (Table 4-1). Our screen of genomic DNA from 38 GBM tissue samples revealed two
tumors (5.2%) that harbored mutations in the HD domain. In both of these tumors there was a
heterozygous guanine to an adenine missense mutation at position 4831 of the Notch1 sequence
inducing an alanine to a threonine mutation at amino acid position 1612. This novel mutation
has not been previously reported in the literature as a contributor to T-ALL, nor is it a reported
single nucleotide polymorphism (SNP). No other mutations were found in other tumor types.
![Page 134: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/134.jpg)
121
Figure 4-1
5% of glioblastomas harbour mutations in the Notch1 receptor. A) Heterozygous mutations
were identified at position 4813 in the genomic sequence. B) The mutation corresponds to
amino acid position 1612 which corresponds to a highly conserved region of the
heterodimerization domain. C) This missense mutation mutates the first nucleotide of an alanine
codon resulting in a threonine codon.
![Page 135: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/135.jpg)
122
4.3 Discussion In this study we have found two heterozygous mutations located in the HD domain in 3.8%
(2/52) of tumors. The absence of pervasive activating Notch1 mutations highlights an interesting
paradigm in tumor initiation and growth. Studies conducted in the past have indicated that
ectopic NICD is sufficient to transform immortalized cell lines244,249 and is required to maintain
the phenotype of Ras-transformed cell lines250. Therefore, one could expect any mutation that
extends the half-life or supports the precocious activation of the NICD would be common in
many tumors that feature activated Notch. While the presence of Notch mutations is not
widespread, there may be an explanation to the lower than expected observed frequency of
mutations. Cancer growth can be dependent on both a tumor derived and/or an exogenous
vascular niche251 to provide nutritional support, metabolic waste management and oxygen
requirements. Perhaps there is an evolutionary pressure to avoid constitutive Notch activation
which would otherwise limit or deny the repertoire of supporting cell fates. Indeed, the
subventricular zone niche is composed of transient amplifying cells which are the progeny of the
bona-fide Type-B stem cell252. The generation of these supporting cells would depend on the
ability of the stem cell to downregulate Notch signaling in daughter cells, a function that would
most certainly be impaired if Notch signaling is constituitively active. The ability of a neural
stem cell or cancer stem cell to cell autonomously generate a supporting niche is a significant
evolutionary advantage, and thus mutations which select against this ability may be unfavorable
in malignancies driven by cancer stem cells. This requirement for de-novo niche generation may
also explain the prevalence of Notch mutations in some hematopoietic cancers versus solid
cancers. Cancer stem cells in some hematopoietic malignancies are capable of usurping normal
bone marrow niches and disrupting the behavior of normal hematopoietic progenitor cells253.
Thus, leukemic stem cells are not pressured to retain the full repertoire of diverse cell fates
required to generate a supporting environment. This hypothesis is consistent with our previous
findings as we have demonstrated that not all of the cells in our relatively homogenous NS
cultures possess nuclear localization of activated Notch, suggesting the differential regulation of
Notch activation within cells in the tumor. Whether these Notch negative cells have a supporting
function in NS lines is yet to be determined. Taken together, our data demonstrate that a fraction
of brain tumors harbor Notch1 mutations. However, we do not rule out the possibility that
alternative mechanisms of aberrant Notch signaling supports brain tumor initiation and growth.
![Page 136: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/136.jpg)
123
Activating Notch mutations are commonly found in T-ALL and now known to be a significant
contributor to the mechanism of leukemia initiation. Paradoxically, a recent discovery has also
implicated inactivating Notch mutations in the perpetuation of chronic myelomonocytic
leukemia (CMML). What was discovered was that mutations within Nicastrin, APH1, MAML1
or Notch2 functioned to disrupt downstream Hes1 signaling and lead to leukemia generation in
5/42 patients254. Thus, this study demonstrates that Notch signals exist in a fine balance in
hematopoietic development. Excess signaling can push hematopoietic stem cells to the T-
lymphocyte cell fate and T-ALL, whereas insufficient signaling can promote
granulocyte/monocyte progenitors leading to CMML. In our study, we have demonstrated that
5% of glioma (38 malignant glioma and 4 ependymoma) harbour activating Notch mutations.
Considering the model of Notch in leukemia, we would expect to discover mutations in glioma
since Notch activation plays a role in glial development. In contrast, Notch normally suppresses
neuronal cell fate. In our study, none of the 10 medulloblastoma samples were found to have
Notch mutations. Since Notch is responsible for glial specification, future studies in our lab will
focus on the identification of mutations in neuronal tumors. Identification of inactivating Notch
mutations in receptors or γ-secretase components in medulloblastoma would be an insightful
discovery and would help explain the mechanism of neuronal tumor development.
![Page 137: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/137.jpg)
124
DomainTumor Type HD PEST
GBM1 A1612T NoneGBM2 A1612T NoneGBM3 None NoneGBM4 None NoneGBM5 None NoneGBM6 None NoneGBM7 None NoneGBM8 None NoneGBM9 None NoneGBM10 None NoneGBM11 None NoneGBM12 None NoneGBM13 None N/AGBM14 None N/AGBM15 None N/AGBM16 None N/AGBM17 None N/AGBM18 None N/AGBM19 None N/AGBM20 None N/AGBM21 None N/AGBM22 None N/AGBM23 None N/AGBM24 None N/AGBM25 None N/AGBM26 None N/AGBM27 None N/AGBM28 None N/AGBM29 None N/AGBM30 None N/AGBM31 None N/AGBM32 None N/A
DomainTumor Type HD PEST
Medullo1 None NoneMedullo2 None NoneMedullo3 None NoneMedullo4 None NoneMedullo5 None NoneMedullo6 None NoneMedullo7 None NoneMedullo8 None NoneMedullo9 None NoneMedullo10 None NoneMedullo11 N/A NoneMedullo12 N/A NoneMedullo13 N/A NoneMedullo14 N/A NoneMedullo15 N/A NoneMedullo16 N/A NoneMedullo17 N/A NoneMedullo18 N/A NoneEpendymoma1 None N/AEpendymoma2 None N/AEpendymoma3 None N/AEpendymoma4 None N/A
Table 4-1
Summary table of brain tumors profiled for mutations in Notch1. Genomic DNA from three
subtypes of brain cancer was profiled for mutations in the HD and PEST regions of Notch1.
![Page 138: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/138.jpg)
125
4.4 Materials and Methods
4.4.1 Genomic DNA extraction
Patient samples were obtained with proper ethics approval and informed consent. Tissue was
immediately snap frozen in liquid nitrogen for archival purposes. Genomic DNA from primary
tumor tissue was isolated by Trizol (Sigma) extraction according to protocols.
4.4.2 Nested Polymerase Chain Reaction
Notch1 HDN1 and PEST amplicons were amplified using nested PCR. Primers used were the
same primers utilized as Weng et al117. First HD amplicon primer: F1
5’AGCCCCCTGTACGACCAGTA R1 5’CTTGCGCAGCTCCTCCTC F2
5’GACCAGTACTGCAAGGACCA R2 5’TCCTCGCGGGCCGTAGTAG.
4.4.3 Sequencing
Nested PCR products were cleaned with Qiagen PCR cleanup kit. DNA sample was sequenced
by The Centre for Applied Genomics (TCAG). Trace sequences were viewed with Finch TV
and Chromas. Sequence alignments conducted with BioEdit.
![Page 139: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/139.jpg)
126
Chapter 5 General Discussion
5.1. Targeting Notch in Brain Cancers
5.1.1. Cancer Stem Cells are Controversial
Since the identification of a tumorigenic population in breast95 and brain97,107,98 malignancies
there has been an explosion of international effort to identify similar populations in all forms of
solid and hematopoietic cancers. The effort of dozens of independent laboratories has identified
putative human solid cancer stem cell origins in prostate96, colon99,100, pancreas101,255,
mesenchyme102, skin103,104, ovaries105, head & neck106 and lung56 cancers. These studies,
including the work presented in this thesis, have relied on mouse models of xenotransplantation
to study cells capable of tumor propogation. With technical and ethical limitions in mind, there
is ongoing debate regarding the universality, applicability and clinical relevance of the cancer
stem cell hypothesis. These questions are invoked by a study of B-Cell lymphoma. Utilizing an
Eµ-myc pre-B/B, Eμ-N-Ras and PU.1-/- AML mouse models, it appeared that tumor formation
did not correlate with number of cells injected or surface marker expression256. Another
argument is that identification of cancer stem cells using muring transplant models identifies
cells capable of growing within genetically modified animal strains. Xenograft hosts are been
bred to lack immune response and the compatibility of human cells with a murine
microenvironment arguably differs from syngeneic models. Indeed, a study of skin cancers
revealed that individual unsorted melanoma cells possessed efficient tumor forming capabilities
in transplant assays whereas other studies identified subpopulations of melanoma intiating cells
identified by ABCB5 or CD271 in an NSG mouse strain104,103, Quintana and colleagues showed
that the efficiency of tumor formation was irrespective of marker expression and importantly,
could be increased with the use of a highly immunocompromised NOD/SCID interleukin-2
receptor gamma chain null (Il2rg(-/-)) mouse model257,258. Notwithstanding the future
development of more sophisticated assays, the cancer stem cell hypothesis may not be
universally applicable to all malignancies. Within the central nervous system, mouse models of
various brain cancers support the cancer stem cell and hierarchical organization of these
tumors130,259,260. Recently, Eppert and colleagues characterized gene expression profiles of AML
leukemic stem cells (LSCs) and found that they shared a transcriptional profile similar to HSCs.
Importantly, LSCs were validated to be tumorigenic with NOD/SCID xenograft models and
![Page 140: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/140.jpg)
127
expression of a stemness profile correlated directly with a poor clinical outcome in the original
patient261. Data presented in this thesis demonstrate patterns of gene expression in glioblastoma
stem cells that cluster closely with human fetal neural stem cells. Whether the similarities in
expression profiles found in glioblastoma stem cells and neural stem cells possess similar
prognostic value is a question being addressed by our laboratory. Recent studies indicate that
stemness genes such as CD-133 and Nestin, are associated with a poor outcome in patients with
glioma262,263,264. Using this knowledge in clinical decision making warrants careful validation
since the prognostic value of stem cell markers remains controversial265. Taken together, a
hierarchical cancer stem cell organization may not exist in all tumors but evidence exists to
support such a hierarchy in blood and brain. These studies underscore the importance of
technical validation and healthy skeptiscm when the ultimate goal is attempting to minimize the
human cost of cancer.
5.1.2. Cancer Stem Cells as a Therapeutic Target
Glioblastoma is the most common brain tumor in adults with very poor survivability. While a
great deal of progress has been made in understanding the molecular genetics and determinants
of this disease many of the therapeutic strategies in use are only marginally effective212,147,213,144.
Understanding the cellular origins and molecular vulnerabilities of this disease will be paramount
for the development of successful patient treatments.
Mizutani and colleagues demonstrated that Notch signaling is not an absolute indicator of murine
neural stem cells266. Activated Notch was assayed in murine telencephalic ventricular zone cells
with an EGFP reporter construct and thus stratifies Notch activity upon expression of EGFPhi
versus EGFPlo. Based upon the high and low levels of Notch activity, they were able to
distinguish populations of neural stem cells (NSCs) and intermediate neural precursors (INPs)
respectively. While both populations utlitized Notch receptor signaling, only neural stem cells
signaling through CBF-1 were capable of long term self-renewal. INPs, in contrast, signalled
independently of CBF-1 and, while proliferative, possessed limited self-renewal. Further
downstream of the pathway, it was discovered that NSCs were enriched predominantly in Hes5,
whereas INPs expressed higher relative Ascl1. Upon differentiation, EGFPhi NSCs generated
multipotent cells with a strong bias towards GFAP positive astrocytes whereas EGFPlo cells
overwhelmingly generated β-III-tubulin positive neurons. There are several parallels between
![Page 141: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/141.jpg)
128
the study conducted by Mizutani et al., and the work presented in this thesis. The class of NS
lines that we termed ‘neurogenic’ express high expression of Ascl1 relative to ‘non-neurogenic’
lines. While none of the NS lines demonstrate an exclusive bias towards neuronal lineage
differentiation upon growth factor withdrawal differentiation (Supplementary Figure-5), Ascl1
expressing cell cultures acquire more neuronal lineage markers upon active Notch blockade.
Arguably, the spontaneous neuronal lineage differentiation observed by Mizutani in INPs in their
differentiation assays could be due to spontaneous loss of Notch signaling. Since FGF2 is
known to feed back on Notch signals and suppress neurons, growth factor withdrawal further
pushes INPs along their neurogenic lineage267. That ‘neurogenic’ lines such as GliNS1, do not
undergo overwhelming or exclusive neuronal differentiation upon growth factor withdrawal may
reflect an astrogliogenic role for the Notch axis in a differentiating environment and/or
functional lateral inhibition. Therefore using the framework delineated by normal neural
developmental, ‘non-neurogenic’ lines are most closely analogous to Notchhi NSCs and
‘neurogenic’ lines are more analogous to Notchlo INPs. What is the significance of these
parallels? Evidence suggests that the stemness role of Notch in tissue stem and/or progenitor
cells is preserved. In hematopoietic stem cells (HSC), the EGFPhi and EGFPlo/neg possess equal
colonly forming ability in-vitro. However, the EGFPhi cells were more likely to form colonies
containing multiple hematopoietic lineages whereas the EGFPlo/neg cells formed more unipotent
colonies268. Considering these close parallels, using what known to modulate normal tissue stem
cells to cancer stem cells may be more applicable than previously thought.
5.2. Notch and the Cancer Niche
Cancer stem cells and neural stem cells have been shown to possess many common biochemical
features. Recent focus on the tumor microenvironment has raised the possibility of indirectly
killing cancer stem cells by affecting the physical environment in which it resides. Normal
neural stem cells are found in structured microenvironments capable of supporting metabolic
needs and providing a physical environment that facilitates controlled self-renewal. In normal
adult brain, neural stem cells within the subventricular and hippocampal regions reside within a
perivascular niche269,252,270. Importantly, niche endothelial cells support neural stem cell self-
renewal and neurogenesis by activating Notch signaling in stem cells directly82,29,271 and through
secreted factors272. Many parallels between normal and cancer stem cells can be drawn and
indeed, growing evidence suggests that cancer stem cells also reside within a specialized
![Page 142: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/142.jpg)
129
vascular niche251. Endothelial activation of Notch receptors occurs in the tumor
microenvironment and proof of concept experiments have shown that targeting endothelial cells
within the tumor are effective in limiting activation of Hes proteins140.
Angiogenesis, the process of new blood vessel growth from an existing vascular network, is a
requisite process for supplying the metabolic demands of a solid tumor growth. An attractive
therapeutic target, blockade of the chemokine Vascular Endothelial Growth Factor (VEGF) is the
basis for treatment with monoclonal antibody Bevacizumab. Recently, the process of retinal
angiogenesis was found to be regulated by Dll4-Notch1. High Notch activity in response to local
VEGF restricted tip cell growth and promoted stalk phenotypes, ultimately leading to budding273.
Further, Notch components are targets of downstream VEGFR-3 signaling in stalk cells as
knockdown of the receptor phenotypically recapitulates tip cell hyperplasia and disorganized
vessel growth associated with Notch antagonists274. This mechanism of sprouting is persevered
in tumors and indeed, blockade of Dll4 is sufficient to inhibit tumor growth. Paradoxically,
Notch inhibition induces vascular hyperplasia albeit forming disorganized vasculature that is
postulated to lack appropriate functionality as a nutrient delivery system275. Intriguingly, these
studies raise the question of whether the disorganized vascular niche would be capable of
supporting self-renewal of cancer stem cells in close proximity. At the time of this writing, it is
unclear whether self-renewal of neural and/or glioma stem cells are preferentially regulated by
either tip cells or stalk cells. Whether vascular metaplasia can be co-opted to induce a favorable
clinical outcome deserves investigation.
Interestingly, there is recent evidence to demonstrate that glioma may make direct cell
contributions to their own vascular niche in a mechanism utilizing Notch signaling. Ricci-Vitiani
and colleagues demonstrated that the tumor vasculature contained CD31+/CD144+ endothelial
cells with the same chromosomal alterations as the tumor cells themselves, suggesting a tumor
cell origin276. Wang and colleagues demonstrated similar findings and interestingly found that
differentiation of glioma stem cells into CD144+ endothelial cells was dependent upon active
Notch signaling. Blockade of Notch with DAPT prevented the endothelial differentiation of
CD133+/CD144- tumor cells but not CD105+ endothelial cells lacking tumor origin277.
The Notch signaling pathway may also preside over non-vascular elements of the stem cell
niche. Extracellular matrix proteins (ECM) are often over expressed in tumors possess many
![Page 143: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/143.jpg)
130
diverse functions such as formation of tumor architecture, protection from host immune
surveillance, activation of cell surface ECM binding proteins and providing physical pathways
for migration and dissemination278. Within the spectrum of glioma and breast malignancies,
expression of an ECM protein Tenascin-C is correlated with aggressiveness and is associated
poor patient prognosis279,280. Interestingly, TNC was recently discovered to be a direct target of
activated Notch. Sivasankaran and colleagues demonstrated that the Tenascin-C promoter
possesses RBP-jK binding sequence. Further, they demonstrated that Notch2 actively promotes
transcription and protein production resulting in enhanced cell migration281. While their study
examined the effects of Notch blockade in serum derived glioma lines, their work provides
compelling evidence that shows a multifaceted role for Notch in tumorigenesis that extends far
beyond what is currently understood.
5.2.1. Insight from Neurodegenerative Disease Treatment
The discovery of a rare subpopulation of tumorigenic cancer stem cells identifies an obvious
therapeutic target. We have proven that some patient derived cancer stem cells possess a robust
clonogenic frequency along with migratory abilities, thus it is not surprising that this disease
frequently recurs at locations proximal to the original tumor144. Identifying ways to target this
rare cell population will be critical to improve survival of GBM patients beyond the current
average of 14.6 months143. In Chapter 2, as a proof of concept we have demonstrated that γSI is
an effective Notch antagonist that induces lineage commitment in some CSCs. γ-secretase is not
a novel therapeutic target and lessons from other fields of research could be adapted to target
cancer. One strategy is to utilize the pharmacologic compounds developed for the treatment of
Alzheimer’s disease (AD). AD is a neurodegenerative disorder characterized by buildup of
amyloid-β-protein senile plaques in the brain. The key step in pathology of this disease is γ-
secretase cleavage of amyloid precursor protein (APP)282 which subsequently forms insoluble
protein aggregates which accumulate in the CNS. Existing therapies and research in AD have
identified γ-secretase specific compounds which are well tolerated and effectively cross the
blood brain barrier. One of these drugs is γSI LY450139 (Semagacestat). This compound has
successfully passed phase II clinical trials with well tolerated side effects and is currently in large
scale phase III clinical trials283. While many AD drugs are designed for APP specificity, there is
evidence from clinical trials to demonstrate that these drugs have a Notch inhibitory effect. One
such manifestation in LY450139 trials was the reversible lightening of hair color in some
![Page 144: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/144.jpg)
131
subjects. Interestingly, analogous effects were observed in several murine studies of the Notch
pathway. The survival of melanoblasts and melanocyte stem cells, cell populations responsible
for regulating hair pigmentation, is regulated in a Hes1 dependent mechanism. Abolishing
Notch signaling by topical γSI treatment or melanoblast specific Hes1 knockouts induced
apoptosis in these cell types which manifests as graying hair colour284,285. Taken together, these
human side effects in Alzheimer’s treatments are indicative of Notch antagonism suggesting that
existing drugs in advanced clinical trials could potentially be used to specifically block Notch in
brain cancers. These clinical studies are even more significant due to progress in side effect
management. Systemic Notch blockade at high doses have significant gastrointestinal effects
due to the differentiation of goblet cells in the intestinal crypt niche286,287. Recent studies have
demonstrated that these effects can be mitigated by combination therapy with corticosteroids
such as dexamethasone214. Alternatively, targeting redundant Notch receptors with inhibitory
antibodies197 has been shown to circumvent intestinal goblet cell metaplasia. Thus, targeting
Notch in glioma stem cells through existing Alzheimer’s treatments may be a viable therapeutic
strategy.
5.2.2. Therapeutic Specificity
With the growing popularity of the CSC hypothesis, there is a strong emphasis on the
development of therapies which distinguish CSCs from normal SCs to spare normal tissues and
cells from the toxic effects of chemotherapy. As of yet, very few feasible targets for CSC
specific therapy have been discovered. Underscoring this challenge, our microarray data show
that CSC’s from some glioma subgroups closely resemble normal neural stem cells and therefore
distinguishing cancer from normal stem cells may be difficult based on gene expression. Thus
our data and others highlight some of the fundamental controversies with CSC research: is it
possible to specifically target CSCs with Notch signaling? If not, what are the ramifications of
Notch blockade in the CNS? Few translational studies exist that can help answer these questions
and therefore we must extrapolate animal studies to predict human effects. Blockade of Notch
signaling in adult murine models induces neuronal commitment and depletion of the self-
renewing population over the long term288. Interestingly, neuronal lineage induction appears to
be functional as rats treated with γSI demonstrated enhanced contextual and spatial memory219.
The role of Notch signaling in memory formation is still poorly understood, however it appears
as though canonical Notch/Hes downstream signaling is critical for memory formation in mouse
![Page 145: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/145.jpg)
132
models289,209. It is unknown whether the burst of neurogenesis followed by a deficiency in long
term neural birth would be a perceptible effect in human patients. Under the extreme scenario, a
global deficit in neurogenesis could recapitulate the dramatic effects observed in the patient
“H.M”. This patient had a resection of the medial temporal lobe to alleviate severe epileptic
seizures. In what is known to be a major contribution to the field of neuroscience, a side effect
of this operation resulted in severe anterograde amnesia due to the complete removal of the
hippocampus290, a structure which harbors neural stem cells67 and is critical for the formation of
new declarative memories. In designing cancer treatments that aim to differentiate BTSCs, we
must be cognizant of the chance that normal neural stem cells may be affected. Thus, the
development of anterograde memory defects may be a sign of early neural stem cell depletion.
Since there is a documented age related depletion of normal neural stem cells, these side effects
may be more pronounced in older individuals and therefore this strategy may be contraindicated
in patients determined to be at risk for memory defects291. Although, considering the poor
survival of patients with primary glioma, this trade-off may an acceptable compromise.
5.2.3. Forcing lineage choice as a treatment for cancer
The identification of cancer stem cells with multi-lineage potential raises the prospect of forcing
differentiation to a growth restricted cell type as cancer therapy. This approach has been used
with great effect in ATRA therapy for PML but the mechanisms of steering lineage commitment
is poorly understood in solid malignancies. Since ATRA therapy does not exert a therapeutic
effect in other forms of leukemia292, it clearly illustrates a need for understanding mechanisms
regulating differentiation in each type of cancer. In a study examining the effect of Notch
blockade in a Neu (N202) mouse model of breast cancer, it was found that pharmacologic Notch
blockade was effective in reducing the tumorigenicity of the cancer initiating cells. When
compared to vehicle controls these cells were found to express CK14 and/or α-SMA,
myoepithelial lineage markers293. Indeed, in a clinical setting, absence of CK14 can be
associated with ductal carcinoma and expression of α-SMA is often associated with benign
papilloma294. We have demonstrated that we can induce robust neuronal lineage differentiation
in a subset of glioblastoma stem cell lines upon Notch blockade. However, if we can steer
differentiation to one of the three cell fates in the brain (neuron, astrocyte, oligodendrocytes),
which cell fate would be most limited in proliferative potential and thus the most useful in cancer
treatment? Gross and colleagues demonstrated that astrocytes can be induced through
![Page 146: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/146.jpg)
133
stimulation of the bone morphogenic protein (BMP) signaling pathway295,296. Interestingly,
despite the expression of glial markers, cell counts of NSCs after BMP treatment revealed a
small, but significant increase in the number of cells compared to controls suggesting some
proliferative capacity in BMP induced astrocytes. Their study supports other observations that
show proliferation of glial cells in-vitro297. Cells positive for other glial markers like A2B5298
and S100β299,300 all retain some degree of proliferative ability suggesting that glial lineage may
be an undesirable fate for cancer stem cells. In contrast, our data and others support the finding
that neuronal precursors are less proliferative. Differentiation of E14.5 neurospheres with BDNF
results in cells that fail to incorporate BrdU showing that neuronal lineage is more restricted than
other subtypes found in the CNS297. Determining a linage that is most growth restricted is an
endeavour deserving careful and cautious interpretation. For instance, medulloblastomas are
malignant tumors manifesting in the cerebellum of primarily paediatric patients. These tumors
possess a primitive phenotype and proliferate rapidly, yet express neuronal signature.
Expression of neuron specific markers such as NeuN, synaptophysin and MAP-2 is common
upon gross pathological evaluation of these primitive tumors301,302. However, functional
differentiation is still possible in this class of brain tumors. For instance, miR-34A which
negatively regulates Notch through Dll1 downregulation induces neurite outgrowth and
diminishes tumorigenicity in a Patched1+/- P53-/- model of medulloblastoma303. Treatment
directly with γSI is known to induce functional neuronal differentiation in these cancers304.
Indeed, mouse models of medulloblastoma have illustrated a hierarchical organization of these
tumors. Less differentiated cell populations expressing CD15 give rise to the marker positive
cells lower in the tumor hierarchy and are commonly seen in immunohistochemical staining130.
In the context of neuronal differentiation, these studies underscore the importance of probing for
functional differentiation and highlight the fact that neuronal marker expression is insufficient as
a determinant of differentiation. Therefore, neuronal differentiation of glial brain tumors may
be the most desirable outcome in cancer therapy.
5.2.4. Glioblastoma prevention
Considering the severity of malignant glioma, what are the known risk factors associated with
glioma and what are the countermeasures that can be employed in the prevention of this disease?
γ-secretase is a known target for several different pharmacological compounds. One large class
of compounds are non-steroidal anti-inflammatory drugs (NSAIDs). Ubiquitous NSAIDs such
![Page 147: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/147.jpg)
134
as ibuprofen and flurbiprofen rapidly pass through the blood brain barrier305 and are known to
inhibit γSI function by allosteric inhibition306. Therefore, is it possible that long term use of
these drugs may suppress aberrant Notch signals and prevent/delay brain cancer development?
An epidemiological study by Sivak-sears et al., showed that there was a significant inverse
association of long term NSAID use and GBM incidence. Glioblastoma patients were less likely
than control individuals to have consumed more than 600 doses of NSAIDs over a 10 year
period307. Furthermore, patients who regularly consumed NSAIDs such as acetylsalicylic acid
(Aspirin) which does not have the capacity to block APP processing by γ-secretase308 did not
demonstrate as significant a preventative trend in cancers outside of the gastrointestinal tract309.
Surprisingly, there are few studies examining the role of NSAIDs on Notch signaling and none
investigating the effect of NSAIDs and other Cox-2 inhibitors in cancer stem cells. One recent
study has shown that ibuprofen is effective at blocking Notch activation in serum cultured lines
derived from adenocarcinoma of the colon310. Thus, the use of relatively safe and ubiquitous
NSAIDs is a preventative treatment that should be considered in patients with a familial risk of
cancer.
5.3. Origins and mechanisms of brain tumors
5.3.1. A neural stem cell as the cancer stem cell
Brain cancers have for generations been thought to arise solely due to transforming events
occurring in glial cells in the CNS311. This method of thinking was due, in part, to the poor
understanding of normal brain plasticity and the dogma that the brain was solely a post-mitotic
organ312,313. There is now a wealth of knowledge to support the existence of self-renewing
populations of neural stem cells residing in multiple regions of the mammalian brain67,60,314.
Considering the capacity for self-renewal and ability to proliferate rapidly in response to
injury315,316,317, a reasonable hypothesis is that gliomas are most likely originate from
transformed neural stem cells and not from post mitotic neurons or astrocytes. Indirect evidence
to support this hypothesis exists from insightful experiments conducted by Hopewell and Wright
in the 1960’s. To induce glioma in rat models the researchers implanted a carcinogenic pellet in
various regions of the brain. Placement of the transforming agent adjacent to the subventricular
zone dramatically increased the frequency of cancer compared to other regions318. A more
recent study has shown that conditional inactivation of tumor suppressors p53, nf1 and Pten in
![Page 148: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/148.jpg)
135
Nestin positive stem and/orprogenitor cells of the murine brain were sufficient to induce
malignant astrocytomas319. Additional evidence stems from studies where lentiviral vectors were
employed to transduce cells with h-Ras and Akt in various regions of the mouse brain.
Consistent with previous experiments where Ras and Akt expression in Nestin and not GFAP
positive cells induced cancer320, tumors were only observed when injection of virus occurred in
the proliferative regions: the subventricular zone and hippocampus321. Ultimately, while a
growing body of evidence points to neural stem cells as a cell of origin in CNS tumors, this may
not be the rule in all forms of cancer. Recent reports suggest that peripheral nerve sheath tumors
arising in the peripheral nervous system have a more differentiated cell of origin322,323 and thus
these problems must be solved through careful and thorough characterization. Delinating the cell
of origin for tumors is significant beyond simple scientific curiosity. Understanding how and
when genetic lesions accululate in a succeptible cell population could be important in the
prevention and management of disease. From an anatomic standpoint, understanding where
cancers are most likely to originate can greatly aid in screening and prevention of advanced
malignancies. From a biochemical standpoint, many cell signaling dependancies are preserved
in the pathological population, and thus understanding lesions arising in the cell of origin
provides new rationales for directed treatment. Indeed, in the context of this thesis, comparison
to human fetal stem cells was crucial to identify exploitable vulnerabilities in the cancer
initiating cell.
5.3.2. Symmetrical versus asymmetrical self-renewal in neural stem cells and cancer stem cells
Stem cells undergo a tightly regulated process where they generate additional stem cells or
differentiate into progeny progenitor cells with a more committed phenotype. A mitotic event
where both of the above cell types are generated is asymmetric self-renewal which occurs with
regularity in most postnatal stem cells and is a requisite event in tissue homeostasis. Stem cells
also possess capacity for clonal expansion, a symmetrical self renewal event generating two
identical cells which is an important process during developmental patterning324 or injury
response325. If the cell of origin is a stem cell, is it possible that a lesion in this cell type would
favor symmetric cancer stem cell expansion over asymmetric self-renewal? Cicalese and
colleagues demonstrated that mammary stem cells predominantly undergo asymmetric self
renewal, generating a predictable cluster of five cells over three cell generations. They
![Page 149: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/149.jpg)
136
documented a cytoplasmic fluorescent label retaining stem cell dividing once to maintain its
number, and rapidly dividing progenitors dividing twice to generate four daughters.
Interestingly, Erbb2 transformed mammary stem cells generated a cluster of eight cells with
equal label retention over the same period of time, reflecting three-generations of symmetric
division326. In the studies we have conducted, human fetal cells expand symmetrically, likely
representing the highly proliferative developmental state from which they were derived and the
inherent bias towards clonal expansion that is due to the NS culture system. The hypothesis that
normal human neural stem cells become transformed and shift from asymmetric to symmetric
self renewal is a theory that is difficult to address owing to the technical challenges and lack of
donor samples. In our study we are able to demonstrate that inducing asymmetric self-renewal
can decrease tumorigenesis in xenograft models. Using pharmacologic inhibitors of Notch we
demonstrated that we are able to induce asymmetric self renewal events in glioma cell lines
programmed to symmetrically self-renew. Our data has important implications for patient
treatment strategies and mechanisms of disease recurrence. Other studies using glioma stem cells
show that γ-secretase blockade results in an proliferative deficit primarily due to an increase in
apoptosis139. To building upon prior works, in addition to apoptosis, we have proven that the
proliferative deficit is due to neuronal lineage commitment of a daughter progenitor cell from an
asymmetrically self-renewing cancer stem cell. We are able to resolve these functional
differences in our in-vivo orthotopic strategy and replating experiments. Fan and colleagues
conducted in-vivo experiments with persistent administration of γSI soaked polymer beads, an
approach that may be subject to variations in dosage in-situ in addition to the potential for very
high proximal concentrations of γSI that may induce non-specific toxicity. Our ex-vivo approach
has the advantage of revealing remission status, a common occurrence in individuals with high
grade glioma.
5.3.3. Cancer as a caricature of development
Cancer has previously been described as a mockery of normal tissue development, often
containing multiple histological characteristics of the different cell types derived from the
originating embryonic germ layer. Therefore, is it possible that a brain tumor can recapitulate a
specific stage in development? Lee and colleagues observed that glioma stem cells derived from
patient GBM were sensitive to BMP treatment and express lineage markers in response to BMPR
activation. Interestingly, they also observed that some patient CSCs increased proliferation and
![Page 150: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/150.jpg)
137
failed to differentiate in response to BMPs. They postulated that this was due to ‘mimicry’ of the
primitive E11 murine stage of development which is insensitive to BMP signals whereas the
majority of BMP responsive lines were BMPR1B positive and recapitulated the later stages of
embryonic neural stem cells327. Our study and others212, have characterized a proneural
expression profile amongst a subset of glioma. We have demonstrated that this subset,
characterized by high Dll3 and Ascl1 expression, acquires neuronal lineage markers upon Notch
blockade. Are there cell types in the normal developing mouse forebrain with similar patterns of
expression? At E12.5 in murine development, neural stem cells highly express neurogenin1/2
and Mash1 to promote a neurogenic program and induce neuronal differentiation. E14.5 cortical
precursors, in contrast are programmed for glial differentiation to support growth and
development existing neurons. Thus, these glial programmed cells are refractory to ectopic
expression of Mash1328. In our observations, neurogenic glioblastoma lines genetically resemble
the early E12.5 stage in development whereas non-neurogenic lines appear to recapitulate the
glial stages of development commonly seen at E14.5 and later. Indeed, we have shown that glial
phenotypes persist in this class of NS lines even when Ascl1 expression is rescued by Notch/Hes
blockade, suggesting insensitivity to the neurogenic effects of Ascl1. Additionally, Hirabayashi
and colleagues showed that E11.5 early neural progenitors are responsive to stabilized β-catenin
and undergo neurogenesis, an effect that diminishes in late culture neurospheres and the more
mature embryonic forebrain SCs. Electroporation of Wnt3A in the E13.5 cortex also promotes
ectopic neuronal growth resulting in cortical dysplasia and neuronal heterotopia.
Correspondingly, electroporation of Dkk1 at E13.5 or E15.5 reduces the prevalence of Ctip2 and
Cux1 positive neurons respectively329. Further, NSCs derived from E17.5 embryos are not
responsive to Wnt pathway activation330. Indeed, this hypothesis is supported by our synergistic
experiments with Wnt agonists. We showed that activation of the Wnt signaling pathway by
blockade of GSK-3β effectively synergizes with Notch antagonists in neurogenic lines but not
non-neurogenic lines. Taken together, human glioblastoma stem cells can be functionally
classified into groups that recapitulate normal stages of CNS development (Figure 5-1).
Identifying the patterns of gene expression which label CSCs as resembling early or late neural
precursors may allow us to predict to the responsiveness of glioblastoma to certain pathway
agonists/antagonists and lead to the development of tailored patient therapies.
![Page 151: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/151.jpg)
138
Figure 4-2
NS lines recapitulate stages of embryonic neocortical development. Glioma and human fetal
neural stem cell lines demonstrate features of gene expression and neurogenic response to
signaling pathway activation that resemble stages of murine development. Based upon the
lineage marker in response to Notch antagonists and Wnt agonists, NS lines can be putatively
stratified into groups resembling ‘early’ neurogenic stem cells (E10-E14) or ‘late-stage’
astrogenic (E14-P0) stem cells.
![Page 152: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/152.jpg)
139
5.4. Future Direction This thesis has provided evidence to support the role of the Notch pathway in cancer stem cell
self-renewal and lineage commitment. As a preclinical model of brain tumor formation, we have
unveiled previously unappreciated roles for Notch in the regulation of symmetric growth in
cancers. These findings raise additional questions and queries that are to be addressed by the
author of this thesis and colleagues; present and future.
5.4.1. How can we target non-neurogenic glioblastoma?
This thesis has shown that a subset of glioblastoma stem cells marked by high Ascl1 and Dll3
expression undergoes neuronal lineage differentiation in response to Notch blockade. Principle
component analysis of the two subgroups identified by neuronal differentiation response showed
significant differences in gene expression between the two groups (Table 2-2). Several probe
sets in this list corresponded to the HMG-box transcription factor Sox4. Evidence from the
literature supports the argument that this gene has critical functions in neuronal survival and
nervous system development. In the developing murine CNS, over expression of Sox4 causes
cerebellar malformation due to an absence of Bergmann glia202 and astrocytic differentiation in-
vitro down regulates Sox4331, suggesting an anti-gliogenic role. Additionally, forced expression
of Sox4 in oligodendrocytes precursors prevents maturation and inhibits myelination332.
Expression of the transcriptional repressor protein REST/NRSF, an inhibitor of Sox4, inhibits the
expression of neuronal markers in undifferentiated neural cells333. Collectively, these studies
support the hypothesis that Sox4 has a role in neuronal lineage commitment at the expense of
other cell types and thus relative under expression of this gene in non-neurogenic NS lines may
explain why these cells fail to undergo neuronal differentiation.
Interestingly, Sox4 may have roles in regulating Wnt and Notch signaling. Sox4 stabilizes
activated β-catenin and can directly interact with the TCF/LEF activation complex thereby
potentiating Wnt signaling334. Moreover, HMG-box factors have classical roles in activating
transcription and Sox4 targets include the frizzled receptors and the Notch Delta-like ligands335.
Therefore, we have presented compelling evidence which would support the role of Sox4 in the
neuronal differentiation of neurogenic NS lines. It is an intriguing possibility that over
expression of Sox4 in NS lines via a delivery vector may rescue neuronal lineage differentiation
![Page 153: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/153.jpg)
140
in our resistant lines. We therefore hypothesize that the defect in neuronal lineage differentiation
may be due to a lack of Sox4 expression and that activation of Sox4 protein expression, either
exogenously or by suppressing negative regulators of Sox4 may restore this cell fate.
5.4.2. Targeting Notch in CNS tumors
Finally, the findings presented in this thesis have been exclusive to glioblastoma. However,
many other brain cancer subtypes contribute to overall cancer deaths. As our lab develops the
technical sophistication to study medulloblastoma and ependymoma stem cells as adherent
precursor cultures, we will use the same approach documented in this thesis to study the role of
Notch in these cancers. We hypothesize that symmetric versus asymmetric cancer stem cell self-
renewal is regulated by Notch signaling in medulloblastoma and ependymoma stem cells. We
perturb Notch signaling in these cell populations and document the effect via live cell imaging.
![Page 154: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/154.jpg)
141
References 1. Jemal, A. et al. Cancer statistics, 2009. CA: a cancer journal for clinicians 59, 225-249
(2009).
2. Committee, C.C.S.s.S. Canadian Cancer Statistics 2009. (2009).
3. Louis, D., Ohgaki, H., Wiestler, OD., Cavenee, WK. WHO Classification of Tumours of the Central Nervous System. WHO Press (2007).
4. Hanahan, D. & Weinberg, R.A. The hallmarks of cancer. Cell 100, 57-70 (2000).
5. Knudson, A.G., Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 68, 820-823 (1971).
6. Darnell, J.E., Jr. Transcription factors as targets for cancer therapy. Nature reviews 2, 740-749 (2002).
7. Louvi, A. & Artavanis-Tsakonas, S. Notch signalling in vertebrate neural development. Nat Rev Neurosci 7, 93-102 (2006).
8. Greenwald, I. LIN-12/Notch signaling: lessons from worms and flies. Genes Dev 12, 1751-1762 (1998).
9. Artavanis-Tsakonas, S., Matsuno, K. & Fortini, M.E. Notch signaling. Science 268, 225-232 (1995).
10. Ellisen, L.W. et al. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661 (1991).
11. Haines, N. & Irvine, K.D. Glycosylation regulates Notch signalling. Nat Rev Mol Cell Biol 4, 786-797 (2003).
12. Blaumueller, C.M., Qi, H., Zagouras, P. & Artavanis-Tsakonas, S. Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane. Cell 90, 281-291 (1997).
13. Rand, M.D., Lindblom, A., Carlson, J., Villoutreix, B.O. & Stenflo, J. Calcium binding to tandem repeats of EGF-like modules. Expression and characterization of the EGF-like modules of human Notch-1 implicated in receptor-ligand interactions. Protein Sci 6, 2059-2071 (1997).
14. Rand, M.D. et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Molecular and cellular biology 20, 1825-1835 (2000).
15. Lei, L., Xu, A., Panin, V.M. & Irvine, K.D. An O-fucose site in the ligand binding domain inhibits Notch activation. Development 130, 6411-6421 (2003).
![Page 155: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/155.jpg)
142
16. Le Borgne, R., Bardin, A. & Schweisguth, F. The roles of receptor and ligand endocytosis in regulating Notch signaling. Development 132, 1751-1762 (2005).
17. Brou, C. et al. A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Molecular cell 5, 207-216 (2000).
18. De Strooper, B. et al. A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398, 518-522 (1999).
19. Chung, H.M. & Struhl, G. Nicastrin is required for Presenilin-mediated transmembrane cleavage in Drosophila. Nature cell biology 3, 1129-1132 (2001).
20. Yu, G. et al. Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 407, 48-54 (2000).
21. Struhl, G. & Greenwald, I. Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature 398, 522-525 (1999).
22. Struhl, G. & Adachi, A. Requirements for presenilin-dependent cleavage of notch and other transmembrane proteins. Molecular cell 6, 625-636 (2000).
23. Struhl, G. & Greenwald, I. Presenilin-mediated transmembrane cleavage is required for Notch signal transduction in Drosophila. Proc Natl Acad Sci U S A 98, 229-234 (2001).
24. Francis, R. et al. aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev Cell 3, 85-97 (2002).
25. Chen, F. et al. TMP21 is a presenilin complex component that modulates gamma-secretase but not epsilon-secretase activity. Nature 440, 1208-1212 (2006).
26. Pardossi-Piquard, R. et al. TMP21 transmembrane domain regulates gamma-secretase cleavage. J Biol Chem 284, 28634-28641 (2009).
27. Wu, L. et al. MAML1, a human homologue of Drosophila mastermind, is a transcriptional co-activator for NOTCH receptors. Nature genetics 26, 484-489 (2000).
28. Hermanson, O., Jepsen, K. & Rosenfeld, M.G. N-CoR controls differentiation of neural stem cells into astrocytes. Nature 419, 934-939 (2002).
29. Andreu-Agullo, C., Morante-Redolat, J.M., Delgado, A.C. & Farinas, I. Vascular niche factor PEDF modulates Notch-dependent stemness in the adult subependymal zone. Nat Neurosci 12, 1514-1523 (2009).
30. Iso, T. et al. HERP, a novel heterodimer partner of HES/E(spl) in Notch signaling. Molecular and cellular biology 21, 6080-6089 (2001).
![Page 156: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/156.jpg)
143
31. Fleming, R.J., Scottgale, T.N., Diederich, R.J. & Artavanis-Tsakonas, S. The gene Serrate encodes a putative EGF-like transmembrane protein essential for proper ectodermal development in Drosophila melanogaster. Genes Dev 4, 2188-2201 (1990).
32. Kim, I.M., Wolf, M.J. & Rockman, H.A. Gene Deletion Screen for Cardiomyopathy in Adult Drosophila Identifies a New Notch Ligand. Circulation research.
33. Miller, A.C., Lyons, E.L. & Herman, T.G. cis-Inhibition of Notch by endogenous Delta biases the outcome of lateral inhibition. Curr Biol 19, 1378-1383 (2009).
34. Sprinzak, D. et al. Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature 465, 86-90.
35. Schmidt, M.H. et al. Epidermal growth factor-like domain 7 (EGFL7) modulates Notch signalling and affects neural stem cell renewal. Nature cell biology (2009).
36. Kelly, D.F. et al. Molecular structure and dimeric organization of the Notch extracellular domain as revealed by electron microscopy. PLoS ONE 5, e10532 (2010).
37. Sanchez-Irizarry, C. et al. Notch subunit heterodimerization and prevention of ligand-independent proteolytic activation depend, respectively, on a novel domain and the LNR repeats. Molecular and cellular biology 24, 9265-9273 (2004).
38. Kopan, R., Nye, J.S. & Weintraub, H. The intracellular domain of mouse Notch: a constitutively activated repressor of myogenesis directed at the basic helix-loop-helix region of MyoD. Development 120, 2385-2396 (1994).
39. Ehebauer, M.T., Chirgadze, D.Y., Hayward, P., Martinez Arias, A. & Blundell, T.L. High-resolution crystal structure of the human Notch 1 ankyrin domain. The Biochemical journal 392, 13-20 (2005).
40. Beatus, P., Lundkvist, J., Oberg, C., Pedersen, K. & Lendahl, U. The origin of the ankyrin repeat region in Notch intracellular domains is critical for regulation of HES promoter activity. Mech Dev 104, 3-20 (2001).
41. Wilson, J.J. & Kovall, R.A. Crystal structure of the CSL-Notch-Mastermind ternary complex bound to DNA. Cell 124, 985-996 (2006).
42. Oberg, C. et al. The Notch intracellular domain is ubiquitinated and negatively regulated by the mammalian Sel-10 homolog. J Biol Chem 276, 35847-35853 (2001).
43. Jin, Y.H. et al. Beta-catenin modulates the level and transcriptional activity of Notch1/NICD through its direct interaction. Biochimica et biophysica acta 1793, 290-299 (2009).
44. Alves-Guerra, M.C., Ronchini, C. & Capobianco, A.J. Mastermind-like 1 Is a specific coactivator of beta-catenin transcription activation and is essential for colon carcinoma cell survival. Cancer Res 67, 8690-8698 (2007).
![Page 157: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/157.jpg)
144
45. Zhao, Y. et al. The notch regulator MAML1 interacts with p53 and functions as a coactivator. J Biol Chem 282, 11969-11981 (2007).
46. Gustafsson, M.V. et al. Hypoxia requires notch signaling to maintain the undifferentiated cell state. Dev Cell 9, 617-628 (2005).
47. Wang, R. et al. Transcriptional regulation of APH-1A and increased gamma-secretase cleavage of APP and Notch by HIF-1 and hypoxia. Faseb J 20, 1275-1277 (2006).
48. Anthony, T.E., Mason, H.A., Gridley, T., Fishell, G. & Heintz, N. Brain lipid-binding protein is a direct target of Notch signaling in radial glial cells. Genes Dev 19, 1028-1033 (2005).
49. Bhattacharya, S., Das, A., Mallya, K. & Ahmad, I. Maintenance of retinal stem cells by Abcg2 is regulated by notch signaling. J Cell Sci 120, 2652-2662 (2007).
50. Shih, A.H. & Holland, E.C. Notch signaling enhances nestin expression in gliomas. Neoplasia (New York, N.Y 8, 1072-1082 (2006).
51. Reya, T. & Clevers, H. Wnt signalling in stem cells and cancer. Nature 434, 843-850 (2005).
52. McCulloch, E.A. & Till, J.E. The sensitivity of cells from normal mouse bone marrow to gamma radiation in vitro and in vivo. Radiation research 16, 822-832 (1962).
53. Barker, N. et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1003-1007 (2007).
54. Toma, J.G. et al. Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nature cell biology 3, 778-784 (2001).
55. Shackleton, M. et al. Generation of a functional mammary gland from a single stem cell. Nature 439, 84-88 (2006).
56. Kim, C.F. et al. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 121, 823-835 (2005).
57. Goldman, S.A. & Nottebohm, F. Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain. Proc Natl Acad Sci U S A 80, 2390-2394 (1983).
58. Reynolds, B.A., Tetzlaff, W. & Weiss, S. A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J Neurosci 12, 4565-4574 (1992).
59. Kuhn, H.G., Dickinson-Anson, H. & Gage, F.H. Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci 16, 2027-2033 (1996).
![Page 158: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/158.jpg)
145
60. Doetsch, F., Caille, I., Lim, D.A., Garcia-Verdugo, J.M. & Alvarez-Buylla, A. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703-716 (1999).
61. Suhonen, J.O., Peterson, D.A., Ray, J. & Gage, F.H. Differentiation of adult hippocampus-derived progenitors into olfactory neurons in vivo. Nature 383, 624-627 (1996).
62. Lois, C., Garcia-Verdugo, J.M. & Alvarez-Buylla, A. Chain migration of neuronal precursors. Science 271, 978-981 (1996).
63. Arvidsson, A., Collin, T., Kirik, D., Kokaia, Z. & Lindvall, O. Neuronal replacement from endogenous precursors in the adult brain after stroke. Nature medicine 8, 963-970 (2002).
64. Emsley, J.G., Mitchell, B.D., Kempermann, G. & Macklis, J.D. Adult neurogenesis and repair of the adult CNS with neural progenitors, precursors, and stem cells. Progress in neurobiology 75, 321-341 (2005).
65. Thored, P. et al. Persistent production of neurons from adult brain stem cells during recovery after stroke. Stem Cells 24, 739-747 (2006).
66. Yamashita, T. et al. Subventricular zone-derived neuroblasts migrate and differentiate into mature neurons in the post-stroke adult striatum. J Neurosci 26, 6627-6636 (2006).
67. Eriksson, P.S. et al. Neurogenesis in the adult human hippocampus. Nature medicine 4, 1313-1317 (1998).
68. Schmidt-Hieber, C., Jonas, P. & Bischofberger, J. Enhanced synaptic plasticity in newly generated granule cells of the adult hippocampus. Nature 429, 184-187 (2004).
69. Curtis, M.A. et al. Human neuroblasts migrate to the olfactory bulb via a lateral ventricular extension. Science 315, 1243-1249 (2007).
70. Nagato, M. et al. Prospective characterization of neural stem cells by flow cytometry analysis using a combination of surface markers. J Neurosci Res 80, 456-466 (2005).
71. Basak, O. & Taylor, V. Identification of self-replicating multipotent progenitors in the embryonic nervous system by high Notch activity and Hes5 expression. Eur J Neurosci 25, 1006-1022 (2007).
72. Yoon, K. & Gaiano, N. Notch signaling in the mammalian central nervous system: insights from mouse mutants. Nat Neurosci 8, 709-715 (2005).
73. Hitoshi, S. et al. Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev 16, 846-858 (2002).
![Page 159: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/159.jpg)
146
74. Ohtsuka, T., Sakamoto, M., Guillemot, F. & Kageyama, R. Roles of the basic helix-loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. J Biol Chem 276, 30467-30474 (2001).
75. Gaiano, N., Nye, J.S. & Fishell, G. Radial glial identity is promoted by Notch1 signaling in the murine forebrain. Neuron 26, 395-404 (2000).
76. Tanigaki, K. et al. Notch1 and Notch3 instructively restrict bFGF-responsive multipotent neural progenitor cells to an astroglial fate. Neuron 29, 45-55 (2001).
77. Solecki, D.J., Liu, X.L., Tomoda, T., Fang, Y. & Hatten, M.E. Activated Notch2 signaling inhibits differentiation of cerebellar granule neuron precursors by maintaining proliferation. Neuron 31, 557-568 (2001).
78. Stump, G. et al. Notch1 and its ligands Delta-like and Jagged are expressed and active in distinct cell populations in the postnatal mouse brain. Mech Dev 114, 153-159 (2002).
79. Nyfeler, Y. et al. Jagged1 signals in the postnatal subventricular zone are required for neural stem cell self-renewal. The EMBO journal 24, 3504-3515 (2005).
80. Aguirre, A., Rubio, M.E. & Gallo, V. Notch and EGFR pathway interaction regulates neural stem cell number and self-renewal. Nature 467, 323-327 (2010).
81. Namihira, M. et al. Committed neuronal precursors confer astrocytic potential on residual neural precursor cells. Dev Cell 16, 245-255 (2009).
82. Shen, Q. et al. Endothelial cells stimulate self-renewal and expand neurogenesis of neural stem cells. Science 304, 1338-1340 (2004).
83. Hansen, D.V., Lui, J.H., Parker, P.R. & Kriegstein, A.R. Neurogenic radial glia in the outer subventricular zone of human neocortex. Nature 464, 554-561 (2010).
84. Hu, Q.D. et al. F3/contactin acts as a functional ligand for Notch during oligodendrocyte maturation. Cell 115, 163-175 (2003).
85. Hu, Q.D., Ma, Q.H., Gennarini, G. & Xiao, Z.C. Cross-talk between F3/contactin and Notch at axoglial interface: a role in oligodendrocyte development. Dev Neurosci 28, 25-33 (2006).
86. Cui, X.Y. et al. NB-3/Notch1 pathway via Deltex1 promotes neural progenitor cell differentiation into oligodendrocytes. J Biol Chem 279, 25858-25865 (2004).
87. Kageyama, R., Ohtsuka, T., Shimojo, H. & Imayoshi, I. Dynamic Notch signaling in neural progenitor cells and a revised view of lateral inhibition. Nat Neurosci 11, 1247-1251 (2008).
88. Sestan, N., Artavanis-Tsakonas, S. & Rakic, P. Contact-dependent inhibition of cortical neurite growth mediated by notch signaling. Science 286, 741-746 (1999).
![Page 160: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/160.jpg)
147
89. Ahmad, I., Zaqouras, P. & Artavanis-Tsakonas, S. Involvement of Notch-1 in mammalian retinal neurogenesis: association of Notch-1 activity with both immature and terminally differentiated cells. Mech Dev 53, 73-85 (1995).
90. Brunschwig, A., Southam, C.M. & Levin, A.G. Host resistance to cancer. Clinical experiments by homotransplants, autotransplants and admixture of autologous leucocytes. Annals of surgery 162, 416-425 (1965).
91. Bruce, W.R. & Van Der Gaag, H. A Quantitative Assay for the Number of Murine Lymphoma Cells Capable of Proliferation in Vivo. Nature 199, 79-80 (1963).
92. Park, C.H., Bergsagel, D.E. & McCulloch, E.A. Mouse myeloma tumor stem cells: a primary cell culture assay. Journal of the National Cancer Institute 46, 411-422 (1971).
93. Hamburger, A.W. & Salmon, S.E. Primary bioassay of human tumor stem cells. Science 197, 461-463 (1977).
94. Lapidot, T. et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367, 645-648 (1994).
95. Al-Hajj, M., Wicha, M.S., Benito-Hernandez, A., Morrison, S.J. & Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100, 3983-3988 (2003).
96. Collins, A.T., Berry, P.A., Hyde, C., Stower, M.J. & Maitland, N.J. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 65, 10946-10951 (2005).
97. Singh, S.K. et al. Identification of human brain tumour initiating cells. Nature 432, 396-401 (2004).
98. Galli, R. et al. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res 64, 7011-7021 (2004).
99. O'Brien C, A., Pollett, A., Gallinger, S. & Dick, J.E. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature (2006).
100. Ricci-Vitiani, L. et al. Identification and expansion of human colon-cancer-initiating cells. Nature (2006).
101. Li, C. et al. Identification of pancreatic cancer stem cells. Cancer Res 67, 1030-1037 (2007).
102. Wu, C. et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer Res 67, 8216-8222 (2007).
103. Schatton, T. et al. Identification of cells initiating human melanomas. Nature 451, 345-349 (2008).
![Page 161: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/161.jpg)
148
104. Boiko, A.D. et al. Human melanoma-initiating cells express neural crest nerve growth factor receptor CD271. Nature 466, 133-137 (2010).
105. Zhang, S. et al. Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res 68, 4311-4320 (2008).
106. Prince, M.E. et al. Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci U S A 104, 973-978 (2007).
107. Singh, S.K. et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 63, 5821-5828 (2003).
108. Longley, D.B., Harkin, D.P. & Johnston, P.G. 5-fluorouracil: mechanisms of action and clinical strategies. Nature reviews 3, 330-338 (2003).
109. Scharenberg, C.W., Harkey, M.A. & Torok-Storb, B. The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors. Blood 99, 507-512 (2002).
110. Goodell, M.A., Brose, K., Paradis, G., Conner, A.S. & Mulligan, R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806 (1996).
111. Zhou, S. et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nature medicine 7, 1028-1034 (2001).
112. Dean, M., Fojo, T. & Bates, S. Tumour stem cells and drug resistance. Nature reviews 5, 275-284 (2005).
113. Kondo, T., Setoguchi, T. & Taga, T. Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci U S A 101, 781-786 (2004).
114. Hirschmann-Jax, C. et al. A distinct "side population" of cells with high drug efflux capacity in human tumor cells. Proc Natl Acad Sci U S A 101, 14228-14233 (2004).
115. Bao, S. et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444, 756-760 (2006).
116. Radtke, F. & Raj, K. The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nature reviews 3, 756-767 (2003).
117. Weng, A.P. et al. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271 (2004).
118. Wilson, A., MacDonald, H.R. & Radtke, F. Notch 1-deficient common lymphoid precursors adopt a B cell fate in the thymus. J Exp Med 194, 1003-1012 (2001).
![Page 162: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/162.jpg)
149
119. Sambandam, A. et al. Notch signaling controls the generation and differentiation of early T lineage progenitors. Nat Immunol 6, 663-670 (2005).
120. Pui, J.C. et al. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11, 299-308 (1999).
121. Purow, B.W. et al. Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res 65, 2353-2363 (2005).
122. Dontu, G. et al. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 6, R605-615 (2004).
123. Talora, C., Sgroi, D.C., Crum, C.P. & Dotto, G.P. Specific down-modulation of Notch1 signaling in cervical cancer cells is required for sustained HPV-E6/E7 expression and late steps of malignant transformation. Genes Dev 16, 2252-2263 (2002).
124. Sriuranpong, V. et al. Notch signaling induces cell cycle arrest in small cell lung cancer cells. Cancer Res 61, 3200-3205 (2001).
125. Dufraine, J., Funahashi, Y. & Kitajewski, J. Notch signaling regulates tumor angiogenesis by diverse mechanisms. Oncogene 27, 5132-5137 (2008).
126. Li, J.L. et al. Delta-like 4 Notch ligand regulates tumor angiogenesis, improves tumor vascular function, and promotes tumor growth in vivo. Cancer Res 67, 11244-11253 (2007).
127. Dang, L. et al. Notch3 signaling initiates choroid plexus tumor formation. Oncogene 25, 487-491 (2006).
128. Dakubo, G.D., Mazerolle, C.J. & Wallace, V.A. Expression of Notch and Wnt pathway components and activation of Notch signaling in medulloblastomas from heterozygous patched mice. Journal of neuro-oncology 79, 221-227 (2006).
129. Ingram, W.J., McCue, K.I., Tran, T.H., Hallahan, A.R. & Wainwright, B.J. Sonic Hedgehog regulates Hes1 through a novel mechanism that is independent of canonical Notch pathway signalling. Oncogene (2007).
130. Ward, R.J. et al. Multipotent CD15+ cancer stem cells in patched-1-deficient mouse medulloblastoma. Cancer Res 69, 4682-4690 (2009).
131. Julian, E., Dave, R.K., Robson, J.P., Hallahan, A.R. & Wainwright, B.J. Canonical Notch signaling is not required for the growth of Hedgehog pathway-induced medulloblastoma. Oncogene 29, 3465-3476 (2010).
132. Julian, E., Hallahan, A.R. & Wainwright, B.J. RBP-J is not required for granule neuron progenitor development and medulloblastoma initiated by Hedgehog pathway activation in the external germinal layer. Neural development 5, 27.
![Page 163: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/163.jpg)
150
133. Fan, X. et al. Notch1 and notch2 have opposite effects on embryonal brain tumor growth. Cancer Res 64, 7787-7793 (2004).
134. Kanamori, M. et al. Contribution of Notch signaling activation to human glioblastoma multiforme. Journal of neurosurgery 106, 417-427 (2007).
135. Mei, J., Bachoo, R. & Zhang, C.L. MicroRNA-146a Inhibits Glioma Development by Targeting Notch1. Molecular and cellular biology (2011).
136. Jeon, H.M. et al. Inhibitor of differentiation 4 drives brain tumor-initiating cell genesis through cyclin E and notch signaling. Genes Dev 22, 2028-2033 (2008).
137. Fan, X. et al. Notch pathway inhibition depletes stem-like cells and blocks engraftment in embryonal brain tumors. Cancer Res 66, 7445-7452 (2006).
138. Hu, Y.Y. et al. Notch signaling contributes to the maintenance of both normal neural stem cells and patient-derived glioma stem cells. BMC cancer 11, 82 (2011).
139. Fan, X. et al. Notch Pathway Blockade Depletes CD133-Positive Glioblastoma Cells and Inhibits Growth of Tumor Neurospheres and Xenografts. Stem Cells (2009).
140. Chen, J. et al. Inhibition of Notch Signaling Blocks Growth of Glioblastoma Cell Lines and Tumor Neurospheres. Genes & cancer 1, 822-835 (2010).
141. Wang, J. et al. Notch promotes radioresistance of glioma stem cells. Stem Cells 28, 17-28 (2010).
142. Lin, J., Zhang, X.M., Yang, J.C., Ye, Y.B. & Luo, S.Q. gamma-secretase inhibitor-I enhances radiosensitivity of glioblastoma cell lines by depleting CD133+ tumor cells. Archives of medical research 41, 519-529 (2010).
143. Stupp, R. et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. The lancet oncology 10, 459-466 (2009).
144. Tonn, J.C. & ebrary Inc. xvi, 706 p. (Springer, Berlin ; New York; 2006).
145. Yarden, Y. & Sliwkowski, M.X. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2, 127-137 (2001).
146. Piccart-Gebhart, M.J. et al. Trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer. The New England journal of medicine 353, 1659-1672 (2005).
147. Network, T.C.G.A.R. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455, 1061-1068 (2008).
148. Taipale, J. & Beachy, P.A. The Hedgehog and Wnt signalling pathways in cancer. Nature 411, 349-354 (2001).
![Page 164: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/164.jpg)
151
149. Chojnacki, A., Shimazaki, T., Gregg, C., Weinmaster, G. & Weiss, S. Glycoprotein 130 signaling regulates Notch1 expression and activation in the self-renewal of mammalian forebrain neural stem cells. J Neurosci 23, 1730-1741 (2003).
150. Grandbarbe, L. et al. Delta-Notch signaling controls the generation of neurons/glia from neural stem cells in a stepwise process. Development 130, 1391-1402 (2003).
151. Morrison, S.J. et al. Transient Notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells. Cell 101, 499-510 (2000).
152. Ge, W. et al. Notch signaling promotes astrogliogenesis via direct CSL-mediated glial gene activation. J Neurosci Res 69, 848-860 (2002).
153. Breunig, J.J., Silbereis, J., Vaccarino, F.M., Sestan, N. & Rakic, P. Notch regulates cell fate and dendrite morphology of newborn neurons in the postnatal dentate gyrus. Proc Natl Acad Sci U S A 104, 20558-20563 (2007).
154. Salama-Cohen, P., Arevalo, M.A., Grantyn, R. & Rodriguez-Tebar, A. Notch and NGF/p75NTR control dendrite morphology and the balance of excitatory/inhibitory synaptic input to hippocampal neurones through Neurogenin 3. J Neurochem 97, 1269-1278 (2006).
155. Gaiano, N. & Fishell, G. The role of notch in promoting glial and neural stem cell fates. Annu Rev Neurosci 25, 471-490 (2002).
156. Campos, L.S. et al. Beta1 integrins activate a MAPK signalling pathway in neural stem cells that contributes to their maintenance. Development 131, 3433-3444 (2004).
157. Pollard, S.M. et al. Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. Cell stem cell 4, 568-580 (2009).
158. Dovey, H.F. et al. Functional gamma-secretase inhibitors reduce beta-amyloid peptide levels in brain. J Neurochem 76, 173-181 (2001).
159. Lammich, S. et al. Presenilin-dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Abeta-like peptide. J Biol Chem 277, 44754-44759 (2002).
160. Ni, C.Y., Murphy, M.P., Golde, T.E. & Carpenter, G. gamma -Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294, 2179-2181 (2001).
161. Lyu, J., Yamamoto, V. & Lu, W. Cleavage of the Wnt receptor Ryk regulates neuronal differentiation during cortical neurogenesis. Dev Cell 15, 773-780 (2008).
162. Maillard, I. et al. Mastermind critically regulates Notch-mediated lymphoid cell fate decisions. Blood 104, 1696-1702 (2004).
![Page 165: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/165.jpg)
152
163. Weng, A.P. et al. Growth suppression of pre-T acute lymphoblastic leukemia cells by inhibition of notch signaling. Molecular and cellular biology 23, 655-664 (2003).
164. Hooper, C., Chapple, J.P., Lovestone, S. & Killick, R. The Notch-1 intracellular domain is found in sub-nuclear bodies in SH-SY5Y neuroblastomas and in primary cortical neurons. Neuroscience letters 415, 135-139 (2007).
165. Shearman, M.S. et al. L-685,458, an aspartyl protease transition state mimic, is a potent inhibitor of amyloid beta-protein precursor gamma-secretase activity. Biochemistry 39, 8698-8704 (2000).
166. Tanaka, M., Kadokawa, Y., Hamada, Y. & Marunouchi, T. Notch2 expression negatively correlates with glial differentiation in the postnatal mouse brain. J Neurobiol 41, 524-539 (1999).
167. Lee, M.K., Tuttle, J.B., Rebhun, L.I., Cleveland, D.W. & Frankfurter, A. The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis. Cell motility and the cytoskeleton 17, 118-132 (1990).
168. Carleton, A., Petreanu, L.T., Lansford, R., Alvarez-Buylla, A. & Lledo, P.M. Becoming a new neuron in the adult olfactory bulb. Nat Neurosci 6, 507-518 (2003).
169. van Praag, H. et al. Functional neurogenesis in the adult hippocampus. Nature 415, 1030-1034 (2002).
170. Song, H.J., Stevens, C.F. & Gage, F.H. Neural stem cells from adult hippocampus develop essential properties of functional CNS neurons. Nat Neurosci 5, 438-445 (2002).
171. Berninger, B., Guillemot, F. & Gotz, M. Directing neurotransmitter identity of neurones derived from expanded adult neural stem cells. Eur J Neurosci 25, 2581-2590 (2007).
172. Pollard, S.M., Conti, L., Sun, Y., Goffredo, D. & Smith, A. Adherent neural stem (NS) cells from fetal and adult forebrain. Cereb Cortex 16 Suppl 1, i112-120 (2006).
173. Sun, Y. et al. Long-term tripotent differentiation capacity of human neural stem (NS) cells in adherent culture. Molecular and cellular neurosciences 38, 245-258 (2008).
174. Eisen, M.B., Spellman, P.T., Brown, P.O. & Botstein, D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95, 14863-14868 (1998).
175. McGill, M.A. & McGlade, C.J. Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J Biol Chem 278, 23196-23203 (2003).
176. Pece, S. et al. Loss of negative regulation by Numb over Notch is relevant to human breast carcinogenesis. J Cell Biol 167, 215-221 (2004).
![Page 166: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/166.jpg)
153
177. Zhang, P., Yang, Y., Nolo, R., Zweidler-McKay, P.A. & Hughes, D.P. Regulation of NOTCH signaling by reciprocal inhibition of HES1 and Deltex 1 and its role in osteosarcoma invasiveness. Oncogene.
178. Potzner, M.R. et al. Sequential requirement of Sox4 and Sox11 during development of the sympathetic nervous system. Development 137, 775-784.
179. Hanson, C.A. & Miller, J.R. Non-traditional roles for the Adenomatous Polyposis Coli (APC) tumor suppressor protein. Gene 361, 1-12 (2005).
180. Otero, J.J., Fu, W., Kan, L., Cuadra, A.E. & Kessler, J.A. Beta-catenin signaling is required for neural differentiation of embryonic stem cells. Development 131, 3545-3557 (2004).
181. Hirabayashi, Y. et al. The Wnt/beta-catenin pathway directs neuronal differentiation of cortical neural precursor cells. Development 131, 2791-2801 (2004).
182. Hirabayashi, Y. & Gotoh, Y. Stage-dependent fate determination of neural precursor cells in mouse forebrain. Neuroscience research 51, 331-336 (2005).
183. Fre, S. et al. Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proc Natl Acad Sci U S A 106, 6309-6314 (2009).
184. Pannequin, J. et al. The wnt target jagged-1 mediates the activation of notch signaling by progastrin in human colorectal cancer cells. Cancer Res 69, 6065-6073 (2009).
185. Korur, S. et al. GSK3beta regulates differentiation and growth arrest in glioblastoma. PLoS ONE 4, e7443 (2009).
186. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P. & Brivanlou, A.H. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nature medicine 10, 55-63 (2004).
187. Druker, B.J. et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. The New England journal of medicine 344, 1031-1037 (2001).
188. Druker, B.J. et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nature medicine 2, 561-566 (1996).
189. Cobleigh, M.A. et al. Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17, 2639-2648 (1999).
190. Slamon, D.J. et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. The New England journal of medicine 344, 783-792 (2001).
![Page 167: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/167.jpg)
154
191. Ohtsuka, T. et al. Hes1 and Hes5 as notch effectors in mammalian neuronal differentiation. The EMBO journal 18, 2196-2207 (1999).
192. Ishibashi, M. et al. Persistent expression of helix-loop-helix factor HES-1 prevents mammalian neural differentiation in the central nervous system. The EMBO journal 13, 1799-1805 (1994).
193. de la Pompa, J.L. et al. Conservation of the Notch signalling pathway in mammalian neurogenesis. Development 124, 1139-1148 (1997).
194. Wall, D.S. et al. Progenitor cell proliferation in the retina is dependent on Notch-independent Sonic hedgehog/Hes1 activity. J Cell Biol 184, 101-112 (2009).
195. Sang, L., Coller, H.A. & Roberts, J.M. Control of the reversibility of cellular quiescence by the transcriptional repressor HES1. Science 321, 1095-1100 (2008).
196. Esler, W.P. et al. Transition-state analogue inhibitors of gamma-secretase bind directly to presenilin-1. Nature cell biology 2, 428-434 (2000).
197. Aste-Amezaga, M. et al. Characterization of Notch1 antibodies that inhibit signaling of both normal and mutated Notch1 receptors. PLoS ONE 5, e9094 (2010).
198. Schreck, K.C. et al. The Notch target Hes1 directly modulates Gli1 expression and Hedgehog signaling: a potential mechanism of therapeutic resistance. Clin Cancer Res 16, 6060-6070 (2011).
199. Pattyn, A. et al. Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat Neurosci 7, 589-595 (2004).
200. Vierbuchen, T. et al. Direct conversion of fibroblasts to functional neurons by defined factors. Nature (2010).
201. Castro, D.S. et al. A novel function of the proneural factor Ascl1 in progenitor proliferation identified by genome-wide characterization of its targets. Genes Dev 25, 930-945 (2011).
202. Hoser, M. et al. Prolonged glial expression of Sox4 in the CNS leads to architectural cerebellar defects and ataxia. J Neurosci 27, 5495-5505 (2007).
203. Ying, M. et al. Kruppel-like family of transcription factor 9, a differentiation-associated transcription factor, suppresses Notch1 signaling and inhibits glioblastoma-initiating stem cells. Stem Cells 29, 20-31 (2011).
204. Dieter, S.M. et al. Distinct types of tumor-initiating cells form human colon cancer tumors and metastases. Cell stem cell 9, 357-365 (2011).
205. Katoh, M. & Katoh, M. Notch ligand, JAG1, is evolutionarily conserved target of canonical WNT signaling pathway in progenitor cells. Int J Mol Med 17, 681-685 (2006).
![Page 168: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/168.jpg)
155
206. Shimizu, T. et al. Stabilized beta-catenin functions through TCF/LEF proteins and the Notch/RBP-Jkappa complex to promote proliferation and suppress differentiation of neural precursor cells. Molecular and cellular biology 28, 7427-7441 (2008).
207. Foltz, D.R., Santiago, M.C., Berechid, B.E. & Nye, J.S. Glycogen synthase kinase-3beta modulates notch signaling and stability. Curr Biol 12, 1006-1011 (2002).
208. Espinosa, L., Ingles-Esteve, J., Aguilera, C. & Bigas, A. Phosphorylation by glycogen synthase kinase-3 beta down-regulates Notch activity, a link for Notch and Wnt pathways. J Biol Chem 278, 32227-32235 (2003).
209. Conboy, L. et al. Notch signalling becomes transiently attenuated during long-term memory consolidation in adult Wistar rats. Neurobiology of learning and memory 88, 342-351 (2007).
210. Kinzler, K.W. & Vogelstein, B. Lessons from hereditary colorectal cancer. Cell 87, 159-170 (1996).
211. Hamilton, S.R. et al. The molecular basis of Turcot's syndrome. The New England journal of medicine 332, 839-847 (1995).
212. Phillips, H.S. et al. Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis. Cancer cell 9, 157-173 (2006).
213. Verhaak, R.G. et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer cell 17, 98-110 (2010).
214. Real, P.J. et al. gamma-secretase inhibitors reverse glucocorticoid resistance in T cell acute lymphoblastic leukemia. Nature medicine (2008).
215. Boltan, D.D. & Fenves, A.Z. Effectiveness of normal saline diuresis in treating lithium overdose. Proceedings (Baylor University 21, 261-263 (2008).
216. Huang, M.E. et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 72, 567-572 (1988).
217. Campos, B. et al. Differentiation Therapy Exerts Antitumor Effects on Stem-like Glioma Cells. Clin Cancer Res (2010).
218. Clynes, R.A., Towers, T.L., Presta, L.G. & Ravetch, J.V. Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nature medicine 6, 443-446 (2000).
219. Dash, P.K., Moore, A.N. & Orsi, S.A. Blockade of gamma-secretase activity within the hippocampus enhances long-term memory. Biochem Biophys Res Commun 338, 777-782 (2005).
![Page 169: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/169.jpg)
156
220. Oya, S. et al. Attenuation of Notch signaling promotes the differentiation of neural progenitors into neurons in the hippocampal CA1 region after ischemic injury. Neuroscience 158, 683-692 (2009).
221. Strijbosch, L.W., Buurman, W.A., Does, R.J., Zinken, P.H. & Groenewegen, G. Limiting dilution assays. Experimental design and statistical analysis. Journal of immunological methods 97, 133-140 (1987).
222. Sharrock, C.E., Kaminski, E. & Man, S. Limiting dilution analysis of human T cells: a useful clinical tool. Immunology today 11, 281-286 (1990).
223. Lefort, K. et al. Notch1 is a p53 target gene involved in human keratinocyte tumor suppression through negative regulation of ROCK1/2 and MRCKalpha kinases. Genes Dev 21, 562-577 (2007).
224. Klassen, H., Ziaeian, B., Kirov, II, Young, M.J. & Schwartz, P.H. Isolation of retinal progenitor cells from post-mortem human tissue and comparison with autologous brain progenitors. J Neurosci Res 77, 334-343 (2004).
225. Nijjar, S.S., Wallace, L., Crosby, H.A., Hubscher, S.G. & Strain, A.J. Altered Notch ligand expression in human liver disease: further evidence for a role of the Notch signaling pathway in hepatic neovascularization and biliary ductular defects. The American journal of pathology 160, 1695-1703 (2002).
226. Lathia, J.D. et al. Distribution of CD133 reveals glioma stem cells self-renew through symmetric and asymmetric cell divisions. Cell death & disease 2, e200 (2011).
227. Johnson, K. & Wodarz, A. A genetic hierarchy controlling cell polarity. Nature cell biology 5, 12-14 (2003).
228. Langevin, J. et al. Lethal giant larvae controls the localization of notch-signaling regulators numb, neuralized, and Sanpodo in Drosophila sensory-organ precursor cells. Curr Biol 15, 955-962 (2005).
229. Le Borgne, R. & Schweisguth, F. Unequal segregation of Neuralized biases Notch activation during asymmetric cell division. Dev Cell 5, 139-148 (2003).
230. McGill, M.A., Dho, S.E., Weinmaster, G. & McGlade, C.J. Numb regulates post-endocytic trafficking and degradation of Notch1. J Biol Chem 284, 26427-26438 (2009).
231. Smith, C.A., Dho, S.E., Donaldson, J., Tepass, U. & McGlade, C.J. The cell fate determinant numb interacts with EHD/Rme-1 family proteins and has a role in endocytic recycling. Molecular biology of the cell 15, 3698-3708 (2004).
232. Coumailleau, F., Furthauer, M., Knoblich, J.A. & Gonzalez-Gaitan, M. Directional Delta and Notch trafficking in Sara endosomes during asymmetric cell division. Nature 458, 1051-1055 (2009).
![Page 170: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/170.jpg)
157
233. Zhong, W., Feder, J.N., Jiang, M.M., Jan, L.Y. & Jan, Y.N. Asymmetric localization of a mammalian numb homolog during mouse cortical neurogenesis. Neuron 17, 43-53 (1996).
234. Zhong, W., Jiang, M.M., Weinmaster, G., Jan, L.Y. & Jan, Y.N. Differential expression of mammalian Numb, Numblike and Notch1 suggests distinct roles during mouse cortical neurogenesis. Development 124, 1887-1897 (1997).
235. Androutsellis-Theotokis, A. et al. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature 442, 823-826 (2006).
236. Iwasa, Y., Nowak, M.A. & Michor, F. Evolution of resistance during clonal expansion. Genetics 172, 2557-2566 (2006).
237. Iwasa, Y., Michor, F. & Nowak, M.A. Evolutionary dynamics of escape from biomedical intervention. Proceedings 270, 2573-2578 (2003).
238. Michor, F., Nowak, M.A. & Iwasa, Y. Evolution of resistance to cancer therapy. Current pharmaceutical design 12, 261-271 (2006).
239. Curry, C.L., Reed, L.L., Nickoloff, B.J., Miele, L. & Foreman, K.E. Notch-independent regulation of Hes-1 expression by c-Jun N-terminal kinase signaling in human endothelial cells. Laboratory investigation; a journal of technical methods and pathology 86, 842-852 (2006).
240. Ramunas, J. et al. True monolayer cell culture in a confined 3D microenvironment enables lineage informatics. Cytometry A 69, 1202-1211 (2006).
241. Perumalsamy, L.R., Nagala, M. & Sarin, A. Notch-activated signaling cascade interacts with mitochondrial remodeling proteins to regulate cell survival. Proc Natl Acad Sci U S A 107, 6882-6887 (2010).
242. Tropepe, V. et al. Distinct neural stem cells proliferate in response to EGF and FGF in the developing mouse telencephalon. Developmental biology 208, 166-188 (1999).
243. Stehelin, D., Varmus, H.E., Bishop, J.M. & Vogt, P.K. DNA related to the transforming gene(s) of avian sarcoma viruses is present in normal avian DNA. Nature 260, 170-173 (1976).
244. Capobianco, A.J., Zagouras, P., Blaumueller, C.M., Artavanis-Tsakonas, S. & Bishop, J.M. Neoplastic transformation by truncated alleles of human NOTCH1/TAN1 and NOTCH2. Molecular and cellular biology 17, 6265-6273 (1997).
245. Pear, W.S. et al. Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 183, 2283-2291 (1996).
246. Malecki, M.J. et al. Leukemia-associated mutations within the NOTCH1 heterodimerization domain fall into at least two distinct mechanistic classes. Molecular and cellular biology 26, 4642-4651 (2006).
![Page 171: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/171.jpg)
158
247. Puget, S. et al. Candidate Genes on Chromosome 9q33-34 Involved in the Progression of Childhood Ependymomas. J Clin Oncol (2009).
248. Maliekal, T.T., Bajaj, J., Giri, V., Subramanyam, D. & Krishna, S. The role of Notch signaling in human cervical cancer: implications for solid tumors. Oncogene 27, 5110-5114 (2008).
249. Jeffries, S., Robbins, D.J. & Capobianco, A.J. Characterization of a high-molecular-weight Notch complex in the nucleus of Notch(ic)-transformed RKE cells and in a human T-cell leukemia cell line. Molecular and cellular biology 22, 3927-3941 (2002).
250. Weijzen, S. et al. Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nature medicine 8, 979-986 (2002).
251. Calabrese, C. et al. A perivascular niche for brain tumor stem cells. Cancer cell 11, 69-82 (2007).
252. Tavazoie, M. et al. A specialized vascular niche for adult neural stem cells. Cell stem cell 3, 279-288 (2008).
253. Colmone, A. et al. Leukemic cells create bone marrow niches that disrupt the behavior of normal hematopoietic progenitor cells. Science 322, 1861-1865 (2008).
254. Klinakis, A. et al. A novel tumour-suppressor function for the Notch pathway in myeloid leukaemia. Nature 473, 230-233 (2011).
255. Hermann, P.C. et al. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell stem cell 1, 313-323 (2007).
256. Kelly, P.N., Dakic, A., Adams, J.M., Nutt, S.L. & Strasser, A. Tumor growth need not be driven by rare cancer stem cells. Science 317, 337 (2007).
257. Quintana, E. et al. Efficient tumour formation by single human melanoma cells. Nature 456, 593-598 (2008).
258. Quintana, E. et al. Phenotypic heterogeneity among tumorigenic melanoma cells from patients that is reversible and not hierarchically organized. Cancer cell 18, 510-523 (2010).
259. Read, T.A. et al. Identification of CD15 as a marker for tumor-propagating cells in a mouse model of medulloblastoma. Cancer cell 15, 135-147 (2009).
260. Harris, M.A. et al. Cancer stem cells are enriched in the side population cells in a mouse model of glioma. Cancer Res 68, 10051-10059 (2008).
261. Eppert, K. et al. Stem cell gene expression programs influence clinical outcome in human leukemia. Nature medicine 17, 1086-1093 (2011).
![Page 172: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/172.jpg)
159
262. Colman, H. et al. A multigene predictor of outcome in glioblastoma. Neuro-oncology 12, 49-57 (2010).
263. He, J. et al. Expression of glioma stem cell marker CD133 and O6-methylguanine-DNA methyltransferase is associated with resistance to radiotherapy in gliomas. Oncology reports 26, 1305-1313 (2011).
264. Sato, A. et al. Association of stem cell marker CD133 expression with dissemination of glioblastomas. Neurosurgical review 33, 175-183; discussion 183-174 (2010).
265. Kim, K.J. et al. The presence of stem cell marker-expressing cells is not prognostically significant in glioblastomas. Neuropathology 31, 494-502 (2011).
266. Mizutani, K., Yoon, K., Dang, L., Tokunaga, A. & Gaiano, N. Differential Notch signalling distinguishes neural stem cells from intermediate progenitors. Nature 449, 351-355 (2007).
267. Faux, C.H., Turnley, A.M., Epa, R., Cappai, R. & Bartlett, P.F. Interactions between fibroblast growth factors and Notch regulate neuronal differentiation. J Neurosci 21, 5587-5596 (2001).
268. Duncan, A.W. et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 6, 314-322 (2005).
269. Palmer, T.D., Willhoite, A.R. & Gage, F.H. Vascular niche for adult hippocampal neurogenesis. J Comp Neurol 425, 479-494 (2000).
270. Shen, Q. et al. Adult SVZ stem cells lie in a vascular niche: a quantitative analysis of niche cell-cell interactions. Cell stem cell 3, 289-300 (2008).
271. Zhu, T.S. et al. Endothelial Cells Create a Stem Cell Niche in Glioblastoma by Providing NOTCH Ligands That Nurture Self-Renewal of Cancer Stem-Like Cells. Cancer Res 71, 6061-6072 (2011).
272. Charles, N. et al. Perivascular nitric oxide activates notch signaling and promotes stem-like character in PDGF-induced glioma cells. Cell stem cell 6, 141-152.
273. Hellstrom, M. et al. Dll4 signalling through Notch1 regulates formation of tip cells during angiogenesis. Nature 445, 776-780 (2007).
274. Tammela, T. et al. Blocking VEGFR-3 suppresses angiogenic sprouting and vascular network formation. Nature 454, 656-660 (2008).
275. Noguera-Troise, I. et al. Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis. Novartis Foundation symposium 283, 106-120; discussion 121-105, 238-141 (2007).
276. Ricci-Vitiani, L. et al. Tumour vascularization via endothelial differentiation of glioblastoma stem-like cells. Nature 468, 824-828 (2010).
![Page 173: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/173.jpg)
160
277. Wang, R. et al. Glioblastoma stem-like cells give rise to tumour endothelium. Nature 468, 829-833 (2010).
278. Miyazaki, K. Laminin-5 (laminin-332): Unique biological activity and role in tumor growth and invasion. Cancer science 97, 91-98 (2006).
279. Leins, A. et al. Expression of tenascin-C in various human brain tumors and its relevance for survival in patients with astrocytoma. Cancer 98, 2430-2439 (2003).
280. Oskarsson, T. et al. Breast cancer cells produce tenascin C as a metastatic niche component to colonize the lungs. Nature medicine 17, 867-874 (2011).
281. Sivasankaran, B. et al. Tenascin-C is a novel RBPJkappa-induced target gene for Notch signaling in gliomas. Cancer Res 69, 458-465 (2009).
282. Haass, C. & Selkoe, D.J. Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nat Rev Mol Cell Biol 8, 101-112 (2007).
283. Fleisher, A.S. et al. Phase 2 safety trial targeting amyloid beta production with a gamma-secretase inhibitor in Alzheimer disease. Archives of neurology 65, 1031-1038 (2008).
284. Moriyama, M. et al. Notch signaling via Hes1 transcription factor maintains survival of melanoblasts and melanocyte stem cells. J Cell Biol 173, 333-339 (2006).
285. Kumano, K. et al. Both Notch1 and Notch2 contribute to the regulation of melanocyte homeostasis. Pigment cell & melanoma research 21, 70-78 (2008).
286. van Es, J.H. et al. Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435, 959-963 (2005).
287. Riccio, O. et al. Loss of intestinal crypt progenitor cells owing to inactivation of both Notch1 and Notch2 is accompanied by derepression of CDK inhibitors p27Kip1 and p57Kip2. EMBO reports 9, 377-383 (2008).
288. Imayoshi, I., Sakamoto, M., Yamaguchi, M., Mori, K. & Kageyama, R. Essential roles of Notch signaling in maintenance of neural stem cells in developing and adult brains. J Neurosci 30, 3489-3498 (2010).
289. Lee, C.T., Ma, Y.L. & Lee, E.H. Serum- and glucocorticoid-inducible kinase1 enhances contextual fear memory formation through down-regulation of the expression of Hes5. J Neurochem 100, 1531-1542 (2007).
290. Scoville, W.B. & Milner, B. Loss of recent memory after bilateral hippocampal lesions. Journal of neurology, neurosurgery, and psychiatry 20, 11-21 (1957).
291. Encinas, J.M. et al. Division-coupled astrocytic differentiation and age-related depletion of neural stem cells in the adult hippocampus. Cell stem cell 8, 566-579.
![Page 174: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/174.jpg)
161
292. Wang, Z.Y. & Chen, Z. Acute promyelocytic leukemia: from highly fatal to highly curable. Blood 111, 2505-2515 (2008).
293. Kondratyev, M. et al. Gamma-secretase inhibitors target tumor-initiating cells in a mouse model of ERBB2 breast cancer. Oncogene (2011).
294. Moriya, T. et al. New trends of immunohistochemistry for making differential diagnosis of breast lesions. Medical molecular morphology 39, 8-13 (2006).
295. Mabie, P.C. et al. Bone morphogenetic proteins induce astroglial differentiation of oligodendroglial-astroglial progenitor cells. J Neurosci 17, 4112-4120 (1997).
296. Gross, R.E. et al. Bone morphogenetic proteins promote astroglial lineage commitment by mammalian subventricular zone progenitor cells. Neuron 17, 595-606 (1996).
297. Ahmed, S., Reynolds, B.A. & Weiss, S. BDNF enhances the differentiation but not the survival of CNS stem cell-derived neuronal precursors. J Neurosci 15, 5765-5778 (1995).
298. Gard, A.L. & Pfeiffer, S.E. Two proliferative stages of the oligodendrocyte lineage (A2B5+O4- and O4+GalC-) under different mitogenic control. Neuron 5, 615-625 (1990).
299. Donato, R. S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. The international journal of biochemistry & cell biology 33, 637-668 (2001).
300. Reeves, R.H. et al. Astrocytosis and axonal proliferation in the hippocampus of S100b transgenic mice. Proc Natl Acad Sci U S A 91, 5359-5363 (1994).
301. Eberhart, C.G., Kaufman, W.E., Tihan, T. & Burger, P.C. Apoptosis, neuronal maturation, and neurotrophin expression within medulloblastoma nodules. Journal of neuropathology and experimental neurology 60, 462-469 (2001).
302. Meurer, R.T. et al. Immunohistochemical expression of markers Ki-67, neun, synaptophysin, p53 and HER2 in medulloblastoma and its correlation with clinicopathological parameters. Arquivos de neuro-psiquiatria 66, 385-390 (2008).
303. de Antonellis, P. et al. MiR-34a Targeting of Notch Ligand Delta-Like 1 Impairs CD15/CD133 Tumor-Propagating Cells and Supports Neural Differentiation in Medulloblastoma. PLoS ONE 6, e24584 (2011).
304. Pistollato, F. et al. Interaction of hypoxia-inducible factor-1alpha and Notch signaling regulates medulloblastoma precursor proliferation and fate. Stem Cells 28, 1918-1929 (2011).
305. Parepally, J.M., Mandula, H. & Smith, Q.R. Brain uptake of nonsteroidal anti-inflammatory drugs: ibuprofen, flurbiprofen, and indomethacin. Pharmaceutical research 23, 873-881 (2006).
![Page 175: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/175.jpg)
162
306. Beher, D. et al. Selected non-steroidal anti-inflammatory drugs and their derivatives target gamma-secretase at a novel site. Evidence for an allosteric mechanism. J Biol Chem 279, 43419-43426 (2004).
307. Sivak-Sears, N.R., Schwartzbaum, J.A., Miike, R., Moghadassi, M. & Wrensch, M. Case-control study of use of nonsteroidal antiinflammatory drugs and glioblastoma multiforme. American journal of epidemiology 159, 1131-1139 (2004).
308. Weggen, S. et al. A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature 414, 212-216 (2001).
309. Thun, M.J., Namboodiri, M.M., Calle, E.E., Flanders, W.D. & Heath, C.W., Jr. Aspirin use and risk of fatal cancer. Cancer Res 53, 1322-1327 (1993).
310. Kwon, C. et al. Notch post-translationally regulates beta-catenin protein in stem and progenitor cells. Nature cell biology (2011).
311. Singh, S.K., Clarke, I.D., Hide, T. & Dirks, P.B. Cancer stem cells in nervous system tumors. Oncogene 23, 7267-7273 (2004).
312. Rakic, P. DNA synthesis and cell division in the adult primate brain. Annals of the New York Academy of Sciences 457, 193-211 (1985).
313. Gross, C.G. Neurogenesis in the adult brain: death of a dogma. Nat Rev Neurosci 1, 67-73 (2000).
314. Seri, B. et al. Composition and organization of the SCZ: a large germinal layer containing neural stem cells in the adult mammalian brain. Cereb Cortex 16 Suppl 1, i103-111 (2006).
315. Nakatomi, H. et al. Regeneration of hippocampal pyramidal neurons after ischemic brain injury by recruitment of endogenous neural progenitors. Cell 110, 429-441 (2002).
316. Yoshimura, S. et al. FGF-2 regulation of neurogenesis in adult hippocampus after brain injury. Proc Natl Acad Sci U S A 98, 5874-5879 (2001).
317. Liu, J., Solway, K., Messing, R.O. & Sharp, F.R. Increased neurogenesis in the dentate gyrus after transient global ischemia in gerbils. J Neurosci 18, 7768-7778 (1998).
318. Hopewell, J.W. & Wright, E.A. The importance of implantation site in cerebral carcinogenesis in rats. Cancer Res 29, 1927-1931 (1969).
319. Alcantara Llaguno, S. et al. Malignant astrocytomas originate from neural stem/progenitor cells in a somatic tumor suppressor mouse model. Cancer cell 15, 45-56 (2009).
320. Holland, E.C. et al. Combined activation of Ras and Akt in neural progenitors induces glioblastoma formation in mice. Nature genetics 25, 55-57 (2000).
![Page 176: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/176.jpg)
163
321. Marumoto, T. et al. Development of a novel mouse glioma model using lentiviral vectors. Nature medicine 15, 110-116 (2009).
322. Joseph, N.M. et al. The loss of Nf1 transiently promotes self-renewal but not tumorigenesis by neural crest stem cells. Cancer cell 13, 129-140 (2008).
323. Zheng, H. et al. Induction of abnormal proliferation by nonmyelinating schwann cells triggers neurofibroma formation. Cancer cell 13, 117-128 (2008).
324. Kriegstein, A., Noctor, S. & Martinez-Cerdeno, V. Patterns of neural stem and progenitor cell division may underlie evolutionary cortical expansion. Nat Rev Neurosci 7, 883-890 (2006).
325. Bodine, D.M., Seidel, N.E. & Orlic, D. Bone marrow collected 14 days after in vivo administration of granulocyte colony-stimulating factor and stem cell factor to mice has 10-fold more repopulating ability than untreated bone marrow. Blood 88, 89-97 (1996).
326. Cicalese, A. et al. The tumor suppressor p53 regulates polarity of self-renewing divisions in mammary stem cells. Cell 138, 1083-1095 (2009).
327. Lee, J. et al. Epigenetic-mediated dysfunction of the bone morphogenetic protein pathway inhibits differentiation of glioblastoma-initiating cells. Cancer cell 13, 69-80 (2008).
328. Britz, O. et al. A role for proneural genes in the maturation of cortical progenitor cells. Cereb Cortex 16 Suppl 1, i138-151 (2006).
329. Munji, R.N., Choe, Y., Li, G., Siegenthaler, J.A. & Pleasure, S.J. Wnt signaling regulates neuronal differentiation of cortical intermediate progenitors. J Neurosci 31, 1676-1687 (2011).
330. Hirabayashi, Y. et al. Polycomb limits the neurogenic competence of neural precursor cells to promote astrogenic fate transition. Neuron 63, 600-613 (2009).
331. Obayashi, S., Tabunoki, H., Kim, S.U. & Satoh, J.I. Gene Expression Profiling of Human Neural Progenitor Cells Following the Serum-Induced Astrocyte Differentiation. Cellular and molecular neurobiology (2009).
332. Potzner, M.R. et al. Prolonged Sox4 expression in oligodendrocytes interferes with normal myelination in the central nervous system. Molecular and cellular biology 27, 5316-5326 (2007).
333. Bergsland, M., Werme, M., Malewicz, M., Perlmann, T. & Muhr, J. The establishment of neuronal properties is controlled by Sox4 and Sox11. Genes Dev 20, 3475-3486 (2006).
334. Sinner, D. et al. Sox17 and Sox4 differentially regulate beta-catenin/T-cell factor activity and proliferation of colon carcinoma cells. Molecular and cellular biology 27, 7802-7815 (2007).
![Page 177: Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment](https://reader033.vdocuments.site/reader033/viewer/2022041611/5e37dd9f29f618643a6f1590/html5/thumbnails/177.jpg)
164
335. Scharer, C.D. et al. Genome-wide promoter analysis of the SOX4 transcriptional network in prostate cancer cells. Cancer Res 69, 709-717 (2009).