Detection ofMycoplasma Synoviae in

chicken flocks in 4 governorates during 2013 by

PCR

Abd El-Hamid H.S.1; Ellakany, H.F. 1; El-

Bestawy, A.R. 1 and Abd El-Halim, B.A2.

Introduction

Mycoplasma synoviae is considered the second most

important mycoplasma affecting chickens (Stipkovits &

Kempf, 1996; Kleven, 2003).

In broilers:

It causes respiratory disease and subsequent condemnations

due to airsacculitis, although it seem to be subclinical

infection until the concomitant infection or vaccination with

one of the respiratory viral diseases like IB or ND and also the

presence of IBD infection which causes immunosuppression

or concurrent bacterial diseases infection like ORT may lead

MS to causes airsacculitis (Roussan etal., 2011).

In layers and breeders:

Mycoplasma Synoviae infection may causes peritonitis and mortality in

laying chickens and also, since the year 2000 a novel eggshell apex

abnormality (EAA) has been increasingly found in table egg producing

chicken flocks in the Netherlands. It was first described in white layers

housed in cages, but were later also seen in brown layers housed in cages,

and in both types of birds kept in other housing systems.

It has an economical impact as the infection is characterized egg production

losses and also, egg abnormalities through a roughened shell surface, shell

thinning, increased translucency, cracks and breaks and also, the

abnormalities are confined to the top cone of the egg, up to approximately 2

cm from the apex, and almost always have a very clear demarcation zone.

The proportion of affected eggs varies between flocks, from a few percent up

to 25% (Feberwee et al., 2009).

The aim of this work:

PCR testing of respiratory tract swabs for the

detection of MS infected chicken flocks

including (layer, breeder and broiler flocks)

suffering from drop of egg production (in layers

& breeders) with respiratory manifestations and

sometimes mortalities (in broiler flocks) in 8

Egyptian governorates (El-Behera, Kafr El-

Sheikh, Alexandria, El-Gharbia, El-Dakahlia,

Matrouh, El-Menofia and Cairo) during the

winter of 2012 and spring of 2013

Material and methods:Samples:

Swabs from respiratory tracts of infected birds from 45 chicken flocks (16 layer, 3 broiler

breeder and 26 broiler flocks) in 7 governorates were collected during the winter of 2012 and

spring of 2013.

Media for isolation:

Modified Frey's media was used for the isolation of MS from collected samples (Naola and

Noormohammadi, 2013):

Mycoplasma broth base (BBL) 22.5 g

Glucose 3 g

Swine serum 120 ml

Nicotinamide adenine dinucleotide (NAD) 0.1 g

Cysteine hydrochloride 0.1 g

Phenol red (1%) 2.5 ml

Thallium acetate (10%) 5 ml

Benzyle penicillin G 1,000,000 units

Distilled H2O 1000 ml

Adjust pH to 7.8 with 20% NaOH and filter sterilize.

The broth cultures were incubated at 37 C for

5-7 days under microaerophilic condition

using gas generating kits (Oxoid LTD

Laboratories) for production of 7-10% Co2 in

the jar of the culture and when the broth

cultures color changed from red to yellow

color the samples were submitted for PCR

testing for MS (Kleven, 2003).

PCR and sequencing of MS

isolates:

Requirements for PCR of MS:

PCR Primers for partial sequencing of MS vlhA gene.

VlhAF Forward

5′ ATTAGCAGCTAGTGCAGTGGCC 3′ Benčina et al., (2001)

VlhAR2 Reverse

5' AGTAACCGATCCGCTTAATGC 3' Hammond et al., (2009)

Protocol of PCR & Sequencing

A- DNA extraction

B- Primer preparation

C- Amplification process through

thermal cycling

D- Agarose gel electrophoresis

E- PurificationF- Cycle sequencing termination

G- Purification

H- Injection in gene sequencer

Extraction of DNA and PCR

conditionsThe DNA of MS cultures was extracted using commercial extraction kits (Thermo Scientific

GeneJET Genomic DNA Purification Kit #K0721, #K0722) using digestion solution,

proteinase K, lysis solution, wash buffer I & II and elution buffer and the method was done

according to manufacturer.

The reaction was carried out in PCR tubes and set up with final concentrations as follow:

25 ul reaction was prepared through addition of 12.5 ul PCR master mix (PCR Master Mix

(2X)#K0171 for 200 rxns), 2 ul of prepared forward primer, 2 ul of prepared reverse primer, 5

ul DNA sample & 3.5ul nuclease free water.

An automated thermal cycler (Applied Biosystems) was used to carry out the thermal cycling

through:

Denaturation at 94 °C for 4 min

PCR was run for 36 cycles at 94 °C denaturation for 1 min,

52 °C annealing for 1 min

72 °C extension for 1 min.

The final extension was at 72 °C extension for 2 min.

The PCR products were analysed on a 1.5% agarose gel and stained with ethidium bromide.

Also, a 100 bp DNA ladder (GeneRulerTM Thermoscientific) was used and the agarose gel was

visualized through UV transilluminator.

Sequencing of MS isolates:

PCR purification using QIA quick PCR purification kit which contained:

QIAquick Spin Columns 50

Buffer PBI* 30 ml

Buffer PE (concentrate) 2 x 6 ml

Buffer EB 15 ml

Collection Tubes 2 ml

Loading Dye (Big dye terminator) 110 μl

CENTRI-SEP Spin Columns

The method was done acc. to manufacturer then the eluted DNA was used in Cycle sequencing reaction using

Big dye terminator v 3.1 cycle sequencing kit as follows:

Samples: Add Big dye terminator 8ul

Primer (3.2 Pmol) 1ul

Template 20ng

Water nuclease free up to 20 ul

Control: Add Big dye terminator 8ul

Primer (3-2 Pmol) 4ul

Template 0.5ng

Water nuclease free up to 7 ul

Thermal cycling:

Stage Description Temperature Time

1 Denaturation 96 C 1 minute

Amplification 96 C 10 seconds

2 (25 cycles) 55 C 5 seconds

60 C 4 minutes

3 Hold 4 C pause

Results

Culturing and PCR examination of 45 chicken

flocks during the winter of 2012 and spring of

2013 revealed that MS infected 3 layer flocks

out of 16 (18.75%) tested suffering from drop

of egg production with or without respiratory

manifestations. Also, 4 broiler flocks out of 26

(15.38%) with complains of respiratory signs

and 5-10% mortality were infected by MS. In

addition, 3 broiler breeder flocks were tested

but proved negative for MS.

A summary for MS in Egypt during 2012-

2013

localityProblems foundAge of

flockCase No.

% PCR

Positivity

Positive PCR

For MS

Total

Examined

Type of

chickens

AlexandriaCRD, IBD27 days29

15.38%426Broilers

AlexandriaIBD, CRD32 days31

AlexandriaCRD, swollen kidneys31 days

32

El-BeheraAirsaccultis, exudative

bursae32 days25

El-GharbiaEgg production 79.8%36 wks2

18.75%316LayersEl-Behera

Caseated plug in larynex

(ILT, CRD)90 days18

Kafr-

El-Sheikh

Egg peritonitis, egg prod.

83%58 wks44

16.66 %742Total

El-Dakahlia-40 wks48

003Breeders

CairoEgg prod. 69%, CCRD,

inflammation of oviduct38 wks49

El-DakahliaInactive ovaries, Necrosis

of trachea43 wks50

PCR results

Amplification of 421 bp bands which is

specific for MS took place from PCR test in

all tested samples using specific PCR

primer (vlhAF– vlhAR2) of MS.

Positive lanes of MS are facing ladder with mol. wt of 421 bp

Sequencing results

Alignment of genetic material complementary

to the assigned primers of 3 local strains of

MS was done in relation to the foreign isolates

and results showed that the 3 tested strains

were not related genetically to the strains

from middle east countries: Israel, Iran, but

they were related to Japanese, Armenian

and Brazilian ones.

Alignment of the Egyptian strains of MS in

relation to the foreign isolates

Phylogenetic tree of the recently isolated Egyptian MS:

Fig.11

1. PCR based detection of MS infection was useful as

it was sensitive, specific, rapid and effort and time

saving.

2. Also, this survey illustrates the role of MS in the

CCRD problem among broiler flocks which may

play a great role in the incidence of such problem.

3. The effect of MS on egg production in layers and

breeders in Egypt need more and more work for

controlling the infection.