REPRODUCTIONRESEARCH

Microtubule depolymerization attenuates WNT4/CaMKIIα signaling in mouse uterus and leads to implantation failure

Vinay Shukla1,2, Jyoti Bala Kaushal1,2, Rohit Kumar1, Pooja Popli1, Promod Kumar Agnihotri3, Kalyan Mitra2,4 and Anila Dwivedi1,2

1Division of Endocrinology, CSIR-Central Drug Research Institute, Lucknow, India, 2Academy of Scientific and Innovative Research (AcSIR), CSIR-CDRI Campus, Lucknow, India, 3Division of Toxicology & Experimental Medicine, CSIR-Central Drug Research Institute, Lucknow, India and 4Electron Microscopy Unit, SAIF, CSIR-Central Drug Research Institute, Lucknow, India

Correspondence should be addressed to A Dwivedi; Email: anila.dwivedi@rediffmail.com

Abstract

Microtubule (MT) dynamics plays a crucial role in fertilization and early embryonic development; however its involvement in uterus during embryo implantation remains unclear. Herein, we report the effect of microtubule depolymerization during embryo implantation in BALB/c mice. Intrauterine treatment with depolymerizing agent nocodazole at pre-implantation phase (D4, 07:00 h) in mice resulted into mitigation in receptivity markers viz. LIF, HoxA10, Integrin-β3, IHH, WNT4 and led to pregnancy failure. MT depolymerization in endometrial epithelial cells (EECs) also inhibited the blastocyst attachment and the adhesion. The decreased expression of MT polymerization-related proteins TPPP and α/β-tubulin in luminal and glandular epithelial cells along with the alteration in morphology of pinopodes in the luminal epithelium was observed in nocodazole receiving uteri. Nocodazole treatment also led to increased intracellular Ca+2 levels in EECs, which indicated that altered Ca+2 homeostasis might be responsible for implantation failure. Microtubule depolymerization inhibited WNT4 and Fz-2 interaction, thereby suppressing the downstream WNT4/CaMKIIα signaling cascades calmodulin and calcineurin which led to attenuation of NF-κB transcriptional promoter activity in EECs. MT depolymerization or CaMKIIα knockdown inhibited the transcription factor NFAT and NF-κB expression along with reduced secretion of prostaglandins PGE2 and PGF2α in mouse EECs. Overall, MT depolymerization impaired the WNT4/CaMKIIα signaling and suppressed the secretion of PGE2 and PGF2α in EECs which may be responsible for implantation failure in mice.Reproduction (2019) 158 47–59

Introduction

For successful pregnancy, a blastocyst competent for implantation needs to be synchronized with the proliferation and differentiation of specific uterine cell types under the influence of steroids mainly estradiol and progesterone (Wang & Dey 2006, Bazer et al. 2009, Huang et  al. 2017, Kaczyński et  al. 2018). Impaired embryo implantation and/or decidual aberrations are thought to be responsible for infertility and recurrent pregnancy loss (Cha et  al. 2012). Although several attempts have been made to explain the molecular aspects of embryo implantation failure in past decade, the underlying mechanisms still remain unclear.

The ability of the cytoskeleton to deform and reform is critical for cellular differentiation at the time of embryo invasion (Paule et  al. 2010). Microtubules (MTs) are structural components and their dynamic instability can lead to sub-cellular movement, mitotic block, cell cycle arrest, protein trafficking, vesicle transport, axonal extension and even cell death (Lopez & Valentine 2015). MTs are also involved in the transport and

secretion of progesterone (Sawyer et al. 1979). Although MT dynamics plays a crucial role in early embryonic development and fertilization (Wu et  al. 1996, Yan et al. 2006, Watanabe et al. 2016), its involvement in embryo implantation is not completely understood. Earlier studies show that uterine tubulin levels rise rapidly in the endometrium and myometrium during pre-implantation period in rabbits (Fujimoto & Saldana 1976). In mice, the MT-associated protein HURP plays a crucial role in embryo implantation (Tsai et al. 2008). Other MT-regulator protein, stathmin, has been reported in rat during embryo implantation (Tamura et al. 2003) and also in human endometrium during pre-receptive (LH + 2) and receptive (LH + 7) phases (Domínguez et al. 2009) as well as in uterine fluid at secretory phase of menstrual cycle (Bhutada et  al. 2014). In our earlier study, we have also demonstrated the expression of tubulin polymerization promoting protein 3 (TPPP3) during endometrial receptivity in human (Manohar et al. 2014a) and have recently demonstrated its functional role in mice and hESCs (Shukla et al. 2018, 2019).

-18-0611

158 1

© 2019 Society for Reproduction and Fertility https://doi.org/10.1530/REP -18-0611ISSN 1470–1626 (paper) 1741–7899 (online) Online version via https://rep.bioscientifica.com

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

V Shukla and others48

Reproduction (2019) 158 47–59 https://rep.bioscientifica.com

Though the literature indicates that MT polymerization might be important for endometrial functions, its significance particularly in embryo implantation is not yet known. The current study was undertaken to explore the significance and functional role of MT polymerization during early implantation phase in mice. Nocodazole disrupts MTs by binding to β-tubulin (Mitchison & Kirschner 1984) and has been used as a MT-depolymerizing agent in several studies (Choi et  al. 2011, Guo et  al. 2012, Isshiki et al. 2015, Signoretto et al. 2016). Therefore, to prove our hypothesis, the effect of MT-depolymerizing agent (nocodazole) was studied on morphological characteristics, receptivity markers and downstream signaling mechanisms regulating implantation and pregnancy establishment in mouse uterus.

Materials and methods

Reagents and chemicals

To induce MT depolymerization, nocodazole (Calbiochem, Merck Millipore) was used. Lysis buffer, Bradford reagent, Collagenase, DNase, protease inhibitor cocktail (PIC), PIPES, MgCl2, EGTA, PBS, cell culture media, FBS, osmium tetroxide, penicillin streptomycin antibiotics and Cy3 secondary antibodies were purchased from Sigma-Aldrich. Anti-fade reagent with DAPI from Life Technologies, Thermo Fisher Scientific, nylon cell strainer from BD Biosciences (NJ, USA) and fluorescein isothiocyanate (FITC) were procured from Santa Cruz Biotechnology. Immunoblot PVDF membrane was purchased from Merck Millipore. ECL reagent was purchased from GE Healthcare.

Antibodies

Antibodies for TPPP (sc-98687), α-tubulin (sc-8035), β-tubulin (sc-5274), WNT4 (sc-376279), LIF (sc-20087), IHH (sc-13088), Fz-2 (sc-68328), HoxA10 (sc-17159), Integrin-β3 (sc-52685), NF-κB p50 (sc-53744), Cytokeratin (sc-57004), Vimentin (sc-32322), ERα (sc-543), PR (sc-538), JNK (sc-572) and GAPDH (sc-32233) were procured from Santa Cruz Biotechnology. Antibody for NF-κB p65 (#8242) was procured from Cell Signaling Technology and STAT3 (610189) was procured from BD Biosciences.

Mouse implantation model

Adult female virgin BALB/c mice (3 months old, ~26 g) were used in this study. All the animal protocols were approved by Institutional Animal Ethical Committee of CSIR-Central Drug Research Institute, Lucknow, India. Female mice were co-caged with fertile (2:1) and were checked next morning for copulation plug. The day on which copulatory plug was observed, was designated as D1 of pregnancy. Uterine tissues were collected from these animals during different days of the pre-implantation period. The excised uterine horn (D5, 08:00 h) was flushed gently through the oviductal end with 1 mL sterile PBS to obtain embryo (Shukla et al. 2018).

Microtubule depolymerization in mouse uterus with the help of microtubule-depolymerizing agent, nocodazole

We used microtubule-depolymerizing agent nocodazole to evaluate the role of MT polymerization on early pregnancy events (Lagos-Cabré & Moreno 2008). The intrauterine injection surgery was done on pre-implantation stage i.e. on D4 (07:00 h) of pregnancy (Maurya et al. 2013). Nocodazole (300 nM, 2 μL) or vehicle was injected into uterine horn in mice. We first optimized the concentration of effective dose of nocodazole by assessing the effect of nocodazole at varying concentrations in mice. At 300 nM, nocodazole suppressed the embryo implantation by ~90%. Whereas at lower concentrations, the suppressing effect on implantation was not significant. Therefore, we selected the optimized effective dose

Figure 1 Investigation of TPPP expression during window of implantation. (A) The expression analysis of TPPP was done in uterine protein fraction through immunoblotting. Representative immunoblot images showing the expression of TPPP on different days of pregnancy. GAPDH was used as a control to correct for loading (upper panel). Densitometric quantitation of protein expression levels is shown as fold changes (lower panel). Number of animals per group = 5. (B) The mRNA expression of Tppp genes in mouse early pregnancy was analyzed by real-time PCR. Number of animals per group = 5. (C) Hormonal regulation of TPPP using delayed implantation model. To maintain delayed implantation, ovariectomized mouse was injected subcutaneously with P4 (1 mg/0.1 mL sesame oil/mouse) from D4 to D7. E2 (25 ng/0.1 mL of sesame oil/mouse) was given to P4-primed mouse to terminate delayed implantation on D8. TPPP protein expression in vehicle, delayed (P4) and activated uterus (E2 + P4) was analyzed by immunoblotting (left panel). Number of animals per group = 5. Densitometric quantitation of protein expression levels is shown as fold changes (right panel). Three replicates (individual animal as a replicate) were used in each group. P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs. D1/vehicle-treated-group.

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

MT depolymerization inhibits implantation 49

https://rep.bioscientifica.com Reproduction (2019) 158 47–59

of nocodazole of 300 nM for our study. The implantation sites (IS) in the uterus were visualized on D8 (10:00 h) (Fig. 2A).

Primary culture of mouse EECs

For mouse EECs isolation, uterine horns were cut longitudinally and washed with DMEM/F-12 and digested with 1% (w/v) trypsin (Sigma-Aldrich) and 4 mg/mL dispase (Sigma-Aldrich) in DMEM/F-12 for 1 h at 4°C followed by 1 h at 25°C and 10 min at 37°C. After rinsing three times with DMEM/F-12,

the remaining tissues were incubated in 3 mL of DMEM/F-12 containing 0.15 mg/mL collagenase I (Sigma-Aldrich) at 37°C for 30 min. The digested uteri were shaken and filtered through a 70 μm wire gauze filter and collected cells having more than 70 μm cell size. The purity of EECs was confirmed with anti-cytokeratin (epithelial cell marker) and anti-vimentin (stromal cell marker), respectively. Immunofluorescence experiment showed that the EECs were positive for cytokeratin and negative for vimentin. The isolated EECs were cultured at 37°C and 5% CO2. Prior to experiment, cells were cultured in phenol red-free MEM supplemented with 10% charcoal-stripped FBS (Shukla et al. 2018).

Co-culture of mouse blastocysts and primary mouse EECs

Attachment experiment was performed by co-culture of mouse blastocysts and mouse EECs. The EECs were treated with nocodazole (300 nM, 10 μL) or the vehicle control in serum medium (containing 10% FBS) for 24 h prior to receiving blastocysts. The medium was changed after 24 h of nocodazole treatment. Blastocysts were isolated from seven mice in each experiment and were used randomly for co-culture with nocodazole or the vehicle control mouse EECs. Initially, co-cultures were incubated undisturbed and blastocyst attachment to mouse EECs was determined at 24 h and their position was examined under a microscope (Nikon Eclipse TE2000-S). Embryos that did not float away were considered to have attached. Upon moving the plate, unattached embryos floated or rolled over the epithelial surface. Attached embryos were then examined for tandem movement when the microscope stage was tapped. Co-culture experiments were performed in triplicate and data were pooled from the three separate experiments and counted as the proportion of blastocysts that had attached to the epithelial cells out of the total number of blastocysts added to the epithelial cells (Green et al. 2015, Shukla et al. 2018).

Delayed implantation model

Delayed implantation was induced in pregnant mouse which were bilaterally ovariectomized on D3. To maintain delayed implantation, ovariectomized mouse was injected subcutaneously with progesterone (1 mg/0.1 mL sesame oil/mouse) from D4 to D7. Estradiol-17β (25 ng/0.1 mL of sesame oil/mouse) was administered to progesterone-primed mouse to terminate delayed implantation on D8. The delayed group and activation group was confirmed by flushing blastocysts from the uterine horns (Liang et al. 2014, Shukla et al. 2018).

Immunoblot analysis

Tissue (in vivo experiments) or cells (in vitro experiments) were lysed in lysis buffer (Sigma-Aldrich). Briefly, uterine tissue was homogenized in ice-cold RIPA lysis buffer (150 mM NaCl, 1% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 Mm Tris, pH 8.0) (Sigma-Aldrich). The homogenate was supplemented with a protease inhibitor cocktail (PIC) (AEBSF 2 mM, Aprotinin 0.3 μM, Bestatin 116 μM, E-64 14 μM,

Figure 2 Microtubule depolymerization by nocodazole (300 nM) at D4 (07:00 h) reduced the implantation sites at D5 (10:00 h) of pregnancy in mice. Representative image of uterus on D8 from the nocodazole-treated group. (A) The intrauterine injection surgery was done on pre-implantation stage i.e. on D4 (07:00 h) of pregnancy and nocodazole (300 nM, 2 μL) or vehicle was injected into uterine horn. The IS in the uterus were visualized on D8 (10:00 h) (A). The arrow indicates blastocyst implantation. Number of animals per group = 5. (B) Number of implantation sites on D8 (10:00 h). (C) Nocodazole treatment decreased the expression of α-tubulin, β-tubulin, TPPP at peri-implantation stage i.e. D5 (08:00 h). (D) Effect of nocodazole in the expression of ERα, PR, JNK and STAT3 on D5 (08:00 h) (left panel). GAPDH was used as a control to correct for loading (left panel). The each experiment was performed three times with three tissue samples. Densitometric quantitation of protein expression levels is shown as fold changes (right panel). P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs vehicle group.

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

V Shukla and others50

Reproduction (2019) 158 47–59 https://rep.bioscientifica.com

Leupeptin 1 μM and EDTA 1 mM) (Sigma-Aldrich) for 4 h at 4°C and then kept overnight at −20°C. The protein was obtained as supernatant by centrifuging at 12000 g for 50 min at 4°C. Protein estimation was done by Bradford reagent (Sigma-Aldrich). Equal amounts of protein (20 µg) were separated by SDS-PAGE and transferred to Immunoblot PVDF membrane. The membrane was blocked for 2 h in 5% skimmed milk dissolved in TBST (Tris-buffered saline, 0.1% Tween 20, 7.5 pH) and incubated with primary antibody overnight at 4°C. The membranes were incubated with secondary antibody for 1 h. Antibody binding was detected by using enhanced chemiluminescence detection system (BIO-RAD ChemiDoc XRS+). After developing, the membrane was stripped and re-probed with GAPDH antibodies. Densitometry of band density was performed by using Quantity One Software (v.4.5.1). The density of a given band was measured as the total volume for each group and normalized to GAPDH as an internal control (Manohar et al. 2014b, Kaushal et al. 2018).

Transmission electron microscopy (TEM)

For TEM, samples were washed with phosphate buffer, and then cut into small pieces (1 mm3) followed by fixation in 4% paraformaldehyde and 2% glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.4) for 4 h at room temperature (24°C). The tissues were then post fixed in 2% osmium tetroxide in 0.1 M phosphate buffer (pH 7.4) for 2 h at room temperature and dehydrated in an ascending grade of ethanol followed by embedding in Epon 812 and polymerized at 60°C for 24 h. Ultra-thin sections (50–70 nm) were obtained using an ultracut Ultra-microtome (Leica Microsystems GmbH) and picked up onto 200 mesh copper grids. The sections were double-stained with uranyl acetate and lead citrate and analyzed under a Jeol JEM-1400 electron microscope (Jeol, Japan) fitted with a GatanOrius SC200 CCD camera. Images were acquired using Gatan Digital Micrograph software at 80 kV (Kathuria et  al. 2014). Imaging was performed at the Electron Microscopy Unit, CSIR-Central Drug Research Institute, Lucknow.

Real-time polymerase chain reaction

Total RNA from tissue was extracted using TRIzol reagent (Invitrogen, Thermo Fisher Scientific) by following the manufacturer's instructions. The concentration of RNA was measured using Nanodrop (Thermo Fisher Scientific). The isolated RNA was treated with RNase-free DNase to remove any residual genomic DNA. First-strand of DNA (cDNA) was prepared from total RNA (1 μg) at each group using high-capacity cDNA reverse transcription kit, according to the manufacturer’s protocol (Thermo Fisher Scientific). The quantification of the genes by Real-TimePCR was performed with a Light Cycler (Roche Life Science). Quantitative PCR analyses were performed using appropriate primers (Mus musculus) (Tppp Forward CACACAGTGGCCTCAGGATA, Reverse: AAAATGTCCCACCCTCAACA; Gapdh Forward AGCTTGTCATCAACGGGAAG, Reverse TTTGATGTTAGTGG GGTCTCG). Expression of the investigated gene was normalized to the steady expression of a housekeeping gene

Gapdh. Comparative cycle threshold (2−ΔΔCt) method was used for relative quantification. The PCR system was programmed according to the manufacturer's instructions. All measurements were performed in triplicate (Shukla et al. 2015).

Hematoxylin and eosin staining and immunofluorescence imaging by confocal microscopy

Formalin-fixed tissues of nocodazole- or vehicle-treated mouse uterus on D5 (IS) were sectioned. Tissues were dehydrated and thereafter embedded in paraffin wax and stained with hematoxylin & eosin (H&E) and examined under light microscope. Images were captured with NIS-Elements F 3.0 camera (Nikon).

In immunofluorescence experiment, formalin-fixed tissues were dehydrated and thereafter embedded in paraffin wax. Paraffin sections of 5 μm were cut from each experimental group. Mouse uterine tissue sections were then fixed in methanol and acetone in 1:1 ratio at 4°C for 2 h and permeabilized with 0.1% Triton X-100 at 25°C for 10 min and then mixed with microtubule stabilizing buffer (100 mM PIPES, 1 mM MgCl2, 5 mM EGTA, pH 6.8). Tissues sections were washed with PBS and blocked with 1% BSA in distilled water and incubated with and TPPP-α/β tubulin antibody for overnight followed by 1 h incubation with fluorescence-tagged secondary anti-rabbit/mouse antibody, then counterstained with DAPI for 5 min. Images were captured at 40× with the using Carl Zeiss LSM 510 META microscope and analyzed using LSM Image- Examiner Software to detect fluorescence and DAPI emissions (Kaushal et  al. 2017). In negative control, sections/cells were incubated with IgG in place of primary antibody.

Co-immunoprecepitation

Interaction between WNT4 and Fz-2 proteins was studied by co-immunoprecipitation of the complex followed by immunoblotting. Briefly, 2 μg anti-Fz-2 antibody were added to 300 μg of cell lysate and samples were incubated for overnight at 4°C. In negative control, cell lysate was incubated with IgG instead of anti-Fz-2. Next, 100 μL of protein A-sepharose beads (Sigma-Aldrich) suspension were added and samples were incubated for 1 h at 4°C with constant rocking. Immunoprecipitated complexes were collected by centrifugation at 3000 g for 2 min at 4°C and then washed three times with RIPA buffer (Sigma-Aldrich), then resuspended in Laemmli sample buffer to a final concentration and heated for 5 min at 95°C. The supernatants were collected by centrifugation at 12000 g for 30 s at room temperature. Equal amounts of immunoprecipitated proteins were separated by 12% SDS-PAGE and transferred on PVDF membrane (Millipore). The proteins were probed with anti-WNT4 and anti-Fz-2, followed by the related secondary peroxidase-conjugated antibody. Antibody binding was detected by using enhanced chemiluminescence detection system (GE Healthcare). Bands were detected by Gel Doc imaging system (Bio-Rad) and analyzed by densitometry using Quantity One Software (v. 4.5.1) (Shukla et al. 2018).

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

MT depolymerization inhibits implantation 51

https://rep.bioscientifica.com Reproduction (2019) 158 47–59

Flow cytometric analysis for cytosolic free Ca+2 measurement

Primary mouse EECs were seeded (2 × 105 cells/well) into 6-well plate and maintained overnight in phenol red-free MEM containing 10% stripped FBS. Next day, EECs were treated/transfected with nocodazole (300 nM) or cyclosporine A (0.5 μM) or CaMKIIα siRNA (30 nM) in serum-free MEM according to manufacturer’s protocol. Cells were washed with PBS and incubated in serum-free MEM medium for 24 h. After 24 h, cells were collected by trypsinization and resuspended in PBS. Fluo-3AM dye (2 μM) was added in each EECs groups for 30 min at 37°C in the dark with continuous shaking. Cytosolic free Ca+2 measurement was detected using a FACScan flow cytometer (BD Biosciences) with excitation and emission settings at 506 nm and 526 nm, respectively (Zhang et  al. 2004, Gupta et al. 2018).

Annexin-V/propidium iodide labeling and flow cytometry assay for apoptosis

Primary mouse EECs (2 × 105 cells per well) were cultured in six-well plates and were treated with nocodazole (300 nM) for 48 h. After trypsinization, cells were probed with FITC-conjugated Annexin-V and PI for 10 min. The fluorescence staining profiles were determined through FACScan and Cell-Quest software. Staurosporin (1 μM) was used as a positive control. The experiments were performed three times.

Transactivation assay

Mouse EECs were seeded and allowed to attain confluency of 70–80%. In transactivation assay, all plasmids were prepared using QIAGEN plasmid DNA preparation kits. EECs were then transfected with 400 ng of pNF-kB-luc (Stratagene) using Lipofectamine RNAiMAX transfection reagent (Invitrogen) as per manufacturer’s protocol. To normalize for transfection efficiencies, 200 ng of pRL-SV40-luc (Promega) was co-transfected. After 24 h of nocodazole (300 nM) treatment or cyclosporine A (0.5 μM) or transfection of CaMKIIα siRNA (30 nM), medium was changed and EECs were treated with cyclosporine A (calcineurin inhibitor). Next, EECs were lysed with lysis buffer and luciferase activity was measured using Dual Luciferase Assay System (Promega) according to the manufacturer’s protocol to detect the transcriptional activity of the transfected promoter. The firefly luciferase activity for each group was normalized with transfection efficiency determined by Renilla luciferase activity (Popli et al. 2015).

Measurement of PGE2 and PGF2α levels

EESc were seeded in six-well plates and grown to confluence. EESc were washed with PBS and incubated in serum-free DMEM medium for 24 h, and then treated/transfected with nocodazole (300 nM) or cyclosporine A (0.5 μM) or CaMKIIα siRNA (30 nM). The culture supernatant was collected to measure PGE2 and PGF2α concentration using a monoclonal antibody in an ELISA kit as specified by the manufacturer (Abcam, Enzo Lifesciences).

Statistical analysis

Statistical analysis was performed using GraphPad Prism v6.0, all statistical tests are described in their respective figure legends. Briefly, data are presented as mean ± s.e.m. for at least three separate determinations for each experiment. One-way ANOVA in combination with Tukey test was done to compare the multiple group’s comparison (three to four groups) and the Student’s ‘t’ test was performed for comparing the two groups. P value less than 0.05 was considered as significant.

Results

TPPP is highly expressed during peri-implantation phase and ovarian hormones modestly influence TPPP expression

Immunoblotting analysis was performed to analyze the expression of TPPP in all the stages of window/period of implantation (Fig.  1A). We observed approximately fourfold (P < 0.001) increase in expression of TPPP at IS on peri-implantation (D5, 08:00 h) as compared to pre-implantation (D1), which indicates its contribution in the embryo implantation. TPPP protein expression was increased significantly in uterus on D4 compared to D1 of pre-implantation period and this high expression level was maintained until receptivity/D5 (08:00 h) (Fig. 1A). On D5 (08:00 h), the expression of TPPP was prominent at the IS than that at respective non-implantation sites (non-IS) (Fig.  1A). Apart from this, our study on the uterine transcript also revealed a low level of Tppp transcript at D1, which was significantly elevated on D5 (P < 0.001) (Fig. 1B).

To investigate whether the process of uterine MT polymerization is a subject to ovarian steroid hormones regulation, we analyzed the hormonal regulation of TPPP protein expression after subcutaneous administration of estrogen and progesterone (E2 + P4; active group)- and progesterone (P4; delayed group)-treated groups in bilaterally ovariectomized mouse in delayed embryo implantation model (Fig. 1C). It was found that treatment of E2 along with P4 caused an increase in TPPP protein expression (by ~1.8-fold) in the uterus. On the contrary, the administration of P4 resulted into decreased TPPP protein expression in the uterus (P < 0.001) as compared to E2 + P4 active group (Fig. 1C). Notably, this information indicated that P4 could negatively affect the regulation of TPPP (Fig. 1C). These results showed that TPPP is upregulated by E2 in the uterus during the embryo implantation process.

Uterine microtubule depolymerization impaired embryo implantation and inhibited expression of associated proteins

To analyze the specific role of MT polymerization in uterus, we used nocodazole, a microtubule de-polymerizing agent (Lagos-Cabré & Moreno 2008).

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

V Shukla and others52

Reproduction (2019) 158 47–59 https://rep.bioscientifica.com

Accordingly, intrauterine injection of the optimized concentration of nocodazole (300 nM, 2 μL) in right uterine horn and vehicle in the left uterine horn was given on D4 (07:00 h). The significantly reduced number of embryos (~90%) (P < 0.001) was observed on D8 in nocodazole-treated uterine horn compared to that of vehicle-treated horn (Fig.  2A and B). MT remains stiff and with help of GTP, α-tubulin and β-tubulin modestly regulate MT polymerization (Mitchison & Kirschner 1984, Paule et  al. 2010). In immunoblotting experiment, we found a decrease in the expression of α-tubulin by ~0.5-fold, β-tubulin by ~0.55-fold and TPPP by ~0.5-fold in the uteri of nocodazole-treated group as compared to vehicle-treated control group (P < 0.001) (Fig.  2C). Results revealed that MT depolymerization suppressed the expression of α-tubulin, β-tubulin and TPPP in peri-implantation phase (D5) of pregnancy.

Microtubule depolymerization inhibits ERα and PR expression during peri-implantation period

The receptors for estrogen (ER) and progesterone (PR) are important for successful blastocyst implantation (Bulun 2017). Hence, we determined the levels of ER and PR protein expression in nocodazole-treated uteri at D5. The immunoblot analysis showed that nocodazole treatment caused reduction in ERα by ~0.3-fold (P < 0.001) PR-A by ~0.65-fold (P < 0.001) and PR-B by ~0.6-fold (P < 0.01) (Fig. 2D). These results showed that MT depolymerization inhibits ERα and PR protein expression in mice uteri.

Apart from microtubule-associated proteins, we checked the effect of nocodazole on some other proteins viz. JNK and STAT3 and our results showed that MT depolymerization did not alter the expression of these proteins (P > 0.05) (Fig.  2D). These results indicated that microtubule depolymerization affects specifically

Figure 3 The effect of nocodazole on the mouse co-culture (EECs and blastocyst) and spatiotemporal expression of TPPP, α-tubulin and β-tubulin in the mouse uterus during peri-implantation (D5, 08:00 h). (A) Nocodazole (300 nM) treatment in primary mouse endometrial epithelial cells mitigates mouse blastocyst attachment. Representative images were taken after 24 h of co-culture. Each experiment was performed three times with three different samples. Data are presented as mean ± s.e.m. P values: P < 0.001 vs vehicle control. (B) H&E staining was performed in the uteri of D5 (IS) from the vehicle- or nocodazole-treated horns (magnification ×10). Asterisk indicates an embryo. Each experiment was performed three times with three different samples. (C and D) Tissue sections were incubated with and TPPP-α/β tubulin antibody for overnight followed by 1-h incubation with fluorescence-tagged secondary anti-rabbit/mouse antibody, and then counterstained with DAPI for 5 min. The expression of α-tubulin and TPPP β-tubulin and TPPP protein was analyzed in the LE, GE and stromal cells (Str) of the endometrium by confocal microscope at ×40. Three replicates (individual animal as a replicate) were used in each group.

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

MT depolymerization inhibits implantation 53

https://rep.bioscientifica.com Reproduction (2019) 158 47–59

the microtubule polymerization-associated proteins (Fig. 2C) and receptivity markers (Fig. 4A) in the uterus.

Microtubule depolymerization suppresses attachment of mouse blastocyst to primary EECs

For in vitro implantation experiment, we analyzed the effect of nocodazole on primary mouse EECs and mouse blastocysts co-culture attachment reaction. Mouse blastocysts were transferred on EECs treated with nocodazole or vehicle control and the blastocysts attachment were assessed. The proportion of blastocysts attached to nocodazole-treated mouse EECs was found to be significantly reduced (7 attached out of 50) as compared to that of vehicle-treated cells (38 attached out of 50) (P < 0.001) (Fig.  3A). These results showed that MT depolymerization in EECs inhibits in vitro embryo attachment.

Microtubule depolymerization caused morphological defects in luminal epithelium in mouse uterus and impaired uterine receptivity

Prior to implantation, luminal epithelium (LE) undergoes the ovarian steroid hormones-induced structural and functional changes that make it competent for embryo invasion and attachment (Hantak et  al. 2014). Hence, to evaluate the changes in LE, we performed the H&E staining in nocodozole- or vehicle- treated horn at D5 (IS). The luminal epithelial cell closure was not observed in MT de-polymerized (nocodazole-treated) horn. Moreover, no embryo attached was seen in cross-section of nocodazole-treated horn, whereas vehicle-treated horn showed normally attached embryo (Fig.  3B). Further, we also checked the spatiotemporal expression of microtubule polymerization-related proteins during peri-implantation phase (D5). The immunoflourecence imaging confirmed that the expression of α-tubulin, β-tubulin and TPPP proteins were highly expressed in the luminal (LE) and glandular epithelium (GE) of vehicle-treated uterus, whereas at peri-implantation phase (D5), approximately 50% reduction in expression of TPPP and α-/β-tubulin was observed in nocodazole-treated uterus as compared to vehicle-treated uterus (Fig. 3C and D).

Further, we analyzed the expression of receptivity markers in mouse uterus (D5). The protein expression of embryo implantation/receptivity markers (LIF, HoxA10, Integrin β-3, IHH and WNT4) was found to be drastically decreased in uteri of nocodazole-treated group as compared to vehicle-treated group (Fig.  4A). The densitometric analysis showed that nocodazole treatment caused reduction in LIF by ~0.3-fold (P < 0.001), in HoxA10 by ~0.4-fold (P < 0.001), in Integrin β3 by ~0.2-fold (P < 0.001), in IHH and WNT4 by ~0.5-fold (P < 0.01) (Fig.  4A). These results showed that MT depolymerization inhibits uterine receptivity in mouse.

Pinopodes as an indicator of endometrial receptivity arise from the apical surface of the uterine LE during the window of receptivity both in rodents and humans (Murphy 2004, Montazeri et  al. 2015). Hence, we evaluated the pinopodes structure in mice uteri after the vehicle or nocodazole treatment on D5. The TEM results showed that the pinopodes were present on peri-implantation phase (D5) in vehicle-treated group which were deformed in nocodazole-treated uterine horn due to MT depolymerization (Fig. 4B).

Microtubule depolymerization induced mild apoptosis in primary mouse EECs

To determine whether nocodazole causes apoptosis in primary mouse EECs, we did flow cytometric analysis

Figure 4 Uterine receptivity was distorted by intrauterine nocodazole treatment in mice. (A) Immunoblotting of receptivity markers (LIF, HoxA10, Integrin β-3, IHH and WNT4) at peri-implantation stage (D5, 08:00 h). GAPDH was used as a control to correct for loading (right panel). Densitometric quantitation of protein expression levels is shown as fold changes (right panel). The results are presented as mean ± s.e.m. of three independent experiments. Three replicates (individual animal as a replicate) were used in each group. P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs vehicle control. (B) TEM of the luminal epithelium showing clear pinopodes (P) on D5 in the vehicle- and distorted in nocodazole-treated horn. Three replicates (individual animal as a replicate) were used in each group. (C) Flow cytometric analysis of apoptosis in vehicle- and nocodazole-treated cells stained with Annexin-V/PI(AV+/PI -intact cells; AV−/PI+ -nonviable/necrotic cells; AV+/PI− and AV+/PI+ –apoptotic cells). Representative images of flow cytometry of treated cells are shown in the upper panel and the percentage of apoptosis with mean ± s.e.m. is shown in the lower panel. P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs vehicle-treated group. Staurosporin (1 μM) was used as a positive control. Three replicates (individual animal as a replicate) were used in each group.

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

V Shukla and others54

Reproduction (2019) 158 47–59 https://rep.bioscientifica.com

of Annexin-V/PI staining after 48 h of nocodazole treatment. Nocodazole significantly increased the number of apoptotic cells (by ~18%) in primary mouse EECs (P < 0.01) as compared to vehicle-treated cells (Fig.  4C), whereas 78% cells were found to be live. These results indicated that only a mild induction of apoptosis is caused by microtubule depolymerization in mouse EECs.

Microtubule depolymerization inhibits WNT4/CaMKIIα signaling during peri-implantation in mice

WNT4 has been suggested to play a crucial role in the embryo implantation and is also known to non-canonically regulate calcium signaling, (Li et  al. 2007, Angers & Moon 2009). In our previous experiment on uterine receptivity, nocodazole caused suppression in WNT4 protein expression (Fig.  4A). Thus, co-immunoprecipitation studies were performed to analyze the effect of nocodazole on WNT4 and Fz-2 interaction. Results indicated that nocodazole significantly decreased the interaction of WNT4/Fz-2 during peri-implantation (Fig. 5A). Further, we assessed the downstream cascades and found reduction in the expression of Fz-2 by ~0.55-fold (P < 0.01), DVL-1 by ~0.4-fold (P < 0.001), PKCα by ~0.5-fold (P < 0.001), calmodulin by ~0.4-fold, CaMKIIα and calcineurin by ~0.5-fold (P < 0.001), transcription factor NFAT by ~0.4-fold (P < 0.001), NF-κB p50 by ~0.6-fold (P < 0.001) and in NF-κB p65 by ~0.5-fold (P < 0.001) as observed by densitometry analysis (Fig.  5B and C). Thus, our results showed that MT depolymerization reduced the WNT4-mediated CaMKIIα signaling during peri-implantation phase.

Microtubule depolymerization increased the intracellular Ca+2 level in mouse EECs

MT stability is related to calcium homeostasis (Ciani et  al. 2004, Salinas 2007), thus, our next aim was to assess the effect of microtubule depolymerization on intracellular Ca+2 in EECs. The results of flow cytometric analysis revealed that nocodazole treatment in EECs enhanced the influx of intracellular Ca+2 (~3.5-fold; P < 0.001) as compared to that in vehicle-treated EECs (Fig. 6A).

Microtubule depolymerization suppressed CaMKIIα-mediated NF-κB and NFAT expression and inhibited PGE2/PGF2α release

Further, to assess whether calcineurin and downstream proteins NFAT and NF-κB are regulated via CaMKIIα, we functionally blocked the CaMKIIα through siRNA and measured the expression of these downstream cascades. The immunoblotting analysis showed the reduction in CaMKIIα and calcineurin by ~0.4-fold (P < 0.001),

transcription factor NFAT by ~0.4-fold (P < 0.001), NF-κB p50 by ~0.5-fold (P < 0.001) and NF-κB p65 by ~0.4-fold (P < 0.001) (Fig. 6B). The NF-κB -Luc reporter gene was significantly inhibited by nocodazole or cyclosporine A treatment or CaMKIIα siRNA knockdown (Fig. 6C). Overall, these results consistently defined that microtubule depolymerization inhibits WNT4/CaMKIIα signaling and suppressed the transcription factor NFAT and NF-κB via CaMKIIα during peri-implantation in mice.

Previous reports confirmed that prostaglandins regulate Ca+2 homeostasis (Harks et  al. 2003, Sales & Jabbour 2003) and PGE2 and PGF2α have been reported

Figure 5 Microtubule depolymerization attenuates WNT4/CaMKIIα signaling during peri-implantation, D5. (A) Interaction between WNT4 ligand and Fz-2 was determined by co-immunoprecipitation. Tissue lysates were immunoprecipitated with anti-Fz-2 and subsequently immunoblotted with anti-WNT4. NC is the negative control in which cell lysate was incubated with IgG instead of anti-Fz-2. Representative blots are shown in the left panel and densitometric quantitation of relative protein expression levels are shown as fold changes in the right panel. P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs vehicle. (B) Effect of nocodazole the WNT4/CaMKIIα signaling and its downstream effectors calcineurin and NFAT during peri-implantation. Three replicates (individual animal as a replicate) were used in each group. (C) MT depolymerization suppressed NF-κB protein expression during peri-implantation. Each experiment was performed three times with three tissue samples. GAPDH was used as a control to correct for loading. Representative blots are shown in the left panel and densitometric quantitation of protein expression levels are shown as fold changes in the right panel. P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs control. Three replicates (individual animal as a replicate) were used in each group.

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

MT depolymerization inhibits implantation 55

https://rep.bioscientifica.com Reproduction (2019) 158 47–59

Figure 6 Microtubule depolymerization attenuates WNT4/CaMKIIα singnaling with inhibition of NFAT and NF-κB in EECs. (A) Effect of microtubule depolymerization on cytosolic free Ca+2. Fluorescence was measured from EECs loaded with 2 μM Fluo-3-AM dye. Exposure of primary mouse EECs to 5 μM ionomycin induced a Ca+2 transient. Each experiment was performed three times with three different samples. (B) Nocodazole (300 nM)- or cyclosporine A (0.5 μM)- treatment or CaMKIIα (30 nM) siRNA in EECs suppressed CaMKIIα, calcineurin, NFAT and NF-κB expression during peri-implantation. Each experiment was performed three times with three different samples. GAPDH was used as a control to correct for loading. Representative blots are shown in the left panel and densitometric quantitation of protein expression levels are shown as fold changes in the right panel. (C) Transcriptional activation of the NF-κB promoter in primary mouse EECs transiently transfected with pNF-κB-luc reporter plasmids or incubated with nocodazole (300 nM) or cyclosporine A (calcineurin inhibitor; 0.5 μM) or transfected with CaMKIIα siRNA (30 nM). pRL-luc plasmid was used as internal control and fold change of normalized relative luciferase activity was determined. Each experiment was performed three times with three different samples. (D) Mouse EECs were treated with nocodazole (300 nM) or cyclosporine A (0.5 μM) or transfected with CaMKIIα siRNA (30 nM). Conditioned media were collected to measure PGE2 levels and PGF2α levels by ELISA. Three replicates (individual animal as a replicate) were used in each group. Data are presented as mean ± s.e.m. P values: aP < 0.001, bP < 0.01, cP < 0.05 and dP > 0.05 vs control group.

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

V Shukla and others56

Reproduction (2019) 158 47–59 https://rep.bioscientifica.com

to play a significant role in embryo implantation (Matsumoto et  al. 2001, Parent et  al. 2003). Thus, we sought to examine whether MT depolymerization impaired PGE2 and PGF2α biosynthesis via CaMKIIα in mouse EECs. For this, we determined PGE2 and PGF2α levels by ELISA. A significant decrease in level of PGE2 and PGF2α was observed in all three conditions i. e. after nocodazole (P < 0.001) or cyclosporine A (P < 0.001) treatment or CaMKIIα siRNA knockdown (P < 0.01) (Fig. 6D).

Discussion

The physiological, cellular, micro-structural and molecular mechanisms of uterine receptivity are implicated in malfunction of embryo implantation in mammals. The ability of the cytoskeleton to deform and reform is critical for cellular differentiation in the uterine endometrium at the time of embryo invasion (Paule et al. 2010). More importantly, understanding the mechanism(s) of microtubule dynamics is of particular interest in the context of embryo implantation. Herein, we explored the functional significance of microtubule polymerization in the embryo implantation using mouse as an experimental model.

Our study revealed that microtubule polymerization has functional significance in regulating crucial cellular functions of the endometrium. TPPP was found to be expressed throughout the window of implantation and was highly detected on D5 of pregnancy. During menstrual cycle, the differentiation and growth of the endometrium is controlled by E2 and P4 (Wang & Dey 2006). The uterine response to E2 is highly regulated during the window of implantation in mouse and human (Lee et al. 2010). To locate whether uterine TPPP and ovarian hormones were correlated, the delayed implantation experiment was done in ovariectomized mice. Our findings indicated that E2 upregulates TPPP, whereas P4 could adversely affect its regulation. Nocodazole disrupts MTs by binding to β-tubulin and preventing the formation of one of the two inter-chain disulfide linkages, thus inhibiting MT dynamics (Mitchison & Kirschner 1984). Hence, we used nocodazole to assess the effect of MT depolymerization in peri-implantation events. The reduction in number of blastocysts on D5 was observed in mice receiving nocodazole treatment at pre-implantation phase in utero. In spatiotemporal studies, the increased expression of TPPP and α/β-tubulin was seen in LE cells and stromal cells in peri-implantation period (D5) which was found to be suppressed in nocodazole-treated mice uteri, which indicated the involvement of MT polymerization at the time of implantation. Steroid receptors ER and PR have fundamental role in maintaining and regulating the embryo implantation (Bulun 2017). Studies targeting PR-A or PR-B showed specific roles of each PR isoform in mediating P4 activities on the murine uterus (Patel

et al. 2015). PR-A is the leading functional isoform in the uterus (Large & DeMayo 2012). In our study, microtubule depolymerization suppressed the expression of ERα, PR-A and PR-B indicates that microtubule depolymerization can affect the action of ovarian hormones which may be responsible for suppressed levels of TPPP. Previous reports indicate that nocodazole does not significantly alter the expression of JNK and STAT3 in different types of cells (Chen et al. 2002, Zhang et al. 2002, Shi et al. 2006, Zou et  al. 2008, Guo et  al. 2012). Our data clearly indicated that microtubule depolymerization by nocodazole did not alter the expression of JNK and STAT3; however, it affected specifically the microtubule polymerization-associated proteins and receptivity markers in the uterus. Our results also indicated that the effect of nocodazole was primarily due to microtubule depolymerization and not because of cell death.

The successful implantation requires simultaneous communication between LE and the synchronous development of the endometrial stroma in mouse (Wang et al. 2015, Lindsay et al. 2016). The LE plasma membrane transformation and cytoskeletal changes are essential for uterine receptivity in rodents and mammals (Murphy 2004, Montazeri et al. 2015). Previous report on comprehensive analysis suggested that spindle-microtubules-related proteins CDC2, KIF11, PRC1 and KIF4A are important for receptivity in human endometrium (Diaz-Gimeno et  al. 2011). The failure of embryo attachment in nocodazole-treated mouse uterus was due to altered cellular structure and failed remodeling of the uterine LE cells into a state that is not receptive for embryo implantation. The epithelial plasma membrane transformation is a hallmark event for uterine receptivity acquisition in various species including the human (Murphy 2004). Here, our study demonstrated that depolymerization of MTs via nocodazole leads to LE modification and distorted pinopodes morphology in mouse uterus on D5 of pregnancy. The expression of receptivity markers (LIF, HoxA10, Integrin β-3, IHH and WNT4) was also found to be decreased in MT depolymerized group. Further, nocodazole treatment prevented the blastocyst attachment and the adhesion reaction to mouse EECs. Although the contribution of embryonic MTs in successful implantation cannot be ruled out, a significant contribution is made by EECs which basically undergoes the acquisition of receptive state and is required for successful blastocyst adhesion and attachment.

In pregnant mouse uterus, WNT4 expression is increased in the stroma surrounding the blastocyst with the onset of attachment reaction at midnight of D4, and further enhanced on D5 and beyond upto D7 (Franco et al. 2011). The reduction in uterine glands may take charge for the impaired implantation in Wnt4-deficient female mice (Li et al. 2007). Previous reports confirmed that WNT regulates MT dynamics through canonical or non-canonical WNT signaling pathway in monkey

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

MT depolymerization inhibits implantation 57

https://rep.bioscientifica.com Reproduction (2019) 158 47–59

kidney and mouse neuronal cells (Ciani et  al. 2004, Salinas 2007). In the current study, we observed that MT depolymerization caused inhibition in the receptivity marker WNT4, which is the upstream target of WNT signaling. which led to suppressed WNT4 and Fz-2 interaction as evident by co-IP experiments.

In the non-canonical WNT pathway, binding of WNTs to Fz receptors increases intracellular calcium levels and activates PKC in a DVL-dependent manner (Sheldahl et al. 2003). Ca+2 homeostasis is the essential phenomenon during blastocyst implantation and the maintenance of optimum Ca+2 levels is important at maternal–fetal interface (Suzuki et  al. 2008). In our study, mouse EECs after nocodazole or cyclosporine A (calcineurin inhibitor) treatment or CaMKIIα siRNA knockdown showed an increase in cytoplasmic Ca+2 level. Also, MT depolymerization notably reduced the expression of calcium-dependent proteins calmodulin, CaMKIIα and calcineurin during peri-implantation phase and also in EECs in mouse.

To explore the WNT4 downstream cascades, we functionally knocked down the CaMKIIα and found an inhibition in the expression of calcineurin, NFAT and NF-κB. Further, in the presence of cyclosporine A, attenuation of transcription factor NFAT along with suppression of NF-κB, was observed. Besides, NF-κB-luc transcriptional activation was significantly inhibited in EECs when treated with nocodazole or transfected with CaMKIIα siRNA or cyclosporine A. Previous reports show that calcineurin, NFAT and NF-κB are expressed in rodents, in human endometrium and first-trimester human trophoblast (Ponce et  al. 2009, Abraham et  al. 2012, Celik et al. 2013, Wang et al. 2013). The elevations of decidual markers induced by Ca2+ have been suggested to be mediated partially through the calcineurin/NFAT pathway (Maldonado-Perez et al. 2007, Macdonald et al. 2011, Abraham et al. 2012). Thus, our results indicated that MT depolymerization suppresses implantation by inhibiting CaMKIIα-mediated calcineurin/NFAT/NF-κB signaling. However, the suppression of WNT4 can also affect canonical pathway; hence, it will be interesting to evaluate further the canonical signaling molecules which may also be important in the regulation of receptivity markers in the uterus.

Defective endometrial PG synthesis has been linked with repeated implantation failure in patients undergoing in vitro fertilization (Achache et  al. 2010). Interaction of PGE2 with the EP1 receptor mobilizes intracellular calcium and PGF receptor activation is coupled to phospholipase C-IP3 pathway and Ca2+ mobilization (Harks et  al. 2003, Sales & Jabbour 2003). PGE2 and PGF2α concentrations are also increased in the human endometrial fluid during the window of implantation (Vilella et al. 2013). Furthermore, in rodents and bovines, PGE2 and PGF2α have been reported to play an important role in blastocyst implantation (Matsumoto et al. 2001, Parent et  al. 2003). In our study, the decreased levels

of PGE2 and PGF2α were observed in EECs under the condition of MT depolymerization. CaMKIIα knockdown and cyclosporine A treatment also suppressed the secretory levels of PGE2 and PGF2α in the EECs. The suppressed levels of PGE2 and PGF2α might be responsible for the failure of uterine receptivity as well as implantation. Overall, these findings proposed that MT depolymerization inhibits WNT4/CaMKIIα signaling during peri-implantation stage in mice. Although the specific role of these microtubule-dependent calcineurin signaling remains to be validated and investigated further, these findings do support our notion on the importance of cytoskeletal proteins in the process of implantation.

In conclusion, MT depolymerization suppressed the WNT4/CaMKIIα signaling, decreased prostaglandins PGE2 and PGF2α in EECs subsequently leading to implantation failure in mice. The findings of this study substantiate the importance of MT polymerization and associated proteins upholding the complex mechanism of embryo implantation. Future studies on such proteins in human clinical samples might aid in the understanding of biological mechanisms involved in female fertility and will also provide cues for development of newer strategies for treatment of endometrium-based infertility in women.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was financially supported by CSIR network project BSC0101. This is CSIR-CDRI communication number 9830.

Author contribution statement

A D conceptualized the study. A D and V S designed and executed the experiments. V S, J B K, P P, R K and P K A performed the experiments. K M analyzed TEM. A D and V S analyzed the entire data and drafted the manuscript. All authors have approved the final version of the manuscript.

Acknowledgments

The authors thank Dr Kavita Singh and Ms Garima Pant, SAIF-facility, CSIR-CDRI for help in confocal microscopy and TEM, respectively. V S is the recipient of Senior Research Fellowship from Indian Council of Medical Research, New Delhi and is PhD scholar of AcSIR, CSIR-CDRI campus, Lucknow.

ReferencesAbraham  F, Sacerdoti  F, De León  R, Gentile  T & Canellada  A 2012

Angiotensin II activates the calcineurin/NFAT signaling pathway and induces cyclooxygenase-2 expression in rat endometrial stromal cells. PLoS ONE 7 e37750. (https://doi.org/10.1371/journal.pone.0037750)

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

V Shukla and others58

Reproduction (2019) 158 47–59 https://rep.bioscientifica.com

Achache  H, Tsafrir  A, Prus  D, Reich  R & Revel  A 2010 Defective endometrial prostaglandin synthesis identified in patients with repeated implantation failure undergoing in vitro fertilization. Fertility and Sterility 94 1271–1278. (https://doi.org/10.1016/j.fertnstert.2009.07.1668)

Angers S & Moon RT 2009 Proximal events in Wnt signal transduction. Nature Reviews: Molecular Cell Biology 10 468–477. (https://doi.org/10.1038/nrm2717)

Bazer  FW, Spencer  TE, Johnson  GA, Burghardt  RC & Wu  G 2009 Comparative aspects of implantation. Reproduction 138 195–209. (https://doi.org/10.1530/REP-09-0158)

Bhutada  S, Basak  T, Savardekar  L, Katkam  RR, Jadhav  G, Metkari  SM, Chaudhari UK, Kumari D, Kholkute SD, Sengupta S et al. 2014 High mobility group box 1 (HMGB1) protein in human uterine fluid and its relevance in implantation. Human Reproduction 29 763–780. (https://doi.org/10.1093/humrep/det461)

Bulun SE 2017 Steroids, cytokines, and implantation. Endocrinology 158 1575–1576. (https://doi.org/10.1210/en.2017-00407)

Celik  O, Celik  E, Turkcuoglu  I, Yilmaz  E, Ulas  M, Simsek  Y, Karaer  A, Celik N, Aydin NE, Ozerol I et al. 2013 Surgical removal of endometrioma decreases the NF-kB1 (p50/105) and NF-kB p65 (Rel A) expression in the eutopic endometrium during the implantation window. Reproductive Sciences 20 762–770. (https://doi.org/10.1177/1933719112466307)

Cha J, Sun X & Dey SK 2012 Mechanisms of implantation: strategies for successful pregnancy. Nature Medicine 18 1754–1767. (https://doi.org/10.1038/nm.3012)

Chen  W, White  MA & Cobb  MH 2002 Stimulus-specific requirements for MAP3 kinases in activating the JNK pathway. Journal of Biological Chemistry 277 49105–49110. (https://doi.org/10.1074/jbc.M204934200)

Choi HJ, Fukui M & Zhu BT 2011 Role of cyclin B1/Cdc2 up-regulation in the development of mitotic prometaphase arrest in human breast cancer cells treated with nocodazole. PLoS ONE 6 e24312. (https://doi.org/10.1371/journal.pone.0024312)

Ciani L, Krylova O, Smalley MJ, Dale TC & Salinas PC 2004 A divergent canonical WNT-signaling pathway regulates microtubule dynamics: dishevelled signals locally to stabilize microtubules. Journal of Cell Biology 164 243–253. (https://doi.org/10.1083/jcb.200309096)

Diaz-Gimeno  P, Horcajadas  JA, Martinez-Conejero  JA, Esteban  FJ, Alama  P, Pellicer  A & Simon  C 2011 A genomic diagnostic tool for human endometrial receptivity based on the transcriptomic signature. Fertility and Sterility 95 50.e1–60.e1. (https://doi.org/10.1016/j.fertnstert.2010.04.063)

Domínguez F, Garrido-Gómez T, López  JA, Camafeita  E, Quiñonero A, Pellicer  A & Simón  C 2009 Proteomic analysis of the human receptive versus non-receptive endometrium using differential in-gel electrophoresis and MALDI-MS unveils stathmin 1 and annexin A2 as differentially regulated. Human Reproduction 24 2607–2617. (https://doi.org/10.1093/humrep/dep230)

Franco HL, Dai D, Lee KY, Rubel CA, Roop D, Boerboom D, Jeong JW, Lydon  JP, Bagchi  IC, Bagchi MK et al. 2011 WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse. FASEB Journal 25 1176–1187. (https://doi.org/10.1096/fj.10-175349)

Fujimoto GI, Saldana LR & Gaskin F 1976 Uterine tubulin production during early pregnancy in the rabbit. Endocrine Research Communications 3 219–229. (https://doi.org/10.3109/07435807609056902)

Green CJ, Fraser ST & Day ML 2015 Insulin-like growth factor 1 increases apical fibronectin in blastocysts to increase blastocyst attachment to endometrial epithelial cells in vitro. Human Reproduction 30 284–298. (https://doi.org/10.1093/humrep/deu309)

Guo X, Zhang X, Li Y, Guo Y, Wang J, Li Y, Shen B, Sun D & Zhang J 2012 Nocodazole increases the ERK activity to enhance MKP-1 expression which inhibits p38 activation induced by TNF-α. Molecular and Cellular Biochemistry 364 373–380. (https://doi.org/10.1007/s11010-012-1239-5)

Gupta K, Sirohi VK, Kumari S, Shukla V, Manohar M, Popli P & Dwivedi A 2018 Sorcin is involved during embryo implantation via activating VEGF/PI3K/Akt pathway in mice. Journal of Molecular Endocrinology 60 119–132. (https://doi.org/10.1530/JME-17-0153)

Hantak AM, Bagchi IC & Bagchi MK 2014 Role of uterine stromal-epithelial crosstalk in embryo implantation. International Journal of Developmental Biology 58 139–146. (https://doi.org/10.1387/ijdb.130348mb)

Harks  EG, Scheenen  WJ, Peters  PH, van Zoelen  EJ & Theuvenet  AP 2003 Prostaglandin F2α induces unsynchronized intracellular calcium

oscillations in monolayers of gap junctionally coupled NRK fibroblasts. Pflugers Archiv 447 78–86. (https://doi.org/10.1007/s00424-003-1126-8)

Huang  J, Qin H, Yang Y, Chen X, Zhang  J, Laird S, Wang CC, Chan TF & Li TC 2017 A comparison of transcriptomic profiles in endometrium during window of implantation between women with unexplained recurrent implantation failure and recurrent miscarriage. Reproduction 153 749–758. (https://doi.org/10.1530/REP-16-0574)

Isshiki  K, Hirase  T, Matsuda  S, Miyamoto  K, Tsuji  A & Yuasa  K 2015 Death-associated protein kinase 2 mediates nocodazole-induced apoptosis through interaction with tubulin. Biochemical and Biophysical Research Communications 468 113–118. (https://doi.org/10.1016/j.bbrc.2015.10.151)

Kaczyński P, Baryla M, Goryszewska E, Bauersachs S & WacŁawik A 2018 Prostaglandin F2α promotes embryo implantation and development in the pig. Reproduction 156 405–419. (https://doi.org/10.1530/REP-18-0225)

Kathuria  M, Bhattacharjee  A, Sashidhara  KV, Singh  SP & Mitra  K 2014 Induction of mitochondrial dysfunction and oxidative stress in Leishmaniadonovani by orally active clerodanediterpene. Antimicrobial Agents and Chemotherapy 58 5916–5928. (https://doi.org/10.1128/AAC.02459-14)

Kaushal  JB, Sankhwar  P, Kumari  S, Popli  P, Shukla  V, Hussain  MK, Hajela K & Dwivedi A 2017 The regulation of Hh/Gli1 signaling cascade involves GSK3β-mediated mechanism in estrogen-derived endometrial hyperplasia. Scientific Reports 7 6557. (https://doi.org/10.1038/s41598-017-06370-1)

Kaushal  JB, Popli  P, Sankhwar  P, Shukla  V & Dwivedi  A 2018 Sonic hedgehog protects endometrial hyperplasial cells against oxidative stress via suppressing mitochondrial fission protein dynamin-like GTPase (Drp1). Free Radical Biology and Medicine 129 582–599. (https://doi.org/10.1016/j.freeradbiomed.2018.10.427)

Lagos-Cabré R & Moreno RD 2008 Mitotic, but not meiotic, oriented cell divisions in rat spermatogenesis. Reproduction 135 471–478. (https://doi.org/10.1530/REP-07-0389)

Large  MJ & DeMayo  FJ 2012 The regulation of embryo implantation and endometrial decidualization by progesterone receptor signaling. Molecular and Cellular Endocrinology 358 155–165. (https://doi.org/10.1016/j.mce.2011.07.027)

Lee DK, Kurihara I, Jeong JW, Lydon JP, DeMayo FJ, Tsai MJ & Tsai SY 2010 Suppression of ERalpha activity by COUP-TFII is essential for successful implantation and decidualization. Molecular Endocrinology 24 930–940. (https://doi.org/10.1210/me.2009-0531)

Li Q, Kannan A, Wang W, DeMayo FJ, Taylor RN, Bagchi MK & Bagchi IC 2007 Bone morphogenetic protein 2 functions via a conserved signaling pathway involving Wnt4 to regulate uterine decidualization in the mouse and the human. Journal of Biological Chemistry 282 31725–31732. (https://doi.org/10.1074/jbc.M704723200)

Liang  XH, Deng  WB, Li  M, Zhao  ZA, Wang  TS, Feng  XH, Cao  YJ, Duan EK & Yang ZM 2014 Egr1 protein acts downstream of estrogen-leukemia inhibitory factor (LIF)-STAT3 pathway and plays a role during implantation through targeting Wnt4. Journal of Biological Chemistry 289 23534–23545. (https://doi.org/10.1074/jbc.M114.588897)

Lindsay  LA, Dowland  SN & Murphy  CR 2016 Uterine focal adhesions retained at implantation after rat ovarian hyperstimulation. Reproduction 152 753–763. (https://doi.org/10.1530/REP-16-0331)

Lopez BJ & Valentine MT 2015 Molecular control of stress transmission in the microtubule cytoskeleton. Biochimica and Biophysica Acta 1853 3015–3024. (https://doi.org/10.1016/j.bbamcr.2015.07.016)

Macdonald LJ, Sales KJ, Grant V, Brown P, Jabbour HN & Catalano RD 2011 Prokineticin 1 induces Dickkopf 1 expression and regulates cell proliferation and decidualization in the human endometrium. Molecular Human Reproduction 17 626–636. (https://doi.org/10.1093/molehr/gar031)

Maldonado-Perez  D, Evans  J, Denison  F, Millar  RP & Jabbour  HN 2007 Potential roles of the prokineticins in reproduction. Trends in Endocrinology and Metabolism 18 66–72. (https://doi.org/10.1016/j.tem.2006.12.002)

Manohar M, Khan H, Sirohi VK, Das V, Agarwal A, Pandey A, Siddiqui WA & Dwivedi A 2014a Alteration in endometrial proteins during early- and mid-secretory phases of the cycle in women with unexplained infertility. PLoS ONE 9 e111687. (https://doi.org/10.1371/journal.pone.0111687)

Manohar M, Khan H, Shukla V, Das V, Agarwal A, Pandey A & Siddiqui WA 2014b Proteomic identification and analysis of human endometrial

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access

MT depolymerization inhibits implantation 59

https://rep.bioscientifica.com Reproduction (2019) 158 47–59

proteins associated with unexplained infertility. Journal of Proteomics and Bioinformatics 07 359–366. (https://doi.org/10.4172/jpb.1000340)

Matsumoto H, Ma WG, Smalley W, Trzaskos J, Breyer RM & Dey SK 2001 Diversification of cyclooxygenase-2-derived prostaglandins in ovulation and implantation. Biology of Reproduction 64 1557–1565. (https://doi.org/10.1095/biolreprod64.5.1557)

Maurya VK, Jha RK, Kumar V, Joshi A, Chadchan S, Mohan JJ & Laloraya M 2013 Transforming growth factor-beta 1 (TGF-B1) liberation from its latent complex during embryo implantation and its regulation by estradiol in mouse. Biology of Reproduction 89 84. (https://doi.org/10.1095/biolreprod.112.106542)

Mitchison  T & Kirschner  M 1984 Dynamic instability of microtubule growth. Nature 312 237–242. (https://doi.org/10.1038/312237a0)

Montazeri M, Sanchez-Lopez JA, Caballero I, Maslehat Lay N, Elliott S, Lopez-Martin  S, Yáñez-Mó  M & Fazeli  A 2015 Activation of Toll-like receptor 3 reduces actin polymerization and adhesion molecule expression in endometrial cells, a potential mechanism for viral-induced implantation failure. Human Reproduction 30 893–905. (https://doi.org/10.1093/humrep/deu359)

Murphy  CR 2004 Uterine receptivity and the plasma membrane transformation. Cell Research 14 259–267. (https://doi.org/10.1038/sj.cr.7290227)

Parent J, Villeneuve C & Fortier MA 2003 Evaluation of the contribution of cyclooxygenase 1 and cyclooxygenase 2 to the production of PGE2 and PGF2 alpha in epithelial cells from bovine endometrium. Reproduction 126 539–547. (https://doi.org/10.1530/rep.0.1260539)

Patel  B, Elguero  S, Thakore  S, Dahoud  W, Bedaiwy  M & Mesiano  S 2015 Role of nuclear progesterone receptor isoforms in uterine pathophysiology. Human Reproduction Update 21 155–173. (https://doi.org/10.1093/humupd/dmu056)

Paule SG, Airey LM, Li Y, Stephens AN & Nie G 2010 Proteomic approach identifies alterations in cytoskeletal remodelling proteins during decidualization of human endometrial stromal cells. Journal of Proteome Research 9 5739–5747. (https://doi.org/10.1021/pr100525a)

Ponce  C, Torres  M, Galleguillos  C, Sovino  H, Boric  MA, Fuentes  A & Johnson  MC 2009 Nuclear factor κB pathway and interleukin-6 are affected in eutopic endometrium of women with endometriosis. Reproduction 137 727–737. (https://doi.org/10.1530/REP-08-0407)

Popli P, Sirohi VK, Manohar M, Shukla V, Kaushal JB, Gupta K & Dwivedi A 2015 Regulation of cyclooxygenase-2 expression in rat oviductal epithelial cells: evidence for involvement of GPR30/Src kinase-mediated EGFR signaling. Journal of Steroid Biochemistry and Molecular Biology 154 130–141. (https://doi.org/10.1016/j.jsbmb.2015.07.019)

Sales KJ & Jabbour HN 2003 Cyclooxygenase enzymes and prostaglandins in pathology of the endometrium. Reproduction 126 559–567. (https://doi.org/10.1530/rep.0.1260559)

Salinas PC 2007 Modulation of the microtubule cytoskeleton: a role for a divergent canonical Wnt pathway. Trends in Cell Biology 17 333–342. (https://doi.org/10.1016/j.tcb.2007.07.003)

Sawyer HR, Abel AH jr, Mcclellan MC, Schmitz M. & Niswender GD 1979 Secretory granules and progesterone secretion by ovine corpus lutea in vitro. Endocrinology 104 476–486.

Sheldahl  LC, Slusarski  DC, Pandur  P, Miller  JR, Kühl  M & Moon  RT 2003 Dishevelled activates Ca2+ flux, PKC, and CamKII in vertebrate embryos. Journal of Cell Biology 161 769–777. (https://doi.org/10.1083/jcb.200211094)

Shi X, Zhang H, Paddon H, Lee G, Cao X & Pelech S 2006 Phosphorylation of STAT3 serine-727 by cyclin-dependent kinase 1 is critical for nocodazole-induced mitotic arrest. Biochemistry 45 5857–5867. (https://doi.org/10.1021/bi052490j)

Shukla  V, Chandra  V, Sankhwar  P, Popli  P, Kaushal  JB, Sirohi  VK & Dwivedi  A 2015 Phytoestrogen genistein inhibits EGFR/PI3K/NF-kB activation and induces apoptosis in human endometrial hyperplasial cells. RSC Advances 5 56075–56085. (https://doi.org/10.1039/C5RA06167A)

Shukla V, Popli P, Kaushal JB, Gupta K & Dwivedi A 2018 Uterine TPPP3 plays important role in embryo implantation via modulation of β-catenin. Biology of Reproduction 99 982–999. (https://doi.org/10.1093/biolre/ioy136)

Shukla V, Kaushal JB, Sankhwar P, Manohar M & Dwivedi A 2019 Inhibition of TPPP3 attenuates β-catenin/NF-κB/COX-2 signaling in endometrial

stromal cells and impairs decidualization. Journal of Endocrinology 240 417–429. (https://doi.org/10.1530/JOE-18-0459)

Signoretto  E, Honisch  S, Briglia  M, Faggio  C, Castagna  M & Lang  F 2016 Nocodazole Induced suicidal death of human erythrocytes. Cellular Physiology and Biochemistry 38 379–392. (https://doi.org/10.1159/000438638)

Suzuki Y, Kovacs CS, Takanaga H, Peng JB, Landowski CP & Hediger MA 2008 Calcium channel TRPV6 is involved in murine maternal-fetal calcium transport. Journal of Bone and Mineral Research 23 1249–1256. (https://doi.org/10.1359/jbmr.080314)

Tamura K, Hara T, Yoshie M, Irie S, Sobel A & Kogo H 2003 Enhanced expression of uterine stathmin during the process of implantation and decidualization in rats. Endocrinology 144 1464–1473. (https://doi.org/10.1210/en.2002-220834)

Tsai  CY, Chou  CK ,Yang  CW, Lai  YC, Liang  CC, Chen  CM & Tsai  TF 2008 Hurp deficiency in mice leads to female infertility caused by an implantation defect. Journal of Biological Chemistry 283 26302–26306. (https://doi.org/10.1074/jbc.C800117200)

Vilella  F, Ramirez  L, Berlanga  O, Martinez  S, Alama  P, Meseguer  M, Pellicer A & Simón C 2013 PGE2 and PGF2α concentrations in human endometrial fluid as biomarkers for embryonic implantation. Journal of Clinical Endocrinology and Metabolism 98 4123–4132. (https://doi.org/10.1210/jc.2013-2205)

Wang  H & Dey  SK 2006 Roadmap to embryo implantation: clues from mouse models. Nature Reviews: Genetics 7 185–199. (https://doi.org/10.1038/nrg1808)

Wang SC, Tang ChL, Piao HL, Zhu R, Sun Ch, Tao Y, Fu Q, Li DJ & Du MR 2013 Cyclosporine A promotes in vitro migration of human first-trimester trophoblasts via MAPK/ERK1/2-mediated NF-κB and Ca2+/calcineurin/NFAT signaling. Placenta 34 374–380. (https://doi.org/10.1016/j.placenta.2013.01.009)

Wang  Y, Zhu  L, Kuokkanen  S & Pollard  JW 2015 Activation of protein synthesis in mouse uterine epithelial cells by estradiol-17β is mediated by a PKC-ERK1/2-mTOR signaling pathway. PNAS 112 E1382–E1391. (https://doi.org/10.1073/pnas.1418973112)

Watanabe  S, Shioi  G, Furuta  Y & Goshima  G 2016 Intra-spindle microtubule assembly regulates clustering of microtubule-organizing centers during early mouse development. Cell Reports 15 54–60. (https://doi.org/10.1016/j.celrep.2016.02.087)

Wu GJ, Simerly C, Zoran SS, Funte LR & Schatten G 1996 Microtubule and chromatin dynamics during fertilization and early development in rhesus monkeys, and regulation by intracellular calcium ions. Biology of Reproduction 55 260–270. (https://doi.org/10.1095/biolreprod55.2.260)

Yan LY, Huang JC, Zhu ZY, Lei ZL, Shi LH, Nan CL, Zhao ZJ, OuYang YC, Song  XF, Sun  QY et  al. 2006 NuMA distribution and microtubule configuration in rabbit oocytes and cloned embryos. Reproduction 132 869–876. (https://doi.org/10.1530/rep.1.01224)

Zhang H, Shi X, Zhang QJ, Hampong M, Paddon H, Wahyuningsih D & Pelech  S 2002 Nocodazole-induced p53-dependent c-Jun N-terminal kinase activation reduces apoptosis in human colon carcinoma HCT116 cells. Journal of Biological Chemistry 277 43648–43658. (https://doi.org/10.1074/jbc.M203214200)

Zhang S, Ong CN & Shen HM 2004 Critical roles of intracellular thiols and calcium in parthenolide-induced apoptosis in human colorectal cancer cells. Cancer Letters 208 143–153. (https://doi.org/10.1016/j.canlet.2003.11.028)

Zou  T, Ouyang  L, Chen  L, Dong  W, Qiao  H, Liu  Y & Qi  Y 2008 The role of microtubule-associated protein 1S in SOCS3 regulation of IL-6 signaling. FEBS Letters 582 4015–4022. (https://doi.org/10.1016/j.febslet.2008.10.055)

Received 4 December 2018First decision 3 January 2019Revised manuscript received 28 March 2019Accepted 4 April 2019

Downloaded from Bioscientifica.com at 02/23/2022 09:37:33PMvia free access