wnt4/5a signalling coordinates cell adhesion and entry into meiosis

Wnt4/5a signalling coordinates cell adhesion andentry into meiosis during presumptive ovarianfollicle development

Florence Naillat1,{, Renata Prunskaite-Hyyrylainen1,{, Ilkka Pietila1, Raija Sormunen2,

Tiina Jokela1, Jingdong Shan1 and Seppo J. Vainio1,�

1Laboratory of Developmental Biology, Department of Medical Biochemistry and Molecular Biology, Oulu Centre

for Cell-Matrix Research, Institute of Biomedicine, Biocenter Oulu and 2Electron Microscopy Unit,

University of Oulu, PO Box 5000, FIN-90220 Oulu, Finland

Received November 30, 2009; Revised and Accepted January 20, 2010

Germ cells are the foundation of an individual, since they generate the gametes and provide the uniquegenome established through meiosis. The sex-specific fate of the germline in mammals is thought to be con-trolled by somatic signals, which are still poorly characterized. We demonstrate here that somatic Wnt signal-ling is crucial for the control of female germline development. Wnt-4 maintains germ cell cysts and earlyfollicular gene expression and provides a female pattern of E-cadherin and b-catenin expression withinthe germ cells. In addition, we find that Stra8 expression is downregulated and the Cyp26b1 gene isexpressed ectopically in the partially masculinized Wnt-4-deficient ovary. Wnt-4 may control meiosis viathese proteins since the Cyp26b1 enzyme is known to degrade retinoic acid (RA) and inhibit meiosis inthe male embryo, and Stra8 induces meiosis in the female through RA. Reintroduction of a Wnt-4 signal tothe partially masculinized embryonic ovary, in fact, rescues the female property to a certain degree, asseen by inhibition of Cyp26b1 and induction of Irx3 gene expression. Wnt-4 deficiency allows only 20% ofthe germ cells to initiate meiosis in the ovary, whereas meiosis is inhibited completely in the Wnt-4/Wnt-5adouble mutant. These findings indicate a critical role for Wnt signalling in meiosis. Thus, the Wnt signalsare important somatic cell signals that coordinate presumptive female follicle development.

INTRODUCTION

During primary sex determination in mammals, the somaticcells of the bipotential gonad are guided to follow either thefemale or the male differentiation pathway. The sex-relatedY (Sry) gene located on the Y chromosome serves as one criti-cal component for triggering testis development and functionsespecially as a determinant of the fate of the Sertoli cells (1).Sry triggers a cascade of gene expression that leads to thedevelopment of the secondary sexual characteristics that aretypical of the male.

Wnt signalling and certain components of the Wnt signaltransduction pathway are critical for female development(2–5). Wnt-4 in particular was identified as a key signalthat promotes female development, since typical female

characteristics are impaired in its absence and are replacedwith some male ones. Consistent with these phenotypicchanges, the somatic cells of the Wnt-4-deficient ovaryexpress several genes ectopically that encode enzymes of thetestosterone biosynthesis pathway (6).

Wnt signalling is thought to regulate female developmentvia b-catenin (Ctnnb1) (7,8) and R-spondin (Rspo1) (4).Stabilization of b-catenin in the early testis, for example,induces some female characteristics (5,9), and b-cateninknock-out in the ovarian somatic cells shifts sexual develop-ment in the male direction (10).

The primary sex determination function of somatic cells isassociated with concurrent commitment of the germlinecells. The primordial germ cells are attracted to the indifferent

†The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.

�To whom correspondence should be addressed at: Laboratory of Developmental Biology, Biocenter Oulu, University of Oulu, Aapistie 5,PO Box 5000, FIN-90220 Oulu, Finland. Tel: þ358 8537604; Fax: þ358 85376115; Email: [email protected]

# The Author 2010. Published by Oxford University Press. All rights reserved.For Permissions, please email: [email protected]

Human Molecular Genetics, 2010, Vol. 19, No. 8 1539–1550doi:10.1093/hmg/ddq027Advance Access published on January 27, 2010

Downloaded from https://academic.oup.com/hmg/article-abstract/19/8/1539/571726by gueston 19 February 2018

gonad (11,12), and there the somatic cells nurse the germ cells,determine their sexual fate and promote their sexuallydimorphic differentiation to either the sperm cells or theoocytes (11). In female mouse embryos, the germ cellsundergo mitotic divisions until around E13.5 and then initiatemeiosis, which continues to prophase I diplonema, a stage atwhich meiosis remains arrested until the start of ovulation(13). The germ cells in the embryonic testis undergo mitoticdivisions and initiate meiosis only at puberty (14).

Retinoic acid (RA) controls the entry of the female germcells into meiosis by inducing expression of a transcriptionfactor, Stra8 (15,16). In contrast, in males, RA becomesdegraded by the activity of the Cyp26b1 enzyme, and theinitiation of meiosis is inhibited (14). Other than the RApathway, the signals involved in the control of gonadal germcell behaviour are poorly known.

We show here that Wnt signalling from the somatic cells ofthe developing ovary is critical for female germline develop-ment. Wnt-4 deficiency disrupts germ cell–cell contacts, andthis is associated with a shift from a female- to a male-typepattern of b-catenin and E-cadherin (Cdh1) expression in thegerm cells. Wnt-4 signalling is also critical for meiosis,since Stra8 and certain other meiosis markers are reduced inWnt-4 deficiency. Wnt-4 may regulate meiosis via the RApathway, as Cyp26b1 is ectopically expressed in theWnt-4-deficient mesonephros–ovary unit, and expression isinhibited by Wnt-4 gain of function. Moreover, only �20%of the Wnt-4-deficient ovarian germ cells are able to enterinto meiosis at E14.5, whereas meiosis is completely inhibitedin the ovaries of Wnt-4/5a double-mutant embryos. We con-clude that the fate of the female germline cells is under thecontrol of somatic Wnt signalling.

RESULTS

Wnt-4 encodes a somatic ovarian cell signal

To determine whether Wnt-4 is expressed by the soma or the germ-line or both, we made use of the Wnt-4EGFPCre knock-in mouseline in which the Cre recombinase-encoding gene has beentargeted under the control of the endogenous Wnt-4 promoter.The Wnt-4EGFPCre line was crossed with the floxed Rosa26LacZ

reporter mouse in which the LacZ gene becomes permanentlyactivated upon Cre-mediated recombination. The ovaries ofthe Wnt-4EGFPCre;Rosa26LacZ-positive newborn F1 mice demon-strated LacZ staining only in the ovarian somatic cells(Supplementary Material, Fig. S1A–C). Moreover, the patternof LacZ expression in the F2 embryos that were derived fromthe Wnt-4EGFPCre;Rosa26LacZ-positive individuals expressingthese cassettes resembled that of the endogenous Wnt-4 gene(Supplementary Material, Fig. S1D) (17). Hence Wnt-4 regulatesfemale development as a somatic signal and it is not expressed inthe female germline at any developmental stage.

Wnt-4 signalling has a role in the maintenance of thefemale germline cysts

To address the potential role of Wnt signalling in the develop-ment of the female germline cells, we analysed the presence ofthe germ cells in Wnt-4-deficient embryos. We found that germ

cells, labelled with an antibody against germ cells expressed,Mvh (anti-Vasa homolog), were numerous in the Wnt-4-deficientovary at E12.5 and E14.5 when the Kit ligand expression isalready reduced (Supplementary Material, Table S1), but uponcloser inspection, the germ cells failed to accumulate to the cor-tical part of the ovary (Supplementary Material, Fig. S2A–D,arrow). At E16.5, some germ cells were detected in close proxi-mity to the mesonephros in the Wnt-4-deficient ovary. It was alsonoted at this stage that most of the female germ cell cysts haddisintegrated to either single-germ cells or assemblies of a fewgerm cells only, whereas the corresponding wild-type germcells remained clustered (Supplementary Material, Fig. S2,compare E with F, arrows and inserts) (12,13).

Ultrastructural analysis indicated that the germ cells in theWnt-4-deficient ovary had become detached from each otherand physical gaps were visible in the whole germ cell–somatic cell complex at E13.5, unlike wild-type control cells(Fig. 1, compare B with A and D with C, white arrows).The adherence junctions in developing oocytes and somaticcells (Fig. 1C, red arrow) were poorly organized in the caseof Wnt-4 deficiency (Fig. 1D, red arrow), whereas these struc-tures were readily detected in the endothelial cells of the emer-ging blood vessels in the same ovary (Fig. 1E, red arrow).Expression of Connexin 43 (Cx43) (18) and Iroquois3 (Irx3)(19) was downregulated in the Wnt-4-deficient ovary(Fig. 1F–J; Supplementary Material, Table S1). HenceWnt-4 signalling is critical for the maintenance of cell–cellcontacts within the developing female follicle.

Wnt-4 deficiency shifts the b-catenin and E-cadherinexpression patterns from the female type to the maletype in the ovary

The compromised organization of the presumptive female fol-licle due to Wnt-4 deficiency may be caused by changes inexpression of certain cell adhesion molecules such asb-catenin and E-cadherin. Wnt-4 signalling can targetb-catenin to the plasma membrane in certain cells (8).

Most strikingly, a comparison of the dynamics of b-cateninand E-cadherin expression between embryonic ovarian andtesticular germ cells revealed sexually dimorphic expressionpatterns. Typically at E12.5, b-catenin is weakly expressedthroughout the female germ cell. In the case of Wnt-4deficiency, it accumulated in the immediate borders of thegerm cells instead, being similar in this respect to theexpression pattern identified in wild-type male germ cells(Fig. 2A–I, compare F with I and C, in yellow, arrows).b-Catenin expression in wild-type female germ cells wasreduced by E14.5 (Fig. 2J–L). However, in the Wnt-4-deficient ovary at E14.5, b-catenin expression still resembledthe pattern identified for the wild-type testis of an E12.5embryo (Fig. 2, compare P–R with G–I and M–O with D–F, in yellow, arrows).

E-cadherin, a cell adhesion molecule, is expressed in theovarian germ cells until around E14.5, whereas its expressionin the developing testis continues well beyond this stage (20).E-cadherin expression was unchanged at E14.5 irrespectiveof Wnt-4 deficiency (Supplementary Material, Fig. S3A–I),but became undetectable at E15.5 in the wild-type ovary(Supplementary Material, Fig. S3J–L), whereas it persisted

1540 Human Molecular Genetics, 2010, Vol. 19, No. 8


http://hmg.oxfordjournals.org/cgi/content/full/ddq027/DC1








in the Wnt-4-deficient germ cells in a manner comparable withthat seen in the wild-type testis (Supplementary Material,Fig. S3, compare P–R with M–O and J–L).

Western blot analysis showed that the Wnt-4-deficient ovaryexpressed increased levels of b-catenin relative to the ovary ofa wild-type embryo, but the stabilized form [anti-active b-catenin (ABC)] remained unchanged at E14.5 (Fig. 2S andT). E-cadherin expression was closer to the level observed

in the wild-type testis in the Wnt-4-deficient ovary (Sup-plementary Material, Fig. S3S).

Since the transcription factors Gata4 and Fog2 are con-sidered to contribute to the stability of the ovarian b-catenin,which is critical for female development (7), we analysedtheir expression in the Wnt-4 knock-out model. AlthoughGata4 expression was unchanged (Supplementary Material,

Figure 1. Wnt-4 deficiency leads to impaired cell contacts between femalegerm cells and somatic cells. (A) The ultrastructure of germ cell–somaticcell complex of an ovary of a wild-type embryo. The cell contacts in the pre-sumptive ovarian follicle are impaired at E13.5 due to Wnt-4 deficiency (B, Dwhite arrows). An adherence junction has formed at the border region betweena germ cell and a somatic cell in a normal ovary at E13.5 (C, red arrows) whilethe junction is defective in the case of Wnt-4 deficiency, and physical gapsbetween cells have formed (D, red arrow) while the junctions between theendothelial cells remain intact (E, red arrow). (F) Expression of Cx43 isreduced in the Wnt-4-deficient ovary at E14.5. qPCR (G) and whole-mountin situ hybridization (H–J) of Irx3 in wild-type or the Wnt-4-deficientovary and testis. O, an oocyte; So, a somatic cell; E, an endothelial cell.Scale bar (A and B) 250 nm; (C–E) 500 nm; (H–J) 250 mm.

Figure 2. b-Catenin expression pattern becomes shifted from the female typeto the male type in the germ cells of the Wnt-4-deficient gonad. (A–C)b-Catenin (in red) is expressed throughout the Mvhþ germ cells (in green)at E12.5 in the ovary of wild-type female (C, yellow). (D–F) In the case ofWnt-4 deficiency, b-catenin accumulates at the sites of germ cell–cell contacts(F, in yellow, arrow). (G–I) The expression pattern in wild-type male germcells is remarkably similar to that seen in the Wnt-4-deficient female germcells (compare F with I, arrows), where b-catenin accumulates at the cellborders (I, in yellow, arrow). (J–R) Wnt-4-deficient ovarian germ cells atE14.5 resemble the pattern of the male and Wnt-4-deficient germ cells atE12.5 (compare O with I and F, arrows). (A, D, G, J, M and P) The germcells identified with the Mvh antibody. The western blots demonstratingexpression of the total b-catenin (S) and the non-phosphorylated, activeform of b-catenin (T). Scale bar 100 mm.

Human Molecular Genetics, 2010, Vol. 19, No. 8 1541







Fig. S4A–G), unexpectedly Fog2 expression was upregulatedcompared with the controls due to Wnt-4 deficiency in theovary (Supplementary Material, Fig. S4H and Table S1).Hence, the changes in the expression patterns of b-catenin andE-cadherin in the germ cells brought about by Wnt-4 deficiencydemonstrate a shift from the female towards the male type.

Wnt-4 signalling is critical for the maintenance of thedeveloping ovarian follicle

Given the fact that Wnt-4 represents a somatic cell signal inthe developing female embryo (2) that also controls germlinedevelopment, we analysed how the female properties of theearly ovarian follicle would be maintained without Wnt-4 sig-nalling. The Adamts19 gene, which is robustly expressed inthe wild-type developing ovary but is not detected in the wild-type testis (21), was downregulated in Wnt-4 deficiency (Sup-plementary Material, Fig. S5A–C). Similarly, gene expressionfor the granulosa cell-derived Kit ligand (Kitl), the protein ofwhich, together with the Kit receptor, controls the growth ofthe oocyte was downregulated (22) (Supplementary Material,Table S1). Moreover, the transcription factor Figla (Figa),which regulates the zona pellucida (Zp1-3) genes (23), wasexpressed at low levels in the Wnt-4-deficient ovary at E14.5and newborn stages compared with the wild-type (Supplemen-tary Material, Fig. S4I–N and Table S1). Also, Nobox genethat controls oocyte gene expression and is essential for folli-culogenesis (24) was downregulated in the case of Wnt-4deficiency (Supplementary Material, Table S1). Expressionof the transcription factor Foxl2 (25) did not change signifi-cantly (Supplementary Material, Fig. S4O), but expressionof Gdf9 and Bmp15, both of which regulate the transition ofa primordial ovarian follicle to a primary one (26), wasreduced due to Wnt-4 deficiency (Supplementary Material,Table S1). Thus, Wnt-4 signalling is critical for the mainten-ance of the developing ovarian follicle.

Wnt-4 signalling controls germ cell entry into meiosis inthe developing ovary

The germ cells initiate meiosis during E13.5–E15.5(15,16,27). RA is a critical signal for the induction ofmeiosis (14) and regulates the entry via the promotion ofovarian Stra8 expression (14,15,28), which increases untilE14.5 (Fig. 3A and D). Stra8 expression, which was notdetected in embryonic testis (Fig. 3C and D) (15), wasreduced in the Wnt-4-deficient ovary (Fig. 3B and D),suggesting that Wnt-4 signalling contributes to the initiationof meiosis in female germ cells.

The Cyp26b1 gene, which encodes an enzyme that degradesRA in the embryonic testis and, in this way, prevents malegerm cells from entering into meiosis, is expressed in bothsexes up to E11.5, but becomes restricted to the somaticcells of the testis by E12.5 (14). Consistent with the role ofRA in meiosis, Cyp26b1 is not detected in the wild-typeovary at E12.5 or E13.5 (Fig. 3E and H; SupplementaryMaterial, Fig. S5D), but is present in the testis at thesestages and later (Fig. 3G and H; Supplementary Material,Fig. S5F). Interestingly, the Cyp26b1 gene was ectopicallyexpressed in the Wnt-4-deficient mesonephros at E12.5

(Fig. 3F), but the expression shifted to the gonad by E13.5(Supplementary Material, Fig. S5E, arrows). It is significantthat the Wnt-4-deficient ovary also expressed reduced levelsof Aldh1a1 and Aldh1a2, which are involved in the productionof RA (14) (Supplementary Material, Table S1). The resultssupport the conclusion that Wnt-4 signalling promotes theentry of the female germ cells into meiosis via the RApathway that leads to the induction of Stra8 expression.

Stra8 has a function in the formation of the synaptonemalcomplexes (SCs) that are important for the progress of meiosismediated by the SC proteins (15). We found that Sycp1 andSycp3 expression was downregulated without Wnt-4 activity(Supplementary Material, Table S1), whereas Cpeb1, whichencodes a protein that promotes meiosis by binding to themRNA of Sycp1 and Sycp3 (26), was also reduced (Supplemen-tary Material, Table S1). It should be noted that expression ofSpo11 and Msh5, both of which regulate meiotic DNA repairproteins (29), also decreased in the Wnt-4-deficient ovary (Sup-plementary Material, Table S1; Fig. 4G).

Given these defects in expression of genes that are involvedin the control of meiosis due to Wnt-4 deficiency, we next ana-lysed potential changes in expression of meiosis markers andthe total number of germ cells. The gH2AX and Xlr proteinswere used as indicators of meiosis prophase I at E14.5, E15.5and E16.5 (30,31). These were expressed in the germ cells ofthe wild-type ovary (Fig. 4A and D; Supplementary Material,Fig. S5G and J), but in the case of Wnt-4 deficiency, they wereexpressed only by some of the dispersed germ cells (Fig. 4Band E; Supplementary Material, Fig. S5H and K), whereasno expression was noted in the developing testis (Fig. 4Cand F; Supplementary Material, Fig. S5I and L).

We counted the numbers of Mvhþ germ cells that were inmeiosis and compared them with the total numbers of germcells. Although �80% of wild-type germ cells had initiatedmeiosis at E14.5, only �20% of the Wnt-4-deficient germcells had done so (Fig. 4H). Collectively, the findings pointto a severe early defect in meiosis when Wnt-4 signalling isimpaired.

A switch in the sexual identity of the female germ cellswithout Wnt-4 signalling

Since the b-catenin and E-cadherin expression patterns weremasculinized in the Wnt-4-deficient ovary, we investigatedwhether the germ cell and soma might demonstrate additionalmale characteristics.

Lack of Oct4 (Pou5f1) function is associated with compe-tence for entering meiosis in female embryos (27), whereasPiwil2 is crucial for spermatogenesis (32). Both of thesegenes were ectopically expressed in the Wnt-4-deficientovary (Fig. 3I–L; Supplementary Material, Table S1).

Another male gene, Renin1 (33), showed a 14-fold induc-tion in the Wnt-4-deficient ovary at E14.5, but was notexpressed in the wild-type ovary (Supplementary Material,Table S1). Xmr, which is transcribed in the round spermatidsat E14.5 (34), was also ectopically expressed in theWnt-4-deficient ovary (Supplementary Material, Table S1).Strikingly, even Acrosin (Acr), which encodes a proteininvolved in fertilization (35) that was not expressed in thewild-type ovary (Fig. 3M and P), was present in some germ





































cells of the Wnt-4-deficient ovary (Fig. 3N, arrows) and thetestis, (Fig. 3O, arrows, P).

Phase-contrast microscopic analysis revealed Wnt-4-deficient germ cells that had four nuclei at E14.5, unlike incontrols (Supplementary Material, Fig. S6, compare A withB, C, arrowheads), suggesting a defect in cytokinesis. Inaddition, certain areas of the Wnt-4-deficient ovaries containedprospermatogonia-like cells that resembled a seminiferoustubule typical of the testis. Some poorly differentiatedoocytes were also present in such ovary (SupplementaryMaterial, Fig. S6, compare D–F with G–I, arrows). Thus,the Wnt-4-deficient ovary obtains male characteristics inboth the somatic cells and the germ cells.

Reintroduction of Wnt-4 signalling partially feminizesthe Wnt-4-deficient ovary

Since we had identified changes in certain sex-related par-ameters in the somatic cells and the germline in theWnt-4-deficient ovary, we set out to examine whether reintro-duction of the Wnt-4 signal in organ culture would rescue anyof these. As the indicators, we selected the oocyte-somatic celladhesion regulator Irx3 and the meiosis inhibitor Cyp26b1(Fig. 5).

When Wnt-4 was reintroduced into the embryonic gonad bycombining a cell line that produced it, no notable changes inexpression of Irx3 or Cyp26b1 was found in the wild-type

Figure 3. Reduction in Stra8 expression and induction of Cyp26b1 expression in the Wnt-4-deficient ovary. Stra8 is expressed in the wild-type ovary at E14.5(A), but expression is reduced in the Wnt-4-deficient ovary (B) while Stra8 is not expressed in the testis at this stage (C). qPCR profile of Stra8 expression (D).The Cyp26b1 gene is not expressed in the ovary (E) but it is expressed in the testis (G) at E12.5. Note that the Cyp26b1 gene has become expressed ectopically inthe mesonephros of the Wnt-4-deficient embryo (F). qPCR of Cyp26b1 in the dissected embryos gonads (H). Oct4 is not detected in the wild-type ovary (I) but itis ectopically expressed in the Wnt-4-deficient ovary (J) being similar to the situation in the wild-type testis (K). qPCR of Oct-4. The Acrosin (Acr) gene is notexpressed in the wild-type ovary (M) but it is ectopic in the Wnt-4-deficient germ cells (N, arrow heads). Acr is normally expressed in the germ cells of the testis(O, arrow heads). qPCR of Acr expression (P). Scale bar (A–K) 250 mm and (M–O) 100 mm.






testis (Fig. 5A, D, G, J and M), but Irx3 expression wasinduced to a certain degree in the Wnt-4-deficient ovarywhen compared with the untreated Wnt-4-deficient ovary(Fig. 5A, compare F with C, E and B). In contrast to this,Wnt-4 signalling inhibited Cyp26b1 expression in theWnt-4-deficient ovary when compared with the untreatedWnt-4-deficient ovary (Fig. 5A, compare L and I with K andH), suggesting a role for RA in the process. This was testedin organ culture. Indeed, RA stimulated meiosis as judged byStra8 expression in the germ cells of the wild-type testis andovary (Fig. 5, compare S with P and Q with N) but also in theWnt-4-deficient ovary (Fig. 5, compare R with O and N).Hence, Wnt-4 signalling appears to be connected to thecontrol of the RA pathway.

Wnt-4 promotes meiosis in synergy with Wnt-5a signalling

Since we found that �20% of the germ cells in theWnt-4-deficient ovary still had the capacity to initiatemeiosis (Fig. 4H), we speculated that Wnt-4 may function in

concert with other Wnt factors to regulate meiosis. Indeed,Wnt-5a expression is upregulated in the Wnt-4-deficientovary when compared with wild-type (SupplementaryMaterial, Table S1; Fig. 6M) and confined to the cells underthe germinal epithelium at E12.5 and E14.5 (Fig. 6A–F,arrows). Although the ovary of the Wnt-5a-deficient embryoexpressed reduced amount of Stra8 and gH2AX (Fig. 6,compare H with G and J with Fig. 4A), strikingly, noexpression of Stra8, Xlr or gH2AX were detected in theMvhþ germ cells of the Wnt-4/Wnt-5a-deficient ovary atE14.5 (Fig. 6I, compare K and L with Fig. 4A and D).

DISCUSSION

Wnt-4 in the control of assembly of the presumptivefemale follicle

The sex-specific fate of the germline in mammals is thoughtto be controlled by somatic signals (11), which are stillpoorly characterized. We now provide evidence that Wnt-4serves as a critical somatic cell component controlling the

Figure 4. A defect in meiosis in the developing ovary due to a lack of Wnt-4 signalling. (A–F) Antibodies against gH2AX and Xlr were used to identify induc-tion of meiosis (in red), whereas the anti-Mvh antibody served to identify the germ cells (in green). At E14.5, germ cells have initiated meiosis and expressgH2AX and Xlr (A and D) while their expression is reduced due to Wnt-4 deficiency (B and E). The male germ cells do not express these meiosis markers(C and F). (G) The expression of Spo11 and Msh5 genes at E14.5 is downregulated in the Wnt-4-deficient ovary (black bar) compared with the controls(white bar). (H) Around 20% of the germ cells in the Wnt-4-deficient ovary at E14.5 have the capacity to proceed in meiosis, whereas this value is close to80% in the wild-type ovary at this stage. Scale bar 200 mm (��P , 0.005 and ��P , 0.05).





Figure 5. A partial rescue of the female properties of the Wnt-4-deficient ovary in response to the recovery of the Wnt-4 signal. (A–M) Irx3 and Cyp26b1expression levels were analysed in ovaries and testes prepared from either wild-type or Wnt-4 mutant embryos at E12.0 after they had been co-cultured for48 h with either the control NIH 3T3 cells or the cells expressing the Wnt-4. Changes in Irx3 and Cyp26b1 gene expression was analysed by qPCR (A) orby whole-mount in situ hybridization (B–M). The role of RA in the control of meiosis was analysed (N–S). Wnt-4 signalling induces Irx3 gene expressionto a certain degree in the Wnt-4-deficient ovary compared with the unconjugated Wnt-4-deficient ovary. Wnt-4 inhibits expression of the Cyp26b1 in co-cultureswith the Wnt-4þ cells. Co-culture of Wnt4þ cells with the Wnt-4-deficient ovary induces Irx3 expression (compare F with C), whereas this inhibits Cyp26b1expression (compare L with I). RA promotes Stra8 expression in the wild-type ovary (compare Q with N), the wild-type testis (compare S with P) and theWnt-4-deficient ovary (compare R with O). G, a gonad; M, mesonephros. Scale bar 100 mm.



development of the female germline. Some of the germ cellsof Wnt-4-deficient embryos fail to reach the ovarian corticalregion, and the germline cysts composed of dividing germcells (13) reduce prematurely to single cells or to assembliesof a few germ cells with physical gaps between them andthe somatic cells. No such gaps are noted between wild-type

germ cells and somatic cells, indicating a severe defect inthe female germline cells caused by Wnt-4 deficiency. Sincecell adhesion mediated by the gap junctional proteins andadhesion molecules is expected to be important for cystogen-esis, and as we found a reduction in expression of Connexin 43and Iroquois 3, both of which contribute to cell adhesion, the

Figure 6. Wnt-5a expression is induced in the Wnt-4-deficient ovary while meiosis is perturbed in the Wnt-4/5a-deficient ovary. (A) Wnt-5a is weakly expressedin the ovary at E12.5, but its expression is enhanced in the Wnt-4 mutant ovary in cells under the germinal epithelium (compare A with B, arrows). At E14.5,Wnt-5a expression is weak in the wild-type ovary, but expression is enhanced in the case of Wnt-4 deficiency (compare C and E with D and F, arrows). Stra8 isexpressed in the wild-type ovarian germ cells (G) but expression is reduced in the Wnt-5a-deficient ovary (H). No Stra8 expression is detected in Wnt-4/Wnt-5adeficient ovary (I). Only few Wnt-5a-deficient ovarian germ cells express gH2AX (in red) at E14.5 (compare J to Fig. 4A) while the gH2AX or Xlr is notexpressed in the Wnt-4/5a-deficient Mvhþ ovarian germ cells (compare K with L). (M) qPCR depicts Wnt-5a expression in the wild-type and the Wnt-4-deficientovary. Scale bar (A–D) 200 mm; (E and F) 100 mm; ( G–I) 50 mm; (J–L) 100 mm.



data support the conclusion that Wnt-4 function is importantfor the maintenance of female germline cysts.

Apart from the defects in the female germ cell cysts, wenoted that the Wnt-4-deficient developing follicle also hadother defects. For example, E-cadherin and b-cateninexpression were localized differently in the germ cells ofdeveloping testis and ovary, and their expression patternsshifted from a female type to a male type when Wnt-4 functionwas impaired. More specifically, we found that E-cadherinexpression persisted to later developmental stages in themutant ovary and that this resembled the situation in the devel-oping testis. b-Catenin also became localized to the immediatecell–cell contact sites in the Wnt-4-deficient ovarian germcells, a pattern that was typical of the male germ cells.Hence, the Wnt-4-deficient germ cells became masculinizedin this respect.

Wnt-4 in the maintenance of female germlinecharacteristics

In addition to the afore-mentioned differences in the germcells of the Wnt-4-deficient ovary, changes in other indicatorsalso support a critical role for Wnt-4 as a promoter of femalegermline development. We found that ovarian follicularfactors such as Figla, Nobox, Gdf9 and Bmp15 were allreduced in expression without Wnt-4 activity when comparedwith the situation in the wild-type ovary. On the basis ofthese results, we propose that Wnt-4 signalling regulates thedevelopment of the follicular complex during ovarian organo-genesis by maintaining the female germline cell character-istics. It is also significant that some germ cells of theWnt-4-deficient ovary had four nuclei, whereas this was notthe case in wild-type germ cells, suggesting a defect in cyto-kinesis. The planar cell polarity Wnt signalling pathway con-trols cell polarity, which involves the PAR proteins andchanges in the cytoskeleton (36), which are also critical forcytokinesis. Hence, Wnt-4 may also influence the germ cellsby taking part in the control of cytokinesis at the same time.

Even though the details of the signal transduction of Wnt-4during ovarian development remain to be demonstrated,Wnt-4 evidently signals synergistically with Rspo1 and thecanonical Wnt signalling component b-catenin. Consistentwith this notion, knock-out of either Wnt-4 or Rspo1 functionleads to partial female-to-male sex reversal (2,4). Since ourresults demonstrate an accumulation of b-catenin betweenadjacent germ cells in the case of Wnt-4 deficiency, we specu-late that the function of somatic Wnt-4 may be dualistic. First,Wnt-4 signalling may take part in controlling the distributionof b-catenin in the cytoplasm by promoting its localization tothe membrane where E-cadherin is localized to have an inputto cell adhesion, for example, as in other models (4). Since wefound male-type accumulation of b-catenin in the plasmamembrane of the germ cells in the case of Wnt-4 deficiency,other factors normally inhibited by Wnt-4 in the ovary appar-ently influence the localization of b-catenin in the partiallymasculinized ovary. Rspo1 signalling involves b-catenin (4)and may, like Wnt-4, as shown here, influence the localizationof b-catenin within the germ cells since b-catenin alsoaccumulates at cell–cell borders in the germ cells of

Rspo1-deficient female embryos (4). The mechanisms of thiswarrant further investigations.

Second, Wnt-4 may coordinate the amount of b-catenin thatenters the nucleus in order to regulate the Wnt target genes bymeans of the TCF proteins to take part in the regulation ofoocyte differentiation. We conclude that Wnt-4 plays a rolein promoting female-type expression patterns of b-cateninand E-cadherin in the germ cells in order to regulate follicledevelopment.

Wnt-4 as a signal involved in the control of meiosisin the ovary

One unique feature of the female germline cells in the mouseis that they initiate meiosis around E13.5. Meiosis is thought tobe initiated by RA signalling, leading to the induction ofexpression of a transcription factor, Stra8 (28). In the maleembryo, meiosis is inhibited by the enzyme Cyp26b1, whichdegrades RA, contributing to the quiescence of the malegerm cells (37). Since b-catenin function is not critical forthe initiation of meiosis but is essential for the subsequent sur-vival of the meiotic germ cells (10), Wnt-4, as a ligand locatedfurther upstream, may have a broader signalling outcome thattargets the control mechanisms of meiosis. Consistent withthis idea, we found that Stra8 expression is reduced in theWnt-4-deficient female while Cyp26b1 becomes ectopicallyexpressed; the introduction of a Wnt-4 signal into theWnt-4-deficient ovary by means of a cell line expressingWnt-4 inhibited the ectopic male-type Cyp26b1 expression.Also, RA promoted meiosis in the Wnt-4-deficient ovary asjudged by Stra8 expression. Hence, Wnt-4 may have a rolein the control of RA signalling, which may differ from theroles how Rspo1 is involved in the control of meiosis. In thezebrafish, for example, Wnt signal transduction controls anenzyme Cyp26a1, which is related to Cyp26b1 and is alsoinvolved in the catabolism of RA (38). Besides these points,it is also worth noting that the reduction in E-cadherinexpression in females is normally associated with the initiationof meiosis (20). Since we found upregulation of E-cadherinexpression in the Wnt-4-deficient female germ cells, we con-sider this yet another trait that points to a role for Wnt-4 inthe control of meiosis. Meiotic germ cells normally suppresssex cord formation and in this way inhibit the masculinizationof the somatic cells and germ cells (3). Consistent with theseresults, we found spermatogonia-like cells within a sex cord-like structure, thus resembling the seminiferous tubulesdepicted in the anterior part of the Wnt-4-deficient ovary.Thus, impaired meiosis due to the Wnt-4 deficiency could beanother factor contributing to the masculinization of theWnt-4-deficient ovary.

In support of the key role of Wnt signalling in meiosis, Rec8and Syp3 were downregulated in the Wnt-4-deficient ovary.The diminished expression of these components may beexpected to make a further contribution to the failure ofmeiosis caused by Wnt-4 deficiency, possibly by being notproperly loaded onto the chromosomes (28). Consistent withthe role of Wnt-4 signalling in the initiation of meiosis, wefound that �80% of the Wnt-4-deficient germ cells failed toenter meiosis, as judged from the Xlr and gH2AX markers.Also, neither meiotic germ cells nor Stra8 expression was



detected in the Wnt-4/5a double-mutant ovary in a situationwhere the germ cells were still present. Stra8 expressionwas also reduced in the Wnt-5a-deficient ovary. We may con-clude on the basis of these findings that Wnt-4 regulatesmeiosis in synergy with Wnt-5a. Collectively, the datasuggest that Wnt-4 signalling promotes the initiation ofmeiosis by influencing the RA pathway and the activation ofStra8.

In addition to Wnt-4, which controls female germline devel-opment, Nanos2 is in turn critical for male germ cell sex deter-mination. If Nanos2 is ectopically expressed in the ovary, itprevents meiosis, making it one critical factor for the inductionof germ cells to follow the male germ cell differentiationpathway (39). For these reasons, ectopic Nanos2 expressioncan be regarded as a candidate contributor to the repressionof meiosis in the partially masculinized Wnt-4-deficientovary. How the Wnt-4 signalling pathway interacts to inhibitNanos2 function in females warrants further investigations.

All told, Wnt-4 is critical for female germline development,since only 20% of the Wnt-4-deficient germ cells have thecapacity to undergo meiosis and/or continue in the process,whereas meiosis is completely inhibited in the ovary ofWnt-4/5a double-mutant embryos. The results indicate a rolefor the Wnts as somatic cell signals in female germline develop-ment, regulating the behaviour of the latter. The data obtainedfrom both loss-of-function and gain-of-function studies pointto a model in which Wnt signalling influences germline develop-ment by patterning b-catenin and E-cadherin and meiosisthrough the inhibition of Cyp26b1 expression, which allowsthe production of RA and entry into meiosis via enhancedexpression of Stra8 (Supplementary Material, Fig. S7).

MATERIALS AND METHODS

Mouse lines

The Wnt-4, Wnt-5a knock-out and Wnt-4EGFPCre knock-inmice were maintained and genotyped as reported previously(2,6,17,40). The gonads of the wild-type (Wnt-4þ/þ) littermateembryos served as controls. All the experiments involvingmice were approved by Finnish national legislation, the Euro-pean Convention (ETS 123) and EU Directive 86/609/EEC.

RNA extraction and quantitative real-time PCR analysis

Organs that were prepared from embryos that had inherited thesame targeted alleles were pooled for RNA extraction andPCR. Eight pairs of isolated gonads for each genotype werepooled at E12.5, six pairs at E14.5 and one pair at E16.5.The RNeasy kit was used for the purification of RNA(Qiagen), and the microarrays and their analyses were per-formed as described (6).

A total of 1 mg of RNA was reverse-transcribed into cDNAusing the First Strand cDNA Synthesis Kit (Fermentas) accordingto the manufacturer’s recommendations. The TaqManw GeneExpression Set-up, reaction conditions and reagents fromApplied Biosystems were used to identify changes in expressionof the Acr, Cyp26b1, Irx3, Oct4 and Stra8 genes. The ABI 7500Applied Biosystem quantitative real-time PCR (qPCR) analysisequipment was used. In order to identify the potential changes

in expression of the Fog2, Foxl2 (7), Msh5 and Spo11 genes,2 ml of cDNA in combination with 0.3 mM of the respectiveprimers and the Brilliant SYBRGREEN qPCR master mix, allfrom Stratagene, were employed. The primers used to analyseMsh5 and Spo11 gene expression were Msh5L: gagccaaagg-gacctgaaat; Msh5R: cgctgtttgcttatctctgga; Spo11L: gaagtgcctgccttcacaat; Spo11R: gccgacagaatcatcaaacat. The MX 3005 Psequence-detection system (Stratagene) was used for theseprimers. The Gapdh gene served in all cases as the reference.The assays were conducted from pooled gonads in triplicates.The values were analysed with Student’s t-test, and the qPCRresults are presented as means+ the standard error. The standarderror was 0.2, and the statistical significance was defined asP , 0.02. The graphs of the qPCR shown in the results sectionare presented so that each value at a specific developmental stagewas scaled to the maximum value obtained for each given gene.

In situ hybridization

The whole-mount and non-radioactive section in situ hybridiz-ation techniques were performed as described (6). The cDNAprobes were obtained as gifts from the following persons:Cyp26b1, Adamts19 (David Page), Stra8 (Peter Koopman),Irx3 (Michel Michaud), Figla (Asma Amleh), Gata4 andOct-4 (Hans Scholer) and Wnt-5a (Andy McMahon). Theprobe recognizing Acr was an EST (3984550). A minimumof three wild-type and three Wnt-4-deficient gonad pairswere examined for each gene and developmental stage.

Culture of the gonads and the Wnt-4 expressing cells

Generation of a cell line that expresses the Wnt-4 protein andthe tests for the functionality of this cell line by means ofinduction of kidney tubules were as described (41).Wnt-4-expressing and normal control NIH3T3 (41) cellswere grown to 70–80% confluence in DMEM (Gibco) sup-plemented with 10% of fetal calf serum (Sigma) and 0.1%of antibiotics penicillin–streptomycin (Sigma), and aliquotsof these cells (1.20 � 106 cells/ml) were separately transferredto small pieces of nucleopore filters with the pore size of0.1 mm and the cells were allowed to attach for 4 h (41).Thereafter, a second filter was placed on top of the cellswith the embryonic mesonephros/gonad blocks that were pre-pared at E12.0 from the Wnt-4-deficient or control embryos. Inthe experiments, the trans-RA of 1 mM (Sigma) was used, andthe mesonephros/gonad blocks were overlaid on a nucleoporefilter and cultured as indicated (41). After 48 h of culture, thegonads were snap-frozen in liquid nitrogen for the extractionof RNA or fixed with 4% paraformaldehyde (PFA) and pro-cessed for whole-mount in situ hybridization as described(6). After 48 h of co-culture, the gonads were removed fromthe filters and either frozen immediately in liquid nitrogen topurify RNA or fixed with 4% PFA to process the samplesfor whole-mount in situ hybridization analysis.

Western blotting

Two pairs of testis or ovary were prepared at E14.5, and the pro-teins were separated by 10% SDS–PAGE as described (42). Theprimary antibodies were anti-active b-catenin (ABC, Lake




Placid, NY, USA), anti-b-catenin (BD Transduction Labora-tories), anti-Connexin 43 (Zymed), anti-E-cadherin (BD Trans-duction Laboratories) and anti-glyceraldehyde-3-phosphatedehydrogenase, clone 6C5 (GAPDH) (Chemicon International),used in the amounts suggested by the manufacturers. The appro-priate HP-conjugated secondary antibodies obtained fromJackson ImmunoResearch Laboratories Inc. were applied in thedilutions recommended by the producer. The LumiGLO Kit(Cell Signalling Technology, Inc.) was used to identify the anti-bodies as described (42). The membranes were analysed with aFuji Film Luminescent Image Analyzer LAS-3000. The separ-ated protein bands were quantified with the Quanty One software(BioRad) and normalized to GAPDH. The analysis was done intriplicate and the results are presented as means+ standarddeviation.

b-Galactosidase assay, immunohistochemistry, squashpreparations and phase contrast microscopy

b-Galactosidase activity was visualized in the sections as pub-lished (17). For immunohistochemistry, testes and ovaries pre-pared at the stage indicated in the Results section wereimmersed in a 30% sucrose solution for 15 min, mounted,cut and stained with mouse anti-XLR antibody obtained as akind gift from Denise Escalier or with anti-gH2AX antibodies(Millipore), whereas the germ cells were revealed with rabbitanti-Vasa homolog (Mvh) antibody (Abcam). The correspond-ing Alexa Fluor-conjugated anti-mouse and anti-rabbit anti-bodies (Invitrogen) were used.

To identify the degree of meiosis in the female germ cells,four pairs of ovaries from wild-type and Wnt-4-deficientembryos were prepared, sectioned and stained with anti-Mvhantibody, whereas those germ cells that had initiated meiosiswere identified from the same samples with the anti-gH2AXor anti-Xlr antibodies and secondary antibodies that did notcross-react with the anti-Mvh antibodies. The pictures weretaken with an Olympus Fluoview FV1000. The germ cellsthat were positive for Mvh and gH2AX and/or Xlr werecounted with the aid of the Olympus FV10-ASW software.The percentage of the calculated germ cells that were inmeiosis was defined. The values were analysed with Student’st-test, and the results are presented as means+ the standarddeviation.

The squash preparations were made by dissecting theembryonic ovaries in ice-cold Dulbecco’s phosphate-bufferedsaline, pH 7.3, placed onto a slide and squashed with a coverslip immediately prior to viewing with a Zeiss/Anxiovert405M phase-contrast microscope. The images were takenwith a Photometrics Cool SNAP HQ camera (USA).

Transmission electron microscopy

Micro-surgically prepared ovaries were fixed in 1% glutaral-dehyde and 4% formaldehyde in 0.1 M phosphate buffer, pH7.4, post-fixed in 1% osmium tetroxide, dehydrated inacetone and embedded in Epon LX 112 (Ladd Research Indus-tries, VT, USA). Semi-thin sections (1 mm) were first stainedwith toluidine blue for light microscopic inspection. There-after, thin sections (80 nm) were cut with a Leica ultracutUCT ultramicrotome, stained in uranyl acetate and examined

in a Philips CM100 transmission electron microscope.Images were captured with a CCD camera equipped withTCL-EM-Menu, version 3, from Tietz Video and Image Pro-cessing Systems GmbH (Gaunting, Germany).

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

ACKNOWLEDGEMENTS

We thank H. Harkman, J. Kekolahti-Liias, J. Kujala,M. Matero and J. Vuoristo for their excellent technical assist-ance. We are grateful to M. Heikkila and F. Pujol for fruitfuldiscussions.

Conflict of Interest statement. None declared.

FUNDING

This work was supported by the grants from the Academy ofFinland (206038, 121647), the Sigrid Juselius Foundation andthe European Union (LSHG-CT-2004-005085; HEALTH-F5-2008-223007 STAR-T REK).

REFERENCES

1. Koopman, P., Munsterberg, A., Capel, B., Vivian, N. and Lovell-Badge,R. (1990) Expression of a candidate sex-determining gene during mousetestis differentiation. Nature, 348, 450–452.

2. Vainio, S., Heikkila, M., Kispert, A., Chin, N. and McMahon, A.P. (1999)Female development in mammals is regulated by wnt-4 signalling.Nature, 397, 405–409.

3. Yao, H.H., Matzuk, M.M., Jorgez, C.J., Menke, D.B., Page, D.C., Swain,A. and Capel, B. (2004) Follistatin operates downstream of Wnt4 inmammalian ovary organogenesis. Dev. Dyn., 230, 210–215.

4. Chassot, A.A., Ranc, F., Gregoire, E.P., Roepers-Gajadien, H.L., Taketo,M.M., Camerino, G., de Rooij, D.G., Schedl, A. and Chaboissier, M.C.(2008) Activation of beta-catenin signaling by Rspo1 controlsdifferentiation of the mammalian ovary. Hum. Mol. Genet., 17, 1264–1277.

5. Maatouk, D.M., DiNapoli, L., Alvers, A., Parker, K.L., Taketo, M.M. andCapel, B. (2008) Stabilization of beta-catenin in XY gonads causesmale-to-female sex-reversal. Hum. Mol. Genet., 17, 2949–2955.

6. Heikkila, M., Prunskaite, R., Naillat, F., Itaranta, P., Vuoristo, J.,Leppaluoto, J., Peltoketo, H. and Vainio, S. (2005) The partial female tomale sex reversal in wnt-4-deficient females involves induced expressionof testosterone biosynthetic genes and testosterone production, anddepends on androgen action. Endocrinology, 146, 4016–4023.

7. Manuylov, N.L., Smagulova, F.O., Leach, L. and Tevosian, S.G. (2008)Ovarian development in mice requires the GATA4-FOG2 transcriptioncomplex. Development, 135, 3731–3743.

8. Bernard, P., Fleming, A., Lacombe, A., Harley, V.R. and Vilain, E. (2008)Wnt4 inhibits beta-catenin/TCF signalling by redirecting beta-catenin tothe cell membrane. Biol. Cell., 100, 167–177.

9. Chang, H., Gao, F., Guillou, F., Taketo, M.M., Huff, V. and Behringer,R.R. (2008) Wt1 negatively regulates beta-catenin signaling during testisdevelopment. Development, 135, 1875–1885.

10. Liu, C.F., Bingham, N., Parker, K. and Yao, H.H. (2009) Sex-specificroles of beta-catenin in mouse gonadal development. Hum. Mol. Genet.,18, 405–417.

11. Adams, I.R. and McLaren, A. (2002) Sexually dimorphic development ofmouse primordial germ cells: switching from oogenesis tospermatogenesis. Development, 129, 1155–1164.




12. Farini, D., La Sala, G., Tedesco, M. and De Felici, M. (2007)Chemoattractant action and molecular signaling pathways of kit ligand onmouse primordial germ cells. Dev. Biol., 306, 572–583.

13. Pepling, M.E. and Spradling, A.C. (2001) Mouse ovarian germ cell cystsundergo programmed breakdown to form primordial follicles. Dev. Biol.,234, 339–351.

14. Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J., Mamiya, S.,Yashiro, K., Chawengsaksophak, K., Wilson, M.J., Rossant, J. et al.(2006) Retinoid signaling determines germ cell fate in mice. Science, 312,596–600.

15. Baltus, A.E., Menke, D.B., Hu, Y.C., Goodheart, M.L., Carpenter, A.E.,de Rooij, D.G. and Page, D.C. (2006) In germ cells of mouse embryonicovaries, the decision to enter meiosis precedes premeiotic DNAreplication. Nat. Genet., 38, 1430–1434.

16. Menke, D.B., Koubova, J. and Page, D.C. (2003) Sexual differentiation ofgerm cells in XX mouse gonads occurs in an anterior-to-posterior wave.Dev. Biol., 262, 303–312.

17. Shan, J., Jokela, T., Skovorodkin, I. and Vainio, S. (2010) Mapping of thefate of cell lineages generated from cells that express the Wnt4 gene bytime-lapse during kidney development. Differentiation, 79, 57–64.

18. Gittens, J.E. and Kidder, G.M. (2005) Differential contributions ofconnexin37 and connexin43 to oogenesis revealed in chimericreaggregated mouse ovaries. J. Cell. Sci., 118, 5071–5078.

19. Jorgensen, J.S. and Gao, L. (2005) Irx3 is differentially up-regulated infemale gonads during sex determination. Gene Expr. Patterns, 5, 756–762.

20. Di Carlo, A. and De Felici, M. (2000) A role for E-cadherin in mouseprimordial germ cell development. Dev. Biol., 226, 209–219.

21. Menke, D.B. and Page, D.C. (2002) Sexually dimorphic gene expressionin the developing mouse gonad. Gene Expr. Patterns, 2, 359–367.

22. Hutt, K.J., McLaughlin, E.A. and Holland, M.K. (2006) Kit ligand andc-kit have diverse roles during mammalian oogenesis and folliculogenesis.Mol. Hum. Reprod., 12, 61–69.

23. Epifano, O. and Dean, J. (2002) Genetic control of early folliculogenesisin mice. Trends Endocrinol. Metab., 13, 169–173.

24. Suzumori, N., Yan, C., Matzuk, M.M. and Rajkovic, A. (2002) Nobox is ahomeobox-encoding gene preferentially expressed in primordial andgrowing oocytes. Mech. Dev., 111, 137–141.

25. Ottolenghi, C., Pelosi, E., Tran, J., Colombino, M., Douglass, E.,Nedorezov, T., Cao, A., Forabosco, A. and Schlessinger, D. (2007) Lossof Wnt4 and Foxl2 leads to female-to-male sex reversal extending to germcells. Hum. Mol. Genet., 16, 2795–2804.

26. Tay, J. and Richter, J.D. (2001) Germ cell differentiation andsynaptonemal complex formation are disrupted in CPEB knockout mice.Dev. Cell., 1, 201–213.

27. Bullejos, M. and Koopman, P. (2004) Germ cells enter meiosis in arostro-caudal wave during development of the mouse ovary. Mol. Reprod.Dev., 68, 422–428.

28. Anderson, E.L., Baltus, A.E., Roepers-Gajadien, H.L., Hassold, T.J., deRooij, D.G., van Pelt, A.M. and Page, D.C. (2008) Stra8 and its inducer,retinoic acid, regulate meiotic initiation in both spermatogenesis andoogenesis in mice. Proc. Natl Acad. Sci. USA, 105, 14976–14980.

29. Morelli, M.A. and Cohen, P.E. (2005) Not all germ cells are created equal:aspects of sexual dimorphism in mammalian meiosis. Reproduction, 130,761–781.

30. Rogakou, E.P., Pilch, D.R., Orr, A.H., Ivanova, V.S. and Bonner, W.M.(1998) DNA double-stranded breaks induce histone H2AXphosphorylation on serine 139. J. Biol. Chem., 273, 5858–5868.

31. Escalier, D., Eloy, L. and Garchon, H.J. (2002) Sex-specific geneexpression during meiotic prophase I: Xlr (X linked, lymphocyteregulated), not its male homologue xmr (xlr related, meiosis regulated), isexpressed in mouse oocytes. Biol. Reprod., 67, 1646–1652.

32. Aravin, A., Gaidatzis, D., Pfeffer, S., Lagos-Quintana, M., Landgraf, P.,Iovino, N., Morris, P., Brownstein, M.J., Kuramochi-Miyagawa, S.,Nakano, T. et al. (2006) A novel class of small RNAs bind to MILIprotein in mouse testes. Nature, 442, 203–207.

33. Perera, E.M., Martin, H., Seeherunvong, T., Kos, L., Hughes, I.A.,Hawkins, J.R. and Berkovitz, G.D. (2001) Tescalcin, a novel geneencoding a putative EF-hand ca(2þ)-binding protein, Col9a3, and reninare expressed in the mouse testis during the early stages of gonadaldifferentiation. Endocrinology, 142, 455–463.

34. Reynard, L.N., Turner, J.M., Cocquet, J., Mahadevaiah, S.K., Toure, A.,Hoog, C. and Burgoyne, P.S. (2007) Expression analysis of the mousemulti-copy X-linked gene xlr-related, meiosis-regulated (xmr), revealsthat xmr encodes a spermatid-expressed cytoplasmic protein, SLX/XMR.Biol. Reprod., 77, 329–335.

35. Nayernia, K., Nieter, S., Kremling, H., Oberwinkler, H. and Engel, W.(1994) Functional and molecular characterization of the transcriptionalregulatory region of the proacrosin gene. J. Biol. Chem., 269, 32181–32186.

36. Huang, P., Senga, T. and Hamaguchi, M. (2007) A novel role ofphospho-beta-catenin in microtubule regrowth at centrosome. Oncogene,26, 4357–4371.

37. Trautmann, E., Guerquin, M.J., Duquenne, C., Lahaye, J.B., Habert, R.and Livera, G. (2008) Retinoic acid prevents germ cell mitotic arrest inmouse fetal testes. Cell Cycle, 7, 656–664.

38. Shelton, D.N., Sandoval, I.T., Eisinger, A., Chidester, S., Ratnayake, A.,Ireland, C.M. and Jones, D.A. (2006) Up-regulation of CYP26A1 inadenomatous polyposis coli-deficient vertebrates via a WNT-dependentmechanism: implications for intestinal cell differentiation and colon tumordevelopment. Cancer Res., 66, 7571–7577.

39. Suzuki, A. and Saga, Y. (2008) Nanos2 suppresses meiosis and promotesmale germ cell differentiation. Genes Dev., 22, 430–435.

40. Yamaguchi, T.P., Bradley, A., McMahon, A.P. and Jones, S. (1999) AWnt5a pathway underlies outgrowth of multiple structures in thevertebrate embryo. Development, 126, 1211–1223.

41. Kispert, A., Vainio, S. and McMahon, A.P. (1998) Wnt-4 is amesenchymal signal for epithelial transformation of metanephricmesenchyme in the developing kidney. Development, 125, 4225–4234.

42. Railo, A., Nagy, I.I., Kilpelainen, P. and Vainio, S. (2008) Wnt-11signaling leads to down-regulation of the Wnt/beta-catenin, JNK/AP-1and NF-kappaB pathways and promotes viability in the CHO-K1 cells.Exp. Cell Res., 314, 2389–2399.



wnt4/5a signalling coordinates cell adhesion and entry into meiosis

Documents