induction of kaposi's sarcoma-associated herpesvirus latency

JOURNAL OF VIROLOGY, June 2005, p. 7453–7465 Vol. 79, No. 120022-538X/05/$08.00�0 doi:10.1128/JVI.79.12.7453–7465.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Induction of Kaposi’s Sarcoma-Associated HerpesvirusLatency-Associated Nuclear Antigen by the Lytic

Transactivator RTA: a Novel Mechanism forEstablishment of Latency

Ke Lan, Daniel A. Kuppers, Subhash C. Verma, Nikhil Sharma,Masanao Murakami, and Erle S. Robertson*

Department of Microbiology and the Abramson Comprehensive Cancer Center, University ofPennsylvania Medical School, 201E Johnson Pavilion, 3610 Hamilton Walk,

Philadelphia, Pennsylvania 19104

Received 27 December 2004/Accepted 16 February 2005

Kaposi’s sarcoma-associated herpesvirus (KSHV) is the etiological agent contributing to development ofKaposi’s sarcoma, primary effusion lymphoma, and multicentric Castleman desease. Following primary infec-tion, latency is typically established. However, the mechanism by which KSHV establishes latency is not under-stood. We have reported that the latency-associated nuclear antigen (LANA) can repress RTA (for replicationand transcription activator) expression by down-regulating its promoter. In this study, we show that RTA isassociated with the virion particle. We also show that RTA can activate the LANA promoter and induce LANAexpression in transient reporter assays. Additionally, the transcription of RTA correlates with LANA expres-sion in the early stages of de novo infection of KSHV, and induction of LANA transcription is responsive toinduction of RTA with an inducible system. This induction in LANA transcription was dependent on recom-bination signal sequence binding protein J� (RBP-J�), as a RBP-J�-deficient cell line was significantly delayedand inefficient in LANA transcription with expression of RTA. These studies suggest that RTA contributes toestablishment of KSHV latency by activating LANA expression in the early stages of infection by utilizing themajor effector of the Notch signaling pathway RBP-J�. This describes a feedback mechanism by which LANAand RTA can regulate each other and is likely to be a key event in the establishment of KSHV latency.

Kaposi’s sarcoma-associated herpesvirus (KSHV) is a gam-maherpesvirus associated with a number of human malignan-cies, which include Kaposi’s sarcoma, primary effusion lym-phoma, and multicentric Castleman’s disease (5, 8, 9, 54, 56,57). Similar to other herpesviruses, KSHV is a large double-stranded DNA virus, which displays two alternate genetic lifecycle programs upon infection of host cells (46). In latent in-fection, gene expression is limited to a small subset of viral la-tent genes and includes the latency-associated nuclear antigen(LANA) encoded by open reading frame 73 (ORF73), viralcyclin (v-cyclin) encoded by ORF72, viral Fas-associated deathdomain interleukin 1L-converting enzyme inhibitory proteinencoded by ORF71, viral interferon regulatory factors encodedby K10, and kaposin encoded by K12 (16, 54, 60). Duringlatency, the viral episome is maintained through successivegenerations, but no viral progeny are produced. In contrast,lytic replication leads to extensive viral gene expression, virionproduction, and death of the infected cell (60). Latently in-fected cells can be induced to enter the lytic cycle under spe-cific physiological conditions (14, 25). Thus, the pool of latentlyinfected cells represents a reservoir of viral persistence fromwhich infectious virus can be later reactivated with productionof viral progeny, which can spread to new target cells.

Generally, KSHV establishes latency within 48 h postinfec-

tion. To date, it is widely accepted that latent infection by thevirus plays a central role in viral pathogenesis with the expres-sion of select genes responsible for targeting and controllingselective cellular pathways (17, 32). Occasionally, lytic reacti-vation of the virus may be critical, as expression of viral cyto-kine homologues during this phase may function as paracrinefactors in stimulating cell growth and proliferation (1, 2, 10,58). The reduced gene expression pattern of latency minimizesthe number of viral epitopes that are presented by infectedcells to cytotoxic T lymphocytes and so contributes to theability of the virus to escape immune surveillance and estab-lishment of persistent infection (6, 7). In addition, a number ofstudies have suggested that the genes expressed during latencymay be important contributors to the tumorigenic process inKSHV-associated cancers (17, 19, 22, 28, 51). Thus, establish-ment of latency is critical to the role of KSHV in humancancers. Nevertheless, the mechanism by which KSHV estab-lishes latency postinfection is still poorly understood; in thepast decade, numerous studies were focused on maintenanceof latency or the mechanism by which KSHV switches to lyticreactivation from latency.

Two virus-encoded molecules LANA and RTA (for replica-tion and transcription activator) are thought to play a centralrole in the switch between latency and lytic replication. Amongthe limited number of latent genes, the ORF73 gene, whichencodes LANA, is critical for the establishment of latentKSHV infection through maintenance of the viral episome (3,4, 47, 49). Recently, studies in our laboratory showed that

* Corresponding author. Mailing address: Department of Microbi-ology, University of Pennsylvania Medical School, 201E Johnson Pa-vilion, 3610 Hamilton Walk, Philadelphia, PA 19104. Phone: (215)746-0114. Fax: (215) 898-9557. E-mail: [email protected].

7453

on April 6, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

LANA is capable of suppressing lytic reactivation and main-taining viral latency through repression of the transcriptionalactivity of the RTA promoter (39). RTA, encoded by ORF50of KSHV, is an immediate early protein and serves as the keymaster switch for viral lytic replication. It has been shown thatexogenous expression of RTA from a heterologous promoteror induction of endogenous RTA expression can initiate lyticreactivation and drive the latent virus to undergo the full lyticreplication cycle (44, 45). Most recently, it has been shown thata small number of lytic genes including RTA are transientlyexpressed very early after de novo infection of KSHV; how-ever, this abortive lytic gene expression is terminated with thesupervention of latency (36). These observations when placedin the context of our own studies led us to hypothesize that theswitch between lytic and latent replication and establishmentof latent infection may be regulated by a feedback mechanism.The expression of the lytic RTA gene may induce the expres-sion of latent genes including LANA, and the accumulation ofthese latent gene products can contribute to quick establish-ment of latent KSHV infection.

In this report, we demonstrated that RTA is detected inassociation with KSHV viral particles. RTA activates theLANA promoter and induces LANA expression in transienttransfection experiments. Transcription of RTA correlateswith that of LANA during the early stages of de novo infectionof KSHV, and LANA transcription is responsive to inductionof RTA expression. Additionally, we also found that the re-

combination signal sequence binding protein J� (RBP-J�)binding site within the LANA promoter is critical for regula-tion by RTA, known to be associated with a number of cellularregulatory proteins including RBP-J� (Fig. 1A and B). InRBP-J� knockout cells, KSHV was unable to establish latentinfection when compared to wild-type cells. Our results there-fore suggest that RTA can contribute to establishment of la-tency through activation of LANA expression in the earlystages of infection. This represents a feedback loop wherebyLANA and RTA regulate each other and is likely to be, at leastin part, key events in establishment of KSHV latent infection.

MATERIALS AND METHODS

Constructs, antibodies, and cell lines. To construct the reporter plasmid of theLANA promoter, an 800-bp sequence upstream of the LANA translation initi-ation codon was amplified from total cellular DNA prepared from BC-1 cells,using primers KpnILANA (5� TCAGGTACCCAGATGAACGCCACCCAAG3�) and BglIILANA (5� CGTAGATCTATCCTCGGGAAATCTGGTC 3�). ThePCR fragment was cloned into the pGL2-basic vector (Promega), with KpnI andBglII as cloning sites, to derive pGLLANAp. The LANA promoter with mutatedRBP-J� binding site pGLLANAmp was obtained by PCR-based site mutagen-esis. L54 phage DNA, which contains ORF73 encoding LANA and its regulatorysequences, was obtained from the National Institutes of Health Research andReagent Program. The pCR3.1-RTA expression vector was described previously(39). All constructs and mutations were verified by DNA sequencing.

KSHV RTA rabbit polyclonal antibody was provided by Gary S. Hayward(Johns Hopkins University School of Medicine). KSHV RTA mouse monoclonalantibody was a kind gift from Koichi Yamanishi (Osaka University, Osaka,Japan). Human polyclonal serum, which recognizes LANA, was designated HS

FIG. 1. Scheme showing the LANA promoter and RTA protein. (A) Scheme showing the LANA promoter used in the present study. Putativetranscriptional factor binding sites are shown, and numbers indicate nucleotides according to the KSHV genome from BC-1 (26, 29–31, 54). (B) Asshown, RTA is a 691-amino-acid protein (BC-1 strain). Numbers indicate amino acids. The putative domains include an N-terminal DNA bindingdomain and C-terminal activation domain, proline rich domain (P-rich), and leucine zipper (L-zip); RTA also has two NLSs in both the amino-and carboxy-terminal regions. The approximate position of each functional interacting domain is shown by a black bar, corresponding to theinteracting partner shown in the column on the right (23, 24, 39–42, 55, 62).

7454 LAN ET AL. J. VIROL.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

and was provided by Gary Nabel (Vaccine Institute, National Institutes ofHealth, Bethesda, MD). KSHV ORF45 mouse monoclonal antibody was pro-vided by Yan Yuan (University of Pennsylvania, Philadelphia, PA). KSHV gBrabbit polyclonal antiserum was a gift of Bala Chandran (The University ofKansas Medical Center, Kansas City, KS).

Human embryonic kidney fibroblast 293 and 293T cells, transformed with E1Aand T antigens, respectively, were obtained from Jon Aster (Brigham and Wom-en’s Hospital, Boston, MA). BJAB is an Epstein-Barr virus (EBV)-negativeB-cell line isolated from Burkitt’s lymphoma and was provided by Elliott Kieff(Harvard Medical School, Boston, MA). BCBL1 and BC3 are KSHV-positivebody cavity-based lymphoma-derived cell lines obtained from Don Ganem andthe American Type Culture Collection, respectively.

Human embryonic kidney fibroblast 293 and 293T cells were grown in high-glucose Dulbecco’s modified Eagle medium (DMEM) supplemented with 5%bovine growth serum (BGS; HyClone, Inc., Logan, Utah), 2 mM L-glutamine, 25U/ml penicillin, and 25 �g/ml streptomycin. BJAB, BCBL1, and BC3 were grownin RPMI 1640 medium supplemented with 10% BGS, 2 mM L-glutamine, 25U/ml penicillin, and 25 �g/ml streptomycin. RTA-inducible BCBL1 and controlcell lines were kindly provided by Jae Jung and grown in RPMI 1640 mediumsupplemented with 10% BGS, 2 mM L-glutamine, 25 U/ml penicillin, 25 �g/mlstreptomycin, and 20 ng/ml hygromycin. Mouse RBP-J��/� (OT11) and wild-type (OT13) fibroblast cell lines were kindly provided by T. Honjo and weregrown in high-glucose DMEM supplemented with 10% BGS and 100 U of mousegamma interferon (PeproTech, Inc., New Jersey) per ml at 32°C.

Transfection. BJAB, 293, 293T, U2OS, OT11, and OT13 cells were transfectedby electroporation with a Bio-Rad Gene Pulser II electroporator. A total of 10million cells harvested in exponential phase were collected and washed in phos-phate-buffered saline (PBS) and then resuspended in 400 �l of RPMI or DMEMwith DNA for transfection. Resuspended cells were transferred to a 0.4-cmcuvette and electroporated at 975 �F and 220 V. The electroporated cells werethen transferred to 10 ml of complete medium, followed by incubation at 37°Cand 5% CO2. Transfections were harvested after 24 h and assayed for activity.

Luciferase assay. HEK293 or U2OS cells were collected at 70% confluency. Atotal of 10 million cells were resuspended, along with plasmid DNA, in 400 �lmedium. The cells were transfected by electroporation with the Bio-Rad GenePulser II at 210 V and 975 �F. Transfected cells were transferred to 100-mmplates in 10 ml of DMEM with 10% fetal bovine serum. The plates were incu-bated at 37°C with 5% CO2 for 20 h. BJAB cells were collected at 5 � 105

cells/ml. A total of 10 million cells were transfected at 220 V and 975 �F. At 20 h,cells were harvested and washed once with phosphate-buffered saline (Invitro-gen-Gibco, Inc.). The cells were subsequently lysed with 200 �l Reporter LysisBuffer (Promega, Inc.). A total of 40 �l of the lysate was mixed with 100 �l ofluciferase assay reagent. Luminescence was measured for 10 s by the OpticompI luminometer (MGM Instruments, Inc.). The lysates were also tested at variousdilutions to ensure that luciferase activity was within the linear range of the assay.The results shown represent experiments performed in triplicate.

Electrophoresis mobility shift assays (EMSA). A probe containing the furthestdownstream RBP-J� consensus binding site was designed (5�-GATCTACTATTTCCCACACATCT-3� [underlining indicates RBP-J� sequence]), annealed, andlabeled. 32P-labeled probes were synthesized via Klenow fill-in reaction andpurified with Select-D with G-25 columns (Shelton/IBI, Inc.). Radioactive probeswere diluted in water to a final concentration of 80,000 cpm/�l. DNA bindingreactions were performed in a manner similar to that described previously (34).Proteins from nuclear extracts or in vitro translation products were mixed with 1�g poly(dI-dC) (Sigma) in 1� DNA binding buffer for 5 min at room temper-ature. A total of 1 �l of labeled probe was added to each reaction mixture, andthe tubes were incubated at room temperature for 15 min. DNA-protein com-plexes were resolved by nondenaturing 6% polyacrylamide gel electrophoresis(PAGE). The gel was run in 0.5� Tris-borate-EDTA buffer at a constant voltageof 150 V. Following electrophoresis, the gel was transferred to Whatman paperand dried for 1 h at 80°C. Dried gels were exposed to BioMax MS autoradiog-raphy film (Kodak, Inc.) for 24 to 48 h at �70°C with an intensifying screen. Todetermine the specificity of the complex of RBP-J� and probe, a 200-fold molarexcess of unlabeled probe was added to the protein-poly(dI-dC) mixture beforeincubation at room temperature; similarly, a 200-fold molar excess of unlabelednonspecific cold competitor probe was added in a separate reaction mixture.Antibodies specific to RBP-J� and nonspecific antibody were used as controls toshow supershift complexes.

Induction of KSHV lytic replication and infection. To prepare KSHV virusparticles, we collected more than 600 million exponentially growing BCBL1 cellsfor induction. Cells were induced by using tetradecanoyl phorbol acetate (TPA)at a concentration of 20 ng/ml of medium and butyrate at a concentration of 1.5mM and were further incubated for 5 days at 37°C with 5% CO2. The superna-

tant was then collected and filtered with a 0.45-�m filter, and viral particles werespun down at 15,000 rpm for 2 h. Then the concentrated virus was collected forfurther use. For KSHV infection, 293 cells grown to 60 to 80% confluency in100-mm-diameter tissue culture dishes and infected with same amount of con-centrated virus induced from same number of cells. Since no protocol for de-termining the infectious titer of HHV8-containing supernatants currently exists,fresh inocula prepared for different experiments were standardized by ensuringthat identical numbers of passage-matched BCBL cells were likewise treated forvirus induction. At different time points, unbound KSHV was removed by beingwashed.

Purification of KSHV virions. A total of 500 million BCBL cells were inducedwith 20 ng of TPA/ml and 1.5 mM sodium butyrate (Sigma) for 5 days. Themedium was then collected and cleared by centrifugation at 2,000 rpm for 15 minto remove cells and cell debris. Then, the medium was filtered through 0.45-�m-pore-size filters. Virions were pelleted at 20,000 rpm for 2 h and resuspended in1� PBS. Then, the concentrated virus particles were centrifuged through a 30 to60% sucrose step gradient at 20,000 rpm for 2 h. The virus band at the gradientjunction was collected.

Trypsin treatment of purified virions. Sucrose-gradient-purified virions weretreated with trypsin (1�) (HyClone) in a 100-�l volume at 37°C for 1 h. Trypsindigestions were terminated by the addition of phenylmethylsulfonyl fluoride to a0.5 mM concentration and a 1/100 volume of protease inhibitors (Sigma). Thereaction mixture was separated in two fractions, supernatant and pellet, bycentrifugation at 20,000 rpm for 1 h for further analysis.

Detergent treatment of purified virions. Sucrose-gradient-purified virionswere treated with 1% Triton X-100 for 30 min at 37°C. The reaction mixture wasseparated in two fractions, supernatant and pelleted tegument nucleocapsid, bycentrifugation at 20,000 rpm for 1 h for further analysis.

Real-time reverse transcription-PCR. Quantitative real-time PCR (qPCR)was used to make a relative quantitative comparison of RTA and LANA levelsover the time course of infection or induction of KSHV. At various time pointspostinfection or postinduction, cells were harvested and total RNA was collectedusing Trizol reagent (Invitrogen, Inc.) following the manufacturer’s instructions.cDNA was then made using a Superscript II RT kit (Invitrogen, Inc.), followingthe manufacturer’s instructions. The primers used for real-time PCR were asfollows: for RTA, 5� TATCCAGGAAGCGGTCTCAT 3� and 5� GGGTTAAAGGGGATGATGCT 3�; for LANA, 5� TAGAGGAGGTGGAGGAGCAA 3�and 5� CGTGCAAGATTATGGGCTCT 3�; and for �-actin, 5� GCTCGTCGTCGACAACGGCTC 3� and 5� CAAACATGATCTGGGTCATCTTCTC 3�.The cDNA was amplified using 10 �l of the DyNAmo SYBR Green qPCR kit(MJ Research, Inc.), 1 mM each primer and 2 �l of the cDNA product in a totalvolume of 20 �l. Forty-five cycles, each of 1 min at 94°C, 1 min at 56°C, 30 s at72°C, were followed by 7 min at 72°C and were performed with an MJ ResearchOpticon II thermocycler. Each cycle was followed by two plate readings with thefirst done at 72°C and the second done at 85°C. A melting curve analysis wasperformed to verify the specificity of the products. The values for the relativequantitation were calculated by the ��Ct method with each sample tested intriplicate.

Immunofluorescence. Immunofluorescent assays were performed essentiallyas described previously (34, 35, 39). Briefly, fixed cells were blocked in theappropriate serum and then incubated with the specific primary antibody forLANA and RTA for 1 h. Cells were washed and then further incubated with theappropriate secondary antibody conjugated to fluorescein isothiocyanate orTexas red at 1:1,000 dilutions in phosphate-buffered saline for 1 h. Slides werewashed, visualized with an Olympus XI70 inverted fluorescence microscope, andphotographed with a digital PixelFly camera and software (Cooke, Inc., Warren,MI).

RESULTS

RTA is associated with KSHV viral particles. KSHV canquickly establish latency postinfection. However, little is knownabout the mechanism of establishment of latency. Recently, itwas shown that immediately after infection there was a burst oflytic viral gene expression, including that of RTA, but the fulllytic replication program was not induced (36). This lytic geneexpression was followed by a sharp decline in expression anddetection of an increase in latent transcripts (36). We previ-ously showed that LANA, a key latency-associated protein, candown-regulate RTA expression through repression of the tran-scriptional activity of the RTA promoter (39). These observa-

VOL. 79, 2005 INDUCTION OF KSHV LATENCY-ASSOCIATED NUCLEAR ANTIGEN 7455


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

tions led us to hypothesize that there is an interplay betweenthese two viral proteins, which may result in the decline of lyticgene expression postinfection and the establishment of a latentinfection. RTA is expressed at relatively high levels during lyticreplication. Therefore, it was possible that the virus can pack-age this protein into virions during lytic reactivation, and assuch RTA may play a role in up-regulating LANA expressionbefore full lytic replication can proceed during the early stagesof infection.

A total of 500 million BCBL1 cells were induced with TPAat 20 ng/ml. Five days postinduction, the supernatants werecollected and filtered with a 0.45-�m filter. Crude virions in thesupernatant were collected by ultracentrifuge at 15,000 rpm for2 h, washed once with PBS, and then pelleted again for anal-ysis. Immunoblotting for LANA showed that there were nodetectable levels of LANA detected in all fractions, includingthe mock-treated virion particles (Fig. 2A, lanes 4, 5, and 6).However, LANA signals were clearly detected in cell lysates ofuninduced and TPA-induced BCBL1 cells (Fig. 2A, lanes 2and 3). As expected, LANA was not found in cell lysate ofBJAB cells, a KSHV-negative B-lymphoma cell line (Fig. 2A,lane1). Treatment with Triton X-100 denatures the doublelipid layers of the viral envelope and exposes the tegumentproteins. Therefore, proteins located inside or outside of theenvelope can be detected if trypsin is used in combination.Interestingly, the immediate early transactivator RTA was con-sistently detected in mock-treated virus particles after the samemembrane is stripped and reprobed with RTA-specific mono-clonal antibody (Fig. 2A, lane 6). Specifically, RTA was de-tected in the trypsin but not preparations treated with trypsinplus Triton X-100. As controls, KSHV ORF45, a known teg-ument protein, was detected in mock- and trypsin-treated viri-ons (Fig. 2A), and KSHV gB, a known glycoprotein located inthe envelope of the virus, was detected in mock-treated virions(Fig. 2A).

To further verify RTA is associated with the KSHV virions

instead of nonspecifically adhering to aggregated virions, weutilized a sucrose gradient to purify the virions, followed bytreatment with trypsin and Triton X-100, solubilization, frac-tionation, and Western blot analysis. As shown in Fig. 2B,there was no detectable levels of LANA detected in the dif-ferent fractions. However, LANA was detected in both unin-duced and induced BCBL1 cell lysates. In contrast, RTA wasdetected in the virion pellet treated with trypsin and TritonX-100 (Fig. 2B). A darker-exposure RTA signal was alsoweakly seen in the Triton X-100-treated soluble fraction (datanot shown). As expected, ORF45 was also detected in samefraction (Fig. 2B). This suggested that RTA is associated withKSHV virions and is most likely present as a component of thetegument.

RTA transactivates the major LANA promoter in humancells. Since RTA is associated with KSHV virions and is likelyto be located in tegument, it is possible that RTA present inthe virions may immediately influence viral gene expressionupon entry of the virion particles. Therefore, it is reasonable tosuggest that RTA can regulate LANA expression. Previousstudies showed that a small number of lytic genes includingRTA are transiently expressed early after de novo infection ofKSHV. This abortive lytic gene expression is terminated withthe supervention of the latency program (36). LANA is accu-mulated at high levels during establishment and maintenanceof latency, and it is a master control for latency through re-pression of RTA expression (39). Therefore, we hypothesizethat RTA may transactivate the LANA promoter, resulting inexpression of LANA during early stages of infection. Thisaccumulation of LANA resulting from RTA expression willthen repress expression of RTA closing the regulatory loop.We sought to investigate if RTA can operate as a transcrip-tional modulator of the LANA promoter. A total of 800 bp ofthe LANA promoter region was cloned into pGL2-basic tocreate reporter plasmid pGLLANAp. The pGLLANAp wastransfected into U2OS cells (Fig. 3A), BJAB cells (Fig. 3B), or

FIG. 2. Immnoblotting to check KSHV virion-associated protein. (A) Cell lysate of BJAB (lane 1), uninduced BCBL1 (lane 2), TPA inducedBCBL1 (lane 3), trypsin and Triton X-100-treated virions (lane 4), trypsin-treated virions (lane 5), and mock-treated virions (lane 6) were separatedby an 8% SDS-PAGE gel, transferred to an nitrocellulose membrane, and then blotted with RTA mouse monoclonal antibody, anti-LANA rabbitserum, ORF45 mouse monoclonal antibody, and anti-gB rabbit serum. (B) Cell lysate of BJAB (lane 1), uninduced BCBL1 (lane 2), TPA-inducedBCBL1 (lane 3), supernatant of trypsin-treated purified virions (lane 4), supernatant of Triton X-100-treated virions (lane 5), and virionpellet-treated by trypsin plus Triton X-100 (lane 6) were separated on an 8% SDS-PAGE gel, transferred to an nitrocellulose membrane, and thenblotted with RTA mouse monoclonal antibody, anti-LANA rabbit serum, ORF45 mouse monoclonal antibody and anti-gB rabbit serum.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

HEK 293 cells (Fig. 3C), all negative for KSHV. The expres-sion construct pCR3.1-RTA was transfected along with theluciferase reporter construct driven by the 800-bp LANA pro-moter region. Cotransfection of the RTA expression vectorwith the pGLLANAp reporter construct consistently resultedin activation of the reporter activity relative to reporter con-struct alone (Fig. 3A to C). Moreover, increasing the concen-tration of the RTA expression construct in this reporter assayresulted in activation of the LANA promoter in a dose-depen-dent manner in each cell line (Fig. 3). These results indicatethat the activation of the LANA promoter in the U2OS, HEK293, and BJAB cell lines was directly proportional to the quan-tity of RTA expressed as demonstrated by the observed dose-response relationship. To further support and confirm whetheror not the LANA promoter was also responsive to natively

synthesized RTA by KSHV, we took advantage of an estab-lished RTA-inducible cell line (48). In this cell line, a tetracy-cline regulatory element was cloned into the upstream of theRTA gene in the KSHV genome, so that tetracycline caninduce RTA expression followed by induction of lytic replica-tion (48). In this experiment, pGLLANAp was transfected intoBCBL1-RTAi 12 h posttransfection; tetracycline was added tothe cultures at time points 0 h, 12 h, 24 h, 36 h, 48 h, and 72 hpostinduction; cells were harvested; and then cell lysates weremade for a luciferase assay. As expected, tetracycline inducedRTA expression over time (Fig. 4A). Importantly, the in-creased levels of RTA also resulted in transactivation of theLANA reporter construct in a dose-dependent manner (Fig.4A). In the control cell line where RTA expression was notinduced by tetracycline, the LANA promoter activity showed

FIG. 3. Transcriptional activity of RTA on LANA promoters in cells. The reporter plasmid pGLLANAp contains an 800-bp sequence upstreamof the start code of the LANA gene that drives the expression of firefly luciferase (29–31). A fixed amount (5 �g) of the reporter plasmids wastransfected or cotransfected into 15 million U2OS (A), BJAB (B), and 293 (C) cells with 2.5 �g, 5 �g, 10 �g, 15 �g, and 20 �g of pCR3.1-RTA.At 24 h posttransfection, cell lysate of each transfection was harvested for the luciferase assay. The promoter activity was expressed as the foldactivation relative to the reporter-alone control. The means and standard deviations from three independent transfections are shown.

FIG. 4. A fixed amount of reporter plasmid pGLLANAp was transfected into 15 million RTA-inducible BCBL1 cells (A) and control cells (B),at different time points 0 h, 12 h, 24 h, 36 h, 48 h, and 72 h postinduction with tetracycline (5 �g/ml), and cell lysate was harvested for a luciferaseassay. The promoter activity was expressed as the fold activation relative to the reporter-alone control. The means and standard deviations fromthree independent transfections are shown.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

little or no change in activity, suggesting that activation ofLANA promoter in BCBL1-RTAi cells is dependent on induc-tion of RTA in the BCBL1 background (Fig. 4B).

RTA induces LANA expression. The above experimentsshowed that RTA activates the LANA luciferase promoter re-porter construct, suggesting that RTA may also induce LANAfrom its native promoter. Therefore, we wanted to determineif RTA can up-regulate LANA expression in the context of theviral genomic DNA. The L54 phage DNA contains the LANAopen reading frame and its native regulatory sequences (54). Inthis experiment, we transfected 293T cells with a fixed amountof L54 DNA and with increasing amounts of the RTA expres-sion vector. Our results showed that LANA expression was atrelatively low levels in the absence of RTA. However, whenincreasing amounts of RTA were introduced, there was anobvious increase in the levels of LANA protein detected byWestern blotting (Fig. 5A). Arbitrary counts showed a gradualincrease in LANA signal, which correlated with the increasedlevels of RTA detected (Fig. 5A). These results suggest thatthe native regulatory element upstream of LANA is responsiveto RTA expression.

To determine if LANA expression up-regulated in respon-sive to RTA is at the transcriptional level, real-time qPCR was

performed to examine the effect of RTA expression on thetranscription of LANA. In RTA-inducible BCBL1 cells, tetra-cycline was used to induce RTA, and total RNA was collectedat 0, 12, 24, 48, and 72 h postinduction. The results of the PCRanalysis in this inducible background reflected the same trendobserved for the L54 DNA experiment above (Fig. 5B and C).An initial large spike in RTA mRNA levels was observed after12 h, after which RTA transcript levels began to level off froma Ct value of about 30 to approximately 12. A delayed increasein LANA was observed beginning sometime between the 24-hand 48-h time points. The observed reduction in Ct value wasconsistent and reproducible in multiple assays. The delayedeffect on LANA transcript levels is likely due to a lag betweenincreased transcription of RTA and the overall change inLANA transcripts, with to endogenous LANA expression inthe BCBL1 cell background. Nevertheless, the results of thetranscription analysis do provide additional supporting datathat the native regulatory element of LANA is responsive toRTA.

Increase in levels of LANA transcripts correlates with theinduction of RTA transcript production. To further explorethe role of LANA and RTA in the establishment of latencypostinfection, we used real-time qPCR to examine RTA and

FIG. 5. RTA induces LANA expression. (A) A total of 15 million T-antigen-transformed human embryonic kidney 293 cells were transfectedwith 20 �g L54 DNA and increasing amounts of RTA expression vector pCR3.1-RTA (lane 1 to lane 6); the amount of pCR3.1-RTA was 0 �g,2.5 �g, 5 �g, 10 �g, 15 �g, or 20 �g. The total transfected DNA was normalized with pCR3.1 vector. At 24 h posttransfection, protein lysates wereanalyzed by Western blotting for levels of expression of transfected protein with LANA rabbit serum to detect LANA and RTA monoclonalantibody for detection of RTA protein. (B) RTA was induced in 50 million RTA-inducible BCBL1 cells with 5 �g of tetracycline/ml. Total RNAwas collected from the cells at 0, 12, 24, 48, and 72 h postinduction. A total of 5 �g of RNA was used with the Superscript First Strand Synthesissystem to construct cDNA. Real-time PCR was performed using the DyNAmo SYBR Green qPCR kit with �-actin as the standard. The PCR dataare expressed as the Ct values at each time point for RTA and LANA. Each time point was tested in triplicate for the calculation of the mean andstandard deviation. (C) The relative transcript abundance based on the Ct values for RTA and LANA.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

LANA transcriptional levels from initial infection to the estab-lishment of latency 24 h postinfection in infection of a KSHV-negative cell line, 293. Consistent with the finding that RTAcan autoactivate its own promoter (15), RTA mRNA was de-tected as early as 30 min postinfection (Fig. 6A). Followingexpression of RTA, the detection of LANA mRNA was ob-served 1 h postinfection and correlated with increasing levelsof RTA during the initial 5 to 6 h of infection (Fig. 6A). Theexpression levels for RTA peaked at 5 h followed by a steadydecline in levels up to 24 h (Fig. 6A). The LANA levels wereincreased to 106 to 107 copies by 12 h and gradually increasedto approximately 108 copies by 24 h postinfection (Fig. 6B).RTA mRNA levels were maintained at the same low level,likely due to the small subset of KSHV-infected cells whichspontaneously undergoes lytic replication (Fig. 6A). At thesame time, LANA mRNA levels increased steadily by 8 h,reflecting the establishment of KSHV latency by expressedLANA and the autoregulation of LANA on its own promoter(Fig. 6B) (31). The rapid increase in mRNA levels of thesetranscripts is likely due to RTA activating its own promoterprior to activating LANA expression. This results in an initialsurge of infected cells which express RTA and stimultanously

results in increased LANA levels to negatively regulate RTAtranscription and establishment of latency.

The RBP-J� binding site within the LANA promoter is crit-ical for RTA-mediated transactivation. The experiments aboveshowed that RTA up-regulates LANA expression. To eluci-date the potential mechanism of regulation by RTA, we ana-lyzed the LANA promoter sequence using the TFsearch pro-gram (26). A number of potential transcriptional factor bindingsites were identified within this promoter region (Fig. 1). In-terestingly, a single RBP-J� binding site was located within theregion that contributes to the core promoter activity of theLANA promoter (29–31). As shown previously, RTA can ac-tivate its downstream genes such as ORF57 through interac-tions with RBP-J� (40). It is also possible that RTA regulatesthe LANA promoter through the RBP-J� binding site. To testthis hypothesis, we mutated the RBP-J� site of the LANApromoter and then cloned the mutant type promoter intopGL2-basic to get reporter plasmid pGLLANApmt. In a lucif-erase assay, pGLLANAp and pGLLANApmt were transfectedinto cells in equivalent amounts and cotransfected with in-creasing amounts of the RTA expression construct. As shown,the activation level of mutant-type promoter by RTA was dra-

FIG. 6. Real-time RT-PCR analysis of RTA and LANA transcripts in 293 cells infected with KSHV. Total RNA was isolated from 20 million293 cells infected with virus from 50 million BCBL1 cells at 30 min and 1, 3, 5, 8, 12, 16, 20, 24, and 48 h postinfection by TRIzol reagent. A totalof 5 �g of RNA was used with the Superscript First Strand Synthesis system to construct cDNA. Real-time PCR was performed using the DyNAmoSYBR Green qPCR kit with �-actin as the standard. (A) cDNA samples for RTA. RTA transcript abundance as calculated by Ct values; thestandard curve is shown to the right. (B) cDNA samples for LANA. LANA transcript abundance as calculated by the Ct values, with standard curveto the right. Each time point and standard were tested in triplicate for the calculation of the mean and standard deviation.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

matically decreased, compared to level of wild-type promoterin both BJAB and U2OS cells. The maximum reduction ofactivation was about 75% from 16- to 20-fold activation, de-creasing to 4- to 5-fold activation in these cell lines (Fig. 7Aand B). This suggests that RBP-J� contributes and is likely tobe the predominant transcriptional factor involved in RTA-mediated regulation of the LANA promoter. The activationlevel was not completely shut down by mutation of the RBP-J�site, indicating that there could be other potential sites forRTA regulation which contribute to the additional 25% acti-vation. Indeed, there are Oct1 binding sites within the LANApromoter. Additionally, it has been shown that RTA can au-toactivate its own promoter by binding to Oct1 (55). Therefore,it is possible that RTA also regulates the LANA promoter inpart through its interaction with Oct1. These studies are cur-rently been investigated.

To support our conclusion which indicates that the RBP-J�binding site is critical for regulation of LANA by RTA, werepeated the reporter assays with mouse RBP-J� knockout cellline OT11 along with its isogenic counterpart wild-type OT13cells. OT11 and OT13 were transfected with equivalentamounts of pGLLANAp and RTA expression vector, respec-tively. At 24 h posttransfection, cells were harvested for anal-ysis by luciferase assay. The results showed that the activationlevel of the LANA promoter by RTA in OT11 (RBP-J� knock-out cell line) was much lower than that in OT13. The activationlevels were approximately 15% percent of that seen in thewild-type OT13 (Fig. 7C). To support our studies, we includedan RBP-J� rescue expression construct into our analysis. Theresults showed that when RBP-J� was provided exogenouslyfrom a heterologous promoter into the system that approxi-mately 80% of the activation was rescued (Fig. 7C). This sug-gests that RTA cannot efficiently activate the LANA promoterin the absence of RBP-J� and that RBP-J� plays a predomi-nant in regulation of LANA by RTA.

RTA interacts with RBP-J� and forms a complex bound toits cognate sequence within the LANA promoter. The results ofthe luciferase reporter assays above indicated that the presenceof the RBP-J� binding site within the LANA promoter iscritical for RTA’s ability to activate the promoter. To address

whether RTA activates the LANA promoter through forma-tion of an RBP-J�/RTA complex bound to the cis-acting DNAelement, an EMSA was performed. A probe was designed thatcontained RBP-J� consensus binding sequence as well as thesix adjacent bases both 5� and 3� to the cognate sequencewithin the LANA promoter (54). The results of the EMSAassay showed that a specific RBP-J� shift was observed withthe probe in the KSHV-negative 293 cells and RBP-J� trans-fected 293 cell nuclear extracts (Fig. 8A, lanes 2 and 4), as wellas in the presence of in vitro-translated RBP-J� (Fig. 8B, lane2). The specificity of these bands was demonstrated by itsdisappearance in the presence of a specific cold competitorprobe (Fig. 8A, lane 3, and B, lane 3) and supershift formed byusing RBP-J� antibody (Fig. 8A, lane 5, and B, lane 4). In thepresence of RTA and RBP-J� coexpressed in 293 cells andwith in vitro-translated RTA and RBP-J�, an additional shiftwas observed, respectively (Fig. 8A, lanes 8 and 11, and B,lanes 7 and 10). The specificity of the shifts was further verifiedby their supershifting in the presence of specific antibody (Fig.8A, lanes 9 and 10, and B, lanes 8 and 9), while no effect wasobserved in the presence of nonspecific antibody (Fig. 8A, lane11, 8B, lane 10). Similar but weak shift and supershift also wereobserved when 293 cells were transfected only with the RTAexpression vector. This was probably due to the complexesformed by RTA and endogenous RBP-J�. The results of theseexperiments therefore suggest that RBP-J� can bind to theconsensus binding site within the LANA promoter and that RTAis able to form a complex with RBP-J� bound to its specificsequence. This then results in derepression of the promoter.

Expression of LANA is significantly delayed in OT11 cellspostinfection by KSHV. Previous studies showed that mouse-derived OT11 and OT13 cells are permissive to infection byKSHV (41). These cell lines provide an ideal system to addressthe question of whether or not there is any functional signifi-cance to the role of RBP-J� involved in latency establishmentpostinfection. To address this, OT11 and OT13 cells wereinfected with KSHV virions induced from BCBL1 cells. Attime points of 4 h, 12 h, 24 h, and 48 h postinfection, cells wereharvested for immuofluorescence analysis to determine theexpression of RTA and LANA.

FIG. 7. Comparison of activity of WT and (RBP-J� binding site mutated) LANA promoter. A fixed amount (5 �g) of the WT or MTreporter plasmid was transfected or cotransfected into 15 million BJAB (A) and U2OS (B) cells with 2.5 �g, 5 �g, 10 �g, 15 �g, or 20 �g ofpCR3.1-RTA. At 24 h posttransfection, the cell lysate of each transfection was harvested for a luciferase assay. (C) WT LANA promoter reporterplasmid (5 �g) was transfected into a RBP-J� knockout cell line (OT11) and a wild-type cell line (OT13) with 10 �g pCR3.1-RTA expressionvector; an extra rescue experiment was carried out introducing the addition of RBP-J� expression vector into OT11. At 24 h posttransfection, celllysate of each transfection was harvested for a luciferase assay.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

In OT13 cells, both RTA and LANA were detected by 4 hpostinfection (Fig. 9A). RTA signals became faint from 24 hand it was difficult to see RTA signals by 48 h postinfection.However, LANA expression steadily intensified from 12 hpostinfection and was significantly stronger by 48 h (Fig. 9A).These results supported the real-time PCR data above, sug-gesting that RTA induces LANA expression and that the ac-cumulated LANA contributes to the repression of RTA veryquickly within 24 h upon infection.

In OT11 cells, RTA can be detected at 4 h postinfection;however, there were no detectable levels of LANA (Fig. 9B).By 12 h postinfection, very faint signals of LANA were de-tected (Fig. 9B). The LANA signal was still relatively weak by24 h postinfection but was noticeably stronger by 48 h postin-fection (Fig. 9B). Interestingly, some clear signal of RTA wasdetected at 24 h postinfection (Fig. 9B). This suggests that by24 h postinfection, the levels of LANA were not sufficient toefficiently shut down RTA expression by negative feedback.Clearly, there were little or no detectable levels of LANA at4 h postinfection, comparing to that of OT13 cells (compareFig. 9A and B). Therefore, RBP-J� is likely to be critical foractivation of LANA expression at an early stage of infection.However, relatively stronger LANA levels were detected by24 h and increased by 48 h, only after levels of RTA wereeffectively shut down. This implies that LANA is likely to alsobe regulated by other cellular transcriptional regulators. Thereporter assays above demonstrated that the transcriptionalactivity of the LANA promoter was not completely shut downin the absence of RBP-J� binding site, again suggesting thatother transcriptional factors may also contribute to the regu-lation of LANA. Indeed, binding sites for transcriptional fac-tors which include Oct1 are located within the LANA pro-moter (26). We are currently investigating this possibility thatOct1 can play a role in establishment of latency. Previous

studies also showed that LANA can autoactivate its own pro-moter (31) and may explain at least in part the eventual accu-mulation of LANA in OT11.

DISCUSSION

ORF50 of KSHV which encodes RTA is an immediate earlygene necessary and critical for initiation of full lytic reactiva-tion (43–45). RTA has been shown to regulate and transacti-vate a number of downstream viral genes that function in lyticreplication (20, 44, 59, 65). Moreover, it is widely accepted thatthe function of RTA is mainly associated with lytic replicationof KSHV. Recent studies by Chandran and colleagues suggest-ing that KSHV can establish latency within 24 h after infection(36) drew our attention to additional studies by Jung andcolleagues which also showed up-regulation of RTA followedby increased LANA transcripts by array analysis (48). There-fore, we hypothesized that RTA may contribute to latencyestablishment through activation of LANA expression duringthe early stages of infection.

Initial studies suggested that the RTA protein is likely to beassociated with the virion particles and supports the possibilitythat there could be a requirement for RTA in establishment ofKSHV latency. Previously, we showed that LANA can repressthe RTA promoter (39). Upon infection, RTA may also acti-vate the LANA promoter. Accumulated LANA then can au-toactivate its own promoter as well as repress RTA expressionthrough a negative feedback mechanism. Our reporter assaysclearly showed that RTA can activate the LANA promoter ina dose-dependent manner. In addition, LANA transcription isshown to be responsive to induction of RTA by using RTA-inducible BCBL1 cells, which supports the hypothesis thatLANA expression is downstream of RTA expression during denovo infection and establishment of latency and that the tran-

FIG. 8. RTA/RBP-J� DNA binding complex. The probe for the EMSA consists of a RBP-J� consensus binding sequence and the flanking basesfrom the LANA promoter. An arrow indicates the position of the RBP-J�/DNA complex. Asterisks indicate the position of the supershiftedcomplex in the presence of RTA- and RBP-J�-cotransfected 293 cell lysate or in vitro-translated mixture of RTA and RBP-J� with specificantibodies. Non, nonspecific; IVT, in vitro translated; NE, nuclear extract.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

scription of LANA correlates with that of RTA during the veryearly stages of de novo infection. The results of these studiestherefore suggest a new mechanism by which LANA can beinduced by the lytic transactivator RTA, expanding the role ofRTA in regulation in the KSHV life cycle and examining apossible new mechanism by which the lytic transactivator RTAalso can contribute to establishment of KSHV latency.

In these studies, we also addressed the potential mechanismby which RTA activates LANA expression through functionalinteraction with RBP-J�. Recently, Liang et al. demonstratedthat RTA can functionally interact RBP-J� to up-regulate itsdownstream lytic genes such as ORF57 (40, 41). RBP-J� is asequence-specific DNA binding protein in the CSL/CBF-1family that is normally thought to repress transcription in re-sponse to the Notch signaling pathway (40, 41). CSL familyproteins recruit corepressor proteins via their interaction withthe CSL central domain (amino acids 179 to 361 in RBP-J�)(27). These corepressors, in turn, recruit histone deacetylases

that induce promoter silencing (38). Regulation of the CSLfamily members is mediated by Notch transmembrane recep-tors, which induce a proteolytic cleavage and release of theNotch intracellular domain (ICN) in response to interactionwith ligand (64). Nuclear localization signal (NLS) sequencesin the ICN mediate transport to the nucleus where the peptideinteracts with RBP-J�. This interaction appears to involve thecentral repressor domain that is also the target for RTA inter-action. RTA binding may also displace repressor proteins fromRBP-J� or may be involved in the recruitment of the ICN-activation domain. Liang et al. also suggested that RTA acts asa functional homologue of Notch (ICN). Interestingly, EBVlatency proteins EBNA-2 and EBNA-3 have also been shownto interact with RBP-J� (21, 52, 53). EBNA-2 does not bind toDNA but is essential for EBV-mediated B-cell proliferation.Interaction of EBNA-2 with the RBP-J� central repressor do-main region is coincident with that mapped for RTA interac-tion. This also results in derepression of RBP-J�-responsive

FIG. 9. LANA expression is delayed in OT11 cells. OT13 (A) and OT11 (B) cells were infected by KSHV for 2 h and then washed once withPBS. Cells were incubated and harvested at 4 h, 12 h, 24 h, and 48 h and fixed with 1:1 methanol/acetone. Latent protein LANA and lytic proteinRTA were detected by immunofluorescence assay.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

promoters (61). However, EBNA-3 appears to function in theconverse in regulating transactivation activity (52, 53). Thisstudy establishes a functional interaction between RTA andthe major downstream effector of the Notch signaling pathwayRBP-J� and shows the unique features of tumor viruses totarget essential cellular signaling events for regulating theirlytic replication and long term persistence in the infected cell.

LANA is a large nuclear protein (222 to 234 kDa, based onanalysis by sodium dodecyl sulfate [SDS]-PAGE) and hasthree distinct domains: a proline-rich N-terminal region with aputative NLS, a long glutamic acid-rich internal repeat do-main, and a carboxy-terminal domain including a putative NLS(12, 33, 50). In latently infected cells, LANA is critical formaintenance of the viral episome by tethering the episome tocellular mitotic chromosomes via direct interactions with his-tone H1 and possibly other cellular proteins, including MeCPand DEK (13, 37). Moreover, LANA has also been shown tomodulate the transcriptional activity of the human immunode-ficiency virus long terminal repeat promoter and to transacti-vate latent membrane protein 1 (LMP1) and Cp major latentpromoters of EBV, which are required for transcription ofessential EBV latent genes (22, 28, 51). Importantly, LANAalso contributes to viral oncogenesis by promoting cell survivalthrough targeting and alteration of p53 function, interactionwith the retinoblastoma protein and glycogen synthase kinase3�, and activation of the telomerase promoter (17, 18, 34). Ithas also been shown that LANA prolongs the life span ofprimary human umbilical vein endothelial cells (63). Thesestudies demonstrate that LANA can function as a viral onco-gene contributing to cell transformation. Since this study showsthat LANA can be regulated by RTA, this may be an indirectmechanism by which RTA can regulate KSHV viral oncogen-esis and raises another aspect of RTA role in KSHV patho-genesis which remains to be elucidated.

In summary, the mechanism by which KSHV can establishlatency postinfection is still incomplete and needs furtherstudy. However, this study provides some clues to a possiblemechanism by which the immediate early transactivator RTAmay contribute to establishment of viral latency. Here, weestablish a potential model which suggests a mechanism offeedback regulatory loop between RTA and LANA and im-plies that the interplay between RTA and LANA could be themaster control for the switch between lytic replication andlatency of KSHV utilizing the major cellular Notch signalingpathway through targeting of the RBP-J� effector protein (Fig.

10) (39a). Further studies are ongoing and should address thedetailed mechanism involved in this process. Interestingly, arecent report showed that RTA of EBV, another human gam-maherpesvirus, can induce major latent protein LMP1 (11).Along with this report, induction of latent genes by a lyticprotein could be a highly conserved process in gammaherpes-viruses for the establishment of latency in the infected cells.The immediate establishment of latency after infection is acritical component and consequence of the interaction be-tween virus and host. Therefore, further studies will be focusedon the identification of cellular molecules interacting with theviral regulatory molecules required for establishment of la-tency.

ACKNOWLEDGMENTS

We thank Gary S. Hayward (Johns Hopkins University School ofMedicine) for KSHV RTA rabbit polyclonal antibody, Kaiji Ueda andKoichi Yamanishi (Osaka University, Osaka, Japan) for KSHV RTAmouse monoclonal antibody, Yan Yuan (University of Pennsylvania,Philadelphia, PA) for KSHV ORF45 mouse monoclonal antibody,Bala Chandran (The University of Kansas Medical Center, KansasCity, KS) for KSHV gB rabbit polyclonal antiserum, Jae Jung (NewEngland Regional Primate Research Center) for RTA-inducibleBCBL1 and control cell lines, and Honjo Tasuku (Kyoto University,Kyoto, Japan) for OT11 and OT13 cells. We also thank Paul M.Lieberman (The Wistar Institute), James C. Alwine (Medical Schoolof University of Pennsylvania), and Yan Yuan (Dental School of Uni-versity of Pennsylvania) for suggestions.

This work was supported by grants from the Leukemia and Lym-phoma Society of America and U.S. Public Health Service grants fromthe NCI (CA072510 and CA091792) and from NIDCR (DE01436).E.S.R. is a scholar of the Leukemia and Lymphoma Society of Amer-ica.

REFERENCES

1. Bais, C., B. Santomasso, O. Coso, L. Arvanitakis, E. G. Raaka, J. S. Gutkind,A. S. Asch, E. Cesarman, M. C. Gershengorn, E. A. Mesri, and M. C.Gerhengorn. 1998. G-protein-coupled receptor of Kaposi’s sarcoma-associ-ated herpesvirus is a viral oncogene and angiogenesis activator. Nature391:86–89.

2. Bais, C., A. Van Geelen, P. Eroles, A. Mutlu, C. Chiozzini, S. Dias, R. L.Silverstein, S. Rafii, and E. A. Mesri. 2003. Kaposi’s sarcoma associatedherpesvirus G protein-coupled receptor immortalizes human endothelialcells by activation of the VEGF receptor-2/ KDR. Cancer Cell 3:131–143.

3. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence ofextrachromosomal KSHV DNA mediated by latency-associated nuclear an-tigen. Science 284:641–644.

4. Ballestas, M. E., and K. M. Kaye. 2001. Kaposi’s sarcoma-associated her-pesvirus latency-associated nuclear antigen 1 mediates episome persistencethrough cis-acting terminal repeat (TR) sequence and specifically binds TRDNA. J. Virol. 75:3250–3258.

5. Boshoff, C., and R. A. Weiss. 2001. Epidemiology and pathogenesis of Ka-posi’s sarcoma-associated herpesvirus. Philos. Trans. R. Soc. Lond. B Biol.Sci. 356:517–534.

6. Brander, C., N. Raje, P. G. O’Connor, F. Davies, J. Davis, D. Chauhan, T.Hideshima, J. Martin, D. Osmond, D. H. Kedes, B. D. Walker, D. T. Scad-den, and K. C. Anderson. 2002. Absence of biologically important Kaposisarcoma-associated herpesvirus gene products and virus-specific cellular im-mune responses in multiple myeloma. Blood 100:698–700.

7. Brander, C., T. Suscovich, Y. Lee, P. T. Nguyen, P. O’Connor, J. Seebach,N. G. Jones, M. van Gorder, B. D. Walker, and D. T. Scadden. 2000.Impaired CTL recognition of cells latently infected with Kaposi’s sarcoma-associated herpes virus. J. Immunol. 165:2077–2083.

8. Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995.Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-re-lated body-cavity-based lymphomas. N. Engl. J. Med. 332:1186–1191.

9. Cesarman, E., R. G. Nador, K. Aozasa, G. Delsol, J. W. Said, and D. M.Knowles. 1996. Kaposi’s sarcoma-associated herpesvirus in non-AIDS re-lated lymphomas occurring in body cavities. Am. J. Pathol. 149:53–57.

10. Cesarman, E., R. G. Nador, F. Bai, R. A. Bohenzky, J. J. Russo, P. S. Moore,Y. Chang, and D. M. Knowles. 1996. Kaposi’s sarcoma-associated herpesvi-rus contains G protein-coupled receptor and cyclin D homologs which areexpressed in Kaposi’s sarcoma and malignant lymphoma. J. Virol. 70:8218–8223.

FIG. 10. A hypothetical model for regulation of LANA by RTAcontributing to latency establishment postinfection.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

11. Chang, Y., H. H. Lee, S. S. Chang, T. Y. Hsu, P. W. Wang, Y. S. Chang, K.Takada, and C. H. Tsai. 2004. Induction of Epstein-Barr virus latent mem-brane protein 1 by a lytic transactivator Rta. J. Virol. 78:13028–13036.

12. Cotter, M. A., II, and E. S. Robertson. 2002. Molecular biology of Kaposi’ssarcoma-associated herpesvirus. Front. Biosci. 7:d358–d375.

13. Cotter, M. A., II, C. Subramanian, and E. S. Robertson. 2001. The Kaposi’ssarcoma-associated herpesvirus latency-associated nuclear antigen binds tospecific sequences at the left end of the viral genome through its carboxy-terminus. Virology 291:241–259.

14. Davis, D. A., A. S. Rinderknecht, J. P. Zoeteweij, Y. Aoki, E. L. Read-Connole, G. Tosato, A. Blauvelt, and R. Yarchoan. 2001. Hypoxia induceslytic replication of Kaposi sarcoma-associated herpesvirus. Blood 97:3244–3250.

15. Deng, H., A. Young, and R. Sun. 2000. Auto-activation of the rta gene ofhuman herpesvirus-8/Kaposi’s sarcoma-associated herpesvirus. J. Gen. Vi-rol. 81:3043–3048.

16. Dittmer, D., M. Lagunoff, R. Renne, K. Staskus, A. Haase, and D. Ganem.1998. A cluster of latently expressed genes in Kaposi’s sarcoma-associatedherpesvirus. J. Virol. 72:8309–8315.

17. Friborg, J., Jr., W. Kong, M. O. Hottiger, and G. J. Nabel. 1999. p53inhibition by the LANA protein of KSHV protects against cell death. Nature402:889–894.

18. Fujimuro, M., F. Y. Wu, C. ApRhys, H. Kajumbula, D. B. Young, G. S.Hayward, and S. D. Hayward. 2003. A novel viral mechanism for dysregu-lation of beta-catenin in Kaposi’s sarcoma-associated herpesvirus latency.Nat. Med. 9:300–306.

19. Garber, A. C., M. A. Shu, J. Hu, and R. Renne. 2001. DNA binding andmodulation of gene expression by the latency-associated nuclear antigen ofKaposi’s sarcoma-associated herpesvirus. J. Virol. 75:7882–7892.

20. Gradoville, L., J. Gerlach, E. Grogan, D. Shedd, S. Nikiforow, C. Metroka,and G. Miller. 2000. Kaposi’s sarcoma-associated herpesvirus open readingframe 50/Rta protein activates the entire viral lytic cycle in the HH-B2primary effusion lymphoma cell line. J. Virol. 74:6207–6212.

21. Grossman, S. R., E. Johannsen, X. Tong, R. Yalamanchili, and E. Kieff.1994. The Epstein-Barr virus nuclear antigen 2 transactivator is directed toresponse elements by the J. kappa recombination signal binding protein.Proc. Natl. Acad. Sci. USA 91:7568–7572.

22. Groves, A. K., M. A. Cotter, C. Subramanian, and E. S. Robertson. 2001. Thelatency-associated nuclear antigen encoded by Kaposi’s sarcoma-associatedherpesvirus activates two major essential Epstein-Barr virus latent promot-ers. J. Virol. 75:9446–9457.

23. Gwack, Y., H. J. Baek, H. Nakamura, S. H. Lee, M. Meisterernst, R. G.Roeder, and J. U. Jung. 2003. Principal role of TRAP/mediator and SWI/SNF complexes in Kaposi’s sarcoma-associated herpesvirus RTA-mediatedlytic reactivation. Mol. Cell. Biol. 23:2055–2067.

24. Gwack, Y., H. Nakamura, S. H. Lee, J. Souvlis, J. T. Yustein, S. Gygi, H. J.Kung, and J. U. Jung. 2003. Poly(ADP-ribose) polymerase 1 and Ste20-likekinase hKFC act as transcriptional repressors for gamma-2 herpesvirus lyticreplication. Mol. Cell. Biol. 23:8282–8294.

25. Haque, M., D. A. Davis, V. Wang, I. Widmer, and R. Yarchoan. 2003.Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) containshypoxia response elements: relevance to lytic induction by hypoxia. J. Virol.77:6761–6768.

26. Heinemeyer, T., E. Wingender, I. Reuter, H. Hermjakob, A. E. Kel, O. V. Kel,E. V. Ignatieva, E. A. Ananko, O. A. Podkolodnaya, F. A. Kolpakov, N. L.Podkolodny, and N. A. Kolchanov. 1998. Databases on transcriptional reg-ulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res. 26:362–367.

27. Hsieh, J. J., S. Zhou, L. Chen, D. B. Young, and S. D. Hayward. 1999. CIR,a corepressor linking the DNA binding factor CBF1 to the histone deacety-lase complex. Proc. Natl. Acad. Sci. USA 96:23–28.

28. Hyun, T. S., C. Subramanian, M. A. Cotter II, R. A. Thomas, and E. S.Robertson. 2001. Latency-associated nuclear antigen encoded by Kaposi’ssarcoma-associated herpesvirus interacts with Tat and activates the longterminal repeat of human immunodeficiency virus type 1 in human cells.J. Virol. 75:8761–8771.

29. Jeong, J., J. Papin, and D. Dittmer. 2001. Differential regulation of theoverlapping Kaposi’s sarcoma-associated herpesvirus vGCR (orf74) andLANA (orf73) promoters. J. Virol. 75:1798–1807.

30. Jeong, J. H., R. Hines-Boykin, J. D. Ash, and D. P. Dittmer. 2002. Tissuespecificity of the Kaposi’s sarcoma-associated herpesvirus latent nuclear an-tigen (LANA/orf73) promoter in transgenic mice. J. Virol. 76:11024–11032.

31. Jeong, J. H., J. Orvis, J. W. Kim, C. P. McMurtrey, R. Renne, and D. P.Dittmer. 2004. Regulation and autoregulation of the promoter for the la-tency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus.J. Biol. Chem. 279:16822–16831.

32. Katano, H., Y. Sato, and T. Sata. 2001. Expression of p53 and humanherpesvirus-8 (HHV-8)-encoded latency-associated nuclear antigen with in-hibition of apoptosis in HHV-8-associated malignancies. Cancer 92:3076–3084.

33. Kedes, D. H., M. Lagunoff, R. Renne, and D. Ganem. 1997. Identification of

the gene encoding the major latency-associated nuclear antigen of the Ka-posi’s sarcoma-associated herpesvirus. J. Clin. Investig. 100:2606–2610.

34. Knight, J. S., M. A. Cotter II, and E. S. Robertson. 2001. The latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus trans-activates the telomerase reverse transcriptase promoter. J. Biol. Chem. 276:22971–22978.

35. Knight, J. S., K. Lan, C. Subramanian, and E. S. Robertson. 2003. Epstein-Barr virus nuclear antigen 3C recruits histone deacetylase activity and asso-ciates with the corepressors mSin3A and NCoR in human B-cell lines.J. Virol. 77:4261–4272.

36. Krishnan, H. H., P. P. Naranatt, M. S. Smith, L. Zeng, C. Bloomer, and B.Chandran. 2004. Concurrent expression of latent and a limited number oflytic genes with immune modulation and antiapoptotic function by Kaposi’ssarcoma-associated herpesvirus early during infection of primary endothelialand fibroblast cells and subsequent decline of lytic gene expression. J. Virol.78:3601–3620.

37. Krithivas, A., M. Fujimuro, M. Weidner, D. B. Young, and S. D. Hayward.2002. Protein interactions targeting the latency-associated nuclear antigen ofKaposi’s sarcoma-associated herpesvirus to cell chromosomes. J. Virol. 76:11596–11604.

38. Lai, E. C. 2002. Keeping a good pathway down: transcriptional repression ofNotch pathway target genes by CSL proteins. EMBO Rep. 3:840–845.

39. Lan, K., D. A. Kuppers, S. C. Verma, and E. S. Robertson. 2004. Kaposi’ssarcoma-associated herpesvirus-encoded latency-associated nuclear antigeninhibits lytic replication by targeting Rta: a potential mechanism for virus-mediated control of latency. J. Virol. 78:6585–6594.

39a.Lan, K., D. A. Kuppers, and E. S. Robertson. 2005. Kaposi’s sarcoma-associated herpesvirus reactivation is regulated by interaction of latency-associated nuclear antigen with recombination signal sequence-binding pro-tein J�, the major downstream effector of the Notch signaling pathway.J. Virol. 79:3468–3478.

40. Liang, Y., J. Chang, S. J. Lynch, D. M. Lukac, and D. Ganem. 2002. The lyticswitch protein of KSHV activates gene expression via functional interactionwith RBP-J� (CSL), the target of the Notch signaling pathway. Genes Dev.16:1977–1989.

41. Liang, Y., and D. Ganem. 2003. Lytic but not latent infection by Kaposi’ssarcoma-associated herpesvirus requires host CSL protein, the mediator ofNotch signaling. Proc. Natl. Acad. Sci. USA 100:8490–8495.

42. Lu, F., J. Zhou, A. Wiedmer, K. Madden, Y. Yuan, and P. M. Lieberman.2003. Chromatin remodeling of the Kaposi’s sarcoma-associated herpesvirusORF50 promoter correlates with reactivation from latency. J. Virol. 77:11425–11435.

43. Lukac, D. M., L. Garibyan, J. R. Kirshner, D. Palmeri, and D. Ganem. 2001.DNA binding by Kaposi’s sarcoma-associated herpesvirus lytic switch pro-tein is necessary for transcriptional activation of two viral delayed earlypromoters. J. Virol. 75:6786–6799.

44. Lukac, D. M., J. R. Kirshner, and D. Ganem. 1999. Transcriptional activa-tion by the product of open reading frame 50 of Kaposi’s sarcoma-associatedherpesvirus is required for lytic viral reactivation in B cells. J. Virol. 73:9348–9361.

45. Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivationof Kaposi’s sarcoma-associated herpesvirus infection from latency by expres-sion of the ORF 50 transactivator, a homolog of the EBV R protein. Virol-ogy 252:304–312.

46. Miller, G., L. Heston, E. Grogan, L. Gradoville, M. Rigsby, R. Sun, D. Shedd,V. M. Kushnaryov, S. Grossberg, and Y. Chang. 1997. Selective switchbetween latency and lytic replication of Kaposi’s sarcoma herpesvirus andEpstein-Barr virus in dually infected body cavity lymphoma cells. J. Virol.71:314–324.

47. Moorman, N. J., D. O. Willer, and S. H. Speck. 2003. The gammaherpesvirus68 latency-associated nuclear antigen homolog is critical for the establish-ment of splenic latency. J. Virol. 77:10295–10303.

48. Nakamura, H., M. Lu, Y. Gwack, J. Souvlis, S. L. Zeichner, and J. U. Jung.2003. Global changes in Kaposi’s sarcoma-associated virus gene expressionpatterns following expression of a tetracycline-inducible Rta transactivator.J. Virol. 77:4205–4220.

49. Piolot, T., M. Tramier, M. Coppey, J. C. Nicolas, and V. Marechal. 2001.Close but distinct regions of human herpesvirus 8 latency-associated nuclearantigen 1 are responsible for nuclear targeting and binding to human mitoticchromosomes. J. Virol. 75:3948–3959.

50. Rainbow, L., G. M. Platt, G. R. Simpson, R. Sarid, S. J. Gao, H. Stoiber, C. S.Herrington, P. S. Moore, and T. F. Schulz. 1997. The 222- to 234-kilodaltonlatent nuclear protein (LNA) of Kaposi’s sarcoma-associated herpesvirus(human herpesvirus 8) is encoded by orf73 and is a component of thelatency-associated nuclear antigen. J. Virol. 71:5915–5921.

51. Renne, R., C. Barry, D. Dittmer, N. Compitello, P. O. Brown, and D. Ganem.2001. Modulation of cellular and viral gene expression by the latency-asso-ciated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus. J. Virol.75:458–468.

52. Robertson, E. S., S. Grossman, E. Johannsen, C. Miller, J. Lin, B. Tomkin-son, and E. Kieff. 1995. Epstein-Barr virus nuclear protein 3C modulates



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

transcription through interaction with the sequence-specific DNA-bindingprotein J�. J. Virol. 69:3108–3116.

53. Robertson, E. S., J. Lin, and E. Kieff. 1996. The amino-terminal domains ofEpstein-Barr virus nuclear proteins 3A, 3B, and 3C interact with RBPJ�.J. Virol. 70:3068–3074.

54. Russo, J. J., R. A. Bohenzky, M. C. Chien, J. Chen, M. Yan, D. Maddalena,J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996.Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).Proc. Natl. Acad. Sci. USA 93:14862–14867.

55. Sakakibara, S., K. Ueda, J. Chen, T. Okuno, and K. Yamanishi. 2001.Octamer-binding sequence is a key element for the autoregulation of Kapo-si’s sarcoma-associated herpesvirus ORF50/Lyta gene expression. J. Virol.75:6894–6900.

56. Sarid, R., A. Klepfish, and A. Schattner. 2002. Virology, pathogenetic mech-anisms, and associated diseases of Kaposi sarcoma-associated herpesvirus(human herpesvirus 8). Mayo Clin. Proc. 77:941–949.

57. Sarid, R., S. J. Olsen, and P. S. Moore. 1999. Kaposi’s sarcoma-associatedherpesvirus: epidemiology, virology, and molecular biology. Adv. Virus Res.52:139–232.

58. Schulz, T. F., and P. S. Moore. 1999. Kaposi’s sarcoma-associated herpesvi-rus: a new human tumor virus, but how? Trends Microbiol. 7:196–200.

59. Sun, R., S. F. Lin, L. Gradoville, Y. Yuan, F. Zhu, and G. Miller. 1998. A

viral gene that activates lytic cycle expression of Kaposi’s sarcoma-associatedherpesvirus. Proc. Natl. Acad. Sci. USA 95:10866–10871.

60. Sun, R., S. F. Lin, K. Staskus, L. Gradoville, E. Grogan, A. Haase, and G.Miller. 1999. Kinetics of Kaposi’s sarcoma-associated herpesvirus gene ex-pression. J. Virol. 73:2232–2242.

61. Waltzer, L., P. Y. Bourillot, A. Sergeant, and E. Manet. 1995. RBP-J�repression activity is mediated by a co-repressor and antagonized by theEpstein-Barr virus transcription factor EBNA2. Nucleic Acids Res. 23:4939–4945.

62. Wang, S., S. Liu, M. H. Wu, Y. Geng, and C. Wood. 2001. Identification of acellular protein that interacts and synergizes with the RTA (ORF50) proteinof Kaposi’s sarcoma-associated herpesvirus in transcriptional activation.J. Virol. 75:11961–11973.

63. Watanabe, T., M. Sugaya, A. M. Atkins, E. A. Aquilino, A. Yang, D. L. Borris,J. Brady, and A. Blauvelt. 2003. Kaposi’s sarcoma-associated herpesviruslatency-associated nuclear antigen prolongs the life span of primary humanumbilical vein endothelial cells. J. Virol. 77:6188–6196.

64. Weinmaster, G. 2000. Notch signal transduction: a real rip and more. Curr.Opin. Genet. Dev. 10:363–369.

65. Zhu, F. X., T. Cusano, and Y. Yuan. 1999. Identification of the immediate-early transcripts of Kaposi’s sarcoma-associated herpesvirus. J. Virol. 73:5556–5567.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

induction of kaposi's sarcoma-associated herpesvirus latency

Documents