Abstract We have identified three novel chicken CCchemokine genes among cDNA clones derived from li-popolysaccharide-stimulated cells of the chicken macro-phage cell line HD11. Two of these chemokines showDNA sequence homology to the mammalian genesSCYA20 (MIP-3α) and SCYA5 (RANTES), while thethird shows similar levels of homology to several mam-malian CC chemokines. Sequencing of genomic DNAshowed that all three chicken chemokines possess thethree-exon structure and conserved intron positions typi-cal of mammalian CC chemokines. Genetic mapping ofthe three chicken chemokines locates them in three chro-mosomal regions which correspond to regions containinghomologous chemokines in humans. Phylogenetic analy-sis of the currently known chicken and human chemo-kines suggests that individual chicken and human che-mokines derive from common ancestral genes in patternsthat reflect their genomic positions, indicating that thediversity of chemokine genes pre-dated avian-mammali-an divergence. Since the function of the chemokines isprincipally to act as intermediates between stimulatedcells and specific subsets of responding immune cells,this suggests that the complex organization of the im-mune system and diversity of responding cells werelargely in place at that time.

Keywords Chicken · CC chemokine · SSCP mapping ·Chromosomal location · Phylogeny

Introduction

In humans and mice, chemokines constitute a large andwell-conserved family of low molecular-weight proteinswhich play a chemotactic role in the response to infec-tion (Baggiolini and Dahinden 1994; Baggiolini et al.

1997; Oppenheim et al. 1991; Yoshie 2000). Chemo-kines act primarily by attracting leukocytes to sites of in-flammation and facilitating their entry into tissue (Ebnetand Vestwebner 1999), though some chemokines alsostimulate cell proliferation, cellular activation, and an-giogenesis (Bacon et al. 1995; Moore et al. 1998; Strieteret al. 1995). Around 50 chemokines have been identifiedin humans so far (Mantovani 1999) and these have beenclassified into four subfamilies based on the arrangementof conserved cysteine residues at the N terminus of theprotein (Rollins 1997). The two major subfamilies whichcontain most of the known chemokines are the CXC or α chemokines, where the first two cysteine residues areseparated by a single amino acid, and the CC or β che-mokines, where the first two cysteine residues are adja-cent. The C or γ chemokines, which possess only thesecond and fourth cysteine residues, and CX3C or δ che-mokines, where the first two cysteine residues are sepa-rated by three other amino acids, constitute minor sub-classes.

In mammals, many of the genes encoding these che-mokines are located in clusters, with most CXC chemo-kines being grouped in a single cluster on human Chro-mosome (Chr) 4, and many of the CC chemokines beingclustered in two groups on human Chr 17, although otherchemokines are located individually or in pairs at otherchromosomal locations (Maho et al. 1999; Nomiyama etal. 1998, 1999; O’Donovan et al. 1999). A very similargenomic arrangement is seen in mice, with CXC chemo-kines lying in a single cluster on Chr 5 and most CC che-mokines grouped in two clusters on Chr 11.

Two CXC chemokines have previously been reportedin chickens, a homologue of the CXC chemokine SCYB8[interleukin (IL)-8] (Kaiser et al. 1999) and a CXC-likecDNA clone designated K60 (Sick et al. 2000). Twochicken CC chemokines have also been identified previ-ously, one showing homology to human SCYA4 [macro-phage inflammatory protein (MIP)-1β] (Hughes andBumstead 1999; Petrenko et al. 1995) and a secondwhich shows homology to other members of the MIPfamily of CC chemokines, designated K203 (Sick et al.

S. Hughes · A. Haynes · M. O’Regan · N. Bumstead (✉ )Institute for Animal Health, Compton Laboratory, Compton, Berkshire, RG20 7NN, UKe-mail: nat.bumstead@bbsrc.ac.ukTel.: +44-1635-578411,Fax: +44-1635-577263

Immunogenetics (2001) 53:674–683DOI 10.1007/s002510100368

O R I G I N A L PA P E R

Simon Hughes · Alison Haynes · Michelle O’Regan Nat Bumstead

Identification, mapping, and phylogenetic analysis of three novel chicken CC chemokines

Received: 20 June 2001 / Revised: 13 August 2001 / Published online: 3 October 2001© Springer-Verlag 2001

675

2000). A chicken orthologue of the single C chemokineSCYC1 (lymphotactin) has also recently been describedand genetically mapped (Hughes and Bumstead 2000;Rossi et al. 1999). Here we describe the identifica-tion, genomic sequencing, and mapping of three further chicken CC chemokines, and investigate the correspon-dence of phylogenetic relationships derived from se-quence data with those implied by the chromosomalgrouping of avian and mammalian chemokines.

Materials and methods

cDNA library construction and identification of cDNA clones

The transformed macrophage cell line HD11 (Beug et al. 1979)was used as a source of RNA likely to contain genes of immuno-logical interest. HD11 cells were grown in RPMI 1640 with 2.5%fetal calf serum and 2.5% chicken serum and activated by the ad-dition of lipopolysaccharide (LPS, Escherichia coli serotype055:B5, 104 ng/ml final concentration; Sigma). After 24 h, RNAwas harvested from the cells, and cDNA was prepared and clonedinto vector plasmid pCINeo using BstXI linkers (O’Regan et al.1999). Plasmid DNA was prepared for sequencing using the QIAprep Spin Miniprep Kit (Qiagen) and sequenced using primersT3 (5′ ATTAACCCTCACTAAAGGGAAGCG 3′) and T7 (5′ CG-AAATTAATACGACTCACTATAG 3′).

Genomic DNA cloning

Genomic clones were generated by polymerase chain reactions(PCRs) using primers designed from cDNA sequence. GenomicDNA was prepared from blood of a male bird of inbred line N byisolation of nuclei and phenol-chloroform extraction as describedin Bumstead and Palyga (1992). Four primers were designedfrom the cDNA sequence for each of the three genes (Table 1)and used to amplify genomic DNA by PCR. Each PCR reactioncontained: primers at 5 µM, dNTPs each at 1 mM, 200 ng templateDNA, 1×PCR reaction buffer (Promega), 1.5 mM MgCl2 and1.25 units of Taq polymerase (Promega). Cycling conditions weredenaturation at 94°C for 60 s; annealing at a primer-dependenttemperature (Table 1) for 60 s; and extension at 72°C for 2 min.The reaction was carried out for 30 cycles with a final extensionat 72°C for 10 min using a Biorad iCycler. The resulting PCRproducts were cloned into the TOPO TA Cloning Vector pCR2.1(Invitrogen) and sequenced using M13 forward (5′ GTTTTCCC-AGTCACGA 3′) and reverse (5′ CAGGAAACAGCTATGACC 3′)primers. In each case, two duplicate products from separate PCR reactions were cloned and sequenced to exclude PCR arti-facts.

Cloned products were sequenced using the BigDye Termina-tor Cycle Sequencing Kit with AmpliTaq DNA Polymerase FS (PE Biosystems) following the manufacturer’s instructions, andanalyzed on an ABI377 fluorescent sequencer (PE Biosystems).

Genetic mapping

Genetic mapping was carried out using the Compton (C) and theEast Lansing (EL) mapping reference populations. Both popula-tions are derived from backcrosses, derived from matings betweenbirds of inbred lines N and 15I for the Compton reference popula-tion (Bumstead and Palyga 1992) and from chicken inbred lineUCD003 and red jungle fowl line UCD001 for the East Lansingpopulation (Crittenden et al. 1993).

Parent birds of the two populations were screened to identifypolymorphisms by single-stranded conformation analysis (SSCP),using the gene-specific primers shown in Table 1. The PCR prod-ucts were digested at 37°C for 2 h using a combination of RsaI,HaeIII, and AluI restriction enzymes. The digested products wereethanol precipitated, resuspended in loading buffer (98% form-amide, 2% EDTA) and denatured at 94°C for 5 min. Samples werecooled rapidly in ice and analyzed on a nondenaturing polyacryla-mide gel (0.5×monomer solution of SEQUAGEL MD; NationalDiagnostics). The SSCP gel was run for 5 h at 8 W at room tem-perature (25°C), and then silver stained (Sambrook et al. 1989).

The segregation patterns of polymorphic bands were identified inprogeny of the two populations and linkage analysis performed usingMAPMANAGER QT software (Manly et al. 1999). A LOD score ofthree in two-point analysis was taken as the threshold for significantlinkage and gene order was determined as the order requiring theleast number of recombination events within linkage groups.

Chicken genomic mapping information and chromosomal designations are drawn from Schmid and co-workers (2000). Human and mouse genomic mapping information was drawn fromthe NCBI (http://www.ncbi.nlm.nih.gov/) and MGI (http://www.informatics.jax.org/) databases, respectively, 15 May 2001.

Bacterial artificial chromosome isolation

Chicken bacterial artificial chromosome clones (BACs) were iden-tified from the Wageningen BAC library (Crooijmans et al. 2000).Colony filters of the library were obtained from the Human Ge-nome Resource Centre, Hinxton, UK, and screened by radioactivehybridization using PCR products generated from genomic DNA,using the primers shown in Table 1.

Analysis of predicted protein structure

Protein motifs and predicted cleavage sites were identified usingthe PIX software package provided by the Human Genome Re-source Centre, Hinxton (http://www.hgmp.mrc.ac.uk).

Table 1 Primers designed fromthe cDNA sequence for clonesah189, ah221, and ah294 usedfor genomic amplification andsequencing. Primers spanningintron/exon boundaries weredesigned by a comparison ofthe chicken cDNA sequence tohuman SCYA2 where the loca-tion of introns was known

Number Primer Sequence Annealing temperature(°C)

1a ah189 F1 5′ ATGCCTGGCTTGAGCACCAAGAGTTTGATT 3′ 711b ah189 F2 5′ TGCCTCGGAAGGTCATTAAGGGCT 3′ 661c ah189 R1 5′ AGCCCTTAATGACCTTCCGAGGCA 3′ 661d ah189 R2 5′ TCACATTGACATCCTCTTGAGCTTCTGGCT 3′ 692a ah221 F1 5′ TCTGCTCCTCCTGGCCCTCTGCTC 3′ 692b ah221 F2 5′ TCCGCCTACATCACCAGCAGCAAA 3′ 682c ah221 R1 5′ TTTGCTGCTGGTGATGTAGGCGGA 3′ 682d ah221 R2 5′ AGGCGTTTCTGCACCCAGGACTCCT 3′ 693a ah294 F1 5′ TGGTTGCCGCCCTCTTCCCTCAA 3′ 713b ah294 F2 5′ TCTACACCAGCAGCAAATGCCCACA 3′ 683c ah294 R1 5′ TGTGGGCATTTGCTGCTGGTGTAGA 3′ 683d ah294 R2 5′ TTCCTTCACCCACCGGGCGTCA 3′ 71

676

Fig. 1 Homology of cDNAclones ah189, ah221, andah294 to human SCYA20 (a),human SCYA3 (b), and humanSCYA5 (c). Alignments werecarried out using the Localpi-leup program from the Wiscon-sin Package Version 10.0 forUnix. Alignment gaps are indi-cated by asterisks

Phylogenetic analysis

Phylogenetic relationships between the chicken chemokines andmammalian chemokines were determined using the PileUp mod-ule of Wisconsin Package Version 10.0, Genetics Computer

Group, USA (Feng and Doolittle 1987) and the FITCH and Neigh-bour-NJ modules of the Phylip package version 3.752c (Felsen-stein 1989). The zebrafish chemokine CCL1 (EMBL accessionnumber AF201450) was used as the outgroup. Analysis was car-ried out using the full known or predicted protein coding sequence

677

Fig. 2 Structure and genomicsequence of ah189 (a), ah221(b), and ah294 (c). Exons arehighlighted in bold and under-lined with the amino acid se-quence of the coding regionsdepicted in the three-letter codebelow the corresponding nucle-otide sequence. The signal se-quence cleavage site was pre-dicted using PIX (http://www.hgmp.mrc.ac.uk) and is markedby an inverted triangle

678

of each of the chemokines to generate unrooted trees. Transi-tion/transversion ratios were calculated using the PUZZLE pro-gram (Strimmer and von Haeseler 1997).

Results

Identification of chemokines within the chicken HD11 cDNA library

Sequencing of cDNA clones from LPS-activated cells ofthe HD11 macrophage cell line library identified a num-ber of clones showing strong homology to mammalianchemokines. The sequences fell into six clusters, three ofwhich were found to correspond to the sequences ofchicken SCYB8, K60, and SCYA4, which have been pre-viously identified (Kaiser et al. 1999; Petrenko et al.1995; Sick et al. 2000). SCYB8 and K60 sequences wereespecially prevalent in this library (around 6% ofclones). Three other groups of clones showed homologyto mammalian CC chemokines. Representative clones ofeach of these groups were selected and fully sequenced.DNA sequence comparisons of the clones with theEMBL database indicated that clone ah189 has 58%DNA sequence homology to the human chemokineSCYA20 (LARC) and clone ah294 has 64% homology to

human SCYA5 (RANTES). Clone ah221 has greater than 50% homology to a number of the MIP family ofhuman CC chemokines, with greatest similarity toSCYA3 (MIP-1Α), although it has a slightly higher ho-mology (61%) to horse eotaxin (data not shown). In eachcase, the chicken cDNA clones extend beyond the com-plete protein coding sequence of the correspondingmammalian genes (Fig. 1). The sequence data for thethree chicken genes have been deposited in the EMBLdatabase with accession numbers AY037861, AY037859,and AY037860 for clones ah189, ah294, and ah221, re-spectively.

Structure of chicken CC chemokine genes

Mammalian CC chemokines have a characteristic struc-ture of two introns and three exons (Danoff et al. 1994).To test whether the putative chicken chemokines havethis typical intron/exon structure, primers were designedfrom the predicted protein-coding sequence of each ofthe three cDNAs to yield amplification products thatspanned the expected positions of introns within the ge-nomic sequence. These were used to generate PCR prod-ucts which were cloned and sequenced (Fig. 2). Compar-

Fig. 2 Legend see page 677

679

ison of the genomic products with the correspondingcDNA sequences confirmed the position of the expectedintrons and identified their intron/exon boundaries(Fig. 3). For each of the three genes, the sequence adja-cent to the intron/exon boundaries is similar to that oftheir mammalian homologues with the introns occurringin the same positions and in the same phases within co-dons (Fig. 3).

Comparisons of the predicted proteins of the threegenes also indicated strong similarity to mammalian che-mokines and indicated probable signal sequences and 3′probable α-helix regions (Fig. 2). For each of the threegenes, the predicted protein size is closely similar to itsmammalian homologue (Fig. 1) but the intron sizes ofthe three chicken genes are smaller than is typical of hu-man chemokines, with the exception of intron 2 of ah189(Fig. 3).

Chromosomal localization

To identify the genomic location of the genes corre-sponding to clones ah189, ah221, and ah294, PCR prod-ucts were generated from DNA of the parent birds of theCompton and East Lansing mapping populations. Prim-ers were designed spanning the positions of intron 2 forclones ah189 and ah294, and spanning introns 1 and 2and exon 2 for clone ah221. These products werescreened for SSCP polymorphisms in the two popula-tions and differences in band pattern were identified be-tween the parent birds of the Compton mapping panelfor clones ah189 and ah294 and between the parents ofthe East Lansing panel for clone ah221.

Analysis of the segregation of variant bands in proge-ny of the mapping populations indicated that ah189 is located on chicken Chr 9, adjacent to nucleolin (NCL)and paired-box homeotic gene 3 (PAX3). Clone ah294mapped to chicken Chr 19 co-incident with chicken che-mokines SCYA4 and K203. ah221 also mapped to chick-en Chr 19 but appeared to be at some distance from

ah294; however, as the two loci were mapped in differ-ent populations estimating their separation was difficult.To overcome this problem, BAC clones were isolated using ah294 as probe. Primers derived from end se-quence from these BACs identified a polymorphism inthe East Lansing population. In this population, ah221and the end sequence of the BAC containing ah294 bothmapped to chicken Chr 19, but were 16 cM apart andseparated by intervening marker loci (Fig. 4).

BAC clones were also isolated for ah221 and, inter-estingly, were found to also contain the chicken CC che-mokine c391 (Sick et al. 2000), indicating that these twogenes lie in very close proximity.

Phylogenetic analysis of CC chemokines

Phylogenetic comparisons were carried out between thechicken chemokines and all currently known human andmouse chemokines, using the full known or predictedprotein-coding sequence of each chemokine. Relation-ships between the chicken and human chemokines areshown in Fig. 5. The figure shows the relationship de-rived using the FITCH module of the Phylip package.Results derived using the NEIGHBOUR module wereclosely similar (data not shown) as were comparisonswhich included all chemokines or only CC chemokines,mouse as well as human chemokines, and with othergenes as outgroups. The consistency of these results sug-gests this model is robust.

As expected, ah294 and the previously describedchicken CC chemokines SCYA4 and K203 group with themammalian MIP-like CC chemokines found in the prin-cipal cluster on human Chr 17. ah221 associates with thehuman chemokines of the MCP cluster, which form asecond group on human Chr 17. ah189 forms an inde-pendent branch with human SCYA20 (LARC) amongquite diverse chemokines from different chromosomalpositions. The chicken C chemokine SCYC1 forms a separate branch with its mammalian counterpart, and

Fig. 3 Intron/exon splice junc-tions for the CC chemokineshuman SCYA3 and chickenclones ah189, ah221, andah294. The predicted intronsizes for the chicken genes areindicated

680

Discussion

Here we identified three novel chicken CC chemokines,including the sequence and intron/exon structure of thegenes, their chromosomal location, and their phylogene-tic relationships to mammalian chemokines. Particularlyinteresting aspects of this analysis are the parallel phylo-genetic relationships seen in chickens and humans, andthe correspondence between this sequence-based phylog-eny and the chromosomal locations of the genes.

Sequence analysis of ah221, ah294, and ah189 strong-ly suggests that they are CC chemokines, with each ofthe three genes showing sequence homology to humanchemokines and protein motifs typical of CC chemo-kines. However, levels of homology of these genes tospecific individual chemokines are moderate in compari-son to those seen for nonimmune genes, where levels ofhomology are commonly 70–80% (Schmid et al. 2000).This appears typical of genes involved in the chicken im-mune process, with genes such as IL2 showing only 38%homology to its human equivalent (Kaiser and Mariani1998) and, arguably, may reflect pathogen-driven selec-tion (Hughes 1997; Murphy 1993). The three chickengenes also show the conserved intron/exon positions andsplice junctions typical of mammalian CC chemokines(Fig. 3). Conservation of intron/exon structure betweenavian and mammalian chemokines was also seen for theCXC chemokine SCYB8 (Kaiser et al. 1999) and appearsgenerally to be very well conserved between mammaliangenes and their chicken orthologues (Schmid et al.2000).

On the basis of their individual sequence homology,the three chicken genes identified here correspond mostclosely to human SCYA20 (ah189), SCYA5 (ah294), andSCYA3 (ah221); however, to determine whether they aretrue orthologues of these specific chemokines from theirsequence alone is difficult. The chromosomal location ofthe three genes provides an alternative and independentindication of their relationship to mammalian chemo-kines, as there is now strong evidence for the conserva-tion of synteny between regions of the chicken genomeand equivalent regions in humans (Girard-Santuosso etal. 1997; Sallusto et al. 2000; Schmid et al. 2000). Wehave previously shown that the region surrounding theposition of the CXC chemokine SCYB8 (IL-8) showsstrong conservation of synteny with corresponding re-gions on human Chr 4 and mouse Chr 5 (Kaiser et al.1999), and this also appears to be the case for the CCchemokines. ah189, which is most closely homologousto SCYA20 (LARC), maps close to PAX3 and NCL whichare closely linked to SCYA20 on human Chr 2 and mouseChr 1 (Fig. 4a). Similarly, ah294, which is most closelyhomologous to human SCYA5, maps to the same geneticlocation on chicken Chr 19 as the previously mappedchicken homologue of SCYA4 (Hughes and Bumstead1999) and this chromosome also carries other geneswhich flank the chemokines on human Chr 17. This co-localization of chicken homologues of SCYA5 andSCYA4 suggests that this region corresponds to the hu-

Fig. 4 Comparative maps of chicken Chr 9 and human Chr 2 (a)and chicken Chr 19 and human Chr 17 (b) showing regions ofconserved synteny. Genes shown to be linked within physicalclones or contigs are joined by bars

chicken CXC chemokines SCYB8 (IL-8) and K60 groupwith the human CXC chemokines from human Chr 4.Chicken chemokine c391 lies on its own with no clearassociation to any particular human chemokine.

681

man MIP-like CC chemokine cluster on Chr 17q11,where these two genes are adjacent to one another in atight cluster (Maho et al. 1999).

From sequence homology, ah221 is also most similarto the MIP-like subfamily of CC chemokines. This geneshows considerable homology to several members of thehuman 17q11 cluster, in particular SCYA3 (MIP-1α) andSCYA18 (PARC), which in humans and mice lie in thesame gene cluster as SCYA4 and SCYA5. However, ourresults clearly show that ah221 lies at a distance of ap-proximately 16 cM from the homologues of these genesin chickens, which is likely to correspond to a distance

of approximately 8 Mb. Interestingly, chicken chemo-kine c391, which is present in the same BAC clones asah221, shows greatest similarity to the MCP subfamilyof mammalian CC chemokines. In humans and mice,these genes lie in a tight cluster at approximately thisdistance from the MIP-like cluster, and the conservedsynteny of chicken Chr 19 to human Chr 17 seems likelyto extend this far. SCYA1(I-309), which lies at one end ofthe human MCP cluster, shows greater similarity to thechemokines of the MIP-like 17q11 cluster than to theother chemokines present in the MCP cluster, presum-ably reflecting the position of cleavage of the ancestralchemokine cluster. ah221, like human SCYA1, likely rep-resents a chemokine intermediate between the two sub-families. The chromosomal positions of the three chemo-kines thus indicate that the three genes are related by de-scent to human SCYA20, SCYA5, and a member of theMCP cluster.

Genetic distance analysis of the known human,mouse, and chicken CC chemokines shows very similarphylogenetic grouping for the chicken and human che-mokines, with pleasing parallels between phylogeneticgrouping and chromosomal positions. ah294, SCYA4,and K203 are closely grouped with mammalian genes ofthe MIP-like cluster on Chr 17 (Fig. 5). ah221 similarlylies in a cluster with the human MCP chemokines. Otherchicken chemokines form distinct branches with theirmammalian counterparts, which are also reflected intheir chromosomal positions: the chicken CXC chemo-kines located on chicken Chr 4 form a well-defined clus-ter with the CXC chemokines from human Chr 4; ah189and its human homologue SCYA20 (LARC) lie in regionsof conserved synteny on chicken Chr 9 and human Chr 2and form a separate branch as do human SCYC1

Fig. 5 Radial phylogenetic tree displaying nucleotide sequencesimilarity for the protein-coding region of nine chicken chemo-kines (in lowercase, bold, and underlined) and currently knownhuman CC (SCYA) and CXC (SCYB) chemokines (in uppercase).The accession numbers for the human sequences are as follows:SCYA1, XM-008410; SCYA2, XM_008415; SCYA3,XM_008450; SCYA4, XM_008449; SCYA5, XM102656;SCYA7, XM_012649; SCYA8, XM_008412; SCYA11,XM_008413; SCYA13, XM_008411; SCYA14, NM_004166;SCYA15, NM_004167; SCYA16, XM_008451; SCYA17,XM_007958; SCYA18, XM_008451; SCYA19, XM_005637;SCYA20, XM_002224; SCYA21, XM_005633; SCYA22,XM_002990; SCYA23, XM_008454; SCYA24, XM_004908;SCYA25, XM_008948; SCYA26, XM_004909; SCYA27,XM_005634; SCYA28, XM_011293; SCYB1, XM_003504;SCYB2, XM_003510; SCYB3, XM_003508; SCYB4,XM_003505; SCYB5, XM_003507; SCYB6, XM_003502;SCYB7, XM_003506; SCYB8, XM_003501; SCYB9,XM_011141; SCYB10, XM_005409; SCYB11, XM_005409;SCYB12, XM_005815; SCYB13, XM_003305; SCYB14,XM_003833. The accession numbers for the chicken sequencesare as follows: SCYB8, AJ009800; K60, Y14971; c391, L34552;SCYA4, AJ243034; K203, Y18692; scyc1, AJ242790, ah189,AY037862; ah221, AY037860; ah294, AY037859. The outgroupfor this tree is zebrafish CCL1, AF201450

682

(lymphotactin) and its chicken homologue, which lie onhuman and chicken Chr 1. The chicken CC chemokinec391 lies on its own in the FITCH analysis, although insome analyses using other outgroups, c391 was associat-ed with ah221 (data not shown) which would be in betteragreement with their chromosomal position.

Overall, the major branching of the chemokine familyappears to have occurred before avian/mammalian diver-gence, with the chicken genome containing representa-tives of most of the mammalian CC chemokine clusters,although chicken equivalents of SCYA22 (MDC) andSCYA17 (TARC) from human Chr 16 and SCYA25(TECK) from Chr 19 have not so far been identified. Inhumans and mice, the CXC, MIP-like, and MCP clustershave subsequently expanded greatly, but whether this isalso the case in chickens, or whether, as in the chickenmajor histocompatibility complex, the chicken clustersare simpler and contain fewer genes (Kaufman et al.1999) remains to be seen. We are addressing this possi-bility through genomic sequencing of these regions. Inmammals, chemokines from the different chromosomalclusters use distinct receptors (Rossi and Zlotnik 2000)and chickens will likely have an equal range of chemo-kine receptors, though at present these are largely un-known.

Since the function of chemokines is to selectively at-tract specific subsets of immunological cells, our resultsimply that both the signalling pathways leading to che-mokine release and the range of subsets of respondingcells pre-date the divergence of birds from mammals. Itis particularly interesting that ah221 and c391 appear tocorrespond to members of the MCP cluster of chemo-kines, which in mammals form part of the Th2 response(Mackay 2001), since this is as yet unidentified in chick-ens. However, the extent to which these parallels extendto the detailed functional properties of the individualchemokines will require the identification of a full set ofchicken chemokines and extensive characterization oftheir functions.

Acknowledgements The authors would like to thank Dr. YvonneBoyd and Dr. Pete Kaiser for their assistance and input during thepreparation of this manuscript. This work was undertaken with thefinancial support of the BBSRC and EU programme QLK5-CT-1999-01591.

References

Bacon KB, Premack BA, Gardner P, Schall TJ (1995) Activationof dual T cell signalling pathways by the chemokine RANTES.Science 269:1727–1730

Baggiolini M, Dahinden CA (1994) CC chemokines in allergic in-flammation. Immunol Today 15:127–133

Baggiolini M, Dewald B. Moser B (1997) Human chemokines: anupdate. Annu Rev Immunol 15:675–705

Beug H, Kirchbach A von, Doderlein G, Conscience JF, Graf T(1979) Chicken haematopoietic cell types transformed by seven strains of defective avian leukemia viruses display threedistinct phenotypes of differentiation. Cell 18:375–390

Bumstead N, Palyga J (1992) A preliminary linkage map of thechicken genome. Genomics 13:690–697

Crittenden FS, Provencher L, Santangelo I, Abplanalp H, BrilesRW, Briles WE, Dodgson JB (1993) Characterisation of a redjungle fowl by white leghorn backcross population for molec-ular mapping of the chicken genome. Poultry Sci 72:334–348

Crooijmans RPMA, Vrebalov J, Dijkof RJM, Poel JJ van der, Groenen MAM (2000) Two-dimensional screening of the Wa-geningen chicken BAC library. Mamm Genome 11:360–363

Danoff TM, Lalley PA, Chang YS, Heeger PS, Neilson EG (1994)Cloning, genomic organization, and chromosomal localizationof the Scya5 gene encoding the murine chemokine RANTES.J Immunol 152:1182–1189

Ebnet K, Vestweber D (1999) Molecular mechanisms that controlleukocyte extravasation: the selectins and the chemokines.Histochem Cell Biol 112:1–23

Felsenstein J (1989) PHYLIP – phylogeny inference package ver-sion 3.2. Cladistics 5:164–166

Feng D, Doolittle RF (1987) Progressive sequence alignment as aprerequisite to correct phylogenetic trees. J Mol Evol 25:351–360

Girard-Santuosso O, Bumstead N, Lantier I, Protais J, Colin P,Guillot JF, Pardon P, Beaumont C, Malo D, Lantier F(1997)Partial conservation of the mammalian NRAMP1 syntenicgroup on chicken Chromosome 7. Mamm Genome 8:614–616

Hughes AL (1997) Rapid evolution of immunoglobulin superfam-ily C2 domains expressed in immune system cells. Mol BiolEvol 14:1–5

Hughes S, Bumstead N (1999) Mapping of the gene encoding achicken homologue of the mammalian chemokine SCYA4.Anim Genet 30:404

Hughes S, Bumstead N (2000) The gene encoding a chicken che-mokine with homology to human SCYC1 maps to chromo-some 1. Anim Genet 31:142

Kaiser P, Mariani P (1998) Promoter sequence, exon:intron struc-ture, and synteny of genetic location show that a chicken cyto-kine with T-cell proliferative activity is IL2 and not IL15. Im-munogenetics 49:26–35

Kaiser P, Hughes S, Bumstead N (1999) The chicken 9E3/CEF4CXC chemokine is the avian orthologue of IL8 and maps tochicken chromosome 4 syntenic with genes flanking the mam-malian chemokine cluster. Immunogenetics 49:673–684

Kaufman J, Milne S, Gobel TW, Walker BA, Jacob JP, Auffray C,Zoorob R, Beck S (1999) The chicken B locus is a minimal es-sential major histocompatibility complex. Nature 401:923–925

Mackay CR (2001) Chemokines: immunology’s high impact fac-tors. Nat Immunol 2:95–101

Maho A, Carter A, Bensimon A, Vassart G, Parmentier M (1999)Physical mapping of the CC-chemokine gene cluster on thehuman 17q11.2 region. Genomics 59:213–223

Manly KF, Olson JM (1999) Overview of QTL mapping softwareand introduction to map manager QT. Mamm Genome 10:327–334

Mantovani A (1999) The chemokine system: redundancy for ro-bust outputs. Immunol Today 20:254–257

Moore BB, Arenberg DA, Addison CL, Keane MP, Strieter RM(1998) Tumor angiogenesis is regulated by CXC chemokines.J Lab Clin Med 132:97–103

Murphy PM (1993) Molecular mimicry and the generation of hostdefense protein diversity. Cell 72:823–826

Nomiyama H, Amano K, Kusuda J, Imai T, Miura R, Yoshie O, Matsuda Y (1998) The human CC chemokine TECK(SCYA25) maps to chromosome 19p13.2. Genomics 51:311–312

Nomiyama H, Fukuda S, Iio M, Tanase S, Miura R, Yoshie O(1999) Organization of the chemokine gene cluster on humanchromosome 17q11.2 containing the genes for CC chemokineMPIF-1, HCC-2, HCC-1, LEC, and RANTES. J InterferonCytokine Res 3:227–234

O’Donovan N, Galvin M, Morgan JG (1999) Physical mapping ofthe CXC chemokine locus on human chromosome 4. Cytoge-net Cell Genet 84:39–42

Oppenheim JJ, Zachariae CO, Mukaida N, Matsushima K (1991)Properties of the novel proinflammatory supergene “inter-crine” cytokine family. Annu Rev Immunol 9:617–648

683

O’Regan MN, Parsons KR, Tregaskes CA, Young JR (1999) Achicken homologue of the co-stimulating molecule CD80which binds to mammalian CTLA-4. Immunogenetics49:68–71

Petrenko O, Ischenko I, Enrietto PJ (1995) Isolation of a cDNAencoding a novel chicken chemokine homologous to mamma-lian macrophage inflammatory protein-1 beta. Gene 160:305–306

Rollins BJ (1997) Chemokines. Blood 90:909–928Rossi D, Sanchez-Garcia J, McCormack WT, Bazan JF, Zlotnik A

(1999) Identification of a chicken “C" chemokine related tolymphotactin. J Leukoc Biol 65:87–93

Rossi D, Zlotnik A (2000) The biology of chemokines and theirreceptors. Annu Rev Immunol 18:217–242

Sallusto F, Mackay CR, Lanzaveccia A (2000) The role of chemo-kine receptors in primary, effector and memory immune re-sponses. Annu Rev Immunol 18:593–620

Sambrook J, Fritsh EF, Maniatis T (1989) Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY

Schmid M, Nanda I, Guttenbach M, Steinlein C, Schartl M, HaafT, Weigand S, Fries R, Buerstedde J-M, Wimmers K, Burt DW

Smith J, A’Hara S, Law A, Griffin DK, Bumstead N, KaufmanJ, Thompson PA, Burke TA, Groenen MAM et al (2000) Firstreport on chicken genes and chromosomes. Cytogenet CellGenet 90:169–218

Sick C, Schneider K, Staeheli P, Weining KC (2000) Novel chicken CXC and CC chemokines. Cytokine 12:181–186

Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick MD,Kasper J, Dzuiba J, Van Damme J, Walz A, Marriott D (1995)The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 270:27348–27357

Strimmer K, Haeseler A von (1997) Likelihood-mapping: a simplemethod to visualize phylogenetic content of a sequence align-ment. Proc Natl Acad Sci USA 94:6815–9

Tirunagaru VG, Sofer L, Cui J, Burnside J (2000) An expressedsequence tag database of T-cell-enriched activated chickensplenocytes: sequence analysis of 5251 clones. Genomics 66:144–151

Yoshie O (2000) Immune chemokines and their receptors: the key elements in the genesis, homeostasis and function of the immune system. Springer Semin Immunopathol 22:371–391

Note added in proof. During the preparation of this manuscriptpartial sequence of a clone similar to clone ah294 was reported byTirunagaru and co-workers (2000).