health testing of germplasm conserved in in vitro ... · lane 11: trichoderma viride lane 12:...
TRANSCRIPT
![Page 1: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/1.jpg)
S. C. Dubey Principal Scientist and Head
Division of Plant Quarantine
ICAR-National Bureau of Plant Genetic Resources
New Delhi 110 012, India
Health testing of germplasm conserved
in in vitro Genebanks and
cryogenebanks
![Page 2: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/2.jpg)
ICAR-NBPGR, New Delhi, has one of the mandates for
acquisition and management of PGR for conservation and their
utilization ensure food security and sustainability.
Seed health testing of collected and indigenously multiplied
material is a pre-requisites for conservation of PGR of agri-
horticultural crops in the Genebank bank (NGB) at ICAR-
NBPGR, New Delhi with the aim to make them pest-free.
Seed health testing was initiated in 1998 at ICAR-NBPGR, New
Delhi for the germplasm collected under mission mode National
Agricultural Technology Project (NATP) on agro-biodiversity
Introduction
![Page 3: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/3.jpg)
Objectives of
Seed-Health
Testing
Quarantine
Seed Trade
Seed
Certification
Seed Treatment
Feed or Food Conservation
Planting Value
Seed Health
The presence or absence of disease causing organisms (ISTA, 1976)
![Page 4: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/4.jpg)
Seed-borne pathogens affect
534 genera of 109 plant families
Pathogens known to be seed-borne
Fungi:~1500 (~331 not reported from India)
Bacteria:~302 (~270 not reported from India)
Viruses: ~120
• Insects: ~60,000 species known from India, ~6% of
the world total diversity of insects
Why seed health testing?
![Page 5: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/5.jpg)
First seed-health testing station was
established in 1918 in Wageningen,
The Netherlands
Dr Lucie C Doyer first official Seed
Pathologist, Wageningen- 1919
First International Rules for Seed
Testing published by ISTA in 1928
included a chapter on phytosanitary
conditions of seed with reference to
pathogens
Background
![Page 6: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/6.jpg)
Processing
of samples
![Page 7: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/7.jpg)
Techniques
Visual examination
Washing test
NaOH soaking
Blotter/Agar plating
X-ray radiography
Seed transparency test
Seed soaking test
Molecular markers
![Page 8: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/8.jpg)
Visual examination
Discolored, deformed & shriveled seeds/ weed seeds
Live/ dead insects or parts thereof
Infected/ infested seeds
Fungal growth/ fructifications (bunt balls, sclerotia)
Magnifier Stereo binocular
![Page 9: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/9.jpg)
Visual Inspection for
Detection of Various Pests
Soil Clods Weed Seeds
Infestation by insects
Ergot in Wheat
![Page 10: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/10.jpg)
Botrytis grey mold Fusarium Purple staining
Discolouration on seeds
Soybean - Mottling Pea - Split seed coat Pea – Tennis boll Necrosis
Viral symptoms
Fungal symptoms
![Page 11: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/11.jpg)
Fungal fructifications mixed with seeds
Karnal bunt Hill bunt Smut of bajra False smut
Ergot of Agropyron Ergot of bajra Ergot of wheat Ergot of oat
Kernel smut
![Page 12: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/12.jpg)
Detection and identification of pathogens
Incubation test for detection of pathogens
Planting Material
Alternating cycles of 12 hours
fluorescent light and darkness
22±10C for 7 days
Stereo-cum-compound Microscopy
Agar Blotter
![Page 13: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/13.jpg)
Bipolaris sorghicola
![Page 14: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/14.jpg)
Colletotrichum graminicola
![Page 15: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/15.jpg)
Phoma sorghina
![Page 16: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/16.jpg)
Alternaria spp.
Alternaria sesami
Alternaria radicina
Alternaria zinniae
![Page 17: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/17.jpg)
Colletotrichum capsici (a-g) C. gloeosporiodes
g
![Page 18: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/18.jpg)
Drechslera spp.
D. oryzae
D. sorokiniana
D. soghicola
D. bicolor
![Page 19: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/19.jpg)
D. tetramera
D. sorokiniana
Drechslera spp.
D. avenae
![Page 20: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/20.jpg)
Fusarium spp.
F. moniliforme
![Page 21: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/21.jpg)
Saprophytes
Melanospora zamiae
Melanospora zamiae Cladosporium
Curvularia spp.
Aspergillus - weed fungus
Aspergillus
![Page 22: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/22.jpg)
Safflower Rust (Puccinia carthami)
Washing test
Seed shaking
Sunflower Rust
(Puccinia helianthi)
Seeds in a test tube +
10 ml water
Stirring on shaker
for 30 sec.
Fig. 4. Fungi Detected during Washing Test: Downy mildew spores; Smuts; Bunts; Rusts, etc.
Oospores of
Perenospora manshuricaSeeds on mechanical shaker
Uromyces betae (Sugarbeet rust)
Smut spores
Chlamydospores
![Page 23: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/23.jpg)
Molecular marker based identification
and detection
Conserved region based markers ITS, IGS, 16s rDNA and TEF etc. Species specific markers Gene specific, SCAR, RFLP
![Page 24: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/24.jpg)
Detection of Fusarium verticillioides infecting sorghum
germplasm collected from different parts of India
0.57kb 0.57kb
0.57kb
0.5kb
1kb
M 1 2 3 4 5 6 7 8 9 10 11
Lane M: 100 bp Marker;
Lane 1-10: F. verticillioides infected sorghum samples;
Lane 11: Negative control
![Page 25: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/25.jpg)
PCR-based detection of Colletotrichum capsici fungus
causing anthracnose in Capsicum annuum in India
Lane M: 100 bp DNA ladder; Lane 1-26: C. capsici isolates; Lane NC: negative control
447 bp
Colletotrichum capsici primers (ITS based): C.cap-F: 5’- ACCTAACTGTTGCTTCGGCG-3’ C.cap-R: 5’- AAATTTGGGGGTTTTACGGC-3’
![Page 26: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/26.jpg)
M 1 2 3 4 5 6 7 8 9 10 11 12
Lane M: 1Kb marker
Lane 1-3: Colletotrichum capsici samples
Lane 4: Colletotrichum gloeosporioides
Lane 5: Colletotrichum lindemuthianum
Lane 6: Alternaria alternata
Lane 7: Drechslera rostrata
Lane 8: Fusarium solani
Lane 9: Macrophomina phaseolina
Lane 10: Aspergillus flavus
Lane 11: Trichoderma viride
Lane 12: Negative control
Rapid detection of Collectotrichum capsici by loop-
mediated isothermal amplification (LAMP) assay
β-tubulin gene at 65°C for 45 min.
Colour changes of LAMP amplification
products after adding 2μl of 10x SYBR
green
Pathogen Specificity Test
![Page 27: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/27.jpg)
Identification of Plant Bacterial Contamination in Taro
(Colocasia esculenta) Tissue Culture Plantlets Using
16S rDNA Sequencing
M 1 2 3 4 5 6 7
Use of universal bacterial
primers for amplification of 16S
rDNA region of unknown
bacteria (1390 bp).
Product eluted, Sequenced and
Blasted (99-100% identity).
Lane M: 100 bp plus marker.
Lane 1, 2, 3 and 6:
Paenibacillus spp.
Lane 4 and 5: Ralstonia spp.
Lane 7: Negative control.
1390 bp
3 kb
1 kb
0.5 kb
Paenibacillus spp. – gram negative, rod shaped, anaerobic, spore-forming
bacteria, sensitive to tetracycline and kanamycin.
Ralstonia spp. – gram negative, motile rod shaped, aerobic, non-spore
forming bacteria, sensitive to tetracycline and cephalosporins (cefotaxmine
and ceftazidime).
![Page 28: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/28.jpg)
Molecular detection of various nematode intercepted in germplasm
under exchange and from pest free conservation in genebank
750 bp
700 bp
M 1 2 3 4 N M 1 2 3 4 5 N 3 kb 3 kb
1 kb
1 kb 0.5 kb
0.5 kb
PCR amplification of ITS region of
Pratylenchus penetrans detected in
Apple germplasm (IQ 15/2015)
PCR amplification of ITS region of
Aphelenchoides besseyi detected in
Rice germplasm
Lane M: 100 bp plus marker, lane 1: Variety-
Sunlight, lane 2: Moon light; lane 3: Redlane;
lane 4: Goldlane; lane N: Negative control
Lane M: 100 bp plus marker, lane 1: DQ50/14;
lane 2: DQ51/14; lane 3: DQ270/14; lane 4:
DQ337/14; lane 5: DQ3/15; lane N: Negative
control.
![Page 29: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/29.jpg)
Amplified product of different isolates of Foc with A-167 F2R1. Lane 1-14 Foc
isolates, 15- Foc inoculated chickpea plant, 16- Un-inoculated chickpea plant, 17-
R. bataticola, 18- R. solani, 19- S. sclerotiorum, 20- NTC, and M– 100bp ladder at
both sides.
Primer Sequence
A-167 F2 TACCAGTGCGGTGGTATTGA
A-167 R1 GCGACAACATACCAATGACG
Amplified product of Foc inoculated plant with a set of
markers 1BR-B125F1R1 at different dilutions. Lane 1-
100ng, 2- 50ng, 3- 25ng, 4- 10ng, 5- 5ng, 6- 2ng, 7- 1ng, 8-
0.5ng, 9- 100pg, 10- 50pg, 11- 25pg, 12- 12.5pg, 13-
6.25pg, 14- 3.12pg, 15- 1.56pg, 16- 0.78pg and M – 100bp
ladder at both sides.
Amplified product of Foc with a set of markers 1BR-
B125F1R1 at different dilutions. Lane 1- 25ng, 2- 10ng,
3- 5ng, 4- 2ng, 5- 1ng, 6- 0.5ng, 7- 100pg, 8- 50pg, 9-
25pg, 10- 12.5pg, 11- 6.25pg, 12- 3.12pg, 13- 1.56pg, 14-
0.78pg and M – 100bp ladder at both sides.
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 M
409 bp
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M 409 bp
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M
409 bp
TEF 1α based Foc specific
marker
![Page 30: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/30.jpg)
Detection level: 2.8 pg
Quantitative analysis by real time PCR
![Page 31: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/31.jpg)
Detection of insects
Planting Material
X-ray radiography Bruchid infestation in legume seeds
Specialized detection for
insects
Detection and identification
of insects
X –ray radiographs of seeds showing
hidden infestation of bruchids
Seed Transparency test
![Page 32: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/32.jpg)
Retrieval and mounting of insect pests
Identification Keys Reference Collection
Infested seeds from X ray Seed soaking
Insect
retrieval
Mounting and
Labeling +
Insect Identification
![Page 33: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/33.jpg)
Digitized Keys for
Identification of
Bruchids
Insect Identification
Database of >1,658 species
under 71 genera of world
bruchid species
![Page 34: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/34.jpg)
Visual examination (For presence of soil, shriveled/ discolored seeds, galls etc.)
Soaking and teasing of seeds for isolation of nematodes
Detection and Identification of Nematode
A. Nematode suspension under stereoscopic microscope at 40 X B. Nematode image under compound microscope at 400 X
A B
![Page 35: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/35.jpg)
Detection and identification of weed seeds
Visual Inspection
• With naked eye
• With aided eye
Identification of weed seeds
• Based on morphological characters
• Based on vegetative and floral characters
![Page 36: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/36.jpg)
Weed Information System
![Page 37: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/37.jpg)
Detection of pathogens in samples of
various crops under cryo-preservation
49 49
111
26
103
75
12
30
55 40.82 53.06 28.83
38.46
11.65 6.67
50.00
6.67 12.73
0
20
40
60
80
100
120
Yr-2011 Yr-2012 Yr-2013 Yr-2014 Yr-2015 Yr-2016 Yr-2017 Yr-2018 Yr-2019
Year wise processing of cryo samples and observed infection level
Samples Infection (%)
Infected:
120/510
![Page 38: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/38.jpg)
Interception Crop
Alternaria brassicae Brassica compestris
A. brassicicola B. juncea
A. sesami Sesamum spp.
Bipolaris avenae B. oleracea
B. hawiiensis Capparis decidua
B. rostrata Coix lacryma-jobi
B. tetramera B. juncea, Eleusine coracana
Botrydiplodia theobromae Carissa carandus, Vigna sp.
Colletotrichum capsici Capsicum annuum, Carissa carandus, Sesamum sp., Vigna sp.
C. gloeosporioides Abelmoschus spp., Citrus sp., *Elaeis guineensis
Fusarium culmorum Vigna umbellata
F. dimerum Luffa hermaphrodita
F/equiseti Trichosanthes cucumerina
F. oxysporum Asparagus secemoses, Eruca sativa, Sesbania grandiflora
Important detection of fungal pathogens in
cryo-materials
C. gloeosporioides
on Elaeis guineensis New Record
![Page 39: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/39.jpg)
Interception Crop
F. semitectum Abelmoschus spp., Brassica juncea, Eruca sativa,
Sesamum spp., Trichosanthes cucumerina, Vigna spp.
F. solani Azadirachta indica, Prunus persica, Viburnum mullaha,
Vigna sp.
F. verticillioides Abelmoschus spp., Asparagus officinalis, Azadirachta
indica, Crotalaria fillipis, Viburnum mullaha
Myrothecium roridum Abelmoschus sp., Cucumis sp.
Pestalotia guepini *Rubus spp.
Phoma exigua Abelmoschus spp., Cucumis spp., Lycopersican
hirsutum, *Sesamum spp., Solanum melongena, Vigna
spp.
P. sorghina Carica papaya, Phyllanthus emblica, Sesamum spp.
Phomopsis sp. Abolmoshcus esculantus, *Sesamum spp.
Sclerotium rolfsii Sesamum spp.
X. c. pv. campestris Brassica juncea, B. rapa
Detection of important fungal pathogens in
Cryo-material
![Page 40: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/40.jpg)
New host records
Phomopsis sp. on Sesamum
Pestalotia guepini on Rubus
![Page 41: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/41.jpg)
Virus indexing of tissue cultured plants using
ELISA Rubus sp.: 55 accessions
Viruses: 06
o Arabis mosaic virus (ArMV)
o Raspberry bush dwarf virus (RBDV)
o Raspberry ringspot virus (RpRSV)
o Strawberry latent ringspot virus (SLRV)
o Strawberry mild yellow edge virus (SMYEV)
o Tomato ringspot virus (ToRSV)
Fragaria sp.: 54 accessions
Viruses: 09
• Arabis mosaic virus (ArMV)
• Raspberry bush dwarf virus (RBDV)
• Raspberry ringspot virus (RpRSV)
• Strawberry latent ringspot virus (SLRV)
• Strawberry mild yellow edge virus (SMYEV)
• Tomato black ring virus (TBRV)
• Tomato ringspot virus (ToRSV)
• Tobacco necrosis virus (TNV)
• Tobacco streak virus (TSV)
Infection: 3.7% - ArMV, RBDV, SLRV, TBRV, TNV
and ToRSV
Infection: 7% - RpRSV, SMYEV, TBRV and
ToRSV
![Page 42: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/42.jpg)
Allium sp.: 206 accessions
Viruses: 07
• Carnation latent virus (CLRV)
• Garlic common latent virus (GCLV)
• Garlic virus C (GVC)
• Leek yellow stripe virus (LYSV)
• Onion yellow dwarf virus (OYDV)
• Shallot latent virus (SLV)
• Shallot yellow stripe virus (SYSV)
Infection: 28.16% - CLV,
GCLV, GVC,
LYSV, OYDV,
SLV and SYSV
Dioscorea: 162 accessions
Viruses: 02
• Dioscorea latent virus (DLV)
• Yam mosaic virus (YMV)
Infection: 4% - DLV and YMV
![Page 43: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/43.jpg)
Detection and salvaging of insect-pests
infested samples of various crops under cryo-
preservation
Year Crop (number of samples) Samples
X-rayed
Infested
Samples
Insect
detected
Samples
salvaged
2015-16 Capparis decidua (5), Pithecellobium
dulce (4), Tamarandus indica (5),
Fagopyrum esculentum (5), Pisum
sativum (5), Sesbania grandiflora (6),
Prunus americana (22), Vigna
unguiculata (1), Crotolaria felipes (6) and
Gossypium hirsutum (5)
64 4
(S. grandiflora)
Immature
stages of
bruchid
4
2016-17 Bixa Orellana (1), Terminalia bellerica
(1), Vigna umbellata (1), Cordia myxa (5),
Cordia rothii (4), Capparis decidua (32)
and Annona squimosa (11)
55 32
(C. decidua)
Immature
stages of
bruchid
32
2018-19 Elaeis quineensis (17), Phaseolus
lathyroides (7) and Rhynchosis minima (2)
26 Nil Nil Nil
2019-20 Arachis hypogea (3), Sesbania grandiflora
(6), Cajanus cajan (3), Cordia myxa (4),
Rosa spp. (9), Prunus spp. (7), Pyrus
pashia (1), Malus baccata (2), Buchanania
lanzan (6), Rosa microphylla (7)
48 4
(S. grandiflora
and C. cajan) )
Immature
stages of
bruchid
4
![Page 44: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/44.jpg)
Disinfestation of insect infested seeds
Real time X-ray radiography machine
Infested:
40/193
Fumigation chamber
![Page 45: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/45.jpg)
Survival of fungal pathogens
![Page 46: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/46.jpg)
ISPM 40
International movement of growing media
in association with plants for planting
Soil as a growing medium is considered to be a high-risk pathway because it can harbour numerous quarantine pests and a number of other growing media are also recognized pathways for the introduction and spread of quarantine pests. The pest risk of growing media in association with plants for planting depends on factors related to both the production of the growing media and the production of the plants, as well as the interaction between the two.
![Page 47: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/47.jpg)
Impact on biodiversity and the environment Pests associated with the international movement of growing media in association with plants for planting may have negative impacts on biodiversity. Implementation of this standard could significantly reduce the introduction and spread of quarantine pests associated with growing media and consequently reduce their negative impacts.
Growing media free from quarantine pests Growing media free from quarantine pests may be achieved by: • using growing media produced in a process that renders the growing
media free from pests • using growing media or their components collected from a pest free
area or a pest free production site • applying appropriate treatments to growing media that are not free
from pests, before their use.
![Page 48: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/48.jpg)
DESTRUCTIVE INSECTS AND PESTS ACT 1914 (AMENDED THROUGH NOTIFICATIONS FROM TIME TO TIME)
Plants, Fruits and Seeds (Regulations of Import into India)
Order 1984
New Policy on Seed Development 1988
PFS Order 1989
SPS Agreement of WTO 1995
Plant Quarantine Order 2003 (Pest Risk Analysis prior to import, Prohibition of 31 invasive alien weed species)
Legislations
• 1906 under the Sea Customs Act to stop the entry of the Mexican cotton boll weevil
• Compulsory fumigation of cotton bales
![Page 49: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/49.jpg)
Salient Features of New PQ Order
PRA made pre-condition for import of items other than those in Schedule V, VI, and VII
Prohibition on import of commodities with specific weed/ alien species contamination
Restriction on import of packaging material of plant origin unless treated
Additional declarations specified in the Order for import of 820 agricultural commodities with specific lists of more than > 1000 quarantine pests and 31 weed species.
Notified points of entry increased to 130
Plant Quarantine
(Regulation of Import into India)
Order 2003
![Page 50: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/50.jpg)
Agricultural imports have been classified as:
Prohibited plant species-14 crops from different countries (Schedule IV)
Restricted species where import permitted only by authorized institutions-
about 17 different species (Schedule V).
Restricted species permitted only with additional declarations of
freedoms from quarantine/ regulated pests and subject to specified
treatment certifications – about 693 different species (Schedule VI).
Plant material imported for consumption/ industrial processing permitted
with normal Phytosanitary Certificate - about 29 species (Schedule VII).
List of quarantine weed species - 57 species (Schedule VIII)
Inspection fee (Schedule IX)
List of Permit Issuing Authorities for Import of Seeds, Plants and Plant
Products and other articles (Schedule X)
List of Inspection Authorities for Certification of Post entry quarantine
facilities and inspection of growing plants (Schedule XI)
Quantities of seeds permitted for trial purpose/accession to gene bank of
National Bureau of Plant Genetic Resources (Schedule XII)
![Page 51: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/51.jpg)
Exotic Pests Introduced into India
Parthenium hysterophorus
Mexico
BBTV of banana
Sri Lanka
San Jose scale of apple
U.S.A Lantana camara
C. America
Phalaris minor
Mexico
Golden nematode of potato
U.K.
Blight of chickpea
Middle East
B. tabaci
Biotype B in cotton
![Page 52: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/52.jpg)
Pests Year of introduction
Woolly apple aphid, Eriosoma lanigerum 1889 Lantana weed, Lantana camara 1809 Coffee rust, Hemilia vastatrix 1879 Late blight of Potato, Phytophthora infestans 1883 Grape downy mildew, Plasmopara viticola 1910 San Jose scale, Quadraspidiotus perniciousus 1911 Water hyacinth, Eichhornia crassipes 1914 Potato tuber moth, Phthorimaea operculella 1937 Banana bunchy top virus 1940 Potato wart, Synchytrium endobioticum 1953 Carrot grass, Parthenium hysterophorus 1956 Golder nematode, Globodera rostochinensis, G. pallida 1961 Apple scab, Venturia enequalis 1978 Downy mildew of sunflower, Plasmopara halstedii 1984 Peanut stripe virus 1987 Sunflower necrosis disease, Sunflower necrosis virus 1997 Cotton mealy bug, Phenococcus solenopsis 2006 Papaya mealy bug, Paracoccus marginatus 2009 Tomato leaf minor, Tuta abosoluta Meyrick 2014 Root knot nematode, Meloidogyne enterolobii 2016 White rust of chrysanthemum, Puccinia horiana 2016 Fall Armyworm (Spodoptera frugiperda) in maize 2018
Pests Introduced in India
![Page 53: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/53.jpg)
(Seed/ Veg. Propagules/ in-vitro)
•Bulk consignments
for consumption
for planting or sowing
•Small samples including transgenics
for research work
Movement of Agricultural Material
Transboundary
•Import/ Export
Regional (Inter-state)
•Trials and Release
Agricultural Commodities
![Page 54: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/54.jpg)
National Bureau of Plant Genetic Resources
Nodal agency for
issue of import permit
quarantine clearance
issue of Phytosanitary Certificate
for germplasm including transgenics
……Small samples
![Page 55: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/55.jpg)
Head Quarter, DPPQ&S, Faridabad
01
Plant Quarantine Stations
57
Central IPM Centres 35
Locust Control Stations 12
Central Insecticide Lab 1
Regional Pesticide Testing Labs
2
Plant Protection Network of DPPQ&S in India
■
■
![Page 56: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/56.jpg)
344429
121186
416225 403578
498368
441893 436315
545187
304749
3095810987
241108 237474
7839352164
89198
6617 5831
0
100000
200000
300000
400000
500000
600000
Sam
ple
nu
mb
ers
Years
Import Export
Germplasm Processed in Quarantine
> 10,000 Phytosanitary Certificates issued for material (after quarantine
testing) meant for export
![Page 57: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/57.jpg)
Samples infected/ infested with different pests
(1976-2018)
57
![Page 58: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/58.jpg)
From 1976-2016, a total of 74 pests not yet reported from
India during quarantine examination have been
intercepted in exotic germplasm imported into the
country for research purposes
Fungi -5
Viruses - 17
Insects/ mites -25
Nematodes -9
Weeds -16
Interceptions of quarantine
pests at NBPGR
![Page 59: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/59.jpg)
Fungi Host Source of import
Fusarium oxysporum f.
sp. cucumerinum
Cucumis sativus USA
Monographella nivalis Triticum aestivum Germany, Hungary, Italy, Mexico,
Sweden, Turkey, UK and USA
Hordeum vulgare Italy
Peronospora manshurica Glycine max Belgium, Brazil, Canada,
Colombia, Costa Rica, Ghana,
Hungary, Indonesia, Israel, Italy,
Japan, Korea, Malaysia, Nepal,
Papua New Guinea, Poland,
Romania, Russia, Taiwan,
Thailand, USA and Zimbabwe
Phomopsis longicolla Helianthus annuus USA
Uromyces beticola Beta vulgaris Belgium, Denmark, Holland,
Hungary, Germany, The
Netherlands, Sweden, UK, USA
and SSR
Exotic Fungal Interceptions
![Page 60: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/60.jpg)
34.4
16.2
51.8
0.7
1.5
7.1
21.3 16.0
Infection in soybean germplasm (%)
Korea (21/61)
USSR (11/68)
Brazil (57/110)
Malaysia (1/145)
Zimbabwe (3/200)
Taiwan 157/2219)
USA (1605/7518)
Others 13/81)
Intercepted from several countries Oospores of P. manshurica remain
viable up to 8 years A large number of physiologic
races exist. Pathogen is of high quarantine
significance for the country.
Peronospora manshurica
(Downy mildew of soybean)
Oospores crust
Phomopsis longicolla (Seed decay in soybean)
Causes pod and stem blight/ seed decay of soybean, has wide hosts and detectad in sunflower from USA in 2011
It is a new host record from USA and elsewhere
Phomopsis logicolla on
Sunflower
![Page 61: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/61.jpg)
Crop Pest Yield loss in
exporting country
(%)
*Estimated annual
loss in India (Rs.
lakhs)
Wheat
Monographella nivalis (fungus) 3.0 to 52.4 (USSR)
15193.80 Barley stripe mosaic virus Up to 30.0 (USA)
Bromus secalinus (weed) 28.0 to 48.0 (USA)
Soybean
Bean pod mottle virus Up to 52.0 (USA)
2619.95 Peronospora manshurica
(fungus)
Up to 80.0 (USA)
Cotton Anthonomus grandis (insect) Up to 51.0 (USA) 2214.43
Maize Maize chlorotic mottle virus 90.0 (USA)
310.65 High plains virus Up to 100.0 (USA)
*Assuming only 0.1% yield loss due to appearance of pest. The total yield and minimum support
price have been taken for 2015-16
(Source: http://eands.dacnet.nic.in/)
Probable annual losses due to various
exotic pests, if introduced into India
![Page 62: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/62.jpg)
Sanitary and Phytosanitary Agreement
Aims to protect
Plants
from pests/ pathogens
Human beings and animals
from toxins, additives in food, feed and
beverages and
diseases/ pests
![Page 63: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/63.jpg)
ISPM 1 Principles of plant quarantine as related to international trade 1995
ISPM 2 Guidelines for pest risk analysis 1996
ISPM 3 Code of conduct for the import and release of exotic biological control agents
1996
ISPM 4 Requirements for the establishment of pest free areas 1996
ISPM 5 Glossary of phytosanitary terms 2002
ISPM 6 Guidelines for surveillance 1997
ISPM 7 Export certification system 1997
ISPM 8 Determination of pest status in an area 1998
ISPM 9 Guidelines for pest eradication programmes 1998
ISPM 10 Requirements for the establishment of pest free places of production and pest free production site
1999
ISPM 11 Pest risk analysis for quarantine pests including analysis of environmental risks and living modified organisms
2003
ISPM 12 Guidelines for phytosanitary certificates 2001
ISPM 13 Guidelines for the notification of non- compliance and emergency action
2001
ISPM 14 The use of integrated measure in a systems approach for pest risk management
2002
ISPM 15 Guidelines for regulating wood packaging material in international trade
2002
ISPM 16 Regulated non-quarantine pests: concept and application 2002
ISPM 17 Pest reporting 2002
International Standards for Phytosanitary Measures
![Page 64: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/64.jpg)
ISPM 18 Guidelines for the use of irradiation as a phytosanitary measure 2003
ISPM 19 Guidelines on list of regulated pests 2003
ISPM 20 Guidelines for phytosanitary import regulatory system 2004
ISPM 21 Pest risk analysis for regulated non-quarantine pests 2004
ISPM 22 Requirements for the establishment of areas of low pest prevalence 2005
ISPM 23 Guidelines for inspection 2005
ISPM 24 Guidelines for the determination and recognition of equivalence of phytosanitary measures
2005
ISPM 25 Consignments in transit 2006
ISPM 26 Establishment of pest free areas for fruit flies (Tephritidae) 2006
ISPM 27 Diagnostic protocols for regulated pests 2006
ISPM 28 Phytosanitary treatments for regulated pests 2007
ISPM 29 Recognition of pest free areas and areas of low pest prevalence 2007
ISPM 30 Establishment of areas of low pest prevalence for fruit flies (Tephritidae)
2008
ISPM 31 Methodologies for sampling of consignments 2008
ISPM 32 Categorization of commodities according to their pest risk 2009
ISPM 33 Pest free potato (solanum spp.) micropropagative material and
minitubers for international trade
2010
ISPM 34 Design and operation of post-entry quarantine stations for plants 2010
![Page 65: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/65.jpg)
ISPM 35 Systems approach for pest risk management of fruit flies (Tephritidae) 2012
ISPM 36 Integrated measures for plants for planting 2012
ISPM 37 Determination of host status of fruit to fruit flies (Tephritidae) 2017
ISPM 38 International movement of seeds 2017
ISPM 39 International movement of wood\ 2017
ISPM 40 International movement of growing media in association with plants
for planting
2017
ISPM 41 International movement of used vehicles, machinery and equipment 2017
ISPM 42 Requirements for the use of temperature treatments as a phytosanitary
measures
2018
![Page 66: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/66.jpg)
National Standards on Phytosanitary Measures
• Prepared by –
DPPQS under DAC & FW
Aim –
1. Guidelines for application of phytosanitary measures
as harmonized with international standards.
2. Facilitate trade & avoid rejection due to
non-compliance.
• Endorsed by – Ministry of Agriculture
![Page 67: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/67.jpg)
NSPM No.
Title of Standard Adopted on
1 Plant Quarantine Operation Systems Manual July, 1999
2 Import Inspection Manual July, 1999
3 Export Inspection Manual July, 1999
4 Post-Entry Quarantine Inspection Manual July, 1999
5 Pest Risk Analysis: Administrative Process Manual January, 2004
6 Pest Risk Analysis-Technical Methodology November,
1999
7 Guidelines for Reporting Plant Quarantine Activities March, 2003
8 Guidelines for Auditing of Plant Quarantine Activities November,
2002
9 Guidelines for Certification of Forced Hot-Air Treatment Facilities
for Wood Packaging Material Revision 1 on: May, 2011
August, 2004
10 Guidelines for Export Inspection & Phytosanitary Certification of
Fresh Mango (Mangifera indica) Fruits to P. R. China
January, 2005
11 Quarantine Treatments and Application Procedures-1. Methyl
Bromide Fumigation
February,
2005
12 Guidelines for Assessment, Accreditation & Auditing of Fumigation
AgenciesRevision 1 on: May, 2011
February,
2005
13 Requirements for establishment of pest free areas for mango nut
weevil (Sternochetus mangiferae) and pulp weevil (Sternochetus
frigidus)
May, 2005
National Standards
![Page 68: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/68.jpg)
NSPM No.
Title of Standard Adopted on
14 Requirements for Establishment of pest free areas for Tephritid
fruit flies May, 2005
15 Guidelines for Certification of Hot-Water Immersion Treatment
Facilities May, 2005
16 Guidelines for development of National Standards for
Phytosanitary Measures
February,
2005
17 Guidelines for Regulating Export, Import & Release of Biological
Control Agents & other Beneficial Organisms
December,
2004
18 Guidelines for Certification of Heat Treatment Facilities for Niger
Seed
December,
2004
19 Requirements for establishment of pest free areas for brown rot
(Ralstonia solanacearum) of potato
February,
2005
20 Guidelines for Certification of Vapour Heat Treatment facilities for
fresh fruits
December,
2005
21 Guidelines for Certification of Irradiation Treatment Facilities for
Fresh Fruits January, 2006
22 Guidelines for Assessment, Audit and Accreditation of Fumigation
Agencies for Undertaking Aluminium Phosphide Fumigation August, 2011
![Page 69: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/69.jpg)
Codling moth
Fluted scale
San Jose scale
Apple scab
Potato cyst nematode
Coffee berry borer
Banana mosaic virus
Potato wart
Banana bunchy top virus
Domestic Quarantine
• Section 4A of DIP Act empowers Central Government to implement Domestic quarantine regulations
• 9 Domestic Quarantine Regulations have been notified to regulate movement of specific commodities from state to state within India
![Page 70: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/70.jpg)
Pest/disease Host plant
material
Restricted States
From To
Fluted Scale
(Icerya purchasi)
Many host plant Mysore (Karnataka),
Madras (Tamil Nadu) & Kerala
To any other
state or place
San Jose Scale
(Aspidiotus perniciosus)
Many host plant
species
Punjab, UP, Madras (TN), WB,
Assam, Orissa, HP, J& K
Any other part
of India
Banana bunchy top (virus) Banana planting
material
Assam, Kerala, Orissa, Tamil
Nadu, & West Bengal
Any other State
& UT
Banana mosaic (virus) Banana plants&
plant material
Maharashtra & Gujarat Any other State
&UT
Potato Wart (Synchytrium
endobioticum)
Potato Darjeeling (West Bengal) Any other State
or place in India
Apple Scab
(Venturia inaequalis)
Apple planting
material
J & K and HP Any other State
Codling Moth
(Carpocapsa pomenella)
Apple & walnut
plants including
fruits
Ladakh District Any other area
in J&K
Potato Cyst Nematodes
(Globodera rostochiensis
& G. pallida)
Potato Tamil Nadu Any other State
& UT
Coffee Berry Borer
(Hypothenamus hampei)
Coffee seeds/
plants/powder
Nilagiri (T.N), Kodagu
(Karnataka) & Wynad (Kerala
Any other parts
of the India
Domestic Quarantine…..
![Page 71: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/71.jpg)
Interception of quarantine potential
pathogens
80 4.1
100
37.5 100
100
63.6
100
Interception (%)
Denmark (4/5)
Germany (6/147)
Italy (5/5)
The Netherlands
(6/16)Sweden (2/2)
UK (3/3)
USA (7/11)
USSR (11/11)
Uromyces beticola from sugar beet a) Teliospoes; b) Uredospores
(a) (b)
Yield losses: 50-70%
48.7
100.0
0.7 0.3 0.3 0.1
Interception (%)
Italy (146/300)
UK 252/252)
GDR (3/422)
Hungary (2/690)
USA (2/321)
Others (3/805)
Fusarium nivale causing snow
mold in wheat
Infected
Healthy
Yield losses: ~ 50%
![Page 72: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/72.jpg)
Interception of quarantine potential
pathogens
Major, minor and wild hosts - 21
Detection on sunflower imported from USA
with infection level of 87.0 per cent
Phomopsis longicolla causing pod and
stem blight/ seed decay of soybean
34.4
16.2 51.8
0.7
1.5
7.1
21.3 16.0
Interception (%)
Korea (21/61)
USSR (11/68)
Brazil (57/110)
Malaysia (1/145)
Zimbabwe (3/200)
Taiwan 157/2219)
USA (1605/7518)
Others 13/81)
White mixed with golden
oospores crusts
Web-comb structured
oospores crust
Peronospora manshurica causing downy
mildew of soybean
Yield losses: up to 80%
![Page 73: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/73.jpg)
Interception of quarantine potential
pathogens
34
49
44
30
28
9 34
228
13 Australia
Canada
Italy
Netherlands
Sweden
Taiwan
UK
USA
Others
Xanthomonas campestris pv. campestris
causing black rot of crucifers
Yield losses: 30-70%
Leptosphaeria maculans causing
balck-leg of crucifers
25
31
12
1
1 1
3 Australia
Canada
Italy
Netherlands
Russia
Sweden
UK
Yield losses: up to 100%
![Page 74: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/74.jpg)
NBPGR prevented introduction of
noxious weeds
Case I: Import of 6 MT of Basil seeds
from Germany under relaxed
conditions without IP and PC
• Request sent to NBPGR for PRA
• PRA showed 4 viruses, 2 pathogens,
one nematode and several weeds of
quarantine significance
• Samples for testing for presence of
pests
• Intercepted exotic weeds
1. Atriplex patula (Spear Saltbush) 2. Asphodelus fistulosus (Onion weed)
Atriplex patula
Recommendation: In view of quarantine weeds intercepted in the sample submitted to NBPGR, it would not be advisable to allow the entry of 6MTS of Basil Ocimum basilicum from Germany.
Asphodelus fistulosus
![Page 75: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/75.jpg)
NBPGR prevented introduction of
noxious weeds
Case II: Import of 78 MT of Niger seeds
for consumption from Ethiopia under
relaxed conditions without IP and PC
• Sample sent to NBPGR for testing
• Samples for testing for presence of
pests
• Intercepted three exotic weeds
1. Bromus diandrus (great brome) 2. Festuca arundinacea (tall fescue) 3. Phalaris paradoxa (awned canary-
grass
Bromus diandrus
Recommendation: Complete inactivation of embryo through irradiation or
dry heat treatment at 122°C for 25 minutes followed by ensuring no
germination on blotter test
Festuca arundinacea
![Page 76: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/76.jpg)
Nematodes intercepted in introduced
germplasm
Microphotographs of Rotylenchus minutus A&B- Anterior body region; C- Oesophageal region;
D- posterios body region; E- tail region. (Bar=20µm).
African potato corms
Hypoxis hemerocallideas
Rotylenchus minutus intercepted during the quarantine processing for the first time in India on imported African potato corms
![Page 77: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal](https://reader036.vdocuments.site/reader036/viewer/2022063019/5fdfc277e54bf76d8e4c8829/html5/thumbnails/77.jpg)
Acknowledgement
Dr. Jameel Akhtar Dr. Kavita Gupta Dr. V. Celia Chalam Dr. M.C. Singh Dr. B. H. Gawade