Functions of VPA1418 and VPA0305 Catalase Genes in Growth ofVibrio parahaemolyticus under Oxidative Stress

Ching-Lian Chen, Shin-yuan Fen, Chun-Hui Chung, Shu-Chuan Yu, Cheng-Lun Chien, Hin-chung Wong

Department of Microbiology, Soochow University, Taipei, Taiwan, Republic of China

The marine foodborne enteropathogen Vibrio parahaemolyticus has four putative catalase genes. The functions of two katE-homologous genes, katE1 (VPA1418) and katE2 (VPA0305), in the growth of this bacterium were examined using gene deletionmutants with or without complementary genes. The growth of the mutant strains in static or shaken cultures in a rich medium at37°C or at low temperatures (12 and 4°C), with or without competition from Escherichia coli, did not differ from that of the par-ent strain. When 175 �M extrinsic H2O2 was added to the culture medium, bacterial growth of the �katE1 strain was delayedand growth of the �katE1 �katE2 and �katE1 �ahpC1 double mutant strains was completely inhibited at 37°C for 8 h. The sen-sitivity of the �katE1 strain to the inhibition of growth by H2O2 was higher at low incubation temperatures (12 and 22°C) than at37°C. The determined gene expression of these catalase and ahpC genes revealed that katE1 was highly expressed in the wild-typestrain at 22°C under H2O2 stress, while the katE2 and ahpC genes may play an alternate or compensatory role in the �katE1strain. This study demonstrated that katE1 encodes the chief functional catalase for detoxifying extrinsic H2O2 during logarith-mic growth and that the function of these genes was influenced by incubation temperature.

Various reactive oxygen species (ROS), such as superoxideanion (O2

�), hydrogen peroxide (H2O2), and hydroxyl radi-cal (˙OH), are generated by intrinsic metabolic activity in bacteriaor induced by environmental stresses (1–3). ROS are detrimentalto cellular components, including proteins, DNA, and membranelipids (4).

Most bacteria are equipped with various antioxidative en-zymes for scavenging ROS. Superoxide dismutase (SOD) trans-forms superoxide anions into hydrogen peroxide, while catalasedecomposes hydrogen peroxide into oxygen and water. Two fam-ilies of catalases, HPI (KatG) and HPII (KatE), have been identi-fied in Escherichia coli and some other enteric bacteria (5). HPI,which is the family of bifunctional catalases/peroxidases, is tran-scriptionally induced during logarithmic growth in response tolow concentrations of hydrogen peroxide. This induction requiresthe positive activator OxyR, which directly senses oxidative stress.HPII, the family of monofunctional catalases, is not peroxide in-ducible and is transcribed at the transition from exponentialgrowth to the stationary phase by the product of the rpoS gene,which is a critical factor in the survival of bacteria in the stationaryphase or under other stresses (6, 7). OxyR also regulates the tran-scription of the alkyl hydroperoxide reductase subunit C (ahpC)gene, which encodes a 2-cysteine peroxiredoxin for detoxifyingorganic peroxides (8, 9).

Food processing commonly imposes stresses on foodbornepathogens, and these stresses may account for the formationof ROS. Campylobacter accumulates hydrogen peroxide underfreeze-thaw treatment (10). Environmental stresses lower the levelof cellular SOD and catalase in Vibrio parahaemolyticus, while in-creasing the susceptibility of this pathogen to oxidative stress (11,12). We have previously demonstrated that the level of intracellu-lar ROS is related to the survival of V. parahaemolyticus under acombination of cold, starvation, and low salinity (13). Therefore,the functions of antioxidative factors may be crucial to the persis-tence of these foodborne pathogens in the environment. Also,extracellular ROS may be generated by other bacteria or hosts ofbacterial infection (14–16), and the presence of extracellular cat-

alase has been demonstrated in Vibrio cholerae (17). The functionsof antioxidative factors may enhance the virulence of infectiousbacteria in human beings, establish natural symbionts in aquacul-tured animals (16), and enable the successful growth of bacteria inthe presence of competitors.

V. parahaemolyticus is a halophilic Gram-negative bacteriumthat frequently causes foodborne gastroenteritis in Taiwan andsome other Asian countries (18), and it has become a pathogen ofglobal concern following the appearance of the first pandemicO3:K6 strain in 1996 (19). In a search of the genome sequence ofthe V. parahaemolyticus strain RIMD2210633 (20), two katE- andtwo katG-homologous genes were identified, namely, katE1(VPA1418), katE2 (VPA0305), katG1 (VPA0768), and katG2(VPA0453). Recently, four proteins exhibiting catalase or cata-lase/peroxidase activity were demonstrated using zymogram in V.parahaemolyticus, whereas two catalases are induced in the expo-nential/early stationary phase (21). Unfortunately, the identitiesof these proteins have not been determined (21), and the func-tions of specific catalase genes remain unclear. In addition to thesecatalase genes, an alkylhydroperoxide reductase subunit C gene(ahpC1) was also responsive to different peroxides (22, 23). Tounderstand the role of specific catalase genes in the growth of V.parahaemolyticus under challenge with peroxides, low tempera-ture, and the presence of a competitive bacterium, katE1 and

Received 10 August 2015 Accepted 4 January 2016

Accepted manuscript posted online 8 January 2016

Citation Chen C-L, Fen S-Y, Chung C-H, Yu S-C, Chien C-L, Wong H-C. 2016.Functions of VPA1418 and VPA0305 catalase genes in growth of Vibrioparahaemolyticus under oxidative stress. Appl Environ Microbiol 82:1859 –1867.doi:10.1128/AEM.02547-15.

Editor: C. A. Elkins, FDA Center for Food Safety and Applied Nutrition

Address correspondence to Hin-chung Wong, wonghc@scu.edu.tw.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.02547-15.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

March 2016 Volume 82 Number 6 aem.asm.org 1859Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

katE2 deletion mutants with and without complementary geneswere constructed and characterized.

MATERIALS AND METHODSBacterial strains and culture conditions. V. parahaemolyticus strain KX-V231 (Kanagawa phenomenon positive, serotype O3:K6), isolated inThailand from a clinical specimen, was used in this study (Table 1). It wasstored frozen at �85°C in beads in Microbank cryovials (Pro-Lab Diag-nostics, Austin, TX, USA). It was cultured at 37°C on tryptic soy agar(Becton-Dickinson Diagnostic Systems, Sparks, MD, USA) that was sup-plemented with 3% sodium chloride (TSA–3% NaCl) or in tryptic soybroth (TSB)–3% NaCl in a 5-ml tube which was shaken at 160 rpm. A50-�l aliquot of the 16-h broth culture was inoculated into 5 ml of freshTSB–3% NaCl and incubated at 37°C with shaking for 2 h for the cells toenter the exponential phase (around 108 CFU/ml), and this culture wasused as the inoculum in the following experiments. E. coli was cultured in

Luria-Bertani (LB) broth (Becton-Dickinson) at 37°C and shaken at 160rpm. Chloramphenicol (final concentration of 6 �g/ml) or chloramphen-icol (20 �g/ml)-ampicillin (50 �g/ml) was added to the media as requiredfor the cultivation of some of the V. parahaemolyticus or E. coli strains,respectively.

Construction of deletion mutants. Mutants with deletions of the cat-alase genes (katE1 and katE2) were constructed following publishedmethods (23, 24). For constructing the �katE2 mutant strain, two DNAfragments were amplified by PCR with V. parahaemolyticus KX-V231chromosomal DNA as the template, one with the primer pair VPA0305-1and VPA0305-2 and the other with the primer pair VPA0305-3 andVPA0305-4 (Table 2). These two amplified fragments were then used astemplates for a second PCR with primers VPA0305-1 and VPA0305-4,resulting in the construction of a fragment with a deletion in the VPA0305gene. This fragment containing the deletion was purified and cloned intothe pGEM-T Easy vector and transformed into E. coli XL1-Blue, following

TABLE 1 Bacterial strains and plasmids used in this study

Strain or plasmid Characteristics Source or reference

V. parahaemolyticusstrains

KX-V231 Wild type, serotype O3:K6, KP�, clinical isolate This study�katE1 mutant KX-V231 �katE1 (VPA1418) This study�katE2 mutant KX-V231 �katE2 (VPA0305) This study�katE1 �katE2 mutant KX-V231�katE1�katE2 This study�katE1/katE1 mutant KX-V231 �katE1/pSCB01-katE1 This study�katE2/katE2 mutant KX-V231 �katE2/pSCB01-katE2 This study�ahpC1 mutant KX-V231 �ahpC1 (VPA1683) 23�katE1 �ahpC1 mutant KX-V231�katE1�ahpC1 This studyKX-V231V KX-V231 containing pSCB01 This study

E. coli strainsXL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F= proAB lacIqZ�M15 Tn10 (Tetr)] StratageneSM10 �pir thi thr leu tonA lacY supE recA::RP4-2-Tc::Mu � pirR6K; Kmr 40

PlasmidspGEM-T Easy Cloning vector, Apr PromegapDS132 R6K ori, mobRP4, sacB, Cmr 41pSCB01 Derived from pBR328 and pDS132, mobRP4, Apr, Cmr, Tcr 23pSCB01-katE1 pSCB01 with katE1 This studypSCB01-katE2 pSCB01 with katE2 This study

TABLE 2 Primers used in cloning experiments

Target Primer Sequence, 5=¡=3VPA0305 VPA0305-1 CGGCGTTGAAGTGGTGTTGG

VPA0305-2 CCGTATTCTTTGTCTGCACGATTTTGCGCCTGTAGAGATGTGVPA0305-3 CACATCTCTACAGGCGCAAAATCGTGCAGACAAAGAATACGGVPA0305-4 GCGAACGTCTTCAAGTCGAGVPA0305-0 GGTCAGATTTATCCTTCGTCVPA0305-5 GTGATTGTGAATCTAGCTGCVPA0305-C1 CAGTGTAATCACTCTCGCCAVPA0305-C2 CAGAGCTGAGCAAGAATACG

VPA1418 VPA1418-1 CATTAAAGAGCCGAACTCGATGCVPA1418-2 TTGGTAAGCGTGGGTGACGTGGACATCTTGTAGGAGTTGAGGGVPA1418-3 CCCTCAACTCCTACAAGATGTCCACGTCACCCACGCTTACCAAVPA1418-4 CAGAACTTGCTGTGGAACTGGVPA1418-0 CAGGAGCCATGACTGAATACTTGVPA1418-5 GTTGGTAATGATAACGACGTACGVPA1418-C1 CATTAAAGAGCCGAACTCGATGCVPA1418-C2 TTATTTCGCTAAACCTAACGCCAG

Chen et al.

1860 aem.asm.org March 2016 Volume 82 Number 6Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

the protocol of the manufacturer (Promega Co., Madison, WI, USA). Theinserted sequence was verified by sequencing. This fragment was thenremoved from the pGEM-T Easy vector by digestion using SacI and SphIand cloned into a suicide vector, pDS132, which contained the chloram-phenicol resistance gene and the sacB gene, conferring sensitivity to su-crose. This plasmid (pDS132-katE2-deletion) was introduced into E. coliSM10 �pir, which was then mated with V. parahaemolyticus strain KX-V231. Thiosulfate-citrate-bile-sucrose (TCBS) agar that contained chlor-amphenicol was used to screen the V. parahaemolyticus cells containingthe inserted plasmid. The V. parahaemolyticus clones were isolated andcultured in LB broth that was supplemented with 2% NaCl and chloram-phenicol. DNA was extracted from these cultures, and the inserted se-quence was detected by PCR using the VPA0305-1 and VPA0305-4 prim-ers. The culture that contained the pDS132-katE2-deletion plasmid wasincubated at 37°C for 3 h in LB broth that contained 2% NaCl and wasthen plated on an LB agar plate that contained 2% NaCl and 10% sucrose.The isolated colonies that were unable to grow on an LB agar plate thatcontained chloramphenicol were selected, and homologous recombina-tion of the deleted fragment was verified by PCR (Table 2). Amplificationof the katE2 gene with the primers VPA0305-0 and VPA0305-5 yieldedamplicons of 3,275 bp and 1,733 bp in the wild-type strain and the �katE2strain, respectively. The mutated gene was also verified by nucleotide se-quencing of the amplified fragments. Following the same procedures us-ing different primers (Table 2), the �katE1 strain was also constructed.The �katE1 �katE2 double mutant was prepared similarly by construc-tion of the katE2 gene deletion in the �katE1 strain, while the �katE1�ahpC1 double mutant was prepared similarly by construction of theahpC1 gene deletion in the �katE1 strain.

Sequencing service was provided by Genomics BioSci & Tech, Inc.,Taipei, using Sanger’s method with an Applied Biosystems 3730 analyzer.

Construction of complementary strains. The entire length of thekatE2 gene was amplified by PCR with V. parahaemolyticus KX-V231chromosomal DNA as the template using primer pair VPA0305-C1 andVPA0305-C2 with restriction enzyme linkers (SalI and SphI) (Table 2).The amplicon was digested with SalI and SphI and ligated to the shuttlevector pSCB01 which had been digested with the same enzymes (23). Theplasmid, pSCB01-katE2, containing the entire length of the katE2 genewas propagated in E. coli SM10 �pir and conjugated to the corresponding�katE2 strain to generate gene complementation, which was selected bychloramphenicol resistance (Table 1). The presence of the entire length ofthe katE2 gene in these strains was verified by PCR. Following the sameprocedures, the complementation of the katE1 gene in the �katE1 strainwas also constructed (Table 1).

Effects of peroxides on bacterial growth. V. parahaemolyticus cul-tures in the exponential phase (200 �l) were dispensed into the wells of amicrotiter plate, to which various concentrations of H2O2 (SantokuChemical Industries, Tokyo, Japan), cumene hydroperoxide (cumene)(Alfa Aesar, Ward Hill, MA, USA), or tert-butyl hydroperoxide (t-BOOH)(Tokyo Kasei Chemicals, Tokyo, Japan) were added; the cultures werethen incubated statically at 37°C or 22°C for 8 h or at 12°C for 56 h.Bacterial growth was determined by measuring the absorbance of theculture at 590 nm using an MRXII microplate reader (Dynex Technolo-gies, Chantilly, VA, USA).

Low-temperature stress. V. parahaemolyticus cultures in the expo-nential phase (200 �l) were dispensed into the wells of a microtiter plateand statically incubated at 12°C. Bacterial growth was determined by mea-suring the absorbance at 590 nm. In another experiment, the V. parahae-molyticus cultures in the exponential phase were 10-fold diluted inTSB–3% NaCl, and 100-ml volumes of these diluted cultures were incu-bated at 4°C. At intervals, the survivors were counted on TSA–3% NaClagar.

Growth competition. Wild-type and mutant V. parahaemolyticusstrains were grown in a coculture with E. coli SM10 �pir harboringpDS132. The V. parahaemolyticus culture in the exponential phase wasdiluted 10-fold in fresh TSB–1% NaCl. E. coli was cultured in LB that

contained chloramphenicol (20 �g/ml) until it reached the exponentialphase. The V. parahaemolyticus and E. coli cultures were inoculated sepa-rately into TSB–1% NaCl or mixed in a 1:40 (vol/vol) ratio and theninoculated; they were subsequently incubated statically or with shaking at160 rpm for 8 h. The V. parahaemolyticus and E. coli cells were counted onTSA–3% NaCl that was supplemented with 15 �g/ml ampicillin and onLuria-Bertani (LB) agar that was supplemented with 5 �g/ml chloram-phenicol, respectively, following incubation at 37°C for 16 h. To count thebacteria with the complementary gene, LB agar was used, on which V.parahaemolyticus formed pale yellow, large colonies while E. coli formedwhite, small colonies.

RT-qPCR. The expression of genes (Table 3) in the wild-type and�katE1 strains was determined using real-time quantitative reverse tran-scription-PCR (RT-qPCR) (23). Briefly, bacterial strains were cultivatedstatically in TSB–3% NaCl at 22 or 37°C, and the cultures in exponentialphase were challenged with 175 �M H2O2 for 1.5 h. Bacterial cells wereharvested by centrifugation and broken using TRIzol reagent (Invitrogen,United Kingdom), and RNA samples were extracted using an RNApurekit (Genesis Biotech Inc., Taipei, Taiwan), following the manufacturer’sinstructions. RNA samples were treated with DNase I (TaKaRa Bio Inc.,Shiga, Japan) and then reverse transcribed using SuperScript III first-strand synthesis SuperMix (Invitrogen, United Kingdom), following theinstructions of the manufacturer. Primers (Table 3) were designed usingthe Primer Express Sequence Editor (http://www.fr33.net/seqedit.php)and Oligo Calculator (http://www.sciencelauncher.com/oligocalc.html),and 16S rRNA was used as the internal control. Real-time PCR wasperformed using the StepOnePlus real-time PCR system v.2.0 (AppliedBiosystems) with a IQ2 SYBR green fast qPCR system master mix andHigh ROX (DBU-008) and RT-PCR reagents. All the data werenormalized with the 16S gene expression levels of the culture at each timepoint, and the normalized values for each gene were compared (AppliedBiosystems). Expression of each target gene of the experimental grouprelative to the expression of the corresponding gene of the control waspresented. Recombinant plasmids for the target genes were used as acalibration standard (Table 1) (23). The quality of the RNA samples andthe quantification protocols that were used here was evaluated bypreviously described methods (23).

Statistical analysis. Triplicate experiments were performed, and thedata of the bacterial growth experiments were obtained from triplicatedeterminations. The data were analyzed by performing one-way analysisof variance (ANOVA) or t test at a significance level of � � 0.05, usingSPSS for Windows version 11.0 (SPSS Inc., Chicago, IL, USA).

RESULTSGrowth and survival of catalase gene mutants. To evaluate thesignificance of these katE-homologous genes in the growth of V.

TABLE 3 Primers used in RT-qPCR experiment

Designation Sequence TargetAmpliconsize, bp

q16SrRNA-F TCCCTAGCTGGTCTGAGA 16S rRNAgene

222q16SrRNA-R GGTGCTTCTTCTGTCGCTVP0580-F CGACAACCGTCTAGCTGA ahpC2 202VP0580-R AGCAACACCTGCTTCTGGVPA1683-F CTACCCAGCAGACTTCAC ahpC1 227VPA1683-R CTTCACGCATCACACCGAVPA0305-F AGAGTTGTGCACGCTCGT VPA0305 228VPA0305-R CCCTACCAGATCCCAGTTVPA1418-F TACGACCGTTGCTGGTGA VPA1418 235VPA1418-R TTCTGGCAGCGATGTCCAVPA0453-F TGCATGGCTCCATGACCA VPA0453 257VPA0453-R CGCATGCCATGACATACGVPA0768-F GTGGTCATACCGTGGGTA VPA0768 237VPA0768-R GGCTCTTCTTCAGTTCCC

KatE of Vibrio parahaemolyticus

March 2016 Volume 82 Number 6 aem.asm.org 1861Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

parahaemolyticus under normal growth conditions, the growth ofthe single (�katE1 and �katE2) and double (�katE1 �katE2) cat-alase gene mutants, the gene-complemented (�katE1/katE1,�katE2/katE2) strains, and the wild-type strain (Table 1) inTSB–3% NaCl at 37°C under either shaking or static conditionswas determined. Bacterial growth was promoted by shaking at 160rpm, and the cells approached the late exponential phase after 4 hof incubation, when they reached a maximal absorbance of about4 at 590 nm (see Fig. S1 in the supplemental material) and a celldensity of about 1010 CFU/ml (data not shown). In the static cul-ture, the growth of bacterial cells approached the stationary phaseafter 3 h of incubation, exhibiting a maximal absorbance of about0.7 at 590 nm (see Fig. S1 in the supplemental material). No de-fective growth compared to the growth of the wild-type strain wasobserved for these mutants under these conditions. Nevertheless,the presence of the complementary katE2 gene in the �katE2strain slightly affected its growth, in particular enhancing thegrowth of the shaking culture after incubation for 6 to 8 h (see Fig.S1A in the supplemental material). This suggests that the shakingculture, in contrast to the static culture, may generate oxidativestress that activates the expression of the katE2 gene.

Incubating these cultures statically at 12°C slowed down thegrowth of the bacterial cells, and the cultures approached the lateexponential phase after 25 h of incubation and reached a maximalabsorbance of 0.5 after 55 h (data not shown).

The populations of culturable cells of the wild-type, �katE1,�katE1 �katE2, and �katE1/katE1 strains in TSB–3% NaCl wereequal following static incubation at 4°C. A slow decline in thenumber of culturable cells was observed over time, and 108 to 109

CFU/ml remained culturable and about 0.5 108 CFU/ml hadbeen killed after 52 h of incubation (data not shown). The resultsrevealed that deletion mutations of these katE-homologous genesdid not influence the growth and survival of this pathogen in richmedium under growth-permitting (12 to 37°C) or refrigerationtemperatures. These results also suggest the presence of an effi-cient compensatory mechanism in these catalase-deficient mu-tants under these conditions.

Growth of catalase gene mutants in coculture with E. coli.Extracellular ROS are produced by some bacterial species, such asEnterococcus faecalis (25), while efflux of H2O2 also occurs in E. coli(26). Catalase-deficient cells have a growth disadvantage over cat-alase-proficient cells in a mixed culture (26). Thus, these catalasegene mutations may decrease the competition of V. parahaemo-lyticus in cocultures and influence its persistence in natural envi-ronment. In this study, the growth of the wild-type strain anddifferent catalase mutants cocultured with E. coli was assayed. TheTSB–1% NaCl medium provided rapid growth for both species inshaken culture (Fig. 1A). In the coculture, the initial density of E.coli was 10 times that of the V. parahaemolyticus strains. In theshaken single culture, both the V. parahaemolyticus strains and E.coli grew rapidly. In the coculture, V. parahaemolyticus strains, at amuch lower initial density than E. coli, multiplied rapidly andbecame the dominant population after 2 to 3 h of incubation, afterwhich the growth of E. coli was inhibited. The cell densities of theV. parahaemolyticus strains at 6 to 8 h of incubation were signifi-cantly lower in the coculture than in the single culture; neverthe-less, deletion mutation of these catalase genes did not significantlyaffect their growth competition (Fig. 1).

In the static culture, the population of E. coli remained at 107

CFU/ml for 8 h of incubation when it was cultured separately or in

the coculture. The V. parahaemolyticus strains, with a much lowerinitial density in the coculture, rapidly reached the maximal den-sity of 109 CFU/ml after 4 h of incubation. Deletion mutation ofthese catalase genes did not significantly affect its growth andcompetition under static culture (see Fig. S2 in the supplementalmaterial).

Growth of catalase gene mutants in the presence of extrinsicH2O2. The addition of 175 or 200 �M H2O2 to the TSB–3% NaClmedium significantly slowed the growth of the wild-type strain ofV. parahaemolyticus at 37°C and delayed the reaching of the expo-nential and stationary phases (Fig. 2A). The concentrations ofH2O2 used in this study were not lethal to V. parahaemolyticus,and it did not significantly decay during the incubation time (datanot shown). When 175 �M H2O2 was applied to catalase mutantstrains, the bacterial growth of the �katE2 mutant was slightlydelayed, that of the �katE1 mutant was markedly delayed, andthat of the �katE1 �katE2 and �katE1 �ahpC1 double mutantswas completely inhibited (Fig. 2B). The growth of the �katE1strain, which was inhibited by H2O2, was restored by the comple-mentary katE1 gene, while the growth of the �katE2 strain in thepresence of the complementary katE2 gene did not differ signifi-cantly from that of the wild-type strain that harbored the cloningvector (KX-V231V) (Fig. 2C). When the �katE1/katE1, �katE2/katE2, and KX-V231V strains were cultivated in medium contain-ing chloramphenicol to maintain the plasmids in the cells, growthof the �katE1/katE1 strain under extrinsic H2O2 was acceleratedand it reached late exponential phase about 1 h earlier than theother two strains containing plasmids (Fig. 2C). The experimentalresults shown in Fig. 2 and in Fig. S1 in the supplemental materialdemonstrate that both katE1 and katE2 were functional, whilekatE1 was more important than katE2 as the protective gene in theexponential phase of V. parahaemolyticus against extrinsic H2O2,and the presence of complementary katE1 on a plasmid may pro-vide sufficient protection against extrinsic H2O2 and the growth-inhibitory effect of chloramphenicol. These results also suggestthat ahpC1 may be the H2O2 detoxifier in the absence of katE1(Fig. 2B).

Growth of catalase gene mutants in the presence of extrinsicorganic peroxides. The addition of 60 or 90 �M cumene signifi-cantly slowed the growth of the wild-type strain of V. parahaemo-lyticus at 37°C (see Fig. S3A in the supplemental material). When60 �M cumene was applied to the single and double catalase mu-tant strains at 37°C, their growth did not differ significantly fromthat of the wild-type strain (see Fig. S3B in the supplemental ma-terial).

Adding 100 or 130 �M t-BOOH to the wild-type cultureslightly reduced the extent of bacterial growth at 37°C, and thebacteria reached a lower maximal absorbance than those in thecontrol group without peroxide. Adding 130 �M t-BOOH did notcause the growth of these catalase mutant strains to differ signifi-cantly from that of the wild-type strain (data not shown). Theseexperiments suggest that these katE-homogenous genes may notdetoxify organic peroxides.

Effect of H2O2 on growth of catalase gene mutants at 22 and12°C. At 22°C, 175 �M H2O2 strongly inhibited the growth of the�katE1, �ahpC1, �katE1 �katE2, and �katE1 �ahpC1 mutantsand had no significant effect on the growth of the �katE2 mutant(Fig. 3A). The presence of the complementary katE1 gene restoredthe growth of the �katE1 mutant that was inhibited by H2O2

(Fig. 3B).

Chen et al.

1862 aem.asm.org March 2016 Volume 82 Number 6Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

At 12°C, the growth of bacteria was slowed. The correspondingexperiment was performed for 56 h. The presence of 70 �M H2O2

inhibited the growth of the �katE1 �katE2 double mutant only fora period of about 40 h, and the growth resumed thereafter. Thisconcentration of H2O2 had no effect on the wild type or on theother mutant strains (Fig. 4A). A 100 �M concentration of H2O2

completely inhibited the growth of the �katE1 �katE2 mutant fora full 56 h (Fig. 4B). A 175 �M concentration of H2O2 completelyinhibited the growth of the �katE1 and �katE1 �katE2 mutants at12°C but did not affect the growth of the wild-type strain or the�katE2 mutant (Fig. 4C). These experiments showed that the sus-ceptibility of the �katE1 mutant to extrinsic H2O2 was sensitizedat incubation temperatures lower than 37°C, and they suggest thatthe behavior of these genes in V. parahaemolyticus is influenced bythe incubation temperature.

Expression of catalase genes. In order to study how these cat-alase genes are influenced by incubation temperature, expressionof the catalase genes (katE1, katE2, katG1, and katG2) and theahpC1 and ahpC2 genes in the exponential phase with and without

the challenge of extrinsic H2O2 was determined by RT-qPCR. Un-der the stress of extrinsic H2O2, the expression of katE1, katE2, andahpC1 in the wild-type strain was significantly higher at an incu-bation temperature of 22°C than at an incubation temperature of37°C, whereas katE1 showed changes of 4.7- and 0.5-fold at 22°Cand 37°C, respectively (Fig. 5A).

When the �katE1 strain was cultured under normal conditionswithout challenge by extrinsic H2O2, the expression of ahpC1 andahpC2 was significantly higher at 37°C than at 22°C (Fig. 5B).Under the challenge of extrinsic H2O2, the expression of theahpC1, ahpC2, and VPA0305 genes was significantly higher at22°C than at 37°C (Fig. 5C), while no significant difference wasobserved between the expressions of the two katG-homologousgenes (katG1 and katG2) (data not shown).

DISCUSSION

Vibrio species have one to four catalase genes. V. fischeri has asingle katA gene, which is critical in forming symbionts in its squidhost (16), whereas V. vulnificus and V. cholerae have two catalase

FIG 1 Effect of catalase gene mutation on growth of Vibrio parahaemolyticus in competition with Escherichia coli in shaken culture. V. parahaemolyticus wild-typeand mutant strains and E. coli that harbored cloning vector pDS132 were cultured separately (control) or cocultured in TSB–1% NaCl at 37°C with at 160 rpm.(A) V. parahaemolyticus wild type; (B) �katE1 mutant; (C) �katE1 �katE2 mutant; (D) �katE1/katE1 mutant. �, V. parahaemolyticus strain in coculture; Œ, E.coli in coculture; �, V. parahaemolyticus strain in separate culture;o, E. coli in separate culture.

KatE of Vibrio parahaemolyticus

March 2016 Volume 82 Number 6 aem.asm.org 1863Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

genes that encode catalase and catalase/peroxidase (17). V. para-haemolyticus has four putative catalase genes, which may havedifferent functions and regulatory characteristics than the catalasegenes of E. coli and other bacterial species.

Among the four putative catalase genes in V. parahaemolyticus,katE1 was demonstrated here to be similar to the monofunctionalperoxidase gene (katE1) of E. coli, and it is probably the chieffunctional catalase gene against extrinsic H2O2 in the exponentialphase of growth of this bacterium (Fig. 2; see Fig. S3 in the sup-plemental material). The other two katG-homologous genes(katG1 and katG2) of V. parahaemolyticus did not exhibit a signif-icant antioxidative role during logarithmic growth (27). The pu-tative amino acid sequence of the KatE1 catalase exhibits highidentities of 95.6% and 80.7% with those of KatE of V. alginolyti-cus (accession no. AGV18944) and KatA of V. fischeri (AF011784),respectively, and 29.6% identity with that of KatE of E. coli.

In different bacterial species, different catalase genes play themajor role in detoxifying peroxides. In E. coli, KatG is the predom-

FIG 2 Growth of Vibrio parahaemolyticus strains under challenge with extrin-sic hydrogen peroxide in a static culture at 37°C. (A) Effect of concentration ofH2O2 on growth of the wild-type strain (KX-V231). �, 0 �M; Œ, 175 �M; �,200 �M. (B) Effect of 175 �M H2O2 on growth of different strains. �, wildtype;Œ, �katE1 mutant;�, �katE2 mutant;o, �katE1 �katE2 double mutant.(C) Effect of 175 �M H2O2 on growth of wild-type and complemented strains.�, wild type; Œ, �katE1 mutant with complementary katE1 gene; �, �katE2mutant with complementary katE2 gene;o, wild-type with cloning vector.

FIG 3 Growth of Vibrio parahaemolyticus strains under challenge with extrin-sic 175 �M hydrogen peroxide in a static culture at 22°C. (A) Mutant strains.�, wild type;Œ, �katE1 mutant;�, �katE2 mutant;o, �katE1 �katE2 doublemutant; �, �ahpC1 mutant; �, �katE1 �ahpC1 double mutant. (B) Comple-mented strains. �, wild type with cloning vector; Œ, �katE1 mutant withcomplementary katE1 gene.

Chen et al.

1864 aem.asm.org March 2016 Volume 82 Number 6Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

inant peroxide scavenger in the exponential phase (28), and thekatG gene of V. vulnificus has a similar protective function (29). InV. cholerae, both katG and katB (a katE-like gene) are protectiveagainst H2O2 (17). In Rhodobacter species, whether H2O2 inducesthe expression of katE or katG depends on the species (30).

FIG 4 Growth of Vibrio parahaemolyticus strains under challenge with differentconcentration of extrinsic hydrogen peroxide in a static culture at 12°C. (A) Sev-enty micromolar H2O2; (B) 100 �M H2O2; (C) 175 �M H2O2. �, wild type; Œ,�katE1 mutant; �, �katE2 mutant;o, �katE1 �katE2 double mutant.

FIG 5 Expression of antioxidative genes in wild-type and �katE1 strains ofVibrio parahaemolyticus under H2O2 stress. (A) Expression of antioxidativegenes in the wild-type strain incubated at 22 or 37°C under challenge with 175�M extrinsic H2O2; (B) expression of different genes in the �katE1 mutantincubated at 22 or 37°C without extrinsic H2O2 stress; (C) expression of dif-ferent genes in the �katE1 mutant incubated at 22 or 37°C under challengewith 175 �M extrinsic H2O2. Expression of genes in the exponential-phaseculture with or without the H2O2 challenge was determined by RT-qPCR, thelevel of expression relative to that of the corresponding gene of the wild type ateach point without H2O2 challenge was calculated, and values at 22 and 37°Cwere analyzed by a t test. * and **, significantly different values (P 0.05 or P 0.01, respectively).

KatE of Vibrio parahaemolyticus

March 2016 Volume 82 Number 6 aem.asm.org 1865Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Although katE1 is probably the chief functional catalase gene inthe exponential phase, the deletion mutation of this gene did notharm the normal growth of these mutant strains (see Fig. S1 in thesupplemental material), their survival at a refrigeration tempera-ture, or their high competitiveness with E. coli (Fig. 1). The endog-enous ROS that is generated by aerobic metabolism in these mu-tants (31) may be detoxified by other antioxidative factors (31). InV. parahaemolyticus, three superoxide dismutase genes (VP2118,VP2860, and VPA1514), four ahpC or ahpF factors (VPA1683,VP0580, VPA1684, and VPA1681), and two katG-homologousgenes (katG1 and katG2) may compensate for the deletion of cat-alase genes in these mutants (�katE1 and �katE2 mutants) (32,33). Catalases and AhpC scavenge endogenous H2O2 that is gen-erated by aerobic metabolism (34, 35), whereas AhpC is the pri-mary detoxifier in Bacillus abortus (33) and E. coli (36). The katE2and ahpC genes may have alternate or compensatory roles in the�katE1 mutant (Fig. 2 and 4).

Another feature of these catalase genes is the influence of incu-bation temperature. The sensitivity of the �katE1 mutant to ex-trinsic H2O2 was increased as the incubation temperature wasreduced below 37°C (Fig. 3 and 4). A similar effect of incubationtemperature on the protective function of the ahpC genes of V.parahaemolyticus and its colony size has been demonstrated else-where (23). Low temperature also impairs the growth of the cata-lase mutant of Listeria monocytogenes (37). In the cited investiga-tions, it was shown that more ROS may be produced as thetemperature falls, increasing the need for a functional catalase.The accumulation of ROS may be attributed to the expression,stability, and activities of catalases and AhpCs. The critical func-tion of katE1 under extrinsic H2O2 stress at 22°C was also sup-ported here by the high expression of this gene in the parent strain(Fig. 5A) and much greater expression of the compensatory genesin the �katE1 mutant at 22°C than at 37°C (Fig. 5C).

The expression of the aforementioned genes may be regulatedby controlling the incubation temperature, as has been demon-strated in Yersinia pestis (38). The thermal regulation of the ex-pression and function of these antioxidative factors may involverpoS, oxyR, toxRS, and other regulatory factors. The OxyR(VP2752) regulon is known to regulate the expressions of catalasegenes and ahpC genes, which exhibit compensatory patterns inseveral bacteria (32), whereas rpoS (VP2553) is a general regulatorof stress responses (39). Nevertheless, the regulation of variouscatalase genes or other antioxidative factors in V. parahaemolyti-cus has not been investigated.

In conclusion, this work demonstrates that the katE-homolo-gous genes katE1 and katE2 are not critical for the aerobic growthof V. parahaemolyticus in a rich medium but that katE1 was themost important required detoxifier under extrinsic H2O2 stressduring logarithmic growth. The sensitivity of the �katE1 mutantto H2O2 increased as the incubation temperature was loweredbelow 37°C, and the katE2 and ahpC genes may have alternate orcompensatory roles in this mutant.

ACKNOWLEDGMENTS

We thank the Ministry of Science and Technology of the Republic ofChina for financially supporting this research under contracts NSC100-2313-B-031-001-MY3 and MOST103-2313-B-031-001-MY3.

We thank Ted Knoy for editorial assistance.

FUNDING INFORMATIONMinistry of Science and Technology, Taiwan (MOST) provided fundingto Hin-chung Wong under grant number MOST103-2313-B-031-001-MY3. Ministry of Science and Technology, Taiwan (MOST) providedfunding to Hin-chung Wong under grant number NSC100-2313-B-031-001-MY3.

REFERENCES1. Kim JS, Sung MH, Kho DH, Lee JK. 2005. Induction of manganese-

containing superoxide dismutase is required for acid tolerance in Vibriovulnificus. J Bacteriol 187:5984 –5995. http://dx.doi.org/10.1128/JB.187.17.5984-5995.2005.

2. Rosche TM, Smith DJ, Parker EE, Oliver JD. 2005. RpoS involvementand requirement for exogenous nutrient for osmotically induced crossprotection in Vibrio vulnificus. FEMS Microbiol Ecol 53:455– 462. http://dx.doi.org/10.1016/j.femsec.2005.02.008.

3. Gabbianelli R, Signoretti C, Marta I, Battistoni A, Nicolini L. 2004.Vibrio cholerae periplasmic superoxide dismutase: isolation of the geneand overexpression of the protein. J Biotechnol 109:123–130. http://dx.doi.org/10.1016/j.jbiotec.2004.01.002.

4. Al-Maghrebi MA, Benov LT. 2001. Polyphosphate accumulation andoxidative DNA damage in superoxide dismutase-deficient Escherichia coli.Free Radic Biol Med 31:1352–1359. http://dx.doi.org/10.1016/S0891-5849(01)00696-7.

5. Switala J, Triggs-Raine BL, Loewen PC. 1990. Homology among bacte-rial catalase genes. Can J Microbiol 36:728 –731. http://dx.doi.org/10.1139/m90-123.

6. Jung IL, Kim IG. 2003. Transcription of ahpC, katG, and katE genes inEscherichia coli is regulated by polyamines: polyamine-deficient mutantsensitive to H2O2-induced oxidative damage. Biochem Biophys Res Com-mun 301:915–922. http://dx.doi.org/10.1016/S0006-291X(03)00064-0.

7. Visick JE, Clarke S. 1997. RpoS- and OxyR-independent induction ofHPI catalase at stationary phase in Escherichia coli and identification ofrpoS mutations in common laboratory strains. J Bacteriol 179:4158 – 4163.

8. Hofmann B, Hecht HJ, Flohe L. 2002. Peroxiredoxins Biol Chem 383:347–364.

9. Imlay JA. 2008. Cellular defenses against superoxide and hydrogenperoxide. Annu Rev Biochem 77:755–776. http://dx.doi.org/10.1146/annurev.biochem.77.061606.161055.

10. Stead D, Park SF. 2000. Roles of Fe superoxide dismutase and catalasein resistance of Campylobacter coli to freeze-thaw stress. Appl EnvironMicrobiol 66:3110 –3112. http://dx.doi.org/10.1128/AEM.66.7.3110-3112.2000.

11. Lin C, Yu RC, Chou CC. 2004. Susceptibility of Vibrio parahaemolyticusto various environmental stresses after cold shock treatment. Int J FoodMicrobiol 92:207–215. http://dx.doi.org/10.1016/j.ijfoodmicro.2003.10.004.

12. Chiang ML, Chou CC. 2008. Expression of superoxide dismutase, cata-lase and thermostable direct hemolysin by, and growth in the presence ofvarious nitrogen and carbon sources of heat-shocked and ethanol-shocked Vibrio parahaemolyticus. Int J Food Microbiol 121:268 –274. http://dx.doi.org/10.1016/j.ijfoodmicro.2007.11.001.

13. Lai WB, Wong HC. 2013. Influence of combinations of sublethal stresseson the control of Vibrio parahaemolyticus and its cellular oxidative re-sponse. Food Control 33:186 –192. http://dx.doi.org/10.1016/j.foodcont.2013.02.036.

14. Diaz JM, Hansel CM, Voelker BM, Mendes CM, Andeer PF, Zhang T.2013. Widespread production of extracellular superoxide by hetero-trophic bacteria. Science 340:1223–1226. http://dx.doi.org/10.1126/science.1237331.

15. Hebrard M, Viala JP, Meresse S, Barras F, Aussel L. 2009. Redundanthydrogen peroxide scavengers contribute to Salmonella virulence and ox-idative stress resistance. J Bacteriol 191:4605– 4614. http://dx.doi.org/10.1128/JB.00144-09.

16. Visick KL, Ruby EG. 1998. The periplasmic, group III catalase of Vibriofischeri is required for normal symbiotic competence and is induced bothby oxidative stress and by approach to stationary phase. J Bacteriol 180:2087–2092.

17. Wang H, Chen S, Zhang J, Rothenbacher FP, Jiang T, Kan B, Zhong Z,Zhu J. 2012. Catalases promote resistance of oxidative stress in Vibrio chol-erae. PLoS One 7:e53383. http://dx.doi.org/10.1371/journal.pone.0053383.

18. Wong HC, Ting SH, Shieh WR. 1992. Incidence of toxigenic vibrios in

Chen et al.

1866 aem.asm.org March 2016 Volume 82 Number 6Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

foods available in Taiwan. J Appl Bacteriol 73:197–202. http://dx.doi.org/10.1111/j.1365-2672.1992.tb02978.x.

19. Nair GB, Ramamurthy T, Bhattacharya SK, Dutta B, Takeda Y, SackDA. 2007. Global dissemination of Vibrio parahaemolyticus serotypeO3:K6 and its serovariants. Clin Microbiol Rev 20:39 – 48. http://dx.doi.org/10.1128/CMR.00025-06.

20. Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, Tagomori K,Iijima Y, Najima M, Nakano M, Yamashita A, Kubota Y, Kimura S,Yasunaga T, Honda T, Shinagawa H, Hattori M, Iida T. 2003. Genomesequence of Vibrio parahaemolyticus: a pathogenic mechanism distinctfrom that of V cholerae. Lancet 361:743–749. http://dx.doi.org/10.1016/S0140-6736(03)12659-1.

21. Lin LC, Lin GH, Wang ZL, Tseng YH, Yu MS. 2015. Differentialexpression of catalases in Vibrio parahaemolyticus under various stressconditions. Res Microbiol 166:601– 608. http://dx.doi.org/10.1016/j.resmic.2015.07.001.

22. Chung CH, Ma TY, Fen SY, Wong HC. 2014. Activity of alkyl hydroper-oxide reductase subunit C1 and C2 of Vibrio parahaemolyticus againstdifferent peroxides. Appl Environ Microbiol 80:7398 –7404. http://dx.doi.org/10.1128/AEM.02701-14.

23. Wang HW, Chung CH, Ma TY, Wong HC. 2013. Roles of alkyl hy-droperoxide reductase subunit C (AhpC) in viable but nonculturableVibrio parahaemolyticus. Appl Environ Microbiol 79:3734 –3743. http://dx.doi.org/10.1128/AEM.00560-13.

24. Okada N, Iida T, Park KS, Goto N, Yasunaga T, Hiyoshi H, Matsuda S,Kodama T, Honda T. 2009. Identification and characterization of a noveltype III secretion system in trh-positive Vibrio parahaemolyticus strainTH3996 reveal genetic lineage and diversity of pathogenic machinery be-yond the species level. Infect Immun 77:904 –913. http://dx.doi.org/10.1128/IAI.01184-08.

25. Huycke MM, Abrams V, Moore DR. 2002. Enterococcus faecalis producesextracellular superoxide and hydrogen peroxide that damages colonic ep-ithelial cell DNA. Carcinogenesis 23:529 –536. http://dx.doi.org/10.1093/carcin/23.3.529.

26. Seaver LC, Imlay JA. 2001. Hydrogen peroxide fluxes and compartmen-talization inside growing Escherichia coli. J Bacteriol 183:7182–7189. http://dx.doi.org/10.1128/JB.183.24.7182-7189.2001.

27. Yu SC. 2014. Characteristics of catalase gene in Vibrio parahaemolyticus.Master thesis. Soochow University, Taipei, Taiwan, Republic of China.

28. Uhlich GA. 2009. KatP contributes to OxyR-regulated hydrogen peroxideresistance in Escherichia coli serotype O157:H7. Microbiology 155:3589 –3598. http://dx.doi.org/10.1099/mic.0.031435-0.

29. Park KJ, Kang MJ, Kim SH, Lee HJ, Lim JK, Choi SH, Park SJ, Lee KH.2004. Isolation and characterization of rpoS from a pathogenic bacterium,Vibrio vulnificus: role of sigmaS in survival of exponential-phase cells un-der oxidative stress. J Bacteriol 186:3304 –3312. http://dx.doi.org/10.1128/JB.186.11.3304-3312.2004.

30. Zeller T, Klug G. 2004. Detoxification of hydrogen peroxide and expres-sion of catalase genes in Rhodobacter. Microbiology 150:3451–3462. http://dx.doi.org/10.1099/mic.0.27308-0.

31. Dubbs JM, Mongkolsuk S. 2012. Peroxide-sensing transcriptional regu-lators in bacteria. J Bacteriol 194:5495–5503. http://dx.doi.org/10.1128/JB.00304-12.

32. Charoenlap N, Eiamphungporn W, Chauvatcharin N, UtamapongchaiS, Vattanaviboon P, Mongkolsuk S. 2005. OxyR mediated compensatoryexpression between ahpC and katA and the significance of ahpC in pro-tection from hydrogen peroxide in Xanthomonas campestris. FEMS Mi-crobiol Lett 249:73–78. http://dx.doi.org/10.1016/j.femsle.2005.06.002.

33. Steele KH, Baumgartner JE, Valderas MW, Roop RM. 2010. Compar-ative study of the roles of AhpC and KatE as respiratory antioxidants inBrucella abortus 2308. J Bacteriol 192:4912– 4922. http://dx.doi.org/10.1128/JB.00231-10.

34. Dubbs JM, Mongkolsuk S. 2007. Peroxiredoxins in bacterial antioxidantdefense. Subcell Biochem 44:143–193. http://dx.doi.org/10.1007/978-1-4020-6051-9_7.

35. Cosgrove K, Coutts G, Jonsson IM, Tarkowski A, Kokai-Kun JF,Mond JJ, Foster SJ. 2007. Catalase (KatA) and alkyl hydroperoxidereductase (AhpC) have compensatory roles in peroxide stress resis-tance and are required for survival, persistence, and nasal colonizationin Staphylococcus aureus. J Bacteriol 189:1025–1035. http://dx.doi.org/10.1128/JB.01524-06.

36. Seaver LC, Imlay JA. 2001. Alkyl hydroperoxide reductase is the primaryscavenger of endogenous hydrogen peroxide in Escherichia coli. J Bacteriol183:7173–7181. http://dx.doi.org/10.1128/JB.183.24.7173-7181.2001.

37. Azizoglu RO, Kathariou S. 2010. Temperature-dependent require-ment for catalase in aerobic growth of Listeria monocytogenes F2365.Appl Environ Microbiol 76:6998 –7003. http://dx.doi.org/10.1128/AEM.01223-10.

38. Han Y, Geng J, Qiu Y, Guo Z, Zhou D, Bi Y, Du Z, Song Y, Wang X,Tan Y, Zhu Z, Zhai J, Yang R. 2008. Physiological and regulatorycharacterization of KatA and KatY in Yersinia pestis. DNA Cell Biol 27:453– 462. http://dx.doi.org/10.1089/dna.2007.0657.

39. Hulsmann A, Rosche TM, Kong IS, Hassan HM, Beam DM, Oliver JD.2003. RpoS-dependent stress response and exoenzyme production inVibrio vulnificus. Appl Environ Microbiol 69:6114 – 6120. http://dx.doi.org/10.1128/AEM.69.10.6114-6120.2003.

40. Simon R, Priefer U, Puhler A. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Biotechnology 11:784 –791.

41. Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. 2004.Improvement of pCVD442, a suicide plasmid for gene allele exchange inbacteria. Plasmid 51:246 –255. http://dx.doi.org/10.1016/j.plasmid.2004.02.003.

KatE of Vibrio parahaemolyticus

March 2016 Volume 82 Number 6 aem.asm.org 1867Applied and Environmental Microbiology

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from